Potyviridae

The Potyviridae is the largest family of RNA plant viruses, members of which have single-stranded, positive-sense RNA genomes and flexuous filamentous particles 680–900 nm long and 11–20 nm wide. There are eight genera, distinguished by the host range, genomic features and phylogeny of the member viruses. Genomes range from 8.2 to 11.3 kb, with an average size of 9.7 kb. Most genomes are monopartite but those of members of the genus Bymovirus are bipartite. Some members cause serious disease epidemics in cultivated plants. This is a summary of the International Committee on Taxonomy of Viruses (ICTV) Report on the taxonomy of the Potyviridae, which is available at www.ictv.global/report/ potyviridae.

Cassava brown streak disease (CBSD) has emerged as the most important viral disease of cassava (Manihot esculenta) in Africa and is a major threat to food security. CBSD is caused by two distinct species of ipomoviruses, Cassava brown streak virus and Ugandan cassava brown streak virus, belonging to the family Potyviridae. Previously, CBSD was reported only from the coastal lowlands of East Africa, but recently it has begun to spread as an epidemic throughout the Great Lakes region of East and Central Africa. This new spread represents a major threat to the cassava-growing regions of West Africa. CBSD-resistant cassava cultivars are being developed through breeding, and transgenic RNA interference-derived field resistance to CBSD has also been demonstrated. This review aims to provide a summary of the most important studies on the aetiology, epidemiology and control of CBSD and to highlight key research areas that need prioritization.

Potato Virus Y (PVY) is a pathogen of economic importance in pepper and other major crop species in the family Solanaceae. Three major PVY strain groups: O, C, and N, have been distinguished on the basis of genome sequencing. In this study, the first full-genome sequence of a PVY isolate (JVW-186) infecting pepper from the province of KwaZulu-Natal, Republic of South Africa is reported. The complete genome sequence of JVW-186 was assembled from overlapping RT-PCR clones using MEGA 5 software. Two ORFs were identified at position 186 and 2915 of the sequence encoding the viral polyprotein and the frameshift translated protein P3NPIPO, respectively. RDP4 software confirmed three recombination breakpoints at position 343, 1365, and 9308 of the sequence. At each recombination event, a 1,021-bp fragment at the 50 end in the region of the P1/HC-Pro protein and a 392-bp fragment in the region of the coat protein shared a high sequence similarity of 91.8 and 98.89 % to the potato borne PVYC isolate PRI-509 and the PVYO isolate SASA-110, respectively. The non-recombinant fragment 1 (342-bp) clustered within the C clade of PVY isolates; however, the large 7,942-bp fragment 3 did not cluster within any of the clades. This suggests the possibility of a PVY isolate that has evolved due to the dynamics of selection pressure or the likelihood of an ancestral PVY strain.

Arracacha mottle virus (AMoV) is the only potyvirus reported to infect arracacha (Arracacia xan-thorrhiza) in Brazil. Here, the complete genome sequence of an isolate of AMoV was determined to be 9,630 nucleotides in length, excluding the 3 0 poly-A tail, and encoding a polyprotein of 3,135 amino acids and a putative P3N-PIPO protein. Its genomic organization is typical of a member of the genus Potyvirus, containing all conserved motifs. Its full genome sequence shared 56.2 % nucleotide identity with sunflower chlorotic mottle virus and verbena virus Y, the most closely related viruses.

The Potyviridae is the largest family of RNA plant viruses, members of which have single-stranded, positive-sense RNA genomes and flexuous filamentous particles 680–900 nm long and 11–20 nm wide. There are eight genera, distinguished by the host range, genomic features and phylogeny of the member viruses. Genomes range from 8.2 to 11.3 kb, with an average size of 9.7 kb. Most genomes are monopartite but those of members of the genus Bymovirus are bipartite. Some members cause serious disease epidemics in cultivated plants. This is a summary of the International Committee on Taxonomy of Viruses (ICTV) Report on the taxonomy of the Potyviridae, which is available at www.ictv.global/report/ potyviridae.

In sub-Saharan Africa, maize is a staple food and key determinant of food security for smallholder farming communities. Pest and disease outbreaks are key constraints to maize productivity. In September 2011, a serious disease outbreak, later diagnosed as maize lethal necrosis (MLN), was reported on maize in Kenya. The disease has since been confirmed in Rwanda and the Democratic Republic of Congo, and similar symptoms have been reported in Tanzania, Uganda, South Sudan, and Ethiopia. In 2012, yield losses of up to 90% resulted in an estimated grain loss of 126,000 metric tonnes valued at $52 million in Kenya alone. In eastern Africa, MLN was found to result from co-infection of maize with Maize chlorotic mottle virus (MCMV) and Sugarcane mosaic virus (SCMV), although MCMV alone appears to cause significant crop losses. We summarize here the results of collaborative research undertaken to understand the biology and epidemiology of MLN in East Africa and to develop disease management...

