Bunyaviridae

Oropouche virus (OROV), genus Orthobunyavirus, family Bunyaviridae, is an important cause of human illness in tropical South America. Herein, we report the isolation, complete genome sequence, genetic characterization, and phylogenetic analysis of an OROV species reassortant, Madre de Dios virus (MDDV), obtained from a sick monkey (Cebus olivaceus Schomburgk) collected in a forest near Atapirire, a small rural village located in Anzoategui State, Venezuela. MDDV is one of a growing number of naturally occurring OROV species reassortants isolated in South America and was known previously only from southern Peru.

A combination of interferon-beta (IFN-beta) and all-trans retinoic acid (IFN/RA) induces tumor cell apoptosis via some unknown mechanisms. Apoptosis is a gene-directed process that limits the proliferation of undesired cells. Several genes are required to regulate cell death in the higher-order animals. Earlier, we employed a gene expression knockout technique to isolate cell death-related genes. A novel gene, the gene associated with retinoid-interferon-induced mortality-19 (GRIM-19), was found to be essential for tumor cell death induced by IFN/RA. Here, we describe the development and characterization of three monoclonal antibodies (mAbs) against GRIM-19. GRIM-19 is present in the nucleus and cytoplasm. Its expression is induced by the IFN/RA combination. We also show that GRIM-19 inhibits the cell-transforming property of viral oncogenic protein viral IFN regulatory factor-1 (vIRF-1) via a physical interaction. mAbs developed in this study should be useful for studying the other...

Pepper, Capsicum annuum L., is an economically important crop in Zimbabwe, grown as a spice and vegetable for both the local and export markets. Pepper is susceptible to infection by up to 49 virus species, some of which cause serious yield loss (Hanssen et al. 2010). During tospovirus surveys conducted in January 2015, pepper plants with typical viral symptoms, including plant stunting, leaf chlorosis, mottling, and curling were observed at a farm in Goromonzi District of Zimbabwe. Visual observations estimated the symptoms incidence at 15%. In addition, there was a high incidence of Frankliniella occidentalis and Myzus persicae in the field. Ten symptomatic and four nonsymptomatic leaves were tested using LoeweFast Lateral Flow Kits (Loewe Biochemica GmbH, Germany) specific to tospoviruses and Potato virus Y (PVY). The tospovirus kit was specific to Tomato spotted wilt virus (TSWV), Tomato chlorotic spot virus (TCSV), and Groundnut ringspot virus (GRSV). Eight and 10 of the symptomatic leaves tested positive for tospoviruses and PVY, respectively, while all the symptomless leaves tested negative for both viruses. Plant sap from virus-infected leaves was imprinted onto FTA Whatman cards (Whatman International, USA), air dried, and shipped to the University of KwaZulu-Natal Plant Virology Laboratory (Pietermaritzburg, South Africa) for further diagnostic tests. Total nucleic acid was eluted from the FTA cards following manufacturer’s instructions. The presence of TSWV and PVY was further confirmed by reverse transcription (RT)-PCR using the TSWV nucleocapsid protein (TSWV 722: GCTGGAGCTAAGTATAGCAGC and TSWV 723: CACAAGGCAAAGACCTTGAG) and the PVY viral protein genome-linked (VPf-F: GAATYCAAGCHYTRAAGTTTCG and VPg-R: GCTTCATGYTCYACHTCCTG) gene-specific primers. The respective reverse primers and the RevertAid First Strand cDNA Synthesis Kit (Thermo Scientific, USA) were used for cDNA synthesis. PCR was performed using KAPA2G Fast HotStart ReadyMix (Kapa Biosystems, USA) and the respective primer pairs for the viruses. These primers amplify 620 bp of the TSWV nucleocapsid gene (Adkins and Rosskopf 2002) and 547 bp of the PVY viral protein genome-linked gene (Ben Khalifa et al. 2009). Amplicons of the expected sizes obtained from symptomatic leaves only, were purified using QiaQuick Gel Extraction Kit (Qiagen, Germany) and directly sequenced at Inqaba Biotech (Pretoria, South Africa). The TSWV isolate sequence (Accession Number KU671049) shared 99% identity with sequences of pepper-infecting isolates from Turkey (KM379142), Serbia (KC182566), and South Africa (DQ834847), while the PVY isolate sequence (KU695465) shared at least 89% identity with sequences of pepper-infecting isolates from France (KF670594), The Netherlands (EF638905), and South Africa (KF770839). To our knowledge, this is the first record of a mixed infection of pepper by TSWV and PVY in Zimbabwe. This is also the first time both pepper-infecting viruses have been sequenced in Zimbabwe. Given the economic and nutritional importance of pepper in Zimbabwe, the occurrence of both viruses on pepper is likely to negatively affect yield and farmers’ income. There is need for further surveys to ascertain how widespread this phenomenon is and determine its economic impact on pepper production in Zimbabwe.

