Pepper, Capsicum annuum L., is an economically important crop in Zimbabwe, grown as a spice and v... more Pepper, Capsicum annuum L., is an economically important crop in Zimbabwe, grown as a spice and vegetable for both the local and export markets. Pepper is susceptible to infection by up to 49 virus species, some of which cause serious yield loss (Hanssen et al. 2010). During tospovirus surveys conducted in January 2015, pepper plants with typical viral symptoms, including plant stunting, leaf chlorosis, mottling, and curling were observed at a farm in Goromonzi District of Zimbabwe. Visual observations estimated the symptoms incidence at 15%. In addition, there was a high incidence of Frankliniella occidentalis and Myzus persicae in the field. Ten symptomatic and four nonsymptomatic leaves were tested using LoeweFast Lateral Flow Kits (Loewe Biochemica GmbH, Germany) specific to tospoviruses and Potato virus Y (PVY). The tospovirus kit was specific to Tomato spotted wilt virus (TSWV), Tomato chlorotic spot virus (TCSV), and Groundnut ringspot virus (GRSV). Eight and 10 of the symptomatic leaves tested positive for tospoviruses and PVY, respectively, while all the symptomless leaves tested negative for both viruses. Plant sap from virus-infected leaves was imprinted onto FTA Whatman cards (Whatman International, USA), air dried, and shipped to the University of KwaZulu-Natal Plant Virology Laboratory (Pietermaritzburg, South Africa) for further diagnostic tests. Total nucleic acid was eluted from the FTA cards following manufacturer’s instructions. The presence of TSWV and PVY was further confirmed by reverse transcription (RT)-PCR using the TSWV nucleocapsid protein (TSWV 722: GCTGGAGCTAAGTATAGCAGC and TSWV 723: CACAAGGCAAAGACCTTGAG) and the PVY viral protein genome-linked (VPf-F: GAATYCAAGCHYTRAAGTTTCG and VPg-R: GCTTCATGYTCYACHTCCTG) gene-specific primers. The respective reverse primers and the RevertAid First Strand cDNA Synthesis Kit (Thermo Scientific, USA) were used for cDNA synthesis. PCR was performed using KAPA2G Fast HotStart ReadyMix (Kapa Biosystems, USA) and the respective primer pairs for the viruses. These primers amplify 620 bp of the TSWV nucleocapsid gene (Adkins and Rosskopf 2002) and 547 bp of the PVY viral protein genome-linked gene (Ben Khalifa et al. 2009). Amplicons of the expected sizes obtained from symptomatic leaves only, were purified using QiaQuick Gel Extraction Kit (Qiagen, Germany) and directly sequenced at Inqaba Biotech (Pretoria, South Africa). The TSWV isolate sequence (Accession Number KU671049) shared 99% identity with sequences of pepper-infecting isolates from Turkey (KM379142), Serbia (KC182566), and South Africa (DQ834847), while the PVY isolate sequence (KU695465) shared at least 89% identity with sequences of pepper-infecting isolates from France (KF670594), The Netherlands (EF638905), and South Africa (KF770839). To our knowledge, this is the first record of a mixed infection of pepper by TSWV and PVY in Zimbabwe. This is also the first time both pepper-infecting viruses have been sequenced in Zimbabwe. Given the economic and nutritional importance of pepper in Zimbabwe, the occurrence of both viruses on pepper is likely to negatively affect yield and farmers’ income. There is need for further surveys to ascertain how widespread this phenomenon is and determine its economic impact on pepper production in Zimbabwe.
