Location via proxy:   [ UP ]  
[Report a bug]   [Manage cookies]                
Scribd Logo
Upload

Welcome to Scribd!

  • 199 views

    Part 02 Phylogenetics

    Uploaded by

    abi_robeniol
    This document discusses principles of phylogenetic systematics and the use of molecular data in phylogenetics. It introduces key concepts like phenetics versus cladistics, phylogenetic trees and grouping using parsimony. Molecular sources of data are described, like mitochondrial genome, chloroplast genome, nuclear ribosomal DNA. Advantages of molecular data are its ability to provide more characters to resolve relationships compared to morphology alone. Molecular evidence has helped resolve systematic questions and revealed unexpected evolutionary relationships.

    Copyright:

    Attribution Non-Commercial (BY-NC)
    Download as PPT, PDF, TXT or read online from Scribd

    Part 02 Phylogenetics

    Uploaded by

    abi_robeniol
    199 views32 pages
    This document discusses principles of phylogenetic systematics and the use of molecular data in phylogenetics. It introduces key concepts like phenetics versus cladistics, phylogenetic trees and grouping using parsimony. Molecular sources of data are described, like mitochondrial genome, chloroplast genome, nuclear ribosomal DNA. Advantages of molecular data are its ability to provide more characters to resolve relationships compared to morphology alone. Molecular evidence has helped resolve systematic questions and revealed unexpected evolutionary relationships.

    Copyright

    © Attribution Non-Commercial (BY-NC)

    Available Formats

    PPT, PDF, TXT or read online from Scribd

    Did you find this document useful?

    Is this content inappropriate?

    This document discusses principles of phylogenetic systematics and the use of molecular data in phylogenetics. It introduces key concepts like phenetics versus cladistics, phylogenetic trees and grouping using parsimony. Molecular sources of data are described, like mitochondrial genome, chloroplast genome, nuclear ribosomal DNA. Advantages of molecular data are its ability to provide more characters to resolve relationships compared to morphology alone. Molecular evidence has helped resolve systematic questions and revealed unexpected evolutionary relationships.

    Copyright:

    Attribution Non-Commercial (BY-NC)
    Download as PPT, PDF, TXT or read online from Scribd
    Download as ppt, pdf, or txt
    199 views32 pages

    Part 02 Phylogenetics

    Uploaded by

    abi_robeniol
    This document discusses principles of phylogenetic systematics and the use of molecular data in phylogenetics. It introduces key concepts like phenetics versus cladistics, phylogenetic trees and grouping using parsimony. Molecular sources of data are described, like mitochondrial genome, chloroplast genome, nuclear ribosomal DNA. Advantages of molecular data are its ability to provide more characters to resolve relationships compared to morphology alone. Molecular evidence has helped resolve systematic questions and revealed unexpected evolutionary relationships.

    Copyright:

    Attribution Non-Commercial (BY-NC)
    Download as PPT, PDF, TXT or read online from Scribd
    Download as ppt, pdf, or txt
    You are on page 1of 32

    Principles of Phylogenetic Systematics

    Grecebio Jonathan D. Alejandro, Ph.D.


    Research Center for the Natural Sciences and College of Science , University of Santo Tomas, Manila, 1008 Philippines. gdalejandro@mnl.ust.edu.ph

    Topic outline

    Systematics & Phylogenetic Revolution

    Phenetics vs Phylogenetics/Cladistics
    Phylogenetic characters/terminologies Phylogenetic trees & grouping (Parsimony) Phylogenetic approaches Sources of molecular data

    Advantages of using molecular data


    E.g., Application of phylogenetics using molecular data

    Basic Methods in Phylogenetics

    Systematics & Phylogenetic Revolution

    Stuessy 1979:622
    3

    Systematics & Phylogenetic Revolution

    Phylogenetic systematics - reconstruction and study of evolutionary relationships. Evolutionary theory similarity among species is due to a common descent, or inheritance from a common ancestor. Phylogeny - the historical relationships among lineages or organisms, such as their genes.
    Willi Hennig (German entomologist, 1950s) proposed that systematics should reflect the known evolutionary history of lineages as closely as possible, an approach he called phylogenetic systematics.

    Systematics & Phylogenetic Revolution

    Phylogenetics = Cladistics The followers of Hennig were disparingly referred to as "cladists" by his opponents, because of the emphasis on recognizing only monophyletic groups, a group plus all of its descendents, or clades. However, the cladists quickly adopted that term as a helpful label, and nowadays, cladistic approaches to systematics are used routinely.

