ANTIMICROBIAL AGENTS AND CHEMOTHERAPY, Feb. 1994, p. 275-281 Vol. 38, No. 2 0066-4804/94/$04.00+0 Copyright (C 1994, American Society for Microbiology Identification of a Mutation at Codon 65 in the IKKK Motif of Reverse Transcriptase That Encodes Human Immunodeficiency Virus Resistance to 2',3'-Dideoxycytidine and 2',3'-Dideoxy-3'-Thiacytidine ZHENGXIAN GU,' 2 QING GAO,"12 HENGSHENG FANG,"2 HORACIO SALOMON 1,2 MICHAEL A. PARNIAK,1"2 ERWIN GOLDBERG,2 JANET CAMERON,3 AND MARK A. WAINBERGl 2* Lady Davis Institute-Jewish General Hospital' and McGill University AIDS Centre,2 Montreal, Quebec, Canada H3T 1E2, and Glaxo Group Research, Greenford, Middlesex, United Kingdom UB6 OHE3 Received 9 August 1993/Returned for modification 11 October 1993/Accepted 22 November 1993 Variants of the human immunodeficiency virus (HIV) that possess a drug resistance phenotype have been isolated from patients receiving prolonged chemotherapy with nucleoside compounds that antagonize viral reverse transcriptase (RT) activity (7, 18, 29, 32). Resistant variants of HIV can also be selected in tissue culture if concentrations of antiviral drugs in the medium are gradually increased (11, 17). HIV resistance against nonnucleoside antagonists of viral RT has also been demonstrated (24, 27). Recent reports suggest that the appearance of drug-resistant viruses in patients undergoing prolonged therapy may be predictive of clinical progression, although it is still unclear whether the emergence of viral drug resistance is casually related to treatment failure (16, 22, 23, 34). Nucleoside antagonists of the viral RT act as chain terminators of proviral DNA synthesis (8). The RT of HIV-1 is known to be error prone, and mutations occur throughout the viral genome during viral replication (26, 28, 33). In the case of replication-competent viruses that contain mutations able to confer drug resistance, it is likely that selective amplification of such quasispecies occurs under conditions of drug pressure. A number of mutations have been identified in the pol genes of HIV-1 strains that display resistance to 3'-azido-3'-deoxythymidine (AZT) (19), 2',3'-didexoyinosine (ddl) (12, 32), 2',3'- ated with resistance are located at sites 69, 74, and 184 in the RT coding region (7, 12, 32). ddC has been extensively used to treat HIV-infected individuals who are intolerant to either AZT or ddl, and it has also been used in combination with AZT to try to delay or prevent the emergence of drug resistance (4, 5, 20, 21, 25). The current paper reports on the cloning and sequencing of the RT coding regions of several ddC-resistant variants of HIV that had been generated through tissue culture selection procedures. We have identified a novel mutation at site 65 of the HIV-1 RT that apparently confers resistance against ddC as well as cross-resistance against the (-) enantiomer of 3TC. A lesser degree of cross-resistance was demonstrated for ddl, and none was demonstrated for AZT. (This research was performed by Z. Gu in partial fulfillment of the requirements for a Ph.D. degree, Faculty of Graduate Studies and Research, McGill University, Montreal, Quebec, Canada.) MATERIALS AND METHODS Viruses and cells. We used MT-4 cells to propagate both resistant and wild-type varianits of HIV-1 as described previously (12). Both a ddC-resistant variant that had been selected under conditions of in vitro passage, through gradual increases in ddC concentrations (ranging between 0.75 and 25 ,uM) in the culture medium, and the HIV-IIIB laboratory strain of HIV-1 (kindly supplied by R. C. Gallo, National Institutes of Health, Bethesda, Md.) were examined extensively (9). We also utilized the HxB2-D clone of infectious DNA as a control dideoxy-3'-thiacytidine (3TC) (10, 31), or 2',3'-dideoxycytidine (ddC) (7). In regard to the last compound, mutations associ- * Corresponding author. Mailing address: Lady Davis InstituteJewish General Hospital, 3755 Chemin C6te Ste-Catherine, Montreal, Quebec, Canada H3T 1E2. 275 Downloaded from https://journals.asm.org/journal/aac on 05 October 2023 by 54.196.167.145. The technique of in vitro selection was used to generate variants of the human immunodeficiency virus type 1 that are resistant to 2',3'-dideoxycytidine (ddC). Most of the pol regions of such viruses, including the complete reverse transcriptase open reading frame and portions of flanking protease and integrase genes, were cloned and sequenced, using PCR-based procedures. Mutations were variously detected at amino acid site 65 (Lys-*Arg; AAA--AGA) and at a previously reported codon, site 184 (Met->Val; ATG->GTG). We introduced the site 65 mutation into the pol gene of infectious, cloned HxB2-D DNA by site-directed mutagenesis in order to confirm by viral replication assay the importance of this site in conferring