Journal of Invertebrate Pathology 107 (2011) 202–205 Contents lists available at ScienceDirect Journal of Invertebrate Pathology journal homepage: www.elsevier.com/locate/jip Detection of single and mixed covert baculovirus infections in eastern spruce budworm, Choristoneura fumiferana populations Elizabeth M. Kemp a,b, David T. Woodward a,c, Jenny S. Cory a,b,d,⇑ a Great Lakes Forestry Centre, 1219 Queen St. E., Sault Ste. Marie, Ontario, Canada Algoma University, 1520 Queen St. E., Sault Ste Marie, Ontario, Canada c University of Guelph, 50 Stone Road East, Guelph, Ontario, Canada N1G 2W1 d Department of Biological Sciences, 8888 University Drive, Simon Fraser University, Burnaby, British Columbia, Canada b a r t i c l e i n f o Article history: Received 31 January 2011 Accepted 9 May 2011 Available online 15 May 2011 Keywords: Sublethal infection Multiplex PCR Mixed infections Pathogen ecology Vertical transmission a b s t r a c t We surveyed for covert baculovirus infections in the eastern spruce budworm, Choristoneura fumiferana (Clemens) and compared the prevalence of virus detected in a laboratory and a field population. DNA was extracted from budworm adults and then PCR with degenerate primers was used to identify individuals carrying baculovirus DNA. Multiplex PCR was then applied to the positive samples to distinguish between the multiple baculovirus types that could potentially be found in C. fumiferana populations. Covert infections were found in both the laboratory and the field population of C. fumiferana, although the frequency of infection and the composition of viruses found were very different. Overall 28% of insects from the laboratory population were positive for baculovirus DNA. Individual adults supported both single and mixed covert infections with CfMNPV plus CfDEFNPV, CfDEFNPV plus a GV and mixtures of all three viruses together. However, the majority of insects supported single virus infections, and surprisingly this virus was CfDEFNPV, a virus that is reported not to have per os activity in C. fumiferana larvae. Insects from field populations showed a very different pattern; 70.5% of individuals were baculovirus positive and all of these were positive for CfDEFNPV only. Ó 2011 Elsevier Inc. All rights reserved. 1. Introduction Baculoviruses are important natural enemies of many lepidopteran and hymenopteran species and several have been developed as biological control agents of a range of pests in agriculture and forestry. They are known to be able to persist in the environment for long periods of time as occlusion bodies (OBs), if protected from ultra violet irradiation, allowing transmission within and between generations (Cory and Myers, 2003). In addition to this environmental reservoir, baculoviruses have also been shown to persist in insect populations as covert or persistent infections which can be passed vertically from parent to offspring (Hughes et al., 1997; Burden et al., 2002, 2003; Vilaplana et al., 2010), although the mechanism by which the virus remains as a persistent infection and its role in virus population dynamics are unknown. Pre-existing covert infections have the potential to greatly influence the outcome of introduced baculovirus infections; for example, covertly infected individuals can revert to productive infections when challenged with heterologous viruses (Hughes et al., 1993; Cooper et al., 2003). Covert baculovirus infections also have the po⇑ Corresponding author at: Department of Biological Sciences, 8888 University Drive, Simon Fraser University, Burnaby, British Columbia, Canada. E-mail address: jsc21@sfu.ca (J.S. Cory). 