    Phenetics vs Cladistics
    Phenetic (overall similarity)

    characteristics critter A 4 limbs meta. hair kidney critter B 4 limbs meta. hair kidney critter C 4 limbs meta. feathers kidney endothermy vivip. no cloaca endothermy ovip. endothermy ovip. ovip.
    B

    identity placental echidna bird turtle


    A

    cloaca cloaca cloaca

    ancestor 4 limbs meta. no ectothermy kidney hair/feathers

    4
    B 5 C
    6

    3
    overall similarity

    Phenetics vs Cladistics
    Cladistics (character evolution; e.g. shared derived characters)

    characteristics critter A 4 limbs meta. hair kidney critter B 4 limbs meta. hair kidney critter C 4 limbs meta. feathers kidney endothermy vivip. no cloaca endothermy ovip. endothermy ovip. ovip. cloaca cloaca cloaca

    identity placental echidna bird turtle

    ancestor 4 limbs meta. no ectothermy kidney hair/feathers

    A 2 B 1 C
    7

    shared derived characters (synapomorphy)

    Phenetics vs Cladistics
    Characters 1 2 Species A B C 0 1 1 0 1 0 3 0 0 1 4 0 0 1 5 0 0 1

    Phenetic
    Overall similarities A A B C B .60 C .20 .20 -

    Cladistic
    0 = Primitive character state or plesiomorphic 1 = Derived character state Character 1 = shared derived or synapomorphic Character 2 = uniquely derived or autopomorphic

    Similarity % 100 80 60 40 20 0

    Character 1
    8

    Phylogenetic trees

    Cladogram

    Phylogenetic trees

    10

    Phylogenetic trees

    11

    Phylogenetic grouping

    A monophyletic group includes the most recent common ancestor of the group and all of its descendants.

    12

    Phylogenetic grouping

    A paraphyletic group includes the most recent common ancestor of the group, but not all of its descendants.

    13

    Phylogenetic grouping

    A polyphyletic group does not include the most recent common ancestor of all the members.

    Sabicea diversifolia Warszewiczia coccinea Heinsia crinita Heinsia zanzibarica Heinsia bussei Landiopsis capuronii Mussaenda sp. nov. Mussaenda pervillei Mussaenda latisepala Mussaenda erectiloba Mussaenda vestita Pseudomussaenda rivularis Pseudomussaenda stenocarpa Pseudomussaenda flava Pseudomussaenda stenocarpa Mussaenda arcuata Mussaenda monticola Mussaenda nivea Mussaenda erythrophylla Mussaenda elegans Mussaenda grandiflora Mussaenda isertiana Mussaenda afzelii Mussaenda pubescens Mussaenda shikokiana Mussaenda parvifolia Mussaenda uniflora Mussaenda uniflora Mussaenda uniflora Mussaenda reinwardtiana Mussaenda nervosa Mussaenda benguetensis Mussaenda multibracteata Mussaenda pinatubensis Mussaenda vidalii 14 Mussaenda philippica Mussaenda palawenensis

    algae molds molds algae algae molds algae algae molds algae

    bryophytes
    pteridophytes gymnosperm angiosperm
    15

    Phylogenetic grouping

    Maximum Parsimony (MP)


    Parsimony: General scientific criterion for choosing among competing hypotheses that states that we should accept the hypothesis that explains the data most simply and efficiently. States that the cladogram having the least number of changes between characters is the best tree. Find topology requiring smallest number of evolutionary changes

    16

    Short Excercise:

    Choosing the shortest tree with parsimony


    Sites
    1A

    OTU 1 2 3 4

    1 T T T T

    2 C T T T

    3 A A C C

    4 G G G T

    5 A A A A

    6 T A T A

    7 C C C G

    8 T T G G

    9 A A A A

    10 Site G G G C

    3
    3C 4C

    Tree I
    2A

    Tree II

    Tree III

    17

    Phylogenetic grouping

    Choosing the shortest tree with parsimony


    Sites
    1A

    OTU 1 2 3 4

    1 T T T T

    2 C T T T

    3 A A C C

    4 G G G T

    5 A A A A

    6 T A T A

    7 C C C G

    8 T T G G

    9 A A A A

    10 Site G G G C

    3
    3C A 2A 1A C 4C 2A A 3C 1A C 4C C 3C 4A A 4C 2A 3T 1T T 2A 1T A

    6
    3T A 4A 2T 1T

    8
    3G

    Tree I
    4 steps best tree

    G
    4G

    1T
    T A

    2A
    4A 2A T 3T

    1T
    T 3G 1T G 3G G T

    2T
    4G 2T 4G
    18

    Tree II
    5 steps

    Tree III
    6 steps

    Phylogenetic grouping

    Taxa (n)