resistance to ddC. The recombinant virus possessed greater than 10-fold resistance against this compound in conmparison with parental HxB2-D. Cross-resistance of approximately 20- and 3-fold, respectively, was detectable against the (-) enantiomer of 2',3'-dideoxy-3'-thiacytidine and 2',3'-dideoxyinosine but not against 3'-azido-3'-deoxythymidine. Combinations of the site 65 and 184 mutations did not yield levels of resistance higher than those attained with the site 65 mutation alone. The presence of the site 65 mutation was confirmed by PCR analysis of peripheral blood mononuclear cells from patients on long-term ddC therapy in 4 of 11 cases tested. Viruses that possessed a ddC resistance phenotype were isolated from subjects whose viruses contained the site 65 mutation in each of four instances. Four of these clinical samples were also demonstrated to possess the Met-184-Wal mutation, and one of them possessed both the Lys-65->Arg and Met-184-Wal substitutions. Direct cloning and sequencing revealed the site 65 mutation in viruses isolated from these individuals. ANTIMICROB. AGENTS CHEMOTHER. GU ET AL. 276 TABLE 1. Oligonucleotides used in this study RTO1 nt.2515-2532 M Iint RT RT01 RT02 65G 65W 65D 65mG RT02 nt. 4256-4236 II RTO1 nt. 2515-2532 5' GTAGGATTCTGTTGACTCAGATTGG GATAAGCTTGGGCCTTATCTATTCCAT CTCCATTTAGTACTGTCTTTTC CTCCATTTAGTACTGTCTTTTT ATGGTAAATGCAGTATACTTCC GCCATAAAGAGAAAAGACAGTAC coordinates 2515-2532a 4256-4236a 2763-2742 2763-2742 2943-2922 2732-2754 a Coordinates for RT01 and RT02 do not include 7 and 6 bases added to the 5' ends of each of these two constructs to serve as recognition sites for EcoRI and w. aaa (Lys65) m. aga (Arg65) RTI 3' RT 65W or 65 G nt. 2763-2742 Sequence (5' >3') Oligonucleotide 65D nt. 2943-2922 FIG. 1. Diagrammatic representation of PCR primer pairs. See Materials and Methods for details. (I) RT01-RT02 primer pair used to amplify the complete RT coding region of HIV-1 and to determine the direction of the mutated MscI fragment which replaced the appropriate fragment of HxB2-D. M, MscI endonuclease enzyme digestion site. (II) RT01-65W and RT01-65G primer pairs used to discriminate wild-type codon from mutated codon Lys-65--*Arg in the RT coding region of HIV-1 and RT01-65D primer pair used to amplify a fragment of the RT coding region as a positive control, which indicates the presence of HIV-1 DNA in the samples. Nucleotide (nt) positions of the primers and wild-type (w) and mutated (m) codon 65 are indicated. for assaying the viral replication (6). Five micromolar ddC (approximately 10-fold greater than the usual 50% effective concentration [EC50] for ddC-sensitive strains) (Sigma Laboratories Inc., St. Louis, Mo.) was routinely utilized for propagation of viruses possessing a ddC resistance phenotype. In certain cases, we passaged viruses that had initially been grown in MT-4 cells onto phytohemagglutinin-prestimulated cord blood lymphocytes (CBL) (donated by the Department of Obstetrics of our hospital) as described previously (12). Subsequently, samples of CBL (5 x 105 cells per ml) were pretreated with concentrations of ddC of between 0 and 50 ,uM for 4 h and inoculated with CBL-grown HIV-1 at a multiplicity of infection of 1.0 (as determined by plaque assay on MT-4 cells), using the same concentration of ddC as used for pretreatment. Fresh medium, containing ddC at appropriate concentrations, was added three times per week along with fresh phytohemagglutinin-prestimulated CBL. Similar analyses were conducted with ddl and 3TC at concentrations of between 0 and 500 puM and with AZT at concentrations of between 0 and 10 puM. Cloning and sequencing. Total cellular DNA was obtained from about 2 x 106 MT-4 cells that had been infected with ddC-resistant variants of HIV-1, which were derived from either HIV-IIIB or a clinical isolate by tissue culture selection as previously described (12). We used PCR-based methodology to amplify a 1,742-bp segment which contained the complete RT coding sequence plus 34 bases of the 3' end of the protease gene and 28 bases of the 5' end of the integrase gene, by using the RTO1 and RT02 primers for the 5' and 3' ends, respectively. The novel oligonucleotides employed in this work were mapped as shown in Fig. 1 and are listed in Table 1. Other oligonucleotides that relate to the site 184 (Met->Val) mutation that confers high-level resistance to 3TC and lowlevel resistance to ddl and ddC have been previously described (12). The RTO1-RT02 primer pair was used to amplify the complete RT coding region and to determine the direction of HindIII, respectively. a mutated MscI fragment, which was inserted into wild-type HxB2-D. The HxB2-D construct utilized in this work is illustrated in Fig. 2; 65G, 65W, RTO1, and 65D were primers utilized to discriminate mutated