Jacques D Ibaba

The frequent identification of cucurbit-infecting viruses across the province of KwaZulu-Natal (KZN) in South Africa necessitates developing effective methods of controlling these diseases. Putative transgenic baby marrow (Cucurbita pepo L.) plants resistant to Zucchini yellow mosaic virus (ZYMV), Moroccan watermelon mosaic virus (MWMV) and Zucchini shoestring virus (ZSSV), three potyviruses occurring in KZN, were developed in this study. A portion of the coat protein coding sequences of each of the selected viruses was amplified by RT-PCR and inserted into the plant expression vector pEPJ86-m/2N. The segment containing the expression cassette was subcloned into the binary vector pGA482G before being introduced into Rhizobium radiobacter (formerly Agrobacterium tumefaciens) strain LBA4404 (pAL4404)(pBI121). Baby marrow cotyledon explants, transformed using Rhizobium-mediated transformation, were regenerated in vitro under kanamycin selection. A total of 94 putative transgenic marrows lines were successfully regenerated from 250 explants. PCR results showed that 84 out of the 94 lines had the transgene. Of these 84 lines, 76 showed resistance after mechanical inoculation with the viruses under study. The preliminary results show the potential of using transgenic cucurbits with resistance to the three potyviruses as an effective strategy to control potyvirus diseases on cucurbits.

Objectives: Plant-infecting viruses remain a serious challenge towards achieving food security worldwide. Cucurbit virus surveys were conducted in Zimbabwe during the 2014 and 2015 growing seasons. Leaf samples displaying virus-like symptoms were collected and stored until analysis. Three baby marrow samples were subjected to next-generation sequencing and the data generated were analysed using genomics technologies. Zucchini shoestring virus (ZSSV), a cucurbit-infecting potyvirus previously described in South Africa was one of the viruses identified. The genomes of the three ZSSV isolates are described analysed in this note. Results: The three ZSSV isolates had the same genome size of 10,297 bp excluding the polyA tail with a 43% GC content. The large open reading frame was found at positions 69 to 10,106 on the genome and encodes a 3345 amino acids long polyprotein which had the same cleavage site sequences as those described on the South African isolate except for the P1-pro site. Genome sequence comparisons of all the ZSSV isolates showed that the isolates F7-Art and S6-Prime had identical sequence across the entire genome while sharing 99.06% and 99.34% polyprotein nucleotide and amino acid sequence identities, respectively with the isolate S7-Prime.

Iris yellow spot virus (IYSV) is an important pathogen of Allium species worldwide. It has a tripartite genome consisting of the large (L), medium (M) and small (S) RNA segments. Despite its worldwide distribution, very few complete gene and genome sequences are available in public databases. The aim of this study was to obtain full gene sequences of a garlic-infecting IYSV isolate by next-generation sequencing (NGS) for understanding its evolution. Total RNA was extracted from an IYSV-positive garlic leaf and sequenced on the Illumina HiSeq platform using paired-end chemistry 125 × 125 bp reads. The quality of raw reads was assessed using FastQC software before trimming with Trimmomatic version 0.36. The resultant paired-end sequences were used for both de novo and reference-based genome assembly. The resultant consensus gene sequences were analyzed using SIAS (for sequence identity and composition), ExPASy (for protein molecular weight) and ORF Finder (for open reading frame identification). Three full gene sequences, that is, nucleocapsid (N), nonstructural protein (NSs) and movement protein (NSm) were recovered. The N gene did not display any distinct clustering patterns based on geographical locations and was most identical to an onion-infecting isolate from Serbia (Accession KT272878). The NSs and NSm genes clustered closely with homologous sequences of IYSV isolates that were retrieved from GenBank and EMBL. This study lays the foundation for complete genome studies of IYSV in Zimbabwe.

The frequent identification of cucurbit-infecting viruses across the province of KwaZulu-Natal (KZN) in South Africa necessitates developing effective methods of controlling these diseases. Putative transgenic baby marrow (Cucurbita pepo L.) plants resistant to Zucchini yellow mosaic virus (ZYMV), Moroccan watermelon mosaic virus (MWMV) and Zucchini shoestring virus (ZSSV), three potyviruses occurring in KZN, were developed in this study. A portion of the coat protein coding sequences of each of the selected viruses was amplified by RT-PCR and inserted into the plant expression vector pEPJ86-m/2N. The segment containing the expression cassette was subcloned into the binary vector pGA482G before being introduced into Rhizobium radiobacter (formerly Agrobacterium tumefaciens) strain LBA4404 (pAL4404)(pBI121). Baby marrow cotyledon explants, transformed using Rhizobium-mediated transformation, were regenerated in vitro under kanamycin selection. A total of 94 putative transgenic marrows lines were successfully regenerated from 250 explants. PCR results showed that 84 out of the 94 lines had the transgene. Of these 84 lines, 76 showed resistance after mechanical inoculation with the viruses under study. The preliminary results show the potential of using transgenic cucurbits with resistance to the three potyviruses as an effective strategy to control potyvirus diseases on cucurbits.