0022-2011/$ - see front matter Ó 2011 Elsevier Inc. All rights reserved. doi:10.1016/j.jip.2011.05.015 tential, theoretically, to alter host population dynamics (e.g. Bonsall et al., 2005). Thus, it is possible that the background levels of covert infection in a population could be an important factor in understanding insect–baculovirus dynamics in natural populations and could also influence the outcome of microbial pest control programs. Additionally, if the frequency, or type, of covert infections in laboratory stocks differ from those found in the field, laboratory-based efficacy testing may not accurately predict the outcome of planned control strategies. To this end, we have undertaken a survey of existing covert infections of baculoviruses in both laboratory-reared and field-collected populations of eastern spruce budworm, Choristoneura fumiferana, an economically important forest pest that exhibits cyclical population dynamics, with devastating outbreaks occurring on average every 35 years (Royama et al., 2005). Several baculoviruses have been isolated from C. fumiferana, including a nucleopolyhedrovirus (CfMNPV) (de Jong et al., 2005) and a granulovirus (Bah et al., 1999; Lucarotti et al., 2004). A third baculovirus has also been isolated from C. fumiferana and designated CfDEFNPV because it is unable to infect per os, although it is infective by injection into the haemocoel (Lauzon et al., 2005). CfDEFNPV appears to be a distinct species, and is more related to other Group I baculoviruses, such as Anticarsia gemmatalis NPV, than it is to CfMNPV (Lauzon et al., 2005). When introduced in the presence of CfMNPV, CfDEFNPV is able to infect and replicate, 203 E.M. Kemp et al. / Journal of Invertebrate Pathology 107 (2011) 202–205 which has led to the relationship being described as ‘symbiont-like’ (Lauzon et al., 2005). Other viruses have also been identified in C. fumiferana, including a cypovirus (Echeverry et al., 1997) and an entomopoxvirus (Bird, 1976). None of these viruses appears to be common as overt infections in field populations of C. fumiferana (Lucarotti et al., 2004), although the authors used DNA dot blot hybridization to detect CfMNPV and C. fumiferana GV and this technique is unlikely to be sensitive enough to detect sublethal infections, and it is not clear whether these probes would have detected CfDEFNPV. 2. Materials and methods 2.1. Insects Second instar larvae were collected from laboratory stocks of diapausing C. fumiferana reared by Insect Production Services at the Great Lakes Forestry Centre, Sault Ste. Marie, Ontario, Canada. Larvae were reared on artificial diet at 23 °C, 60% relative humidity and a 16 h:8 h light/dark cycle and kept until they emerged as adults. C. fumiferana pupae, plus a few late instar larvae, were also collected arbitrarily from white spruce (Picea glauca ((Moench) Voss) trees in Sault Ste. Marie, Ontario (N46° 330 , W84° 160 ) in late June, and kept in the laboratory until they emerged as adults. One hundred and five insects were examined from both laboratory and field populations. may amplify other GVs present, so the results for these primers are referred to as granulovirus rather than specifically Choristoneura spp. GV. The orfs selected for multiplex PCR were also chosen to be located at a distance from the lef-8 orf to decrease the probability that we were amplifying short stretches of the virus genome which may be inserted into the host genome, or were not part of full-length virus genomic DNA. The orfs chosen were: CfMNPV lef-8 (orf 48) and orf 90; CfDEFNPV lef-8 (orf 47) and orf 142; and ChocGV lef-8 (orf 107) and gran (orf 1). All templates were then amplified with the following multiplex primer set: Mpx1-Cf90F ATGGACA CATCATTTTGTCGCCGGAA, Mpx1-Cf90R, TACTATTCGTCGCAATA GAAGTGGCA to amplify orf 90 from CfMNPV, Mpx1-DEF142F, CAGTCAACATGAATCAAAACGCGGTA, Mpx1-DEF142R GTACCGGAA AACGGTCGCTCAACGAC to amplify orf 142 from CfDEFNPV and Mpx1-granF, CACCTAAAAGCTTAGGTTCTGTGC, Mpx1-granR, TCTTGGACAAGTTGATGCGTTCCA to amplify gran from GVs. PCR conditions were as follows: 1  PCR buffer (Invitrogen), 300 lM dNTPs, 8 mM MgCl2, 80 lM BSA, 0.2 lM each primer, 2 U Taq polymerase (Invitrogen) in a 25 ll reaction volume. The reaction was amplified by an initial denaturation step of 95 °C for 5 min, followed by 35 cycles of 45 s at 95 °C, 1 min at 55 °C, 2 min at 72 °C and a final extension of 10 min at 72 °C. This multiplex primer set produced easily distinguishable products for CfDEFNPV (239 bp), CfMNPV (667 bp) and granulovirus (464 bp). PCR data were compared using Pearson’s v2. 