from wild-type sequences at the Lys-65--Arg codon in the RT coding region of HIV-1, while oligonucleotide 65mG was used in site-directed mu- FIG. 2. Construction of a molecular clone of HIV-1 carrying the Arg-65 mutation. As described in Materials and Methods, mpHIVRT was made by cloning a HincII-KpnI 1.3-kb fragment of the RT coding region in M13mpl8. pHIVpol was constructed by cloning the HincIIEcoRI 2.1-kb fragment of the HIV-1 pol gene into pGEM3-Z. mpHIVRT65 was produced by site-directed mutagenesis to introduce the RT codon 65 mutation (Lys-.Arg) into mpHIVRT. After complete digestion with HinclI and partial digestion with KpnI, a 1.3-kb fragment of pHIVpol was substituted with the appropriate mutated fragment of mpHIVRT65 to yield pHIVpol65. HxB2-D(K65R) was constructed by replacing the MscI 1.9-kb fragment of HxB2-D with the mutated MscI fragment of pHIVpol65. The shaded boxes represent HIV-1 sequences. The line and blank boxes refer to vectors. Abbreviations: H, HincII; K, KpnI; E, EcoRI; M, MscI. Downloaded from https://journals.asm.org/journal/aac on 05 October 2023 by 54.196.167.145. pro M VOL. 38, 1994 HIV RESISTANCE TO ddC 277 tagenesis protocols only. PCRs for amplification were performed as previously described (12). After purification of amplified segments from agarose gels by electroelution, digestions were performed with EcoRI and HindlIl (Pharmacia Fine Chemicals, Montreal, Canada), whose recognition sites were built into the 5' and 3' ends of the PCR primers and (12). Site-directed mutagenesis. Figure 2 illustrates the construction of mutated HxB2-D. Briefly, the codon 65 (Lys->Arg) mutation of the RT was introduced into wild-type HxB2-D as described previously for the site 184 mutation (Met--Val) that confers resistance against ddl and 3TC (12). A 1.9-kb MscI fragment from the HIVpol65 construct thus generated was substituted for the appropriate fragment of HxB2-D to produce HxB2-D(K65R). The orientation of the cloned fragment was analyzed by PCR using the RTO1 and RTO2 primers depicted in Figure 1. The presence of the Lys-65--Arg mutation was confirmed by DNA sequencing. In some experiments, a recombinant virus containing substitutions at each of positions 65 and 184 [HxB2-D(K65R+M184V)] was constructed. For such purposes, an oligonucleotide/template ratio of 40:1 was used instead of the 22:1 ratio used for single-codon substitutions. Transfections and viral resistance assays. MT-4 cells were transfected by electroporation as previously described (12). To generate viral stock, fresh MT-4 cells were added to cultures as soon as cytopathic effects were seen. Culture fluids were clarified and frozen at - 70°C for subsequent analysis. Assays of HIV susceptibility to drugs, RT assays, and p24 antigen capture assays were performed as described previously (2, 30). Viruses were isolated from patients on prolonged ddC therapy by a protocol similar to that recently published (14), except that we employed CBL in place of adult peripheral blood mononuclear cells (PBMC) as HIV targets. Calculation of EC50s was carried out on the basis of p24 antigen levels in culture fluids (12) because of reports that a recombinant RT containing an Arg-65 mutation contained less than 5% of the RT activity otherwise observed (3). PCR detection of mutation sites. Figure 1 shows a map of the primer pairs used in PCR analysis. We used a mutant primer (65G), a wild-type primer (65W), an upstream primer (RTO1), and a downstream primer (65D) to distinguish mutated from wild-type codons at site Lys-65-->Arg (primer pair consisting of RTO1 and either 65G or 65W) and to detect HIV DNA as a positive control in our reactions (RTO1-65D primer pair). The 65G-RTO1 or 65W-RTO1 primer pair yielded a 249-base fragment, while the RTO1-65D primer pair yielded a 429-base fragment. We also studied clinical isolates displaying ddC resistance that were derived from patients who had received at least 6 months of ddC therapy. Wild-type HxB2-D and HxB2-D(K65R) were used as controls, and a blank sample was also employed to ensure noncontamination of samples in each case. DNA from uninfected cells was examined to ensure that our primers did not nonspecifically amplify cellular DNA. CBL were infected with clinical isolates and total cellular DNA extracted for PCR analysis of the position 65 mutation site, using procedures previously described (12). The presence of the previously observed Met-184-Val, Thr-69-->Asp, and Thr215->Tyr substitutions was also tested with appropriate primers. In some experiments, cellular DNA extracted from 5 x 106 30 0 0 20 o 'IT CM 10 0 0 2 4 6 8 10 12 ddC concentration (uM) FIG. 3. Susceptibility of HxB2-D and recombinant mutated viruses to ddC. MT-4 cells were infected with viruses in the presence of different concentrations of drugs. Viral