Experimental
Biology and Medicine
http://ebm.sagepub.com/
Differential Mechanisms of Ca2+ Release from Vascular Smooth Muscle Cell Microsomes
Ahad N.K. Yusufi, Jingfei Cheng, Michael A. Thompson, John C. Burnett and Joseph P. Grande
Exp Biol Med (Maywood) 2002 227: 36
The online version of this article can be found at:
http://ebm.sagepub.com/content/227/1/36
Published by:
http://www.sagepublications.com
On behalf of:
Society for Experimental Biology and Medicine
Additional services and information for Experimental Biology and Medicine can be found at:
Email Alerts: http://ebm.sagepub.com/cgi/alerts
Subscriptions: http://ebm.sagepub.com/subscriptions
Reprints: http://www.sagepub.com/journalsReprints.nav
Permissions: http://www.sagepub.com/journalsPermissions.nav
>> Version of Record - Jan 1, 2002
What is This?
Downloaded from ebm.sagepub.com by guest on June 14, 2013
Differential Mechanisms of Ca2+ Release from
Vascular Smooth Muscle Cell Microsomes
AHAD N.K. YUSUFI, JINGFEI CHENG, MICHAEL A. THOMPSON, JOHN C. BURNETT,
JOSEPH P. GRANDE1
AND
Renal Pathophysiology Laboratory, Department of Laboratory Medicine and Pathology, Mayo
Clinic, Mayo Medical School, Rochester, Minnesota 55905
The release of Ca2+ from intracellular stores is a fundamental
element of signaling pathways involved in regulation of vascular tone, proliferation, apoptosis, and gene expression. Studies
of sea urchin eggs have led to the identification of three functionally distinct Ca2+ signaling pathways triggered by IP3,
cADPR, and NAADP. The coexistence and functional relevance
of these distinct intracellular Ca2+ release systems has only
been described in a few mammalian cell types. The purpose of
this study was to determine whether the IP3, cADPR, and
NAADP Ca2+ release systems coexist in smooth muscle cells
(SMC) and to determine the specificity of these intracellular
Ca2+ release pathways. Microsomes were prepared from rat aortic SMC (VSMC) and were loaded with 45Ca2+. cADPR, NAADP,
and IP3 induced Ca2+ release from VSMC microsomes in a dosedependent fashion. Heparin blocked only IP3-mediated Ca2+ release, whereas the ryanodine channel inhibitors 8-Br-cADPR
and ruthenium red blocked only cADPR-induced Ca2+ release.
Nifedipine, an L-type Ca2+ channel blocker, inhibited NAADP
elicited Ca2+ release, but had no effect on IP3- or cADPRmediated Ca2+ release. An increase in pH from 7.2 to 8.2 inhibited cADPR-mediated Ca2+ release, but had no effect on IP3- or
NAADP-induced Ca2+ release. By RT-PCR, VSMC expressed
ryanodine receptor types 1, 2, and 3. Ca2+-dependent binding of
[3H]-ryanodine to VSMC microsomes was enhanced by the ryanodine receptor agonists 4-chloro-methyl-phenol (CMP) and
caffeine, but was inhibited by ruthenium red and cADPR. We
conclude that VSMC possess at least three functionally distinct
pathways that promote intracellular Ca2+ release. IP3-, cADPR-,
and NAADP-induced intracellular Ca2+ release may play a critical role in the maladaptive responses of VSMC to environmental
stimuli that are characteristically associated with hypertension
and/or atherogenesis.
[Exp Biol Med Vol. 227(1):36–44, 2002]
Key words: vascular smooth muscle; inositol-1,4,5-trisphosphate
(IP3); cyclic ADP-ribose (cADPR); nicotinic acid-adenine dinucleotide phosphate (NAADP); calcium (Ca++)
This work was supported by the National Institutes of Health (grants DK16105 and
55603).
1
To whom requests for reprints should be addressed at Mayo Foundation, 200 First
Street SW, Rochester, MN 55905. E-mail: grande.joseph@mayo.edu
Received June 13, 2001.
Accepted August 27, 2001.
