NIH Public Access
Author Manuscript
Tuberculosis (Edinb). Author manuscript; available in PMC 2012 September 1.
NIH-PA Author Manuscript
Published in final edited form as:
Tuberculosis (Edinb). 2011 September ; 91(5): 378–385. doi:10.1016/j.tube.2011.06.001.
Increased Foxp3 expression in guinea pigs infected with WBeijing strains of M. tuberculosis
Shaobin Shanga, Marisa Hartona, Marcela Henao Tamayoa, Crystal Shanleya, Gopinath S.
Palanisamya, Megan Carawaya, Edward D. Chanb,c,d, Randall J. Basarabaa, Ian M. Ormea,
and Diane J. Ordwaya,*
a Mycobacteria Research Laboratories, Department of Microbiology, Immunology and Pathology,
Colorado State University, Fort Collins, Colorado, 80523
b
Denver Veterans Affairs Medical Center, University of Colorado School of Medicine
c
Department of Medicine, National Jewish Health, University of Colorado School of Medicine
d
NIH-PA Author Manuscript
Division of Pulmonary Sciences and Critical Care Medicine, University of Colorado School of
Medicine
SUMMARY
There is increasing evidence that clinical isolates of Mycobacterium tuberculosis that belong to the
W-Beijing genotype of newly emerging strains are often of very high virulence when tested in
small animal models, including the mouse and guinea pig. In this report we provide further
evidence to support this contention, and show that two W-Beijing strains are of very high
virulence when introduced by low dose aerosol into out-bred guinea pigs. In addition to severe
lung pathology, each of these infections was associated with large influxes of activated CD4 and
CD8 T cells into the lungs. Large influxes of macrophages were also observed, but the fraction of
these showing evidence of activation by Class-II expression was relatively low. A progressive
increase in neutrophils was also seen, with highest levels accumulating in the lungs of the WBeijing infected animals. In the case of these two infections mRNA levels for TH1 cytokines was
elevated early, but these then declined, and were replaced by increasing levels of message
encoding for Foxp3, IL-10, and TGF . These observations support the hypothesis that W-Beijing
strains are potent inducers of regulatory T cells, and that this event may enhance survival and
transmission of these bacilli.
NIH-PA Author Manuscript
Keywords
Mycobacterium tuberculosis; Guinea pig; Foxp3+ regulatory T cells; clinical isolates; W-Beijing
strains
© 2011 Elsevier Ltd. All rights reserved.
*
Corresponding author: Phone 970-491-4117, Fax 970-491-1815. D.Ordway-Rodriguez@colostate.edu.
Competing interests. None
Ethical approval: Animal studies were fully approved by the IACUC at CSU.
Publisher's Disclaimer: This is a PDF file of an unedited manuscript that has been accepted for publication. As a service to our
customers we are providing this early version of the manuscript. The manuscript will undergo copyediting, typesetting, and review of
the resulting proof before it is published in its final citable form. Please note that during the production process errors may be
discovered which could affect the content, and all legal disclaimers that apply to the journal pertain.
Shang et al.
Page 2
1. Introduction
NIH-PA Author Manuscript
The global epidemic caused by the bacterial pathogen Mycobacterium tuberculosis
continues unabated, with the most recent figures in 2009 estimating 9.4 million incident
cases of tuberculosis, with about 1.3 million deaths 1, 2. It is becoming evident that a
significant percentage of new clinical isolates of M. tuberculosis are of extremely high
virulence 3–5. Amongst these, the W-Beijing family of M. tuberculosis is globally
distributed and is being increasingly documented as a cause of major outbreaks of infection
worldwide that involve multidrug-resistant strains 6–10. Increasing evidence suggests that the
Beijing genotype family can induce distinctly different host immune responses compared to
other M. tuberculosis strains, and amongst these is the newly emerging idea that this family
induces the generation of regulatory T cells 11; an event that could allow evasion of both
innate 12 and acquired immunity 11, 13.
NIH-PA Author Manuscript
Despite the obvious high virulence of these newly emerging clinical strains, most work on
screening new drugs and vaccines has used the “laboratory strains” H37Rv and
Erdman 14, 15. This is of concern, because it has already been noted 11 in the mouse model
that such strains are of far less potency in terms of their capacity to induce regulatory T cell
responses. To date however it remains unknown if this caveat extends to the guinea pig
animal model, which remains the gold standard for testing new vaccine candidates. To begin
to address this question we compared three clinical isolates (two of them, W-Beijing strains)
in parallel with the two laboratory strains for their ability to infect and grow in the lungs of
guinea pigs after low dose aerosol infection. Using newly developed flow cytometry for this
species 16 we were further able to monitor the influx of several cell populations into the
lungs, including activated T cell subsets. We are unable as yet to perform intracellular
staining for cytokines in this species, but were able to track TH1 cytokines, as well as
cytokines associated with negative regulation of immunity, using RT-PCR.