    rooted (2n-3)!/(2n-2(n-2)!) 1 3 15 105

    unrooted (2n-5)!/(2n-3(n-3)!) 1 1 3 15

    2 3 4 5

    6
    7 8 9 10

    954
    10,395 135,135 2,027,025 34,459,425

    105
    954 10,395 135,135 2,027,025

    Phylogenetic Analysis Using Parsimony

    19

    Phylogenetic approach

    2 ways Classic phylogenetic analysis uses morphological features Ex: anatomy, size, shape, etc.

    Modern phylogenetic analysis uses molecular information Genetic material (DNA and protein sequences)

    20

    Sources of Systematic evidence

    Morphology gross structure

    21

    Sources of Systematic evidence

    Anatomy tissues and cell types

    22

    Sources of Systematic evidence

    Physiology metabolic processes

    23

    Sources of Systematic evidence

    Embryology development

    24

    Sources of Systematic evidence

    Palynology pollen grains and their development

    25

    Sources of Systematic evidence

    Reproductive Biology e.g., pollination mechanism

    26

    Sources of Systematic evidence

    Molecular Systematics Genomic DNA sequences

    27

    Phylogenetic approach

    Types of Characters and Character states Morphology: Petal color 0 white 1 red 2 blue Molecular:
    260 * 280 * 300 * 320 CCTTCAATTTTTATT-----------------------AGAGTTTTAGGAGAAATAAGTATGTG CCTCCAATTTTTATTAGCTTGCCTACTCCTTTGGGCACAGAGTTTTAGGAGAAATAAGTATGTG CCTCCAATTTTTATTAGCTTGCCTACTCCTTTGGGCACAGAGTTTTAGGAGAAATAAGTATGTG CCTCCAATTTTTATTAGCTTGCCTACTCCTTTGGGAACAGAGTTTTAGGAGAAATAAGTATGTG CCTCCAATTTTTATTAGTTTGCCTACTCCTTTGGGCACAGAGTTTTAGGAGAAATAAGTATGTG CCTCCAATTTTTATTAGCTTGCCTACTCCTTTGGGCACAGAGTTTTAGGAGAAATAAGTATGTG CCTcCAATTTTTATTag ttgcctactcctttggg acAGAGTTTTAGGAGAAATAAGTATGTG

    0841r 0992r 3803r 4062r 3802r ph2f

    : : : : : :

    : : : : : :

    272 213 305 319 282 306


    28

    Sources of molecular data

    Understanding Genome

    Genome = Total genetic materials of an organism


    Mitochondrial Genome
    coxl atpA

    Chloroplast Genome
    rbcL , atpB,

    Nuclear Genome
    18S rDNA
    26S rDNA ITS

    matK, ndhF,
    rps16 intron, atpB-rbcL intergenic region, trn spacers (trnT, trnL, trnF), 16S rDNA

    29

    Sources of molecular data

    Internal Transcribed Spacer (nrDNA)

    (Baldwin et. al., 1995)

    Gymnosperm: ITS 1500 3700 bp Angiosperm: ITS1 187-298 bp 5.8s 163-165 bp ITS2 187-252 bp
    30

    Sources of molecular data

    chloroplast genome trnT-F (cpDNA)

    (Taberlet et. al, 1991) (Soltis at Soltis, 1998)

    31

    Advantages of using molecular data

    Why molecular data are powerful for evolutionary studies?

    They give more characters. Some organisms have limited


    number of morphological characters that can be used for taxonomic purposes.

    Molecular data are often easier to quantitate than are


    morphological data.

    DNA sequences more simple to model, only four character


    states A, C, G, T.

    Molecular data have often resolved systematic questions where


    morphological evidence is inconlusive.

    Molecular data have often revealed relationships that are not

    32 suspected on the basis of traditional morphological characters.

    You might also like