1535-3702/02/2271-0036$15.00
Copyright © 2002 by the Society for Experimental Biology and Medicine
36
T
he release of Ca2+ from intracellular stores and endoplasmic and sarcoplasmic reticulum (ER/SR) is
one of the key signal transduction mechanisms in the
regulation of numerous cellular functions (1–3), including
contractility, protein synthesis and turnover, hormone secretion, proliferation, and activation. Currently, at least three
distinct intracellular Ca2+-mobilizing systems have been
identified. The most comprehensively studied is the Ca2+
release triggered by inositol-1,4,5-trisphosphate (IP3), an
agonist that binds to a specific IP3-receptor/Ca2+ channel
(4–6). A second major Ca2+ signaling pathway is triggered
by cyclic ADP-ribose (cADPR), an adenine nucleotide synthesized from -NAD by the enzyme ADP-ribosyl cyclase
(7–9). cADPR induces Ca2+ release via the ryanodine receptor/channel (RyR) by increasing the sensitivity of RyR
for Ca2+, thereby causing Ca2+ release by a Ca2+-induced
Ca2+ release mechanism (CICR) (9, 10). Ryanodine receptors have been described in vascular and cardiac muscle
cells and in several nonexcitable cell types (11). We have
recently demonstrated that rat mesangial cells, contractile
cells with smooth muscle-like properties, possess elements
of a cADPR→RyR→Ca2+ signaling pathway (12).
A third intracellular Ca2+ signaling pathway, activated
by nicotinic acid-adenine dinucleotide phosphate
(NAADP), has recently been identified through studies of
Ca2+ release in sea urchin eggs (7, 9, 10, 13). NAADP, an
analog of -NADP, controls intracellular Ca2+ release by a
mechanism fundamentally different from that of IP3 or
cADPR (13). We have recently shown that NAADP elicits
specific Ca2+ release from microsomes prepared from a variety of cells and cell lines, suggesting that the capacity for
NAADP-induced Ca2+ release is widespread in mammalian
cells (14).
The physiologic relevance of intracellular Ca2+ signaling pathways triggered by IP3, cADPR, and NAADP has
not been adequately defined. The IP3→IP3R→Ca2+ release
system is ubiquitously distributed (5, 15); this pathway mediates rapid intracellular Ca2+ release in response to vasoactive mediators such as endothelin or vasopressin (2, 6). In
addition to promoting Ca2+-induced Ca2+ release (9), the
cADPR→RyR→Ca2+ release pathway is involved in insulin
CALCIUM RELEASE FROM VSMC MICROSOMES
Downloaded from ebm.sagepub.com by guest on June 14, 2013
release by pancreatic  cells (16) and gonadotrophin releasing hormone, signaling (17). Recent studies have shown that
the activity of ADP-ribosyl cyclase, the enzyme responsible
for cADPR synthesis, is upregulated in various tissues and
cell types by steroid superfamily hormones such as retinoic
acid (18), -estradiol (19), or 3,5,3⬘-triiodothyronine (20).
Although little is known about NAADP-elicited intracellular Ca2+ release in mammalian cells, we have recently demonstrated that retinoic acid increases capacity for NAADP
biosynthesis in rat mesangial cells (21). The IP3, cADPR,
and NAADP signaling systems coexist in ascidian oocytes,
and each system mediates distinct changes associated with
fertilization and early development of the oocyte (22).
The IP3, cADPR, and NAADP intracellular Ca2+ signaling pathways have not previously been directly compared in mammalian cells. Since alterations in intracellular
Ca2+ have been shown to play a major role in vascular
smooth muscle contractility, hypertrophy, and hyperplasia
(23), these functionally distinct intracellular Ca2+ signaling
pathways may direct adaptive cellular responses to pathobiologic stimuli. Here, we report that primary cultures of rat
aortic smooth muscle cells (SMCs) possess functionally distinct Ca2+ signaling pathways triggered by IP3, cADPR, and
NAADP. IP3 augments ryanodine binding to smooth muscle
microsomes, indicating a potential site of crosstalk between
the IP3 and cADPR signaling pathways.
Materials and Methods
[3H]-ryanodine and 45Ca2+ were purchased from Amersham Pharmacia Biotech (Piscataway, NJ). cADPR,
8-bromo-cyclic ADP ribose (8-Br-cADPR), ADPR, and ruthenium red (RR) were purchased from Calbiochem (La
Jolla, CA). 4-Cl-methyl-phenol (CMP) was from Aldrich
(Milwaukee, WI). Nicotinamide guanine dinucleotide
(NGD), cyclic GDP-ribose (cGDPR), caffeine, and calmodulin were obtained from Sigma (St. Louis, MO). All other
chemicals and biochemicals, all of highest purity grades,
were from other standard suppliers.
Vascular SMC (VSMC) Isolation and Culture.