NIH-PA Author Manuscript
The results of this study show that the two W-Beijing strains, as well as a multidrug resistant
“P family” isolate, grew to higher numbers in the lungs of these animals compared to the
two laboratory strains. This was further associated with more severe lung pathology, and
reduced survival. These events were associated with an initial higher expression of message
encoding the TH1 cytokines IL-12p40 and gamma interferon (IFN ) in animals infected
with the clinical strains, but this was then followed by progressive increases in mRNA
encoding the regulatory T cell markers Foxp3, IL-10, and TGF in the animals exposed to
the W-Beijing isolates. These data thus lead us to hypothesize that W-Beijing isolates of M.
tuberculosis induce potent T regulatory cell responses in the guinea pig model, a finding that
has the potential to serious confound vaccine testing in this model which is routinely
performed using the laboratory strains.
2. Methods
2.1. Guinea pigs
Female outbred Hartley guinea pigs (~500 g in weight) were purchased from the Charles
River Laboratories (North Wilmington, MA, USA) and held under barrier conditions in a
Biosafety Level III animal laboratory. The specific pathogen-free nature of the guinea pig
colonies was demonstrated by testing sentinel animals. All experimental protocols were
approved by the Animal Care and Usage Committee of Colorado State University and
comply with NIH guidelines.
2.2. Experimental infections
The laboratory strains M. tuberculosis H37Rv and Erdman were originally obtained from the
Trudeau Institute collection, Saranac Lake, NY. The clinical isolates used in this study were
Tuberculosis (Edinb). Author manuscript; available in PMC 2012 September 1.
Shang et al.
Page 3
NIH-PA Author Manuscript
chosen specifically because they were all associated with outbreaks in the United States.
Three strains from the Public Health Research Institute TB Center collection were selected
in regard to their genetic backgrounds and their resistance phenotype. Strain TN14149
(″W10″ DNA fingerprint) is a member of the W-Beijing strain family; it is drug susceptible,
and has an identical fingerprint to the sequenced strain 210. Strain TN5904 is a ″P″ family
cluster group VI MDR-TB isolate with resistance to isoniazid, rifampin, p-aminosalicylic
acid, and streptomycin, that was isolated from HIV-positive patients that had undergone
exogenous reinfection 17. The W-Beijing strain SA161 is an isolate found within a cluster of
cases in Arkansas.
All of the strains used in this study were grown in 7H9 broth containing 0.05% Tween-80.
Thawed aliquots of frozen cultures were diluted in sterile water to the desired inoculum
concentrations. A Madison chamber aerosol generation device was used to expose the
animals to M. tuberculosis. This device was calibrated to deliver approximately 20 bacilli
into the lungs. Lung bacterial counts on days 10, 30 and 60 were determined by plating
serial dilutions of tissue homogenates on nutrient 7H11 agar and counting colony-forming
units after 3 weeks incubation at 37° C. In survival studies, animals showing substantial
weight loss with no evidence of weight rebound were euthanized. The results shown in the
survival studies are based upon 8-10 guinea pigs per group.
NIH-PA Author Manuscript
2.3. Histological analysis
The lung lobes, spleen and mediastinal lymph nodes from each guinea pig were fixed with
4% paraformaldehyde in phosphate buffered saline (PBS). Sections from these tissues were
stained using haematoxylin and eosin. The concurrent progression of lung and lymph
nodelesions was evaluated using a histological grading system 18.
2.4. Organ digestion
NIH-PA Author Manuscript
To prepare single cell suspensions, the lungs, lymph nodes and spleens were perfused with
20ml of a solution containing PBS and heparin (50 U/ml; Sigma-Aldrich, St. Louis, MO)
through the pulmonary artery and the caudal lobe aseptically removed from the pulmonary
cavity, placed in media and dissected. The dissected lung tissue was incubated with
complete DMEM (cDMEM media) containing collagenase XI (0.7 mg/ml; Sigma-Aldrich)
and type IV bovine pancreatic DNase (30 μg/ml; Sigma-Aldrich) for 30 minutes at 37°C.
The digested lungs were further disrupted by gently pushing the tissue twice through a cell
strainer (BD Biosciences, Lincoln Park, NJ). Red blood cells were lysed with ACK buffer,
washed and resuspended in cDMEM. Total cell numbers were determined by flow
cytometry using BD™ Liquid Counting Beads, as described by the manufacturer (BD
PharMingen, San Jose, CA USA 95131).