4. Results and discussion DNA was extracted from apparently healthy C. fumiferana adults using a Qiagen DNeasy mini kit. The samples were screened in two stages using PCR; first, degenerate primers were used to detect any baculovirus in the adults, and second, samples positive for the first screen were then probed with multiplex primers that were specific for each of the three baculoviruses that had been found previously in C. fumiferana. As little sequence information was available for C. fumiferana GV and no DNA was available, C. occidentalis GV (ChocGV) sequence data was used to design primers (Escasa et al., 2006). PCR was first carried out with Invitrogen recombinant Taq polymerase using the following degenerate primers: prL8-1 TTYTTYCAYGGNGARATGAC and prL8-2 CAYRTANGGRTCYTCNGC that were adapted from Lange et al., (2004) to amplify a region of the lef-8 orf which is conserved between all known baculoviruses, that resulted in a 756 bp product for CfMNPV. The high degree of degeneracy of the outer primer set could lead to reduced sensitivity and specificity relative to PCR with specific primers, so a nested degenerate primer pair was designed to overcome this problem. A sample of the product from the first reaction (1 ll) was used as a template for the following nested primers: lef-8intDF GCNTTYAA NRAYMGDCCNAC and lef-8intDR ACNKCACHANHGTCCACA. The nested primers resulted in a product of 545 bp for CfMNPV. Amplification was carried out with Invitrogen recombinant Taq polymerase according to the manufacturer’s recommendations with cycling conditions of an initial denaturation step of 95 °C for 5 min, followed by 25 cycles of 1 min at 95 °C, 1 min at 55 °C, 1 min at 72 °C and a final extension of 10 min at 72 °C. PCR products were resolved by electrophoresis on a 1% agarose gel. Compatible multiplex primers were designed using FastPCR Professional experimental test version 5.0.45 according the recommendations in Heregariu et al., (1997). The open reading frames for CfMNPV and CfDEFNPV multiplex PCR were selected carefully to ensure selective amplification of the correct isolate in the presence of the other viruses, based on lack of significant sequence homology in the published genome sequences. The primers for the GV were designed not to amplify CfMNPV and CfDEFNPV but Baculovirus DNA was detected in both the laboratory-reared and field-collected C. fumiferana adults. In the first stage of PCR testing, the degenerate lef-8 primers identified 29 laboratoryreared adults carrying baculoviral DNA, and 74 positive individuals from the field-collected samples. The prevalence of covert infections in the laboratory stock (28%) was considerably lower than that found in the wild population tested (70.5%) (Pearson’s v2 = 38.58, df = 1, P < 0.0001). Individuals were divided by sex, however, for a small number of field-collected samples we were not able to visually identify the sex due to damage to the bodies collected, these are labeled as ‘unknown’ in the figure (Fig. 1). There was no difference between the sexes in the proportion of individuals that were positive for baculovirus DNA (Pearson’s v2 = 0.43, df = 1, P > 0.05). % of individuals positive for viral DNA 3. PCR testing of adult C. fumiferana 80 n = 46 n = 46 Field collected 70 Laboratory-reared 60 50 n = 13 40 n = 59 30 n = 46 20 10 0 Male Female Unknown Sex of individuals Fig. 1. Percentage of C. fumiferana adults positive for baculovirus DNA in fieldcollected and laboratory-reared populations. PCR was carried out using degenerate primers designed to amplify lef-8 sequences from baculoviruses. A number of the field-collected insects were not intact and it was not possible to visually identify the sex of these samples (listed as unknown). Numbers of individuals tested for each population is shown above each bar. 204 E.M. Kemp et al. / Journal of