Accurate identification of plant pathogens is crucial towards developing sustainable control strategies to ensure sustainable economic agricultural production. The aim of this study was to detect and characterize Potato virus Y (PVY) isolates infecting potato (Solanum tuberosum L.) in the Msinga district in the Province of KwaZulu-Natal, South Africa. Potato leaf samples exhibiting virus-like symptoms were collected from four different areas in the district. Initial detection of PVY in the leaf samples was done using triple antibody sandwich ELISA. PVY-positive samples were further tested using antibodies specific to PVY serotypes O and N. Nicotiana tabacum cv Samsun plants were individually mechanically inocu-lated with all 32 PVY-ELISA positive samples. Symptoms on inoculated tobacco plants were monitored over a 4-week period. They consisted of vein clearing, faint mosaic patterns, and the veinal necrosis, symptoms characteristic of PVY N , PVY N Wilga and PVY NTN strains. Reverse transcription-polymerase chain reaction, using primers specific to the coat protein gene of PVY, was performed as a confirmation test on total RNA of four randomly selected PVY-ELISA positive samples, each sample representing each of the four areas surveyed. Strains PVY N and PVY O were identified. The second part of the study aimed to analyse the full genome sequences of the PVY isolates A4, KD2, MOD1 and SneP3, in order to understand the evolution of the virus in Msinga. To achieve this, total RNA, extracted from tobacco leaves (N. tabacum cv Samsun) that had been inoculated with the selected four PVY isolates, was used as a template for next generation sequencing (NGS). NGS was run on Illumina HiSeq using paired-end chemistry 125 Â 125bp reads. de novo assembly of the generated reads was performed. The resulting contigs were subjected to BLAST on the GenBank database in order to identify PVY genomes. The PVY isolates were aligned with closely related non-recombinant PVY sequences comprising of the following strains: PVY N , PVY O , PVY NTN , and PVY C. Recombination events were assessed using RDP4 software. Phylogenetic results revealed that PVY isolate SneP3 belonged to the PVY NTN strain while isolate PVYMOD1 to the PVY N Wilga strain group. Recombination analyses confirmed the occurrence of PVY recombinant strains in the Msinga district. The widespread presence of PVY and occurrence of recombinant strains in Msinga has serious implications on the management of PVY diseases by small-scale farmers growing potato for a livelihood.

Moroccan watermelon mosaic virus (MWMV) has been prevalent in cucurbits in the Republic of South Africa (RSA) since it was first reported in 1987. However, full-genome studies of the South African isolates have never been conducted previously. The full genome of two MWMV isolates infecting cucurbits (Cucurbita pepo L.) in the province of KwaZulu-Natal, RSA, was compared with the genome of the Tunisian isolate in this communication. The genome sequences of the RSA MWMV isolates were elucidated using next-generation sequencing and Sanger sequencing. The analyses performed included nucleotide and amino acid sequence comparison, determination of the genetic distances, detection of potential recombination, and phylogeny. The genome sequences of the RSA MWMV isolates were found to be 9719 nucleotides long, excluding the poly(A) tail. Sequence homology, genetic distances, and phylogenetic analyses indicated close relationships between the RSA isolates. This record will contribute to building up the MWMV isolate sequences from the different countries where the virus occurs, a useful step toward understanding MWMV evolution.

Zucchini shoestring virus (ZSSV) has been proposed to be a putative potyvirus in the papaya ringspot virus (PRSV) cluster, based on the sequence similarity of its coat protein to those of related potyviruses. ZSSV has been associated with the outbreak of a damaging disease of baby marrow (Cucurbita pepo L.) that had been observed throughout the province of KwaZulu-Natal, in the Republic of South Africa (RSA). We report the genome sequence of ZSSV, determined by next-generation sequencing of total RNA extracted from an infected baby marrow (Cucurbita pepo L.). The ZSSV genome is 10,295 nucleotides long excluding the poly(A) tail and displays a typical potyvirus organization. Algerian watermelon mosaic virus (AWMV; EU410442.1) was identified as the closest relative of ZSSV, sharing the highest nucleotide sequence identity of 65.68%. The nucleotide and amino acid sequence identity values for each protein support the differentiation of ZSSV as a member of a distinct species in the genus Potyvirus. This taxonomic position was also confirmed using the Pairwise Sequence Comparison online tool from the National Center for Biotechnology Information. Phylogenetic analysis of the polyprotein coding sequence of ZSSV grouped ZSSV together with AWMV and Moroccan watermelon mosaic virus, but in different clusters. ZSSV is the second cucurbit-infecting virus in the PRSV cluster present in RSA.