2.4. Flow cytometric analysis of cell surface markers
Single cell suspensions from each individual guinea pig were incubated first with antibodies
as previously described 16, 19 to CD4, CD8, pan T cell, CD45, MIL4, B cell, macrophage
and class II antibodies at 4°C for 30 minutes in the dark after washing the cells with PBS
containing 0.1% sodium azide (Sigma-Aldrich). The anti-guinea pig macrophage MR-1
antibody is an intracytoplasmic antigen and therefore cell membranes were permeabilized
using Leucoperm (Serotec Inc, Raleigh, NC) according to the manufacturer’s instructions
prior to intracellular staining. Data acquisition and analysis were done using a FACSCalibur
flow cytometer (BD Biosciences, Mountain View, CA) and CellQuest software (BD
Biosciences, San Jose, CA). Compensation of the spectral overlap for each fluorochrome
was done using CD4 or MIL4 or CD3 antigens from cells gated in the FSClow versus
SSClow; FSCmid/high versus SSCmid/high; SSClow versus MIL4+; SSChigh versus MIL4neg
Tuberculosis (Edinb). Author manuscript; available in PMC 2012 September 1.
Shang et al.
Page 4
and SSChigh versus MIL4+ region respectively. Analyses were performed with an
acquisition of at least 100,000 total events.
NIH-PA Author Manuscript
2.5. RT-PCR analysis
NIH-PA Author Manuscript
Expression of mRNA encoding the cytokines IFN , IL-12p40, TNFα, TGF , IL-10, and the
regulatory T cell associated intracellular marker Foxp3, was quantified using real-time
reverse transcription-polymerase chain reactions (RT-PCR). One lobe from each guinea pig
(n=5) lung was added to 1 ml of TRIzol RNA reagent (Invitrogen), homogenized, and
frozen immediately. Total RNA was extracted according to the manufacturer’s protocol.
RNA samples from each group and each time point were reverse transcribed using the
Reverse Transcriptase Enzyme (M-MLV RT- Invitrogene). Four μl samples of cDNA were
then amplified using the iQ SYBR Green Supermix (Bio-Rad) following the manufacturer's
protocol on the iQ5 iCycler amplification detection system (Bio-Rad). A negative control
using ultra pure Molecular Biology water as the template and a non-template control (NTC)
were ran to confirm that the signals were derived from RNA and not due to contaminating
genomic DNA. In order to ensure that only the correct gene was amplified, and was not the
presence of primer-dimer or non-specific secondary products, a Melt Curve was performed
for each run. Fold induction of mRNA was determined by analyzing cycle threshold (CT)
values normalized for HPRT (CT) expression. The primer sequences for guinea pig IFN ,
TNFα, TGF 1, IL-12p40 and 18S were previously published 20,21. The primer sequences for
guinea pig Foxp3 and IL-10 were determined with assistance from Dr Anand Damodaran
(Genotypic Technology, Bangalore, India). Primer sequences used for Foxp3 were forward:
5’ AGAAAGCACCCTTTCAAGCA 3; reverse: 5’ GAGGAAGTCCTCTGGCTCCT 3’,
and forward: 5’ TTCTTCCAAACACAGGATCAGC 3’; reverse: 5’
TCATTTCCGATAGGGCTTGG 3’ for IL-10.
2.6. Statistical analysis
Data is representative of two experiments. Mean values were calculated from results for
individual guinea pigs within each group (n=5) ± standard error of the mean (SEM). Oneway ANOVA was used to compare the statistical differences in numbers of bacilli, mean
lesion scores and necrosis scores between different groups.
3. Results
3.1. Course of experimental infections
NIH-PA Author Manuscript
Guinea pigs were exposed to approximately 20 bacilli of the M. tuberculosis clinical strains
TN14149, SA161 and TN5904, as well as the laboratory strains H37Rv and Erdman, and the
bacterial loads in target organs followed versus time (Fig.1A). Both laboratory strains were
contained in the lungs at a level of approximately 5.5-log, whereas the W-Beijing strain
TN14149 grew to over 6.5-log, and W-Beijing strain SA161 exceeded 8-logs in the lungs.
The MDR strain exhibited an intermediate pattern. The increased growth potential of both
W-Beijing strains was also evident in the spleen and draining lymph nodes. In a parallel
group of animals, these high bacterial burdens resulted in animal mortality, with animals
beginning to die soon after day-60 (Fig.1B).
3.2. M. tuberculosis clinical strains of TN14149 and SA161 show increased organ tissue
pathology
As anticipated, the five experimental infections resulted in a range of increasingly severe
lung pathology over the first sixty days of the experiment (Fig.2). In all cases the infections
induced extensive mixed inflammation and necrosis, but this was particularly severe in the
case of the two W-Beijing infections (Fig.2G-J) compared to the two laboratory strains (Fig.
Tuberculosis (Edinb). Author manuscript; available in PMC 2012 September 1.
Shang et al.
Page 5
NIH-PA Author Manuscript
2A-D). Again, the MDR strain showed an intermediate pattern (Fig.2E&F). By day 60,
lesions in animals infected with the clinical isolates showed severe increases in secondary
lesion progression, characterized by multiple foci of extensive inflammation coalescing
within the pulmonary parenchyma (Fig.2Q-T) whereas lung involvement in the cases of the
two laboratory strains was more modest (Fig.2K-N). These progressive changes in tissue
lesions were further reflected by lesion score analysis, revealing the extensive damage both
in the lungs but also in the spleen and draining lymph nodes over the course of the infections
(Fig.3).