Invertebrate Pathology 107 (2011) 202–205 % of individuals testing positive for virus combination All positive individuals were retested using the multiplex primer set to identify the viruses present and in which combinations. Field-collected individuals were found to carry only CfDEFNPV, whilst a small number of laboratory-reared individuals were found with mixed virus types, although the majority of individuals also carried CfDEFNPV alone. Of the 29 adults from the laboratory colony positive for baculovirus DNA, multiplex PCR identified that all of these contained CfDEFNPV, and five of these individuals were positive for multiple virus types (Fig. 2). One individual tested positive for lef-8 DNA but no product was found with any of the multiplex primers, introducing the possibility of an additional baculovirus isolate being present. It is possible that the first result was a false positive, although the negative controls (water controls for extraction and PCR) for all PCR reactions were negative and all other samples tested resulted in amplicons of the expected sizes with the multiplex primer set following a positive result with the lef-8 primers. Insect-based negative controls in the assay were not feasible as there is no way to guarantee that an insect is free of virus, other than by using PCR, which will always be limited by having a lower sensitivity threshold. However, the large number of insects that were negative in the assay and predictability of the amplicon sizes lead us to believe that false positives were not an issue. The discovery of CfDEFNPV in apparently healthy laboratory cultures may explain the occasional contamination of CfMNPV occlusion bodies amplified in C. fumiferana with CfDEFNPV as observed by genomic DNA extraction and restriction profiling (E. Kemp, unpubl. data). One potential issue with multiplex PCR is that the smallest PCR product is likely to be amplified with the greatest efficiency, which in this case is CfDEFNPV. This could potentially lead to overestimation of CfDEFNPV relative to other baculovirus types; however, CfMNPV primers were actually more sensitive, and able to consistently detect 1 pg DNA per reaction, whereas the CfDEFNPV primers were only able to consistently detect 10 pg per reaction (with only the expected template present) (data not shown). Therefore we do not think that this is likely to be a significant issue. It is interesting that the structure of the covert virus community found in the wild C. fumiferana population differs from that of the laboratory-reared population. In the field-collected samples only a single virus isolate, CfDEFNPV, was identified, whereas the laboratory-reared population contained at least three distinct viruses, CfMNPV, CfDEFNPV and a GV. The wild populations tested were collected from several trees in a single location, which may explain the conservation of the CfDEFNPV infection across most of the individuals tested. More samples from a wider geographical range CfDEFNPV+CfMNPV+GV 35 CfDEFNPV + GV 30 CfMNPV + CfDEFNPV 25 CfDEFNPV only 20 15 10 5 0 Male Female would need to be tested to see if this is a general feature of C. fumiferana populations, although its presence is intriguing. The presence of multiple virus isolates in different combinations in the laboratory culture may suggest that these covert infections could have been initiated on more than one occasion following exposure to single or multiple virus isolates. The laboratory culture is occasionally supplemented from field populations so it is possible that individuals with different covert infections could have been introduced over time. It has been demonstrated that individuals that have survived challenge with a baculovirus as a larva can develop a covert infection in the next generation (Burden et al., 2002; Cabodevilla et al., 2011). However, it is not known how long covert infections induced in this manner can persist. CfMNPV and Choristoneura spp. GVs are known to be infectious to C. fumiferana, whereas CfDEFNPV alone does not