Accurate identification of plant pathogens is crucial towards developing sustainable control stra... more Accurate identification of plant pathogens is crucial towards developing sustainable control strategies to ensure sustainable economic agricultural production. The aim of this study was to detect and characterize Potato virus Y (PVY) isolates infecting potato (Solanum tuberosum L.) in the Msinga district in the Province of KwaZulu-Natal, South Africa. Potato leaf samples exhibiting virus-like symptoms were collected from four different areas in the district. Initial detection of PVY in the leaf samples was done using triple antibody sandwich ELISA. PVY-positive samples were further tested using antibodies specific to PVY serotypes O and N. Nicotiana tabacum cv Samsun plants were individually mechanically inoculated with all 32 PVY-ELISA positive samples. Symptoms on inoculated tobacco plants were monitored over a 4-week period. They consisted of vein clearing, faint mosaic patterns, and the veinal necrosis, symptoms characteristic of PVYN, PVYNWilga and PVYNTN strains. Reverse transcription-polymerase chain reaction, using primers specific to the coat protein gene of PVY, was performed as a confirmation test on total RNA of four randomly selected PVY-ELISA positive samples, each sample representing each of the four areas surveyed. Strains PVYN and PVYO were identified. The second part of the study aimed to analyse the full genome sequences of the PVY isolates A4, KD2, MOD1 and SneP3, in order to understand the evolution of the virus in Msinga. To achieve this, total RNA, extracted from tobacco leaves (N. tabacum cv Samsun) that had been inoculated with the selected four PVY isolates, was used as a template for next generation sequencing (NGS). NGS was run on Illumina HiSeq using paired-end chemistry 125 × 125bp reads. de novo assembly of the generated reads was performed. The resulting contigs were subjected to BLAST on the GenBank database in order to identify PVY genomes. The PVY isolates were aligned with closely related non-recombinant PVY sequences comprising of the following strains: PVYN, PVYO, PVYNTN, and PVYC. Recombination events were assessed using RDP4 software. Phylogenetic results revealed that PVY isolate SneP3 belonged to the PVYNTN strain while isolate PVYMOD1 to the PVY N Wilga strain group. Recombination analyses confirmed the occurrence of PVY recombinant strains in the Msinga district. The widespread presence of PVY and occurrence of recombinant strains in Msinga has serious implications on the management of PVY diseases by small-scale farmers growing potato for a livelihood.
Accurate identification of plant pathogens is crucial towards developing sustainable control stra... more Accurate identification of plant pathogens is crucial towards developing sustainable control strategies to ensure sustainable economic agricultural production. The aim of this study was to detect and characterize Potato virus Y (PVY) isolates infecting potato (Solanum tuberosum L.) in the Msinga district in the Province of KwaZulu-Natal, South Africa. Potato leaf samples exhibiting virus-like symptoms were collected from four different areas in the district. Initial detection of PVY in the leaf samples was done using triple antibody sandwich ELISA. PVY-positive samples were further tested using antibodies specific to PVY serotypes O and N. Nicotiana tabacum cv Samsun plants were individually mechanically inocu-lated with all 32 PVY-ELISA positive samples. Symptoms on inoculated tobacco plants were monitored over a 4-week period. They consisted of vein clearing, faint mosaic patterns, and the veinal necrosis, symptoms characteristic of PVY N , PVY N Wilga and PVY NTN strains. Reverse transcription-polymerase chain reaction, using primers specific to the coat protein gene of PVY, was performed as a confirmation test on total RNA of four randomly selected PVY-ELISA positive samples, each sample representing each of the four areas surveyed. Strains PVY N and PVY O were identified. The second part of the study aimed to analyse the full genome sequences of the PVY isolates A4, KD2, MOD1 and SneP3, in order to understand the evolution of the virus in Msinga. To achieve this, total RNA, extracted from tobacco leaves (N. tabacum cv Samsun) that had been inoculated with the selected four PVY isolates, was used as a template for next generation sequencing (NGS). NGS was run on Illumina HiSeq using paired-end chemistry 125 Â 125bp reads. de novo assembly of the generated reads was performed. The resulting contigs were subjected to BLAST on the GenBank database in order to identify PVY genomes. The PVY isolates were aligned with closely related non-recombinant PVY sequences comprising of the following strains: PVY N , PVY O , PVY NTN , and PVY C. Recombination events were assessed using RDP4 software. Phylogenetic results revealed that PVY isolate SneP3 belonged to the PVY NTN strain while isolate PVYMOD1 to the PVY N Wilga strain group. Recombination analyses confirmed the occurrence of PVY recombinant strains in the Msinga district. The widespread presence of PVY and occurrence of recombinant strains in Msinga has serious implications on the management of PVY diseases by small-scale farmers growing potato for a livelihood.