3.3. Influx of defined cell populations using flow cytometric analysis
Our development of new gating strategies for flow cytometry 16 now allows the analysis of
the influx of T cell and other cell populations into infected organs over the course of the
infection. Analysis of the T cell response still remains very limited (there are no antibodies
to CD44, and guinea pigs lack CD62/L-selectin) but we have been able to define activated T
cell subsets based on raised expression of the markers CD45 and CT-4 16. As shown in Fig.
4, we observed substantially increased numbers of CD4+ CD45+ cells and CD4+ CT-4+
cells in the lungs and lymph nodes of guinea pigs infected with the two W-Beijing strains,
and these raised levels were sustained out through day-60 of these infections. Similarly,
increased numbers of CD8 T cells expressing (the putative selectin) CT-4 were also
observed in response to these two infections.
NIH-PA Author Manuscript
We next analyzed the influx of macrophages and granulocytes (neutrophils) into the lungs
and draining lymph nodes. Representative gating for two of the infections is shown in Fig.
5A. By combining MR-1 expression with high levels of MHC Class-II molecules we can
distinguish total macrophage numbers and the numbers of these which are highly activated.
Figure 5B shows that all five infections were associated with the progressive influx of large
numbers of macrophages, as expected. As noted before 19, only a small fraction of
macrophages in animals infected with the two laboratory strains were activated, and whereas
this fraction was higher for the two W-Beijing strains, this also waned with time. Finally,
neutrophil influx is associated with progressive lung and lymph node damage, and numbers
of these cells steadily increased in all five sets of animals with the highest numbers observed
for the Beijing strains (Fig.5C).
3.4. Kinetics of emergence of messenger RNA encoding cytokines
NIH-PA Author Manuscript
As yet we cannot measure intracellular cytokine expression by flow cytometry in guinea
pigs, but we can use RT-PCR methods to detect signals associated with specific T cell
subsets. In Fig.6 we used RT-PCR to track the expression of the [Fig 6A] TH1 cytokines
IL-12p40 and IFN , and compared this information to levels of [Fig 6B] Foxp3, IL-10, and
TGF , markers associated with down-regulation of immunity. The markers of TH1
immunity were substantially raised by day-30 of the infections, particularly in the case of the
two W-Beijing strains, but these waned significantly by day-60. In contrast, in the case of
the two W-Beijing infections, there were progressive increases in all three potential markers
of regulatory T cell activity.
4. Discussion
Previous studies in our laboratory have shown that newly emerging clinical strains of M.
tuberculosis cause progressive and highly inflammatory disease in both the mouse 11 and
guinea pig 4, 5 models of the disease. Our studies in mice provided the new observation that
such strains appear to be strong inducers of CD4+Foxp3+ regulatory T cells, thus explaining
the “hypervirulence” of W-Beijing strain HN878 in the face of waning protective
immunity 11, whereas the commonly used laboratory strains induce such cells weakly or not
Tuberculosis (Edinb). Author manuscript; available in PMC 2012 September 1.
Shang et al.
Page 6
NIH-PA Author Manuscript
at all. Hence, given our previous data regarding the extreme range of virulence of similar
clinical strains in guinea pigs 4 we decided to further investigate the cellular response to
such strains in this relevant animal model, including whether these animals could express
markers in the lungs that we believe to be associated with the emergence and accumulation
of regulatory T cells.
The results of this simple descriptive study further illustrate the progressive and destructive
nature of the W-Beijing clinical isolates when introduced into the lungs of guinea pigs. In
addition this study provides the new information that this is associated with the influx of
activated CD4 and CD8 T cells, but relatively poor numbers of Class-II activated
macrophages. As lung damage continued, this was associated with a continued influx of
neutrophils, which we postulate play a central role in driving the process of necrosis 22, as
well as playing a key role in bacterial persistence, even after chemotherapy 23. The most
important new observation however was the demonstration that, despite evidence for a
strong initial protective TH1 immune response, both W-Beijing strain infections potently
induced signals in the lungs that we can reasonably hypothesize represent the influx of
CD4+Foxp3+ IL-10 secreting regulatory T cells.
NIH-PA Author Manuscript
Our data show that infection of guinea pigs with the M. tuberculosis W-Beijing strains
TN14149 or SA161 resulted in significantly increased bacterial burden in the lungs, lymph
nodes and spleens and reduced animal survival compared to the laboratory strains H37Rv
and Erdman and the MDR-TB 5904 strain. In addition, the increased bacterial growth of the
W-Beijing strains was associated with an increased granulomatous response and more
severe tissue pathology. Coinciding with the increased bacterial burden in guinea pigs
infected with the W-Beijing strains, there was increased influx of activated CD4+ and CD8+
T cells into the lungs and lymph nodes during the subacute phase of infection (Day 30)
which was associated with increased IFN and IL-12p40 expression compared to the
laboratory strains. Importantly, we show that during chronic infection (Day 60), this IFN
response induced by the W-Beijing strains was replaced with an increased expression of
Foxp3+ regulatory T cells.