Resumen (es_ES)
Los potyvirus son uno de los grupos de virus más limitantes en los cultivos de papa (Solanum tuberosum y S. phureja) en el mundo, siendo PVY, PVV y PVA las especies más prevalentes. En este trabajo se evaluó la presencia de estos potyvirus en cuatro lotes de S. tuberosum cv. Diacol-Capiro y cuatro lotes de S. phureja cv. Criolla-Colombia ubicados en el oriente de Antioquia, analizando la cápside viral mediante RT-PCR/secuenciación Sanger y secuenciación de nueva generación (NGS) para S. tuberosum. Los resultados indicaron la ocurrencia de los potyvirus PVY y PVV en las muestras de S. tuberosum y S. phureja, respectivamente; siendo detectadas mediante cebadores específicos la presencia de tres diferentes cepas de PVY (PVYN, PVYNTN y PVYO) en la región de estudio. Este hallazgo fue confirmado por NGS, obteniendo las secuencias completas de los genomas de estas tres cepas, lo que representa el primer reporte de PVYO en Colombia. Por su parte, los análisis de secuencias de la región CP de PVV indicaron niveles de identidad superiores a 99% con respecto a aislamientos del linaje PVVPhu reportado previamente en Antioquia. Estos hallazgos evidencian la necesidad de ajustar los sistemas de detección de virus en los programas de certificación de tubérculo-semilla de papa adelantados en el país.
Resumen (en_US)
Potyviruses are one of the most limiting viruses for the potato (Solanum tuberosum and S. phureja) production worldwide, being PVY, PVV and PVA the most prevalent species. In this work, we tested the presence of these viruses in four commercial S. tuberosum cv. Diacol-Capiro and S. phureja cv. Criolla-Colombia plots in eastern Antioquia using RT-PCR and Sanger sequencing of the coat protein (CP) region, as well as next generation sequencing (NGS) for S. tuberosum samples. Our results revealed the presence of a PVV strain infecting S. phureja with high sequence identity (>99%) to lineage PVVPhu previously reported in Antioquia. Three strains of PVY (PVYN, PVYNTN and PVYO) were found to infect S. tuberosum. The presence of these three PVY strains was confirmed by NGS, allowing the assembly of their complete genomes. This is the first report of the full genome sequence of PVYo strain in Colombia. These findings highlight the need to adjust the tuber-seed certification programs currently implemented in the country.

Pepper, Capsicum annuum L., is an economically important crop in Zimbabwe, grown as a spice and vegetable for both the local and export markets. Pepper is susceptible to infection by up to 49 virus species, some of which cause serious yield loss (Hanssen et al. 2010). During tospovirus surveys conducted in January 2015, pepper plants with typical viral symptoms, including plant stunting, leaf chlorosis, mottling, and curling were observed at a farm in Goromonzi District of Zimbabwe. Visual observations estimated the symptoms incidence at 15%. In addition, there was a high incidence of Frankliniella occidentalis and Myzus persicae in the field. Ten symptomatic and four nonsymptomatic leaves were tested using LoeweFast Lateral Flow Kits (Loewe Biochemica GmbH, Germany) specific to tospoviruses and Potato virus Y (PVY). The tospovirus kit was specific to Tomato spotted wilt virus (TSWV), Tomato chlorotic spot virus (TCSV), and Groundnut ringspot virus (GRSV). Eight and 10 of the symptomatic leaves tested positive for tospoviruses and PVY, respectively, while all the symptomless leaves tested negative for both viruses. Plant sap from virus-infected leaves was imprinted onto FTA Whatman cards (Whatman International, USA), air dried, and shipped to the University of KwaZulu-Natal Plant Virology Laboratory (Pietermaritzburg, South Africa) for further diagnostic tests. Total nucleic acid was eluted from the FTA cards following manufacturer’s instructions. The presence of TSWV and PVY was further confirmed by reverse transcription (RT)-PCR using the TSWV nucleocapsid protein (TSWV 722: GCTGGAGCTAAGTATAGCAGC and TSWV 723: CACAAGGCAAAGACCTTGAG) and the PVY viral protein genome-linked (VPf-F: GAATYCAAGCHYTRAAGTTTCG and VPg-R: GCTTCATGYTCYACHTCCTG) gene-specific primers. The respective reverse primers and the RevertAid First Strand cDNA Synthesis Kit (Thermo Scientific, USA) were used for cDNA synthesis. PCR was performed using KAPA2G Fast HotStart ReadyMix (Kapa Biosystems, USA) and the respective primer pairs for the viruses. These primers amplify 620 bp of the TSWV nucleocapsid gene (Adkins and Rosskopf 2002) and 547 bp of the PVY viral protein genome-linked gene (Ben Khalifa et al. 2009). Amplicons of the expected sizes obtained from symptomatic leaves only, were purified using QiaQuick Gel Extraction Kit (Qiagen, Germany) and directly sequenced at Inqaba Biotech (Pretoria, South Africa). The TSWV isolate sequence (Accession Number KU671049) shared 99% identity with sequences of pepper-infecting isolates from Turkey (KM379142), Serbia (KC182566), and South Africa (DQ834847), while the PVY isolate sequence (KU695465) shared at least 89% identity with sequences of pepper-infecting isolates from France (KF670594), The Netherlands (EF638905), and South Africa (KF770839). To our knowledge, this is the first record of a mixed infection of pepper by TSWV and PVY in Zimbabwe. This is also the first time both pepper-infecting viruses have been sequenced in Zimbabwe. Given the economic and nutritional importance of pepper in Zimbabwe, the occurrence of both viruses on pepper is likely to negatively affect yield and farmers’ income. There is need for further surveys to ascertain how widespread this phenomenon is and determine its economic impact on pepper production in Zimbabwe.