Pepper, Capsicum annuum L., is an economically important crop in Zimbabwe, grown as a spice and v... more Pepper, Capsicum annuum L., is an economically important crop in Zimbabwe, grown as a spice and vegetable for both the local and export markets. Pepper is susceptible to infection by up to 49 virus species, some of which cause serious yield loss (Hanssen et al. 2010). During tospovirus surveys conducted in January 2015, pepper plants with typical viral symptoms, including plant stunting, leaf chlorosis, mottling, and curling were observed at a farm in Goromonzi District of Zimbabwe. Visual observations estimated the symptoms incidence at 15%. In addition, there was a high incidence of Frankliniella occidentalis and Myzus persicae in the field. Ten symptomatic and four nonsymptomatic leaves were tested using LoeweFast Lateral Flow Kits (Loewe Biochemica GmbH, Germany) specific to tospoviruses and Potato virus Y (PVY). The tospovirus kit was specific to Tomato spotted wilt virus (TSWV), Tomato chlorotic spot virus (TCSV), and Groundnut ringspot virus (GRSV). Eight and 10 of the symptomatic leaves tested positive for tospoviruses and PVY, respectively, while all the symptomless leaves tested negative for both viruses. Plant sap from virus-infected leaves was imprinted onto FTA Whatman cards (Whatman International, USA), air dried, and shipped to the University of KwaZulu-Natal Plant Virology Laboratory (Pietermaritzburg, South Africa) for further diagnostic tests. Total nucleic acid was eluted from the FTA cards following manufacturer’s instructions. The presence of TSWV and PVY was further confirmed by reverse transcription (RT)-PCR using the TSWV nucleocapsid protein (TSWV 722: GCTGGAGCTAAGTATAGCAGC and TSWV 723: CACAAGGCAAAGACCTTGAG) and the PVY viral protein genome-linked (VPf-F: GAATYCAAGCHYTRAAGTTTCG and VPg-R: GCTTCATGYTCYACHTCCTG) gene-specific primers. The respective reverse primers and the RevertAid First Strand cDNA Synthesis Kit (Thermo Scientific, USA) were used for cDNA synthesis. PCR was performed using KAPA2G Fast HotStart ReadyMix (Kapa Biosystems, USA) and the respective primer pairs for the viruses. These primers amplify 620 bp of the TSWV nucleocapsid gene (Adkins and Rosskopf 2002) and 547 bp of the PVY viral protein genome-linked gene (Ben Khalifa et al. 2009). Amplicons of the expected sizes obtained from symptomatic leaves only, were purified using QiaQuick Gel Extraction Kit (Qiagen, Germany) and directly sequenced at Inqaba Biotech (Pretoria, South Africa). The TSWV isolate sequence (Accession Number KU671049) shared 99% identity with sequences of pepper-infecting isolates from Turkey (KM379142), Serbia (KC182566), and South Africa (DQ834847), while the PVY isolate sequence (KU695465) shared at least 89% identity with sequences of pepper-infecting isolates from France (KF670594), The Netherlands (EF638905), and South Africa (KF770839). To our knowledge, this is the first record of a mixed infection of pepper by TSWV and PVY in Zimbabwe. This is also the first time both pepper-infecting viruses have been sequenced in Zimbabwe. Given the economic and nutritional importance of pepper in Zimbabwe, the occurrence of both viruses on pepper is likely to negatively affect yield and farmers’ income. There is need for further surveys to ascertain how widespread this phenomenon is and determine its economic impact on pepper production in Zimbabwe.