NIH-PA Author Manuscript
These observations support the hypothesis that one element of the highly successful global
spread of the W-Beijing family of isolates might be their ability to depress protective
immunity by the induction of regulatory T cells. This could be due to very simple reasons,
such as the fact that these isolates are highly inflammatory and virulent, or due to more
subtle reasons such as the possession of molecules, such as lipids, that could specifically
trigger regulatory T cell responses. Currently we favour the former possibility, given that we
are seeing similar outcomes in our animal models using highly virulent but “non-W-Beijing”
clinical isolates as well. Whichever is correct, we still have no way of distinguishing if this
T cell subset is generated in response to the potent TH1 response in order to dampen it, or
whether this subset is instead simply generated by the lung inflammation, with depression of
the Th1 response an unfortunate side-effect.
In this regard the granulomatous response to the two W-Beijing strains was characterized in
both cases by far greater amounts of primary lesion necrosis on day 30, more severe
pulmonary inflammation, pyogranulomatous and necrotizing lymphadenitis of the draining
lymph nodes, and increased numbers of secondary granulomas in comparison to the two
laboratory strains. Secondary lesions caused by hematogenous dissemination developed at
an increased rate in animals infected with the W-Beijing strains, compromising much of the
healthy lung tissue as the disease progressed. It is tempting to hypothesize such rapid lung
damage would be expected to result in increased clinical transmission of infection.
However, multiple studies have demonstrated that M. tuberculosis strains responsible for
major outbreaks have been shown to vary in virulence in animal models 22, 23, 24.
Tuberculosis (Edinb). Author manuscript; available in PMC 2012 September 1.
Shang et al.
Page 7
NIH-PA Author Manuscript
In addition, progression of the W-Beijing infections was associated with higher numbers of
MIL4+ neutrophils being drawn into the lungs and draining lymph nodes. Our prior studies
showed by immunohistochemical staining that MIL4+ neutrophils were primarily located
within the prominent necrotic center of primary lesions in an area of acellular debris 25. This
may suggest that the W-Beijing isolates are potent at inducing continuous degranulation of
neutrophils coming into these structures, releasing proteolytic enzymes and thus further
driving the necrotic process, thus in turn enhancing the likelihood of transmission to the next
host.
The possibility that regulatory T cells are designed to depress these inflammatory processes,
and yet also depress protective immunity, creates an obvious paradox. The apparent
“success” of the newly emerging strains of tuberculosis may in fact reflect their ability to
potently drive both of these processes. Recent data 26 revealing the hyperconservation of
certain epitopes across the entire family of bacterial strains raises the specter that this is a
deliberate evolutionary act by M. tuberculosis, since potent expression of immunity in the
lungs leads to tissue damage, necrosis, and subsequent escape. Hence, while it seems
intuitive to regard regulatory T cell induction in the above disease process as a negative
event, an alternative possibility is that it is a positive homeostatic response to a host
protective process that is eventually detrimental.
NIH-PA Author Manuscript
A central conclusion of our observations here are much more practical however, because
they directly relate to the current screening procedures used to test and prioritize new
vaccine candidates which are to date almost exclusively based on the use of the “laboratory
strains” H37Rv and Erdman. Not only are the W-Beijing strains far more virulent, but their
induction of regulatory T cells may interfere with the vaccine candidates. These
observations not only may explain why the W-Beijing strains remain prevalent in areas of
the world that still apply routine BCG vaccination 27, 28, 29, 30, but may also constitute a
serious impediment to the success of new tuberculosis vaccine candidates.
Acknowledgments
We thank Drs Kathy Eisenach and Barry Kreiswirth for providing strains used in this study.
Funding
This work was supported by NIH grant’s AI083856-02, AI070456 and NIH Innovation award 1DP2OD006450, and
ARRA funds. Further support was provided by the College of Veterinary Medicine and Biomedical Sciences,
Colorado State University.
NIH-PA Author Manuscript
References
1. Dye C, Espinal MA, Watt CJ, Mbiaga C, Williams BG. Worldwide incidence of multidrug-resistant
tuberculosis. J Infect Dis. 2002; 185:1197–1202. [PubMed: 11930334]
2. WHO report. Global Tuberculosis control. 2010:1–205.
3. Zhang M, Gong J, Yang Z, Samten B, Cave MD, Barnes PF. Enhanced capacity of a widespread
strain of Mycobacterium tuberculosis to grow in human macrophages. J Infect Dis. 1999;
179:1213–1217. [PubMed: 10191225]
4. Palanisamy GS, DuTeau N, Eisenach KD, Cave DM, Theus SA, Kreiswirth BN, et al. Clinical
strains of Mycobacterium tuberculosis display a wide range of virulence in guinea pigs.