susceptibility was assayed by measurement of p24 concentration in the samples of clarified culture supernatants. Symbols: El, HxB2-D; *, HxB2-D(K65R); A, HxB2- D(M184V); 0, HxB2-D(K65R+M184V). infected CBL was amplified by use of the RTO1-RTO2 primer pair. Direct sequencing was carried out as described previously (12) to reveal the possible presence of resistance-conferring mutations in the HIV RT open reading frame. RESULTS Cloning and sequencing of the complete RT coding regions of a number of ddC-resistant variants of HIV-IIIB, selected in tissue culture, revealed that mutations at codons 65 (Lys->Arg) and 184 (Met-Val) were present in three of three and two of three cases, respectively. Similar findings were obtained with clinical strains of HIV-1 selected for resistance against 3TC under tissue culture conditions. To understand the potential biological significance of these mutations, we employed site-directed mutagenesis to introduce Arg-encoding AGA in place of AAA at position 65 of the RT gene of HxB2-D. In addition, we generated a construct, HxB2-D(K65R+M184V), that contained both this change and the Met-184-Val alteration, which was previously shown to be associated with high-level resistance against 3TC and low-level resistance against ddl and ddC (10, 12, 31). Figure 3 demonstrates that both the Arg substitution at position 65 and the Val alteration at codon 184 caused a significant diminution in susceptibility to ddC. However, HxB2-D(K65R+M184V) did not possess higher levels of drug resistance than those obtained with either mutation alone. Similar observations were obtained on the basis of RT levels in culture fluids as well as indirect immunofluorescence assays for p24 antigen in infected cells (not shown). We did not observe that RT activity of isolates containing Lys-65--Arg was diminished when tested in cellfree assays. The susceptibilities of the wild-type and mutated isolates from which our constructs were derived are shown in Table 2. The Lys-65--Arg mutation caused more than a 10-fold diminution in susceptibility to ddC and 20-fold resistance against Downloaded from https://journals.asm.org/journal/aac on 05 October 2023 by 54.196.167.145. ligated with digested M13mpl9. Transfection of Escherichia coli TG1 cells with recombinants, screening of double-stranded DNA with restriction endonucleases, nucleotide sequencing of single-stranded DNA prepared from recombinant M13 clones, and RT sequencing were performed as previously described 278 ANTIMICROB. AGENTS CHEMOTHER. GU ET AL. TABLE 2. Susceptibilities of HIV-1 variants to antiviral agents EC50 (,uM) in MT-4 cellse of: Variant HIV-IIIB HIV-IIIB-ddC" 263 263-ddCc HxB2-D HxB2-D(K65R) HxB2-D(M184V) HxB2-D(K65R+M184V) ddC 0.45 3.2 0.35 4.8 0.45 5.6 ± ± ± ± ± ± 2.5 ± 5.8 ± 3TC ddI 0.08 NDIb 0.4 0.04 0.6 ND ND ND 0.76 ± 0.08 18.4 ± 1.3 1,032 ± 104 1,033 ± 98 0.071 0.39 0.21 0.4 4.2 25.3 3.6 15.8 7.0 22.1 37.6 34.2 ± ± ± ± ± ± ± ± AZT 0.5 3.2 0.4 2.1 0.48 1.4 2.2 2.3 0.03 0.04 0.02 0.07 0.012 0.011 0.015 0.013 ± ± ± ± ± ± ± ± 0.002 0.001 0.001 0.004 0.0002 0.0002 0.0004 0.0003 ' EC50s were obtained from plots of amounts of p24 detected in culture fluids as a function of antiretroviral drug concentration. Each value is the average of three separate determinations ± standard deviation. b ND, not determined. c ddC-resistant variants of HIV were selected in vitro by using both the HIV-IIIB laboratory strain and clinical isolate 263. of the pol regions of viruses isolated from patients on prolonged ddC therapy confirmed the presence of the site 65 mutation (Lys-65--Arg) in the case of patients 3584, 3701, 3548, and 3650, all of whom tested positive for this codon alteration by PCR analysis. Conversely, sequencing revealed the wild-type codon only at site 65 in patient 3654, who had in fact been treated with ddC for 16 months but who was also negative for this mutation by PCR analysis. Two other individuals, patients 3582 and 3652, who were not treated with ddC, also did not possess the site 65 mutation, as studied by direct sequencing of proviral DNA. Four samples also possessed Met-184-Val, and one possessed both Lys-65-->Arg and Met184- Val. None of the samples tested contained the Thr69-*Asp substitution (Table 3). In six cases, the Thr-215->Tyr mutation associated with resistance to AZT (19) was also detected in the proviral DNAs of individuals who had received this compound over extensive periods. High-level resistance to AZT was also noted in some cases (Table 3). M W M W-' W ,' W Ill ..i .l `L. 1 I . .. Mt .; sl=-= .,;::i& '' 14 .. S. *-429bp g iiq -249bp (codon65) FIG. 4. Detection of a wild-type or mutated codon at position 65 of the HIV-1 RT coding region. HxB2-D and HxB2-D(K65R) were used as wild-type codon and Lys-65--*Arg (AGA) mutated codon controls, respectively. 