Pepper, Capsicum annuum L., is an economically important crop in Zimbabwe, grown as a spice and vegetable for both the local and export markets. Pepper is susceptible to infection by up to 49 virus species, some of which cause serious yield loss (Hanssen et al. 2010). During tospovirus surveys conducted in January 2015, pepper plants with typical viral symptoms, including plant stunting, leaf chlorosis, mottling, and curling were observed at a farm in Goromonzi District of Zimbabwe. Visual observations estimated the symptoms incidence at 15%. In addition, there was a high incidence of Frankliniella occidentalis and Myzus persicae in the field. Ten symptomatic and four nonsymptomatic leaves were tested using LoeweFast Lateral Flow Kits (Loewe Biochemica GmbH, Germany) specific to tospoviruses and Potato virus Y (PVY). The tospovirus kit was specific to Tomato spotted wilt virus (TSWV), Tomato chlorotic spot virus (TCSV), and Groundnut ringspot virus (GRSV). Eight and 10 of the symptomatic leaves tested positive for tospoviruses and PVY, respectively, while all the symptomless leaves tested negative for both viruses. Plant sap from virus-infected leaves was imprinted onto FTA Whatman cards (Whatman International, USA), air dried, and shipped to the University of KwaZulu-Natal Plant Virology Laboratory (Pietermaritzburg, South Africa) for further diagnostic tests. Total nucleic acid was eluted from the FTA cards following manufacturer’s instructions. The presence of TSWV and PVY was further confirmed by reverse transcription (RT)-PCR using the TSWV nucleocapsid protein (TSWV 722: GCTGGAGCTAAGTATAGCAGC and TSWV 723: CACAAGGCAAAGACCTTGAG) and the PVY viral protein genome-linked (VPf-F: GAATYCAAGCHYTRAAGTTTCG and VPg-R: GCTTCATGYTCYACHTCCTG) gene-specific primers. The respective reverse primers and the RevertAid First Strand cDNA Synthesis Kit (Thermo Scientific, USA) were used for cDNA synthesis. PCR was performed using KAPA2G Fast HotStart ReadyMix (Kapa Biosystems, USA) and the respective primer pairs for the viruses. These primers amplify 620 bp of the TSWV nucleocapsid gene (Adkins and Rosskopf 2002) and 547 bp of the PVY viral protein genome-linked gene (Ben Khalifa et al. 2009). Amplicons of the expected sizes obtained from symptomatic leaves only, were purified using QiaQuick Gel Extraction Kit (Qiagen, Germany) and directly sequenced at Inqaba Biotech (Pretoria, South Africa). The TSWV isolate sequence (Accession Number KU671049) shared 99% identity with sequences of pepper-infecting isolates from Turkey (KM379142), Serbia (KC182566), and South Africa (DQ834847), while the PVY isolate sequence (KU695465) shared at least 89% identity with sequences of pepper-infecting isolates from France (KF670594), The Netherlands (EF638905), and South Africa (KF770839). To our knowledge, this is the first record of a mixed infection of pepper by TSWV and PVY in Zimbabwe. This is also the first time both pepper-infecting viruses have been sequenced in Zimbabwe. Given the economic and nutritional importance of pepper in Zimbabwe, the occurrence of both viruses on pepper is likely to negatively affect yield and farmers’ income. There is need for further surveys to ascertain how widespread this phenomenon is and determine its economic impact on pepper production in Zimbabwe.