Oropouche virus (OROV), genus Orthobunyavirus, family Bunyaviridae, is an important cause of human illness in tropical South America. Herein, we report the isolation, complete genome sequence, genetic characterization, and phylogenetic analysis of an OROV species reassortant, Madre de Dios virus (MDDV), obtained from a sick monkey (Cebus olivaceus Schomburgk) collected in a forest near Atapirire, a small rural village located in Anzoategui State, Venezuela. MDDV is one of a growing number of naturally occurring OROV species reassortants isolated in South America and was known previously only from southern Peru.

Aims Severe fever with thrombocytopenia syndrome (SFTS) is an emerging tick-borne infectious disease. SFTS is epidemic in Asia, and its fatality rate is around 30% in Japan. The causative virus severe fever with thrombocytopenia syndrome virus (SFTSV) is a phlebovirus of the family Phenuiviridae (the order Bunyavirales). Although effective treatments are required, there are no antiviral agents currently approved for clinical use. Ribavirin and favipiravir were examined for their anti-SFTSV activity and found to be selective inhibitors of SFTSV replication in vitro. However, their activity was not sufficient. Therefore, it is mandatory to identify novel compounds active against SFTSV. To this end, we have established a safe and rapid assay system for screening selective inhibitors of SFTSV. Methods The virus was isolated from SFTS patients treated in Kagoshima University Hospital. Vero cells were infected with SFTSV and incubated in the presence of various concentrations of test comp...

Hantaviruses are the causative agents of hantavirus pulmonary syndrome in humans in the Americas; The primary reservoirs are in the rodents of the subfamily Sigmodontinae. In South America, cases of hantavirus pulmonary syndrome caused by numerous viral genotypes have been diagnosed. In Colombia, different serological studies have reported the circulation of hantavirus in humans and rodents. These viruses act in an intimate association with a rodent species that serves as a reservoir and have a distribution around the wild rodent, being limited to a specific geographic region. In South America, the first HPS-associated hantavirus was described in 1993 in Brazil and was called Juquitiva and from 1993 to 2012, more than 1400 cases had been identified in Brazil. This syndrome should be suspected in all patients with respiratory distress syndrome of unclear etiology, in areas endemic for the disease, especially if accompanied by fever, marked leukocytosis and thrombocytopenia and bilateral interstitial infiltrates. Hemorrhagic febrile syndrome has not yet been described in the Americas. There are no clinical or laboratory signs that are pathognomonic of hantavirus infection. The treatment is based on adequate hydration, use of antipyretics and anti-inflammatories and patients with signs of severity should establish a more aggressive management. Triage is indispensable, patients with co-morbidities have a higher mortality risk and therefore should be hospitalized. Future research in Colombia should be directed to multidisciplinary studies that include viral isolation, different clinical forms of case presentation, epidemiological differences, risk factors, and taxonomy of viruses and rodents.

Aedes albopictuswas introduced into the United States in used tires in 1985. Its successful colonization of the upper Midwest has potential to alter the current epidemiology of bunyaviruses that circulate in the region. It is permissive for the replication of several arboviruses, including La Crosse (LACV) and Jamestown Canyon (JCV) bunyaviruses. In this study, we demonstrate the ability of LACV and JCV to coinfect Ae. albopictus mosquitoes and to form all six possible reassortant genotypes. All reassortant viruses infect Ae. albopictus orally and can be transmitted to suckling mice. All reassortants are neurovirulent in mice. However, reassortant viruses carrying the LACV M segment in the foreign genetic background of JCV are more neuroinvasive than JCV, or any other reassortant genotype. In addition, these reassortants can replicate in gerbils and infect Ae. triseriatus, characteristics of LACV, but not JCV. Because Ae. albopictus is spreading into new geographic areas and feeds o...

European mountain ash ringspot-associated virus (EMARAV) was recently characterized from mountain ash (rowan) (Sorbus aucuparia) in Germany. The virus belongs tentatively to family Bunyaviridae but is not closely related to any classified virus. How commonly EMARAV occurs in ringspot disease (EMARSD) affected mountain ash trees was not reported and was investigated here. Virus-specific detection tools such as reverse transcription-polymerase chain reaction and dot blot hybridization using digoxigenin-labeled RNA probes were developed to test 73 mountain ash trees including 16 trees with no virus-like symptoms from 16 districts in Finland and Viipuri, Russia. All trees were infected with EMARAV. Hence, EMARAV is associated with EMARSD and can also cause latent infections in mountain ash. Symptom expression and the variable relative concentrations of viral RNA detected in leaves showed no correlation. Infectious EMARAV was detected also in dormant branches of trees in winter. Subseque...