result in overt infections when introduced per os (Li et al., 1999; Woodward and Cory, unpublished data); however, unexpectedly, CfDEFNPV was identified as being the most prevalent baculovirus in both wild and laboratory populations. We believe this is the first example of a covert baculovirus infection caused by a virus isolate that is apparently not infectious per os to the host in which it is found. It is predicted that pathogen strains that are transmitted vertically are less virulent than those that rely primarily on horizontal transmission (e.g. Lipsitch et al., 1995), thus we might expect baculovirus variants that produce covert infections to be adapted in some way to vertical transmission, such as by showing reduced pathogenicity. There is some recent evidence from Spodoptera exigua NPV that supports this supposition (Cabodevilla et al., 2011). In the case of C. fumiferana, it is not a particular strain of CfMNPV that appears to be transmitted vertically, but a different virus species. The fact that CfDEFNPV cannot infect C. fumiferana by ingestion means that vertical transmission might be the only route available for it to persist within the budworm population. It also suggests the possibility that covert infections might be more common in viruses that are only partially infective for a particular insect species, and that covert infection could result from exposure to baculoviruses from other species, that cannot infect on their own, but might under specific circumstances be introduced by a fortuitous co-infection event. There are other data that show that baculoviruses that under normal circumstances cannot infect alone, can be maintained in virus populations by co-occlusion and where co-infection can increase (or decrease) resulting host mortality (e.g. López-Ferber et al., 2003). However, these interactions are usually among strains of one species of baculovirus, some of which lack key infection genes, rather than two different species, neither of which have been shown to lack known virulence genes (De Jong et al., 2005; Lauzon et al., 2005), thus the origin of the CfMNPV and CfDEFNPV interaction is harder to speculate on. Further experiments are needed to analyze the nature and biological consequences of covert baculovirus infections in C. fumiferana. However, the intriguing questions are how is CfDEFNPV retained as a covert infection in budworm populations, and how is this related to its exposure to and interaction with CfMNPV (and perhaps other viruses)? In addition, the presence of CfDEFNPV at such high levels in natural populations of C. fumiferana could influence the response of wild budworm populations to CfMNPV artificially introduced as part of a biological control program, and it would be interesting to carry out field experiments to study this interaction. Total Sex Fig. 2. Presence of DNA from multiple baculovirus types in individual adults from laboratory stocks of C. fumiferana. A total of 105 individuals (46 males and 59 females) isolated from laboratory stocks of C. fumiferana were tested with multiplex PCR primers to identify the presence of CfDEFNPV, CfMNPV and GV. Acknowledgments We would like to thank Sharon Hooey for collecting the field populations of C. fumiferana and the Insect Production Services team at the Great Lakes Forestry Centre, Sault Ste. Marie, Ontario E.M. Kemp et al. / Journal of Invertebrate Pathology 107 (2011) 202–205 for providing the laboratory-reared insects. We would like to thank Peter Krell and Basil Arif for discussion of the work. This work was supported by a Canadian Regulatory System for Biotechnology (CRSB) Grant from Natural Resources Canada and NSERC Strategic Grant STGTP 322185-05. JSC would like to acknowledge the support of the NSERC Canada Research Chair Program. References Bah, A., Lucarotti, C.J., Arella, M., Guertin, C., 1999. Choristoneura fumiferana granulovirus: sequence analysis and 50 characterization of ORF891. Arch. Virol. 