Tuberculosis (Edinb). 2009; 89:203–209. [PubMed: 19251482]
5. Palanisamy GS, Smith EE, Shanley CA, Ordway DJ, Orme IM, Basaraba RJ. Disseminated disease
severity as a measure of virulence of Mycobacterium tuberculosis in the guinea pig model.
Tuberculosis (Edinb). 2008; 88:295–306. [PubMed: 18321783]
6. Bifani PJ, Mathema B, Kurepina NE, Kreiswirth BN. Global dissemination of the Mycobacterium
tuberculosis W-Beijing family strains. Trends Microbiol. 2002; 10:45–52. [PubMed: 11755085]
Tuberculosis (Edinb). Author manuscript; available in PMC 2012 September 1.
Shang et al.
Page 8
NIH-PA Author Manuscript
NIH-PA Author Manuscript
NIH-PA Author Manuscript
7. Velayati AA, Masjedi MR, Farnia P, Tabarsi P, Ghanavi J, Ziazarifi AH, et al. Emergence of new
forms of totally drug-resistant tuberculosis bacilli: super extensively drug-resistant tuberculosis or
totally drug-resistant strains in iran. Chest. 2009; 136:420–425. [PubMed: 19349380]
8. Wright A, Zignol M, Van Deun A, Falzon D, Gerdes SR, Feldman K, et al. Epidemiology of
antituberculosis drug resistance 2002–07: an updated analysis of the Global Project on AntiTuberculosis Drug Resistance Surveillance. Lancet. 2009; 373:1861–1873. [PubMed: 19375159]
9. Dye C. Doomsday postponed? Preventing and reversing epidemics of drug-resistant tuberculosis.
Nature Reviews. 2009; 7:81–87.
10. Dye C, Espinal MA. Will tuberculosis become resistant to all antibiotics? Proc Biol Sci. 2001;
268:45–52. [PubMed: 12123297]
11. Ordway D, Henao-Tamayo M, Harton M, Palanisamy G, Troudt J, Shanley C, et al. The
hypervirulent Mycobacterium tuberculosis strain HN878 induces a potent TH1 response followed
by rapid down-regulation. J Immunol. 2007; 179:522–531. [PubMed: 17579073]
12. Shafiani S, Tucker-Heard G, Kariyone A, Takatsu K, Urdahl KB. Pathogen-specific regulatory T
cells delay the arrival of effector T cells in the lung during early tuberculosis. J Exp Med. 2010;
207:1409–1420. [PubMed: 20547826]
13. Scott-Browne JP, Shafiani S, Tucker-Heard G, Ishida-Tsubota K, Fontenot JD, Rudensky AY, et
al. Expansion and function of Foxp3-expressing T regulatory cells during tuberculosis. J Exp Med.
2007; 204:2159–2169. [PubMed: 17709423]
14. Orme IM. Preclinical testing of new vaccines for tuberculosis: a comprehensive review. Vaccine.
2006; 24:2–19. [PubMed: 16139397]
15. Lenaerts AJ, Degroote MA, Orme IM. Preclinical testing of new drugs for tuberculosis: current
challenges. Trends Microbiol. 2008; 16:48–54. [PubMed: 18182291]
16. Ordway D, Palanisamy G, Henao-Tamayo M, Smith EE, Shanley C, Orme IM, et al. The cellular
immune response to Mycobacterium tuberculosis infection in the guinea pig. J Immunol. 2007;
179 :2532–2541. [PubMed: 17675515]
17. Small PM, Shafer RW, Hopewell PC, Singh SP, Murphy MJ, Desmond E, et al. Exogenous
reinfection with multidrug-resistant Mycobacterium tuberculosis in patients with advanced HIV
infection. N Engl J Med. 1993; 328:1137–1144. [PubMed: 8096066]
18. Basaraba RJ, Dailey DD, McFarland CT, Shanley CA, Smith EE, McMurray DN, et al.
Lymphadenitis as a major element of disease in the guinea pig model of tuberculosis. Tuberculosis
(Edinb). 2006; 86:386–394. [PubMed: 16473044]
19. Ordway D, Henao-Tamayo M, Shanley C, Smith EE, Palanisamy G, Wang B, et al. Influence of
Mycobacterium bovis BCG vaccination on cellular immune response of guinea pigs challenged
with Mycobacterium tuberculosis. Clin Vaccine Immunol. 2008; 15:1248–1258. [PubMed:
18508930]
20. Allen SS, Mackie JT, Russell K, Jeevan A, Skwor TA, McMurray DN. Altered inflammatory
responses following transforming growth factor-beta neutralization in experimental guinea pig
tuberculous pleurisy. Tuberculosis (Edinb). 2008; 88:430–436. [PubMed: 18555747]
21. McMurray DN, Allen SS, Jeevan A, Lasco T, Cho H, Skwor T, Warren RM, et al. Vaccineinduced cytokine responses in a guinea pig model of pulmonary tuberculosis. Tuberculosis
(Edinb). 2005; 85:295–301. [PubMed: 16253558]
22. Aguilar D, Hanekom M, Mata D, Gey van Pittius NC, van Helden PD, et al. Mycobacterium
tuberculosis strains with the Beijing genotype demonstrate variability in virulence associated with
transmission. Tuberculosis (Edinb). 2010; 90:319–325. [PubMed: 20832364]
23. Marquina-Castillo B, García-García L, Ponce-de-León A, Jimenez-Corona ME, Bobadilla-Del
Valle M, Cano-Arellano B, et al. Virulence, immunopathology and transmissibility of selected
strains of Mycobacterium tuberculosis in a murine model. Immunology. 2009; 128:123–133.