Soybean mosaic virus (SMV) and peanut mottle virus (PMV) are two potyviruses that cause yield losses and reduce seed quality in infested soybean (Glycine max (L.) Merr.) fields throughout the world. Rsv1 and Rpv1 are genes that provide soybean with resistance to SMV and PMV, respectively. Isolating and characterizing Rsv1 and Rpv1 are instrumental in providing insight into the molecular mechanism of potyvirus recognition in soybean. A population of 1056 F2 individuals from a cross between SMV- and PMV-resistant line PI 96983 (Rsv1 and Rpv1) and the susceptible cultivar 'Lee 68' (rsv1 and rpv1) was used in this study. Disease reaction and molecular-marker data were collected to determine the linkage relationship between Rsv1, Rpv1, and markers that target candidate disease-resistance genes. F2 lines showing a recombination between two of three Rsv1-flanking microsatellite markers were selected for fine mapping. Over 20 RFLP, RAPD, and microsatellite markers were used to map 3...

In sub-Saharan Africa, maize is a staple food and key determinant of food security for smallholder farming communities. Pest and disease outbreaks are key constraints to maize productivity. In September 2011, a serious disease outbreak, later diagnosed as maize lethal necrosis (MLN), was reported on maize in Kenya. The disease has since been confirmed in Rwanda and the Democratic Republic of Congo, and similar symptoms have been reported in Tanzania, Uganda, South Sudan, and Ethiopia. In 2012, yield losses of up to 90% resulted in an estimated grain loss of 126,000 metric tonnes valued at $52 million in Kenya alone. In eastern Africa, MLN was found to result from co-infection of maize with Maize chlorotic mottle virus (MCMV) and Sugarcane mosaic virus (SCMV), although MCMV alone appears to cause significant crop losses. We summarize here the results of collaborative research undertaken to understand the biology and epidemiology of MLN in East Africa and to develop disease management...

The RNA silencing pathway mediated by small interfering RNAs (siRNAs) plays an important antiviral role in eukaryotes. To counteract this defense barrier, a large number of plant viruses express proteins with RNA silencing suppression activity. Recently, it was reported that the ipomovirus Cucumber vein yellowing virus (CVYV), which lacks the typical silencing suppressor of members of the family Potyviridae, i.e., HCPro, has a duplicated P1 coding sequence and that the downstream P1 copy, named P1b, has silencing suppression activity. In this study, we provide experimental evidence that P1b is a serine protease that self-cleaves at its C terminus but that its proteolytic activity is not essential for silencing suppression. In contrast, a putative zinc finger and a conserved basic motif in the N-terminal region of the protein are required for efficient silencing suppression. In vitro gel filtration-fast protein liquid chromatography and in vivo bimolecular fluorescence complementation assays showed that P1b binds itself to form oligomeric structures and that the zinc finger-like motif is essential for the self interaction. Moreover, we observed that CVYV P1b forms complexes with synthetic siRNAs, and this ability correlated with both silencing suppression activity and enhancement of Potato virus X pathogenicity in a mutational analysis. Together, these results suggest that CVYV P1b resembles potyviral HCPro and other viral proteins in interfering RNA silencing by preventing siRNA loading into the RNA-induced silencing complex.