3701, 3548, 3650, and 3584 are clinical samples isolated from PBMC of HIV-1-infected patients on prolonged ddC therapy and then replicated in CBL. The therapeutic regimens of the patients are summarized in Table 3. In this study, 65W (wild type), 65G (AAA-toAGA mutated), and RTO1 primer pairs produced a 249-bp fragment and were used to discriminate the wild-type from the Arg mutated codon 65 of the HIV-1 RT gene. Materials in all lanes were also amplified with the RTO1-65D primer pair (429 bp) to ensure the presence of HIV-1 DNA in the samples as a positive control. Abbreviations: M, Arg-65 (AAA-to-AGA) mutated form, W, Lys-65 wildtype form. Downloaded from https://journals.asm.org/journal/aac on 05 October 2023 by 54.196.167.145. 3TC, without affecting susceptibility to AZT. A relatively small degree of cross-resistance to ddl (ca. threefold) was also noted. The degree of resistance against 3TC is far less than that previously documented for the site 184 (Met->Val) substitution, for which resistance levels of 500 to 1,000 times above the background level were obtained (10, 31). Specific primer pairs were generated, as described in Materials and Methods, to distinguish the wild-type site 65 codon from its mutated counterpart. Viruses that were isolated from the PBMC of HIV-infected patients on prolonged ddC therapy (longer than 6 months) were propagated in CBL in the continuous presence of ddC (20 ,uM) for 3 days, in order to maintain drug pressure and increase the likelihood of detecting relevant mutations, following which cellular DNA was harvested for purposes of PCR amplification. Similar analyses were performed on MT-4 cells that had been infected with either the HxB2-D or HxB2-D(K65R) molecular construct of HIV-1. In all cases, we amplified samples in which viral DNA should have been present and identified a 429-bp fragment corresponding to a conserved region in pol as a positive control. Figure 4 shows that DNA that contained the wild-type codon 65 was detected in the case of cells infected with HxB2-D. DNA that contained the mutated form of codon 65 was absent in such samples. However, MT-4 cells infected with the recombinant HxB2-D(K65R) construct contained the mutated form of codon 65. Conversely, cells infected with the latter construct did not contain wild-type codon 65 genetic material. Four clinical samples obtained from patients who had undergone ddC therapy for at least 6 months were shown to contain the mutated form of codon 65. While one isolate (sample 3701) contained only the mutated form of codon 65, the other three samples tested contained both mutated and wild-type forms of this codon. DNA from each of two ddCresistant samples selected in culture contained only the mutated form of codon 65. DNA from uninfected cells did not express any band at this locus (not shown). In some cases, we performed similar analyses on samples that were not amplified in the presence of 20 jxM ddC (patients 3701, 3548, 3650, 3584) and obtained results similar to those described above. Table 3 contains information on the therapeutic regimens received by 11 ddC-treated and 2 nontreated patients as well as on the detection of resistance-conferring mutations as analyzed by PCR. All patients had received AZT for various times before switching to ddC therapy because of AZT intolerance or treatment failure. Pretreatment isolates from these individuals were not available. Viruses from the patients whose cells contained the Lys-65--Arg mutation were approximately 5- to 15-fold less sensitive to ddC in vitro. Direct sequence analysis HIV RESISTANCE TO ddC VOL. 38, 1994 279 TABLE 3. Summary of ddC treatment information and mutation analysis for patients in this study Patient no. 3582 3652 3560 3699 3584 3580 3701 3706 3608 3548 3650 3654 3577 Time (mo) treated with: AZT 0 0 2 5 6 6 7 8 10 11 15 16 18 0 35 28 24 23 54 31 48 36 47 38 49 53 Codon 215 Codon 184 Codon 69 Codon 65 ddC EC50 (pM) Of: Genotype WTW Mutated WT Mutated WT Mutated WT Mutated + + + + + + + + + + + + - + + + + + + + + + + + + + - + + + + + + + + + + + + + + + + + + NDb ND ND ND ND ND - ND ND ND ND ND + + + + ND + + + + + + - - ddC AZT 0.4 0.4 0.2 0.2 5.3 2.2 1.6 ND ND 2.1 1.9 0.6 ND 0.006 0.004 0.03 0.4 >10 0.04 0.5 ND ND >10 0.007 0.3 ND DISCUSSION This paper reports that a novel mutation at codon 65 (Lys-*Arg) is associated with HIV resistance to ddC and cross-resistance to 3TC. Mutations that confer resistance to ddC have been previously identified at codons 69 and 184 (7, 12). It is noteworthy that both the site 65 and 69 mutations are located in the region at positions 65 to 70 of the amino acid sequence of the viral RT, which is known to be associated with the active site of this enzyme. It is also significant that monoclonal antibodies against HIV RT enzymatic