Pepper, Capsicum annuum L., is an economically important crop in Zimbabwe, grown as a spice and v... more Pepper, Capsicum annuum L., is an economically important crop in Zimbabwe, grown as a spice and vegetable for both the local and export markets. Pepper is susceptible to infection by up to 49 virus species, some of which cause serious yield loss (Hanssen et al. 2010). During tospovirus surveys conducted in January 2015, pepper plants with typical viral symptoms, including plant stunting, leaf chlorosis, mottling, and curling were observed at a farm in Goromonzi District of Zimbabwe. Visual observations estimated the symptoms incidence at 15%. In addition, there was a high incidence of Frankliniella occidentalis and Myzus persicae in the field. Ten symptomatic and four nonsymptomatic leaves were tested using LoeweFast Lateral Flow Kits (Loewe Biochemica GmbH, Germany) specific to tospoviruses and Potato virus Y (PVY). The tospovirus kit was specific to Tomato spotted wilt virus (TSWV), Tomato chlorotic spot virus (TCSV), and Groundnut ringspot virus (GRSV). Eight and 10 of the symptomatic leaves tested positive for tospoviruses and PVY, respectively, while all the symptomless leaves tested negative for both viruses. Plant sap from virus-infected leaves was imprinted onto FTA Whatman cards (Whatman International, USA), air dried, and shipped to the University of KwaZulu-Natal Plant Virology Laboratory (Pietermaritzburg, South Africa) for further diagnostic tests. Total nucleic acid was eluted from the FTA cards following manufacturer’s instructions. The presence of TSWV and PVY was further confirmed by reverse transcription (RT)-PCR using the TSWV nucleocapsid protein (TSWV 722: GCTGGAGCTAAGTATAGCAGC and TSWV 723: CACAAGGCAAAGACCTTGAG) and the PVY viral protein genome-linked (VPf-F: GAATYCAAGCHYTRAAGTTTCG and VPg-R: GCTTCATGYTCYACHTCCTG) gene-specific primers. The respective reverse primers and the RevertAid First Strand cDNA Synthesis Kit (Thermo Scientific, USA) were used for cDNA synthesis. PCR was performed using KAPA2G Fast HotStart ReadyMix (Kapa Biosystems, USA) and the respective primer pairs for the viruses. These primers amplify 620 bp of the TSWV nucleocapsid gene (Adkins and Rosskopf 2002) and 547 bp of the PVY viral protein genome-linked gene (Ben Khalifa et al. 2009). Amplicons of the expected sizes obtained from symptomatic leaves only, were purified using QiaQuick Gel Extraction Kit (Qiagen, Germany) and directly sequenced at Inqaba Biotech (Pretoria, South Africa). The TSWV isolate sequence (Accession Number KU671049) shared 99% identity with sequences of pepper-infecting isolates from Turkey (KM379142), Serbia (KC182566), and South Africa (DQ834847), while the PVY isolate sequence (KU695465) shared at least 89% identity with sequences of pepper-infecting isolates from France (KF670594), The Netherlands (EF638905), and South Africa (KF770839). To our knowledge, this is the first record of a mixed infection of pepper by TSWV and PVY in Zimbabwe. This is also the first time both pepper-infecting viruses have been sequenced in Zimbabwe. Given the economic and nutritional importance of pepper in Zimbabwe, the occurrence of both viruses on pepper is likely to negatively affect yield and farmers’ income. There is need for further surveys to ascertain how widespread this phenomenon is and determine its economic impact on pepper production in Zimbabwe.