In Zimbabwe, garlic (Allium sativum L.) and leek (Allium ampeloprasum L.) are minor crops grown as herbs and spices by a few farmers. Annual output is estimated at 200 tonnes for garlic and 160 tonnes for leek. Since both crops are considered resistant to pests and diseases, most farmers do not implement crop protection measures during production. Iris yellow spot virus (IYSV; genus Tospovirus, family Bunyaviridae) is an important emerging pathogen of Alliums worldwide (Bag et al. 2015; Pappu et al. 2009). During a tospovirus disease survey in July 2015, garlic and leek plants displaying suspected IYSV symptoms were found at three farms in Goromonzi, Mutasa, and Nyanga districts of Zimbabwe. The symptoms consisted of straw-colored, spindle-shaped spots with poorly defined ends on leeks, and diamond-shaped lesions with green chlorotic islands on garlic. These coalesced to form large, brown, necrotic patches on the leaves. Disease incidence estimated by visual observations was 25% in leek and up to 60% in garlic. There was high incidence of Thrips tabaci on all farms surveyed. Fifteen symptomatic and six healthy samples from the basal and middle portions of young leaves collected at each farm were preserved in RNAlater solution (Ambion, Foster City, CA, USA). IYSV presence was confirmed by double antibody sandwich enzyme-linked immunosorbent assay (DAS-ELISA) using an IYSV kit (Loewe Biochemica GmbH, Sauerlach, Germany). All symptomatic samples tested were IYSV-positive, while the healthy samples were negative. The pathogen was further confirmed by reverse transcription polymerase chain reaction (RT-PCR) using the nucleocapsid protein (N) gene-specific primers IYSV-NCP2_F (5′-GGCGGTCCTCTCATCTTACTG-3′) and IYSV-NCP2_R (5′-GAAGTTCCAGGAGTGCATTTAGTC-3′) (Lee et al. 2011). Firstly, total RNA was extracted using Quick-RNA MiniPrep Kit (Zymo Research, Irvine, CA, USA) according to manufacturer’s instructions. Then, first strand cDNA was synthesized using the RevertAid First Strand cDNA Synthesis Kit (Thermo Scientific, Waltham, MA, USA), followed by PCR using KAPA2G Fast HotStart ReadyMix Kit (KAPA Biosystems, Roche, Basel, Switzerland), and the primers IYSV-NCP2_F and IYSV-NCP2_R. Amplicons of 236 bp, obtained in IYSV-positive samples and not in healthy controls, were excised and purified from agarose gel using Qiagen Gel Extraction Kit (Hilden, Germany) prior to cloning into the pCR2.1 vector of TOPO-TA Cloning kit (Invitrogen, Carlsbad, CA, USA). Three positive clones were sequenced using M13 forward and reverse primers at Inqaba Biotechnical Industries (Pty) Ltd (Pretoria, South Africa). The consensus sequence of the Zimbabwean IYSV garlic isolate (GenBank Accession No. KT732272) shared 97% nucleotide identity with the corresponding region of onion-infecting isolates originating from South Australia (KJ769188), Mexico (JX946658) and western USA (DQ233475), while the Zimbabwean leek isolate (KT732273) shared 99% nucleotide identity with the onion-infecting IYSV isolate from Zimbabwe (KT271469). To our knowledge, this is the first report of natural infection of garlic and leek by IYSV in Zimbabwe. Despite garlic and leek being minor crops, IYSV occurrence on these crops shows the expanding host range of the pathogen in Zimbabwe. Both garlic and leek are commonly intercropped with other vegetables and ornamental plants and could provide a “green bridge” for IYSV survival. There is need to monitor IYSV disease impact on Allium spp. in the country.