activity map to this region (35). Cross-resistance between ddC and 3TC, encoded by both the Lys-65-->Arg and Met-184--Val mutations, may be due to the fact that both of these molecules possess 2',3'-dideoxy moieties. It is consistent that neither the Lys-65-*Arg nor the Met-184->Val substitution is present in variants of HIV selected for resistance against AZT. A mutation of Leu-74-->Val that confers resistance against ddl and cross-resistance to ddC has also been described (32). We are now assessing whether recombinant HxB2-D that contains both the Lys-65->Arg and Thr-69---Asp mutations may display higher-level resistance to ddC. It is significant that HxB2-D, grown in CBL, continued to possess the codon 65 mutation and to maintain resistance to both ddC and 3TC. Thus, this mutation can persist in cells others than those of the MT-4 line used in our tissue culture selection protocol. The individuals studied whose isolates contained the Lys-65-->Arg mutation had all received therapy with this nucleoside for longer than 6 months. Similar results have been obtained with each of 11 individuals, although an absence of the Lys-65->Arg mutation has been noted in each of 7 individuals who also received ddC therapy over this time. Lys-65 is a highly conserved amino acid in the RTs of several retroviruses, located in the center of the IKKK motif of the HIV-1 RT, which when mutated to Arg can affect enzymatic activity (1, 3, 13). One report showed that a recombinant RT containing Lys-65-->Arg possessed less than 5% of RNAdependent DNA polymerase activity, virtually no in situ DNAdependent DNA polymerase activity, and intact in situ RNase H in comparison with wild-type enzyme (3). Since both Lys and Arg are basic amino acids, this further indicates that Lys-65 is important in maintaining RT function. Surprisingly, HxB2-D and HxB2-D(K65R) appeared to be equally infectious for MT-4 cells, and both caused cytopathic effects at around the same time. We did not find any impairment in cell-free RT activity in our recombinant viruses (not shown). Perhaps mutated forms of RT that are synthesized in E. coli undergo posttranscriptional modifications different from those in mammalian cells. We found that deoxynucleoside triphosphates (dNTPs) can competitively inhibit the binding of RT-neutralizing monoclonal antibodies to the RT template-primer complex (35). Thus, the region at positions 65 to 71, against which these monoclonal antibodies react, may also play a role in the binding of dNTP substrates. Substitution of Lys-65--->Arg might change the conformation of this region, resulting in decreased affinity for ddC and 3TC. Lys-65 is located on the "fingers" subdomain of the RT crystal structure, which is thought to play a role in enzymetemplate interaction (15). However, Met-184 is located on the "palm" subdomain, which is thought to be related to primertemplate binding activity (15). This may explain why these two mutations did not, in concert, yield either synergistic or antagonistic effects with regard to ddC and 3TC resistance. Our data suggest that the Lys-65--Arg mutation may be selected under conditions of drug therapy. Further analysis using diluted preparations of DNA will be necessary to determine whether mixtures of viral quasispecies, containing both mutated and wild-type codons at site 65, were present, as has been shown for mutations relevant to AZT and ddl (12, 22, 32). As stated, the Lys-65->Arg and Met-184-->Val mutations can persist in cells others than the MT-4 line used in our tissue culture selection protocol. We used specific PCR to amplify the Lys-65--Arg substitution from clinical isolates obtained from 11 HIV-1-infected patients who received prolonged ddC therapy. The Lys-65-->Arg mutation was present in each of four such individuals and absent in the other seven. Of the four people who tested positive for the Lys-65->Arg codon, three contained viruses that were positive for the wild-type Lys-65 codon as well, while the fourth also possessed the Met184--Val mutation. No viral mutation sites were observed in the case of HIV-1 isolates from each of two control patients not treated with ddC. Further work using a nested PCR Downloaded from https://journals.asm.org/journal/aac on 05 October 2023 by 54.196.167.145. WT, wild-type. b ND, not determined. GU ET AL. approach to amplify low levels of DNA from uncultured PBMC is in progress. This work demonstrates that the Lys-65->Arg mutation of the HIV-1 RT can be used to discriminate among some viruses that possess a ddC-susceptible or -resistant phenotype. Another group has recently obtained similar findings with regard to the site 65 mutation and has shown that recombinant RT that contains the appropriate amino acid substitution is less susceptible than wild-type enzyme to inhibitory effects exerted by ddCTP (37). ACKNOWLEDGMENTS We thank F. Busschaert for preparation of the manuscript. This research was supported by grants from Health and Welfare Canada, from the Medical Research Council of Canada, and from the American Foundation for AIDS Research. REFERENCES 1. Barber, A., A. Hizi, J. V. Maizel, Jr., and S. H. Hughes. 