The entire M RNA segment of the phlebovirus Rift Valley fever virus (RVFV) has been molecularly cloned and the complete nucleotide sequence determined. The RNA is 3884 nucleotides in length, corresponding to a molecular weight of 1.38 × 106, having a base composition of 27.3% A, 25.4% G, 27.2% U, and 20.1% C. Sequences present at the 3′ and 5′ termini of the molecule are largely complementary for some 51 residues and can form a stable duplex structure when the potential secondary structure of the entire molecule is considered. A single major open reading frame, capable of encoding 1206 amino acids (131,845 Da), was found in the viral-complementary sequence (“positive” polarity). Amino-terminal amino acid sequencing of the purified viral glycoproteins G1 and G2 allowed for the positioning of the coding sequences for these polypeptides within this major open reading frame in the following orientation with respect to the genomic M RNA: 3′-G2-G1–5′. From the predicted amino acid composition of the two mature viral glycoproteins, both were found to have a high cysteine content (G2, 6%; G1, 5%). Sequences within the open reading frame capable of encoding up to 23,000 Da of polypeptide were found in addition to those required for the viral glycoproteins. The potential contribution of these sequences to the coding capacity of the M RNA, viral protein processing, and intracellular protein distribution is discussed.

Schmallenberg virus (SBV), an arbovirus within the family Bunyaviridae, represents a ruminant pathogen that has caused epidemic abortion and birth of malformed or stillborn animals in many European countries since August 2011. Histological and immunohistochemical analysis of peripheral tissues of SBV-infected animals, including lymphoid tissues, endocrine organs and tissues of the gastrointestinal, urogenital and respiratory system, were analyzed in order to elucidate the occurrence of SBV-associated changes and the presence of viral antigens and RNA. Twenty calves and 12 lambs as well as age-matched controls were included in this study. Significant muscular hypoplasia with fatty replacement was noted in affected calves and lambs. In addition, hepatocellular degeneration with lymphohistiocytic inflammation, interstitial fibrosis and biliary hyperplasia was detected in calves. All animals lacked SBV-positive cells in the peripheral organs. These observations resemble those found in A...

Oropouche virus (OROV), genus Orthobunyavirus, family Bunyaviridae, is an important cause of human illness in tropical South America. Herein, we report the isolation, complete genome sequence, genetic characterization, and phylogenetic analysis of an OROV species reassortant, Madre de Dios virus (MDDV), obtained from a sick monkey (Cebus olivaceus Schomburgk) collected in a forest near Atapirire, a small rural village located in Anzoategui State, Venezuela. MDDV is one of a growing number of naturally occurring OROV species reassortants isolated in South America and was known previously only from southern Peru.

Reproductive disorders in dairy cattle have been noted to be common in urban and peri-urban dairy production system in Ethiopia. The available reports on the causes of these disorders, however, are not conclusive. A case-control study was designed to investigate the possible association of major reproductive disorders in dairy cattle with exposure status to bovine herpesvirus-1 (BHV-1), bovine viral diarrhea virus (BVDV) and Schmallenberg virus (SBV). Cows with history of abortion/stillbirth were considered as cases (n=204) while, those cows with no such history were taken as control (n=359). The serological screening tests used for all the three viruses were blocking enzyme linked immunosorbent assays (B-ELISAs). Of the total 563 samples tested 58.4%, 43.8% and 32.9% were positive for SBV, BHV-1 and BVDV, respectively. Significant difference between cases and controls were noted for SBV (p=0.026) and BHV-1 exposures (p<0.001). The difference noted for BVDV serostatus was not sig...

The Mapputta group comprises antigenically related viruses indigenous to Australia and Papua New Guinea that are included in the family Bunyaviridae but not currently assigned to a specific genus. We determined and analyzed the genome sequences of five Australian viruses isolated from mosquitoes collected during routine arbovirus surveillance in Western Australia (K10441, SW27571, K13190, and K42904) and New South Wales (12005). Based on matching sequences of all three genome segments to prototype MRM3630 of Trubanaman virus (TRUV), NB6057 of Gan Gan virus (GGV), and MK7532 of Maprik virus (MPKV), isolates K13190 and SW27571 were identified as TRUV, 12005 as GGV, and K42904 as a Mapputta group virus from Western Australia linking GGV and MPKV. The results confirmed serum neutralization data that had linked SW27571 to TRUV. The fifth virus, K10441 from Willare, was most closely related to Batai orthobunyavirus, presumably representing an Australian variant of the virus. Phylogenetic ...

Adult golden hamsters inoculated subcutaneously with either of two sandfly fever group viruses, Punta Toro and Gabek Forest (Phlebovirus, Bunyaviridae), developed a fulminating fatal illness characterized by hepatic and splenic necrosis and interstitial pneumonitis. Most animals died within three days after infection; this was accompanied by high levels of viremia. Necropsy and histopathologic examination of the infected animals revealed pathologic changes involving multiple organs that resembled those described in Rift Valley fever. These two hamster-phlebovirus systems may serve as alternative animal models for Rift Valley fever and should be useful in studying the pathogenesis of severe phlebovirus infection and for testing potential therapeutic agents.