VNTR- Minisatellite

Akash Mahadev Iyer
S4 M.Sc Biochemistry
Department of Biochemistry
University of Kerala

 All human share about 99 % of their DNA.
 The remaining 1% accounts for variability between us- unless you are
an identical twin!.

 Repetitive DNA -two patterns of distribution in the chromosomes.
The two major classes of repetitive elements are
 Interspersed elements and
 Tandem arrays.

1. Interspersed repeated elements are usually present as single copies
and distributed widely throughout the genome.
2. Tandemly-repeated DNA may be further classified according to the
length and copy number of the basic repeat units as well as its
genomic localization;
3 main types
 Satellite
 Minisatellite
 Microsatellite

 A satellite is a highly repetitive DNA sequence with each repeated
sequence ranging from a thousand to several thousand base pairs.
 The entire satellite can be up to 100 million base pairs long,
Occur in regions of heterochromatin.
Satellite DNA - clustered in discrete
areas such as centromere.

 Differ in density from the remaining chromosomal DNA and are separable as
minor band in CsCl Density Gradient Centrifugation, called as SATELLITE
DNA.

 A minisatellite is an array of tandem repeats, with each repeat ranging
from nine to 100 base pairs.
 The entire array is usually 500 to 30,000 base pairs long.
 Most commonly found in euchromatin regions of the chromosome.
 Like satellite DNA sequences, they are also not transcribed
 A microsatellite is an array of very short repeats
 2-6 base pairs each, with the entire array ranging from 10,000 to 100,000
base pairs in length.
 Found in the euchromatin regions of vertebrate, insect and plant
chromosomes. The number of repeats varies among individuals in a
population, making microsatellites particularly useful to the population
geneticist.

 Tandem repeats occur in DNA when a pattern of one or more nucleotides
is repeated and the repetitions are directly adjacent to each other.
 An example would be:
AATTTTCCGGCCCCAAAATTCCAATTTTCCGGCCCCAAAATTCCAATTTTCCGGCCCCAAAATTCC
 These can be found on many chromosomes, and often show variations in
length between individuals.
 The number of elements in a given region may vary, hence they are known
as variable number tandem repeats.
 Each variant acts as an inherited allele, allowing them to be used for
personal or parental identification.
 Scientists use polymorphic loci that are known to
contain VNTRs/STRs in order to differentiate people based on their DNA.
Variable Number Tandem Repeats

 In standard genetics, we often think of an allele as a variation
of gene that would result in a difference in a physical manifestation
of that gene.
 In the case of VNTRs, these alleles are simply a difference in
number of repeats.
 The length of DNA within this locus is either longer or shorter and gives
rise to many different alleles.
 A locus in a population is polymorphic if it has more than one allele.
 This is often used in forensic science or in maternity/paternity cases.
 Any variation of a locus is referred to as an allele.
• VNTR regions are not genes, and our interest in them is solely related to
their use for identifying individuals. We therefore refer to them
as markers.

 Because different alleles consist of different numbers of repeats, VNTR
alleles can be identified by their lengths.
 If DNA fragments of different lengths are placed on a semisolid medium
(gel) in an electric field, they migrate at different rates;
 Different-sized fragments can therefore be identified by the distance
they travel between electrodes in such a gel

 First human minisatellite was discovered in 1980 by A.R. Wyman and
R. White
 Alec Jeffreys coined the term ‘minisatellite’
 14-100 bp sequences which repeats 20-50 times
 Hypervariable minisatellites, highly polymorphic, contain 100-1000
repeats
 HVMS DNA sequences; Not transcribed (ex; MUC1 locus)
 The variability is not just limited to the number of repeat but also the
sequence of repeats can vary in different members of an array
 Of the 300 minisatellite families, which have been typed less than 10
are hypervariable

 Individual repeats can be removed from (or added to) the VNTR via
recombination or replication errors.
 Different individuals within a population may have different numbers of
repeats.
 For example, one person might carry 3 tandem repeats in a particular
gene, while another person might bear 15 repeats

• Due to the repetitive nature of the sequence have allowed further
increases/decreases in the number of repeats resulting in the
polymorphisms observed
 These can be isolated from an individual’s DNA and therefore relatively
easy to map.
VNTRs have a disadvantage as genetic markers:
 They tend to bunch together at the ends of chromosomes, leaving the
interiors of the chromosomes relatively devoid of markers.

While the repeated sequences
themselves are usually the same from
person to person, the number of times
they are repeated tends to vary.
In order to create a DNA fingerprint
that is unique to each person
scientists had to identify areas in the
genome that are highly variable.
VNTRs are highly polymorphic-
VNTRs tends to differ among different
people.
The number of times the sequence is repeated can differ
within and between individuals therefore making these
VNTRs a polymorphic entity.