1990. HIV-1 reverse transcriptase: structure predictions for the polymerase domain. AIDS Res. Hum. Retroviruses 6:1061-1072. 2. Boulerice, F., S. Bour, R. Geleziunas, A. Lvovich, and M. A. Wainberg. 1990. High frequency of isolation of defective human immunodeficiency virus type 1 and heterogeneity of viral gene expression in clones of infected U-937 cells. J. Virol. 64:17451755. 3. Boyer, P. L., A. L. Ferris, and S. H. Hughes. 1992. Cassette mutagenesis of the reverse transcriptase of human immunodeficiency virus type 1. J. Virol. 66:1031-1039. 4. Broder, S. 1990. Pharmacodynamics of 2',3'-didexoycytidine: an inhibitor of human immunodeficiency virus. Am. J. Med. 88:5B2S-5B-7S. 5. Erice, A., D. L. Mayers, D. G. Strike, K. J. Sannerud, F. E. McCutchan, K. Henry, and H. H. Balfour. 1993. Primary infection with zidovudine resistant human immunodeficiency virus type-1. N. Engl. J. Med. 328:1163-1165. 6. Fisher, A. G., E. Collalti, L. Ratner, R. C. Gallo, and F. WongStaal. 1985. A molecular clone of HTLV-III with biological activity. Nature (London) 316:262-265. 7. Fitzgibbon, J. E., R. M. Howell, C. A. Haberzettl, S. J. Sperber, D. J. Gocke, and D. T. Dubin. 1992. Human immunodeficiency virus type 1 pol gene mutations which cause decreased susceptibility to 2',3'-dideoxycytidine. Antimicrob. Agents Chemother. 36:153-157. 8. Furman, P. A., J. A. Fyfe, M. H. St. Clair, K. Weinhold, J. L. Rideout, G. A. Freeman, S. N. Lehrman, D. P. Bolognesi, S. Broder, H. Mitsuya, and D. W. Barry. 1986. Phosphorylation of 3'-azido-3'-deoxythymidine and selective interaction of the 5'triphosphate with human immunodeficiency virus reverse transcriptase. Proc. Natl. Acad. Sci. USA 83:8333-8337. 9. Gao, Q., Z. Gu, J. Hiscott, G. Dionne, and M. A. Wainberg. 1993. Generation of drug-resistant variants of human immunodeficiency virus type 1 by in vitro passage in increasing concentrations of 2',3'-dideoxycytidine and 2',3'-dideoxy-3'-thiacytidine. Antimicrob. Agents Chemother. 37:130-133. 10. Gao, Q., Z. Gu, M. A. Parniak, J. Cameron, N. Cammack, C. Boucher, and M. A. Wainberg. 1993. The same mutation that encodes low-level human immunodeficiency virus type 1 resistance to 2',3'-dideoxyinosine and 2',3'-dideoxycytidine confers highlevel resistance to the (-) enantiomer of 2',3'-dideoxy-3'-thiacytidine. Antimicrob Agents Chemother. 37:1390-1392. 11. Gao, Q., Z. Gu, M. A. Parniak, X. Li, and M. A. Wainberg. 1992. In vitro selection of variants of human immunodeficiency virus type 1 resistant to 3'-azido-3'-deoxythymidine and 2',3'-dideoxyinosine. J. Virol. 66:12-19. 12. Gu, Z., Q. Gao, X. Li, M. A. Parniak, and M. A. Wainberg. 1992. Novel mutation in the human immunodeficiency virus type 1 reverse transcriptase gene that encodes cross-resistance to 2',3'dideoxyinosine and 2',3'-dideoxycytidine. J. Virol. 66:7128-7135. 13. Hizi, A., A. Barber, and S. H. Hughes. 1989. Effects of small insertions on the RNA-dependent DNA polymerase activity of ANTIMICROB. AGENTS CHEMOTHER. HIV-1 reverse transcriptase. Virology 170:326-329. 14. Japour, A. J., D. L. Mayers, V. A. Johnson, D. R. Kuritzkes, L. A. Beckett, J.-M. Arduino, J. Lane, R. J. Black, P. S. Reichelderfer, R. T. D'Aquila, C. S. Crumpacker, The RV-43 Study Group and The AIDS Clinical Trials Group Virology Committee Resistance Working Group. 1993. Standardized peripheral blood mononuclear cell culture assay for determination of drug susceptibilities of clinical human immunodeficiency virus type 1 isolates. Antimicrob. Agents Chemother. 37:1095-1101. 15. Kohlstaedt, L. A., J. Wang, J. M. Friedman, P. A. Rice, and T. A. Steitz. 1992. Crystal structure at 3.5 A resolution of HIV-1 reverse transcriptase complexed with an inhibitor. Science 256:1783-1790. 16. Kozal, M. J., R. W. Shafer, M. A. Winters, D. A. Katzenstein, and T. C. Merigan. 1993. A mutation in human immunodeficiency virus reverse transcriptase and decline in CD4 lymphocyte numbers in long-term zidovudine recipients. J. Infect. Dis. 167:526532. 17. Larder, B. A., K. E. Coates, and S. D. Kemp. 1991. Zidovudineresistant human immunodeficiency virus selected by passage in cell culture. J. Virol. 65:5232-5236. 18. Larder, B. A., G. Darby, and D. D. Richman. 1989. HIV with reduced sensitivity to zidovudine (AZT) isolated during prolonged therapy. Science 243:1731-1734. 19. Larder, B. A., and S. D. Kemp. 1989. Multiple mutations in HIV-1 reverse transcriptase confer high-level resistance to zidovudine (AZT). Science 246:1155-1158. 