[PubMed: 19191912]
24. Nicol MP, Wilkinson RJ. The clinical consequences of strain diversity in Mycobacterium
tuberculosis. Trans R Soc Trop Med Hyg. 2008; 102:955–965. [PubMed: 18513773]
25. Basaraba RJ. Experimental tuberculosis: the role of comparative pathology in the discovery of
improved tuberculosis treatment strategies. Tuberculosis (Edinb). 2008; 88(Suppl 1):S35–47.
[PubMed: 18762152]
Tuberculosis (Edinb). Author manuscript; available in PMC 2012 September 1.
Shang et al.
Page 9
NIH-PA Author Manuscript
26. Ordway DJ, Shanley CA, Caraway ML, Orme EA, Bucy DS, Hascall-Dove L, et al. Evaluation of
standard chemotherapy in the guinea pig model of tuberculosis. Antimicrob Agents Chemother.
2010; 54:1820–1833. [PubMed: 20160055]
27. Comas I, Chakravartti J, Small PM, Galagan J, Niemann S, Kremer K, et al. Human T cell epitopes
of Mycobacterium tuberculosis are evolutionarily hyperconserved. Nature Genetics. 2010;
42:498–503. [PubMed: 20495566]
28. Sun R, Skeiky YA, Izzo A, Dheenadhayalan V, Imam Z, Penn E, et al. Novel recombinant BCG
expressing perfringolysin O and the over-expression of key immunodominant antigens; preclinical characterization, safety and protection against challenge with Mycobacterium tuberculosis.
Vaccine. 2009; 27:4412–4423. [PubMed: 19500523]
29. Abebe F, Bjune G. The emergence of Beijing family genotypes of Mycobacterium tuberculosis and
low-level protection by bacille Calmette-Guerin (BCG) vaccines: is there a link? Clin Exp
Immunol. 2006; 145:389–397. [PubMed: 16907905]
30. Kremer K, van-der-Werf MJ, Au BK, Anh DD, Kam KM, van-Doorn HR, et al. Vaccine-induced
immunity circumvented by typical Mycobacterium tuberculosis Beijing strains. Emerg Infect Dis.
2009; 15:335–339. [PubMed: 19193289]
NIH-PA Author Manuscript
NIH-PA Author Manuscript
Tuberculosis (Edinb). Author manuscript; available in PMC 2012 September 1.
Shang et al.
Page 10
NIH-PA Author Manuscript
NIH-PA Author Manuscript
FIGURE 1.
Clinical strains of M. tuberculosis TN14149 and SA161 show increased organ bacterial
loads. Panel A shows the bacterial growth in the lungs, spleens and lymph nodes from
guinea pigs receiving a low dose aerosol of Mycobacterium tuberculosis laboratory strains
H37RV (■), Erdman (●), and clinical strains TN5904 (▽), TN14149 (◇) and SA161 (☐)
was assayed on day 10, 30, and 60 after infection. Results are expressed logarithmically as
the mean Log10 bacilli colony forming units (CFU) (± SEM, n=5). Student t-test, TN14149,
SA161, TN5904 compared to H37Rv and Erdman, *p<0.050, Panel B shows the median
survival days of Hartley guinea pigs (n=10) infected with the clinical and laboratory and
strains Kaplan Meier analysis, Student t-test, TN14149, SA161, TN5904 compared to
H37Rv and Erdman, *p<0.050.
NIH-PA Author Manuscript
Tuberculosis (Edinb). Author manuscript; available in PMC 2012 September 1.
Shang et al.
Page 11
NIH-PA Author Manuscript
NIH-PA Author Manuscript
FIGURE 2.