144, 737–746. Bird, F.T., 1976. Cell-proliferation in spruce budworm, Choristoneura fumiferana (Lepidoptera: Tortricidae) infected with entomopox virus. Can. Entomol. 108, 859–864. Bonsall, M.B., Sait, S.M., Hails, R.S., 2005. Invasion and dynamics of covert infection strategies in structured insect–pathogen populations. J. Anim. Ecol. 74, 464– 474. Burden, J.P., Griffiths, C.M., Cory, J.S., Smith, P., Sait, S.M., 2002. Vertical transmission of sublethal granulovirus infection in the Indian meal moth, Plodia interpunctella. Mol. Ecol. 11, 547–555. Burden, J.P., Nixon, C.P., Hodgkinson, A.E., Possee, R.D., Sait, S.M., King, L.A., Hails, R.S., 2003. Covert infections as a mechanism for long-term persistence of baculoviruses. Ecol. Letts. 6, 524–531. Cabodevilla, O., Ibañez, I., Simón, O., Murillo, R., Caballero, P., Williams, T., 2011. Occlusion body pathogenicity, virulence and productivity traits vary with transmission strategy in a nucleopolyhedrovirus. Biol. Control 56, 184–192. Cooper, D., Cory, J.S., Theilmann, D.A., Myers, J.H., 2003. Nucleopolyhedroviruses of forest and western tent caterpillars: cross-infectivity and evidence for activation of latent virus in high-density field populations. Ecol. Entomol. 28, 41–50. Cory, J.S., Myers, J.H., 2003. The ecology and evolution of insect baculoviruses. Annu. Rev. Ecol. Evol. Syst. 34, 239–272. De Jong, J.G., Lauzon, H.A.M., Dominy, C., Poloumienko, A., Carstens, E.B., Arif, B.M., Krell, P.J., 2005. Analysis of the Choristoneura fumiferana nucleopolyhedrovirus genome. J. Gen. Virol. 86, 929–943. 205 Echeverry, F., Bergeron, J., Kaupp, W., Guertin, C., Arella, M., 1997. Sequence analysis and expression of the polyhedrin gene of Choristoneura fumiferana cytoplasmic polyhedrosis virus (CfCPV). Gene 198, 399–406. Escasa, S.R., Lauzon, H.A.M., Mathur, A.C., Krell, P.J., Arif, B.M., 2006. Sequence analysis of Choristoneura occidentalis granulovirus genome. J. Gen. Virol. 87, 1917–1933. Heregariu, O., Heerema, N.A., Dlouht, S.R., Vance, G.H., Vogt, P.H., 1997. Multiplex PCR: critical parameters and step-by-step protocol. Biotechniques 23, 504–511. Hughes, D.S., Possee, R.D., King, L.A., 1993. Activation and detection of a latent baculovirus resembling Mamestra brassicae nuclear polyhedrosis virus in M. brassicae insects. Virology 194, 608–615. Hughes, D.S., Possee, R.D., King, L.A., 1997. Evidence for the presence of a low-level, persistent baculovirus infection of Mamestra brassicae insects. J. Gen. Virol. 78, 1801–1805. Lange, M., Wang, H., Zhihong, H., Jehle, J.A., 2004. Towards a molecular identification and classification system of lepidopteran-specific baculoviruses. Virology 325, 36–47. Lauzon, H.A., Jamieson, P.B., Krell, P.J., Arif, B.M., 2005. Gene organization and sequencing of the Choristoneura fumiferana defective nucleopolyhedrovirus genome. J. Gen. Virol. 86, 945–961. Li, X., Lauzon, H.A.M., Sohi, S.S., Palli, S.B., Retnakaran, A., Arif, B.M., 1999. Molecular analysis of the p74 gene of Choristoneura fumiferana multicapsid nucleopolyhedroviruses CfMNPV and CfDEFNPV. J. Gen Virol 80, 1833–1840. Lipsitch, M., Nowak, M.A., Ebert, D., May, R.M., 1995. The population dynamics of vertically and horizontally transmitted parasites. Proc. R. Soc. Ser. B 260, 321– 327. López-Ferber, M., Simón, O., Williams, T., Caballero, P., 2003. Defective or effective? Mutalistic interactions between virus genotypes. Proc. R. Soc. Ser. B 270, 2249– 2255. Lucarotti, C.J., Eveleigh, E.S., Royama, T., Morin, B., McCarthy, P., Ebling, P.M., Kaupp, W.J., Guertin, C., Arella, M., 2004. Prevalence of viruses in spruce budworm (Lepidoptera: Tortricidae) populations in New Brunswick. Can. Entomol. 136, 255–264. Royama, T., MacKinnon, W.E., Kettela, E.G., Carter, N.E., Hartling, L.K., 2005. Analysis of spruce budworm outbreak cycles in New Brunswick, Canada, since 1952. Ecology 86, 1212–1224. Vilaplana, L., Wilson, K., Redman, E.M., Cory, J.S., 2010. Pathogen persistence in migratory insects: high levels of vertically-transmitted virus infection in field populations of the African armyworm. Evol. Ecol. 24, 147–160.