20. Meng, T.-C., M. A. Fishl, M. M. Boota, S. A. Spector, D. Bennett, Y. Bassiakos, S. Lai, B. Wright, and D. D. Richman. 1992. Combination therapy with zidovudine and didexoycytidine in patients with advanced human immunodeficiency virus infection: a phase I/II study. Ann. Intern. Med. 116:13-20. 21. Mitsuya, H., and S. Broder. 1986. Inhibition of the in vitro infectivity and cytopathic effect of human T-lymphotropic virus type III/lymphadenopathy-associated virus (HTLV-III/LAV) by 2',3'-dideoxynucleosides. Proc. Natl. Acad. Sci. USA 83:19111915. 22. Mohri, H., M. K. Singh, W. T. W. Ching, and D. D. Ho. 1993. Quantitation of zidovudine-resistant human immunodeficiency virus type 1 in the blood of treated and untreated patients. Proc. Natl. Acad. Sci. USA 90:25-29. 23. Montaner, J. S. G., J. Singer, M. T. Schechter, J. M. Raboud, C. Tsoukas, M. O'Shaughnessy, J. Ruedy, K. Nagai, H. Salomon, B. Spira, and M. A. Wainberg. 1993. Clinical correlates of in vitro HIV-1 resistance to zidovudine. Results of the Multicentre Canadian AZT trial. AIDS 7:189-196. 24. Nunberg, J. H., W. A. Schleif, E. J. Boots, J. A. O'Brien, J. C. Quintero, J. M. Hoffman, E. A. Emini, and M. E. Goldman. 1991. Viral resistance to human immunodeficiency virus type 1-specific pyridinone reverse transcriptase inhibitors. J. Virol. 65:4887-4892. 25. Perno, C.-K., R. Yarchoan, D. A. Cooney, N. R. Hartman, S. Gartner, M. Popovic, Z. Hao, T. L. Gerrard, Y. A. Wilson, D. G. Johns, and S. Broder. 1988. Inhibition of human immunodeficiency virus (HIV-1/HTLVBa-L) replication in fresh and cultured human peripheral blood monocytes/macrophages by azidothymidine and related 2',3'-dideoxynucleosides. J. Exp. Med. 168:11111125. 26. Preston, B. D., B. J. Poiesz, and L. A. Loeb. 1988. Fidelity of HIV-1 reverse transcriptase. Science 242:1168-1171. 27. Richman, D., C.-K. Shih, I. Lowy, J. Rose, P. Prodanovich, S. Goff, and J. Griffin. 1991. Human immunodeficiency virus type 1 mutants resistant to nonnucleoside inhibitors of reverse transcriptase arise in tissue culture. Proc. Natl. Acad. Sci. USA 88:11241-11245. 28. Roberts, J. D., K. Bebenek, and T. A. Kunkel. 1988. The accuracy of reverse transcriptase from HIV-1. Science 242:1171-1173. 29. Rooke, R., M. Tremblay, H. Soudeyns, L. DeStephano, X.-J. Yao, M. Fanning, J. S. G. Montaner, M. O'Shaughnessy, K. Gelmon, C. Tsoukas, J. Ruedy, and M. A. Wainberg. 1989. Isolation of drug-resistant variants of HIV-1 from patients on long-term zidovudine (AZT) therapy. AIDS 3:411-415. 30. Rooke, R, M. Tremblay, and M. A. Wainberg. 1990. AZT (zidovudine) may act postintegrationally to inhibit generation of HIV-1 progeny virus in chronically infected cells. Virology 176:205-215. Downloaded from https://journals.asm.org/journal/aac on 05 October 2023 by 54.196.167.145. 280 31. Schinazi, R. F., R. M. Lloyd, Jr., M.-H. Nguyen, D. L. Cannon, A. McMillan, N. Ilksoy, C. K. Chu, D. C. Liotta, H. Z. Bazmi, and J. W. Mellors. 1993. Characterization of human immunodeficiency viruses resistant to oxathiolane-cytosine nucleosides. Antimicrob. Agents Chemother. 37:875-881. 32. St. Clair, M. H., J. L. Martin, G. Tudor-Williams, M. C. Bach, C. L. Vavro, D. M. King, P. Kellam, S. D. Kemp, and B. A. Larder. 1991. Resistance to ddl and sensitivity to AZT induced by a mutation in HIV-1 reverse transcriptase. Science 253:1557-1559. 33. Takeuchi, Y., T. Nagumo, and H. Hoshino. 1988. Low fidelity of cell-free DNA synthesis by reverse transcriptase of human immunodeficiency virus. J. Virol. 62:3900-3902. 34. Tudor-Williams, G., M. H. St. Clair, R. E. McKinney, M. Maha, E. Walter, S. Santacroce, M. Mintz, K. O'Donnell, T. Rudoll, C. L. Vavro, E. M. Connor, and C. M. Wilfert. 1992. HIV-1 sensitivity to zidovudine and clinical outcome in children. Lancet 339:15-19. HIV RESISTANCE TO ddC 281 35. Wu, J., E. Amandoron, X. Li, M. A. Wainberg, and M. A. Parnialk 1993. Monoclonal antibody-mediated inhibition of HIV-1 reverse transcriptase polymerase activity. J. Biol. Chem. 268:9980-9985. 36. Yarchoan, R., C. F. Perno, R. V. Thomas, R. W. Klecker, J.-P. Allkain, R. J. Wills, N. McAtee, M. A. Fischl, R. Dubinsky, M. C. McNeely, H. Mitsuya, J. M. Pluda, T. J. Lawley, M. Leuther, B. Safai, J. M. Collins, C. E. Myers, and S. Broder. 1988. Phase I studies of 2',3'-dideoxycytidine in severe human immunodeficiency virus infection as a single agent and alternating with zidovudine (AZT). Lancet i:76-81. 37. Zhang, D., A. M. Caliendo, J. J. Eron, K. M. DeVore, J. C. Kaplan, M. S. Hirsch, and R. T. D'Aquila. 1994. Resistance to 2',3'dideoxycytidine conferred by a mutation in codon 65 of the human immunodeficiency virus type 1 reverse transcriptase. Antimicrob. Agents Chemother. 38:282-287. Downloaded from https://journals.asm.org/journal/aac on 05 October 2023 by 54.196.167.145. VOL. 38, 1994