NIH-PA Author Manuscript
Increased granulomatous responses from guinea pigs infected with the clinical strains of M.
tuberculosis TN14149 and SA161. Panel A shows representative photomicrographs from
sections of paraformaldehyde-fixed and paraffin embedded guinea pig tissues from lung (AT) which were collected on day 30 and 60 after infection with the laboratory strains H37Rv
(A, B, K, L), Erdman (C, D, M, N), MDR-TB strain 5904 (E, F, O, P), W-Beijing strains
TN14149 (G, H, Q, R) and SA161 (I, J, S, T) of M. tuberculosis. By day 30, lesions in lung
had extensive foci of mixed inflammation with central necrosis (G-J) compared to the
laboratory strains (A-D). In addition the clinical strains showed by day 60, a severe
increased in secondary lesion progression in which multiple foci of extensive inflammation
coalesced within the pulmonary parenchyma. The increased rate of progression and
involvement of large areas of lung correlated with reduce animal survival (Q-T) compared to
the laboratory strains (K-N). The MDR TN5904 strain did not show substantial differences
in bacterial load and pathology (E-F) during acute, subacute and chronic infection (O-P)
compared to the laboratory strains (A-D; K-N) Hematoxylin and Eosin staining, total
magnification=A, C, E, G, I, K, M, O, Q, S=10X and B, D, F, H, J, L, N, P, R, T=20X.
Tuberculosis (Edinb). Author manuscript; available in PMC 2012 September 1.
Shang et al.
Page 12
NIH-PA Author Manuscript
FIGURE 3.
Clinical strains of M. tuberculosis TN14149 and SA161 show increased lesion scores in the
lungs, lymph nodes and spleens. Panel A shows the lesion scores of lungs, panel B lymph
nodes and panel C, spleens for the guinea pigs on day 10, 30 and 60 after infection with the
various strains of M. tuberculosis. The histopathology was characterized using a lesion
scoring system that showed the significant extent of lung disease compared to the other
organs during chronic infection (n=5, ANOVA, *p>0.05).
NIH-PA Author Manuscript
NIH-PA Author Manuscript
Tuberculosis (Edinb). Author manuscript; available in PMC 2012 September 1.
Shang et al.
Page 13
NIH-PA Author Manuscript
NIH-PA Author Manuscript
FIGURE 4.
Flow cytometric analysis of T cell subsets accumulating in the lungs and lymph nodes over
the course of the infection with Mycobacterium tuberculosis laboratory strains H37Rv (■),
Erdman (●), and clinical strains TN5904 (▽), TN14149 (◇) and SA161 (☐). Cell numbers
expressed as total cells (×107) expressing each phenotype per 1.0 gram of each tissue (n=4,
mean values ± SEM). Cell numbers in all data sets after day-10 were significantly raised in
the two W-Beijing infections compared to the two laboratory strains (Student t-test
*p<0.01).
NIH-PA Author Manuscript
Tuberculosis (Edinb). Author manuscript; available in PMC 2012 September 1.
Shang et al.
Page 14
NIH-PA Author Manuscript
NIH-PA Author Manuscript
FIGURE 5.
Flow cytometric analysis of macrophages and neutrophils accumulating in the lungs and
lymph nodes over the course of the infection with Mycobacterium tuberculosis laboratory
strains H37RV (■), Erdman (●), and clinical strains TN5904 (▽), TN14149 (◇) and SA161
(☐). Panel A shows a representative example of macrophage gating strategy. Panel B shows
numbers of total MR-1+ macrophages and MR-1+ cells expressing MHC Class-II
moleculesin the lungs and lymph nodes over the course of the infection. Data is shown as
mean values (n=4, mean values ± SEM) for total cells ×107 per 1.0 gram of tissue. MR-1+
MHC Class-II+ cell numbers on day-30 were significantly raised in the two W-Beijing
infections compared to the two laboratory strains (Student t-test *p<0.01). Panel C shows
numbers of MIL4+ neutrophils accumulating over the course of the infection (n=4, mean
values ± SEM) for total cells ×107 per 1.0 gram of lung tissue. Cell numbers were
significantly raised in the two W-Beijing infections compared to the two laboratory strains
from day-10 onwards (Student t-test *p<0.01).
NIH-PA Author Manuscript
Tuberculosis (Edinb). Author manuscript; available in PMC 2012 September 1.
Shang et al.
Page 15
NIH-PA Author Manuscript
NIH-PA Author Manuscript
FIGURE 6.
Increased TGF , IL-10 and Foxp3 messenger RNA (mRNA) expression in guinea pig
infected with the clinical strains of M. tuberculosis TN14149 and SA161.
Panel A shows IFN- and IL-12p40 and panel B shows TGF , Foxp3 and IL-10 expression in
the lungs on days 10, 30, and 60 from guinea pigs exposure to a low dose of with
Mycobacterium tuberculosis laboratory strains H37RV (■), Erdman (●), and clinical strains
TN5904 (▽), TN14149 (◇) and SA161 (☐) were compared. Cytokine mRNA expression
was quantified using real-time reverse transcription-polymerase chain reaction. Fold
induction of mRNA was calculated from the threshold cycle (Ct) normalized to HPRT Ct
values and then to uninfected guinea pig lung cells. Results are expressed as the average
(n=4) of the fold induction in each group (± SEM).
NIH-PA Author Manuscript
Tuberculosis (Edinb). Author manuscript; available in PMC 2012 September 1.