Accurate identification of plant pathogens is crucial towards developing sustainable control stra... more Accurate identification of plant pathogens is crucial towards developing sustainable control strategies to ensure sustainable economic agricultural production. The aim of this study was to detect and characterize Potato virus Y (PVY) isolates infecting potato (Solanum tuberosum L.) in the Msinga district in the Province of KwaZulu-Natal, South Africa. Potato leaf samples exhibiting virus-like symptoms were collected from four different areas in the district. Initial detection of PVY in the leaf samples was done using triple antibody sandwich ELISA. PVY-positive samples were further tested using antibodies specific to PVY serotypes O and N. Nicotiana tabacum cv Samsun plants were individually mechanically inoculated with all 32 PVY-ELISA positive samples. Symptoms on inoculated tobacco plants were monitored over a 4-week period. They consisted of vein clearing, faint mosaic patterns, and the veinal necrosis, symptoms characteristic of PVYN, PVYNWilga and PVYNTN strains. Reverse transcription-polymerase chain reaction, using primers specific to the coat protein gene of PVY, was performed as a confirmation test on total RNA of four randomly selected PVY-ELISA positive samples, each sample representing each of the four areas surveyed. Strains PVYN and PVYO were identified. The second part of the study aimed to analyse the full genome sequences of the PVY isolates A4, KD2, MOD1 and SneP3, in order to understand the evolution of the virus in Msinga. To achieve this, total RNA, extracted from tobacco leaves (N. tabacum cv Samsun) that had been inoculated with the selected four PVY isolates, was used as a template for next generation sequencing (NGS). NGS was run on Illumina HiSeq using paired-end chemistry 125 × 125bp reads. de novo assembly of the generated reads was performed. The resulting contigs were subjected to BLAST on the GenBank database in order to identify PVY genomes. The PVY isolates were aligned with closely related non-recombinant PVY sequences comprising of the following strains: PVYN, PVYO, PVYNTN, and PVYC. Recombination events were assessed using RDP4 software. Phylogenetic results revealed that PVY isolate SneP3 belonged to the PVYNTN strain while isolate PVYMOD1 to the PVY N Wilga strain group. Recombination analyses confirmed the occurrence of PVY recombinant strains in the Msinga district. The widespread presence of PVY and occurrence of recombinant strains in Msinga has serious implications on the management of PVY diseases by small-scale farmers growing potato for a livelihood.
Accurate identification of plant pathogens is crucial towards developing sustainable control stra... more Accurate identification of plant pathogens is crucial towards developing sustainable control strategies to ensure sustainable economic agricultural production. The aim of this study was to detect and characterize Potato virus Y (PVY) isolates infecting potato (Solanum tuberosum L.) in the Msinga district in the Province of KwaZulu-Natal, South Africa. Potato leaf samples exhibiting virus-like symptoms were collected from four different areas in the district. Initial detection of PVY in the leaf samples was done using triple antibody sandwich ELISA. PVY-positive samples were further tested using antibodies specific to PVY serotypes O and N. Nicotiana tabacum cv Samsun plants were individually mechanically inocu-lated with all 32 PVY-ELISA positive samples. Symptoms on inoculated tobacco plants were monitored over a 4-week period. They consisted of vein clearing, faint mosaic patterns, and the veinal necrosis, symptoms characteristic of PVY N , PVY N Wilga and PVY NTN strains. Reverse transcription-polymerase chain reaction, using primers specific to the coat protein gene of PVY, was performed as a confirmation test on total RNA of four randomly selected PVY-ELISA positive samples, each sample representing each of the four areas surveyed. Strains PVY N and PVY O were identified. The second part of the study aimed to analyse the full genome sequences of the PVY isolates A4, KD2, MOD1 and SneP3, in order to understand the evolution of the virus in Msinga. To achieve this, total RNA, extracted from tobacco leaves (N. tabacum cv Samsun) that had been inoculated with the selected four PVY isolates, was used as a template for next generation sequencing (NGS). NGS was run on Illumina HiSeq using paired-end chemistry 125 Â 125bp reads. de novo assembly of the generated reads was performed. The resulting contigs were subjected to BLAST on the GenBank database in order to identify PVY genomes. The PVY isolates were aligned with closely related non-recombinant PVY sequences comprising of the following strains: PVY N , PVY O , PVY NTN , and PVY C. Recombination events were assessed using RDP4 software. Phylogenetic results revealed that PVY isolate SneP3 belonged to the PVY NTN strain while isolate PVYMOD1 to the PVY N Wilga strain group. Recombination analyses confirmed the occurrence of PVY recombinant strains in the Msinga district. The widespread presence of PVY and occurrence of recombinant strains in Msinga has serious implications on the management of PVY diseases by small-scale farmers growing potato for a livelihood.