 VNTR loci tend to be hypermutable through an insertion/deletion of
short nucleotide repeat sequences.
 They are classified a hypermutable only when their mean mutation
frequency is greater than 0.5%
 Mutation frequency is defined as the frequency at which a specific kind
of mutation is found in a population of cells
 Great variation can be generated –as the mutation rates thousands-
millions, of times faster than the rest of the genome
 Short arrays of repeats can be stable over millions of years, while long
alleles can have an extremely high frequency of mutational changes (up
to 15%).

 The most highly mutable minisatellite locus described so
far is CEB1 (D2S90)- 13% mutation rate in the male
germline (Vergnaud et.al)
Organellar location;
 Minisatellites are not just restricted to nuclear DNA, they are
also present in mtDNA, cpDNA
VNTRs are thought to have arisen due to
 Slippages during DNA replication or
 As a consequence of Unequal crossing-over,

 During replication the DNA polymerase copies the template and sometimes
stutters in areas where tandem repeats are located.
 As a result the number of repeats increases. This is called backward
replication slippage.

 If a tandem repeat region contains many repeats a mechanism called
forward replication slippage may occur.
 During replication when the DNA is single stranded, the repeat region
forms loops.
 The DNA polymerase may accidentally skip this looped region and as a
result the replicated stand contains a decreased number of tandem
repeats.

VNTRs are very rarely found in polypeptide encoding DNA.
 Exception; MUC1 locus at 1q21 encodes a highly polymorphic glycoproteins-
mucins
 Mucins are HMW GPs
 Found in several epithelial tissues, mucous membranes and body
fluids(maintains integrity and differentiation of EC, promotes tumor cell
proliferation and metastasis)
 Mucins can be either secretory (MUC2, MUC6, MUC7) or membrane bound
(MUC1, MUC12, MUC13)
 The extracellular portion of mucins contain large no of TR repeats of similar
amino acids- 20 aa (Ser, Thr; O-linked glycosylation sites)

Variation at the insulin gene variable number of tandem
repeats (INS VNTR)
 Minisatellite has been shown to influence pancreatic insulin gene
transcription, both in the fetus and in adulthood
 The 5’ regulatory region of INS contains a variable number of tandem repeat
(VNTR) locus that has been associated with T1D.
 A(C/T)AGGGGT(G/C)C(G/C/T)(G/A/T)(G/A/T)G(G/C/T);
 14-15 bp consensus sequence situated at the 5’region of INS gene
 The VNTR lies 596 bp upstream of the insulin gene on chromosome
11p15.5, and has been suggested to influence transcription rate of these
genes.
 Known as Insulin gene minisatellite or ILPR- Insulin linked polymorphic
region
 No of repeats in the alleles ranges from 26 to >200

Three classes of alleles identified on the basis of overall size;
 Class I (26-63 repeats- associated with IDDM suscepibility)
 Class ll (80 repeats)
 Class lll (140-200 repeats)- cause transcription of INS gene in
developing thymus, thus increases efficiency of deletion of insulin-
reactive T-cell clones during development of immune system, reducing
risk of autoimmune attack
Low thymic insulin- hampered negative selection

Insulin Gene (INS)
Class I VNTR
26-63 repeats
21 alleles
Predisposing
Insulin Gene (INS)
Class III VNTR
140-200 repeats
15 alleles
Protective
VNTR = Variable Number of Tandem Repeats

Applications
 VNTR fingerprinting has been applied for subtyping of Salmonella
typhi and S.typhimurium
 VNTR typing as the next gold standard in the molecular
epidemiology of tuberculosis - Genotyping for early diagnosis of
M. tuberculosis super-infection or mixed infection
 Used as genetic markers in linkage analysis and population studies
 Highly valuable new tool in population ecology
 Fingerprinting
 Conservation biology
 Parentage
 Forensics
 Genetic identity

Importance in human genome
 Minisatellites have been found in association with important features of
human genome biology such as gene regulation, chromosomal fragile
sites, and imprinting
 Some are part of an open reading frame, which may or may not display
polymorphism in the human population
 Minisatellites located in the 5′ region of genes participate in the
regulation of transcription.
 Others located within introns interfere with splicing
 Minisatellites at imprinted loci are thought to play a role in the imprint
control
 Finally, minisatellites may constitute chromosome fragile sites and
have been found in the vicinity of a number of recurrent translocation
breakpoints and in the switch recombination site in immunoglobulin
heavy chain genes

References
 Human Molecular Genetics, Tom Strachan, 3rd edition, Garland
Science
 Molecular Markers and Plant Biotechnology-By Rukam S. Tomar,
New India Publishing
 Computational Systems-Biology and Bioinformatics- edited by
Jonathan H. Chan,
 Human Molecular Biology Laboratory Manual- by Stefan
Surzycki, Wiley
 Mini- and Microsatellites by Claes Ramel, Stockholm University
 Slideshare
 NCBI

VNTR- Minisatellite

More Related Content

VNTR- Minisatellite

Editor's Notes