Onion (Allium cepa L.), an important food and cash crop in Zimbabwe, is prone to attack by several biotic agents causing up to 60% yield loss (Birithia et al. 2011). Iris yellow spot virus (IYSV) (genus Tospovirus, family Bunyaviridae) in Africa has been reported in Reunion and South Africa (Pappu et al. 2009), Kenya and Uganda (Birithia et al. 2011), Mauritius (Lobin et al. 2010), and Egypt (Hafez et al. 2012). Bulb onion plants, displaying symptoms typical of IYSV infection, were observed at two Harare farms during tospovirus disease surveys conducted in November 2014. These symptoms consisted of diamond-shaped, irregular chlorotic and necrotic lesions with green islands on the scapes. Disease incidence was estimated at 35% and 50% at the two farms. IYSV infection was confirmed when 18 symptomatic leaf samples collected from both farms were tested by double-antibody sandwich enzyme-linked immunosorbent assay using an IYSV kit supplied by LOEWE Biochemica GmbH (Germany) according to the manufacturer’s instructions. Twelve samples were positive for the virus. IYSV-infected leaf samples, together with healthy onion leaves, were subsequently collected and preserved in RNAlater (Life Technologies, USA). Total RNAs were extracted from both symptomatic and healthy onion leaves using Quick-RNA MiniPrep Kit (Zymo Research, USA) according to manufacturer’s instructions. First-strand cDNA was synthesized using RevertAid First Strand cDNA Synthesis Kit (Thermo Scientific, USA); followed by PCR using KAPA2G Fast HotStart ReadyMix Kit (KAPA Biosystems, USA), the forward primer IYSV-NCP2_F (5′-GGCGGTCCTCTCATCTTACTG-3′) and the reverse primer IYSV-NCP2_R (5′-GAAGTTCCAGGAGTGCATTTAGTC-3′) specific to the IYSV nucleocapsid (N) gene (Lee et al. 2011). The expected 236-bp amplicons, observed only from symptomatic samples, were excised and purified from agarose gel using Qiagen Gel Extraction Kit (Germany) prior to cloning into the pCR2.1 vector of TOPO-TA Cloning kit (Life Technologies, USA). Four positive clones were sequenced using M13 forward and reverse primers at Inqaba Biotechnical Industries (Pty) Ltd (Pretoria, RSA). The consensus sequence of the Zimbabwean IYSV (isolate 5c_Harare; GenBank Accession No. KT271469) shares nucleotide and protein sequence identities of 96 to 97% with corresponding region of IYSV isolates originating from Australia (KJ769187), Brazil (AF067070), Mexico (JX946658) and South Africa (EF579801). To our knowledge, this is the first report of IYSV infecting onion in Zimbabwe. The occurrence of IYSV in Zimbabwe underscores the need for systematic surveys to assess its incidence and its host range in order to develop effective disease management strategies.

Virus infections on cucurbits often result in substantial losses. Surveys were conducted throughout the province of KwaZulu-Natal (KZN) in the Republic of South Africa (RSA) during the 2011–2013 growing seasons to identify cucurbit-infecting viruses. Viruses were detected on sampled leaves displaying virus-like symptoms using double antibody sandwich enzyme-linked immunosorbent assay (DAS-ELISA) and reverse transcription polymerase chain reaction (RT-PCR). The phylogenetic relationships of all detected viruses were also studied. Cucumber mosaic virus (CMV), Beet pseudo-yellows virus (BPYV), Zucchini yellow mosaic virus (ZYMV), Moroccan watermelon mosaic virus (MWMV) and a Polerovirus were detected at an incidence of 3.48%, 10%, 13.04%, 48.70% and 41.67% respectively. Phylogenetic analyses identified CMV isolates as members of the Subgroup IA of the CMV lineage and ZYMV isolates as members of the subgroups AI and AII of the of ZYMV lineage. MWMV isolates formed a distinct clade within the Southern African group of the MWMV lineage. Polerovirus isolates were identified as Pepo aphid-borne yellows virus (PABYV) based on the sequence similarity and phylogenetic analyses. The information generated from this study will contribute towards the development of effective management strategies against viruses infecting cucurbits in KZN.

Plant viruses are a major limiting factor of cucurbit production in the Republic of South Africa (RSA). Current methods of controlling virus diseases infecting cucurbits are not very effective thus necessitating the need to look for alternative approaches. The aim of this study was to develop baby marrow (Cucurbita pepo L.) plants with multiple resistance to the common Potyviruses infecting cucurbits in the province of KwaZulu-Natal (KZN). Surveys were conducted throughout KZN during the 2011 - 2013 growing seasons to identify cucurbit-infecting viruses. Cucumber mosaic virus (CMV), Beet pseudo yellows virus (BPYV), Zucchini yellows virus (ZYMV), Morrocan watermelon mosaic virus (MWMV), Pepo aphid-borne yellows virus (PABYV) and a distinct tentative species in the genus Potyvirus from the Papaya ringspot virus (PRSV) cluster were the viruses identified using double antibody sandwich enzyme-linked immunosorbent assay and reverse transcription polymerase chain reaction (RT-PCR) and characterized using phylogenetic analyses. Portions of the coat protein gene of the three potyviruses detected in the survey (MWMV, ZYMV and the tentative Potyvirus) were incorporated into a gene construct that was used to transform baby marrow cotyledon explants. Agrobacterium-mediated transformation was used. Resultant putative transgenic baby marrow plants were screened by PCR and resistance was evaluated by challenging plants with inoculum made from a mixture of the selected three Potyviruses. Southern and Northern blot hybridization are still to be performed on putative transgenic plants to confirm the nature of the resistance which is expected to be via post-transcriptional gene silencing (PTGS). The findings of this study will contribute positively to strategies that effectively manage virus diseases in cucurbits in RSA.