Pepper, Capsicum annuum L., is an economically important crop in Zimbabwe, grown as a spice and v... more Pepper, Capsicum annuum L., is an economically important crop in Zimbabwe, grown as a spice and vegetable for both the local and export markets. Pepper is susceptible to infection by up to 49 virus species, some of which cause serious yield loss (Hanssen et al. 2010). During tospovirus surveys conducted in January 2015, pepper plants with typical viral symptoms, including plant stunting, leaf chlorosis, mottling, and curling were observed at a farm in Goromonzi District of Zimbabwe. Visual observations estimated the symptoms incidence at 15%. In addition, there was a high incidence of Frankliniella occidentalis and Myzus persicae in the field. Ten symptomatic and four nonsymptomatic leaves were tested using LoeweFast Lateral Flow Kits (Loewe Biochemica GmbH, Germany) specific to tospoviruses and Potato virus Y (PVY). The tospovirus kit was specific to Tomato spotted wilt virus (TSWV), Tomato chlorotic spot virus (TCSV), and Groundnut ringspot virus (GRSV). Eight and 10 of the symptomatic leaves tested positive for tospoviruses and PVY, respectively, while all the symptomless leaves tested negative for both viruses. Plant sap from virus-infected leaves was imprinted onto FTA Whatman cards (Whatman International, USA), air dried, and shipped to the University of KwaZulu-Natal Plant Virology Laboratory (Pietermaritzburg, South Africa) for further diagnostic tests. Total nucleic acid was eluted from the FTA cards following manufacturer’s instructions. The presence of TSWV and PVY was further confirmed by reverse transcription (RT)-PCR using the TSWV nucleocapsid protein (TSWV 722: GCTGGAGCTAAGTATAGCAGC and TSWV 723: CACAAGGCAAAGACCTTGAG) and the PVY viral protein genome-linked (VPf-F: GAATYCAAGCHYTRAAGTTTCG and VPg-R: GCTTCATGYTCYACHTCCTG) gene-specific primers. The respective reverse primers and the RevertAid First Strand cDNA Synthesis Kit (Thermo Scientific, USA) were used for cDNA synthesis. PCR was performed using KAPA2G Fast HotStart ReadyMix (Kapa Biosystems, USA) and the respective primer pairs for the viruses. These primers amplify 620 bp of the TSWV nucleocapsid gene (Adkins and Rosskopf 2002) and 547 bp of the PVY viral protein genome-linked gene (Ben Khalifa et al. 2009). Amplicons of the expected sizes obtained from symptomatic leaves only, were purified using QiaQuick Gel Extraction Kit (Qiagen, Germany) and directly sequenced at Inqaba Biotech (Pretoria, South Africa). The TSWV isolate sequence (Accession Number KU671049) shared 99% identity with sequences of pepper-infecting isolates from Turkey (KM379142), Serbia (KC182566), and South Africa (DQ834847), while the PVY isolate sequence (KU695465) shared at least 89% identity with sequences of pepper-infecting isolates from France (KF670594), The Netherlands (EF638905), and South Africa (KF770839). To our knowledge, this is the first record of a mixed infection of pepper by TSWV and PVY in Zimbabwe. This is also the first time both pepper-infecting viruses have been sequenced in Zimbabwe. Given the economic and nutritional importance of pepper in Zimbabwe, the occurrence of both viruses on pepper is likely to negatively affect yield and farmers’ income. There is need for further surveys to ascertain how widespread this phenomenon is and determine its economic impact on pepper production in Zimbabwe.
Uploads
Papers by Sne Ximba