VSMC were isolated and subcultured from rat aorta explant
outgrowths as previously described (24). Briefly, the aorta
was isolated from 200- to 250-g male Sprague-Dawley rats,
cleaned in ice-cold sterile 0.9% NaCl, endothelium was removed by scraping, and adventitia was removed with surgical tweezers. The tissue was then minced and placed in
100-mm petri dishes with Dulbecco’s modified Eagle’s medium (DMEM) supplemented with 10% fetal bovine serum,
100 U/ml penicillin, 100 g/ml streptomycin, and 2.5 g/
ml amphotericin B. VSMC outgrowths were characterized
by positive immunocytochemical staining against ␣-smooth
muscle actin and phase-contrast microscopy as previously
described (24, 25). Cell cultures were maintained at 37°C in
an atmosphere of 95% air and 5% CO2. After reaching
confluence on 100 mm-diameter dishes, cells were washed
twice with phosphate-buffered saline (PBS) and they were
incubated in serum-free DMEM. Cells were used between
passages 4 and 12.
Isolation of Microsomes. Microsomal fractions
were prepared from harvested cultured rat VSMC as previously described (21, 26). In brief, harvested cells were
chilled to 4°C and were suspended in a buffer containing
300 mM sucrose, 10 mM HEPES, 0.1 mM EDTA, and 0.5
mM PMSF (pH 7.4) and homogenized by polytron (3 × 30
sec at setting 10). The homogenate was centrifuged for 10
min at 1600g, and the pellet was discarded. The supernatant
was further centrifuged at 11,000g for 20 min, and the supernatant thus obtained was ultracentrifuged at 100,000g for
1 hr. The pellet was resuspended in a small volume of
homogenizing buffer using a Dounce homogenizer. The microsomes were then either used fresh for measurement of
45
Ca2+ release, or were divided into aliquots, quickly frozen,
and stored at −80°C for measurement of [3H]-ryanodine
binding (12). Storage at −80°C preserved the [ 3 H]ryanodine binding capacity of microsomes. The protein
content of fractions was determined by the method of
Lowry et al. (27).
PCR Analysis. Total RNA was isolated from VSMC
using the RNeasy Total RNA Isolation kit (Qiagen, Valencia, CA) according to the manufacturer’s protocol. Reverse
transcription and PCR amplification were performed using
the GeneAmp System (Perkin Elmer, Branchburg, NJ).
PCR analysis of RyR-1, RyR-2, and RyR-3 was performed
essentially as previously described (28). Design of PCR
primers was based upon GenBank accession numbers
X83932 (RyR-1), X83933 (RyR-2), and X83934 (RyR-3)
(28). The nucleotide sequence and length of expected PCR
products for each primer pair are: RyR-1 (s), GAAGGTTCTGGACAAACACGGG; RyR-1 (as), TCGCTCTTGTTGTAGAATTTGCGG (435 bp); RyR-2 (s), GAATCAGTGAGTTACTGGGCATGG; RyR-2 (as), CTGGTCTCTGAGTTCTCCAAAAGC (635 bp); RyR-3 (s),
AGAAGAGGCCAAAGCAGAGG; RyR-3 (as), GGAGGCCAACGGTCAGA (269 bp). All PCR products were
was sequenced in both orientations. To exclude the possibility that genomic DNA rather than cDNA was amplified,
control reactions were performed in which the reverse transcription step was omitted prior to PCR amplification. Additional negative control reactions were performed in which
the template was omitted.
[3H]-Ryanodine Binding. This was carried out as
previously described (12, 29, 30). Microsomes (100–200 g
of protein) were incubated for 2 hr at 37°C in a medium
containing (final concentration) 600 mM KCl, 100 M
EGTA, 150 M Ca2+, 0.2 mM PMSF, 25 mM HEPES (pH
7.2), and 30 nM [3H]-ryanodine (54.7 Ci/mm). Free [3H]ryanodine was separated from [3H]-ryanodine bound to microsomes by a rapid filtration technique using Whatman
GF/B filters, followed by three subsequent washes with icecold water. The [3H]-ryanodine radioactivity that remained
CALCIUM RELEASE FROM VSMC MICROSOMES
Downloaded from ebm.sagepub.com by guest on June 14, 2013
37
on the filters was measured by liquid scintillation counting.
The high-affinity Ca2+-dependent specific [3H]-ryanodine
binding was calculated as the difference of total binding and
nonspecific binding, determined in the presence of RR (10
M).
45
Ca2+ Release from Microsomes. Freshly prepared microsomes (approximately 100 g of protein) were
passively loaded by incubating for 3 hr at room temperature
(21°C) in a medium containing 100 mM NaCl, 25 mM
HEPES (pH 7.2), 1 mM CaCl2, and 1 Ci of 45Ca2+. Release of 45Ca2+ from loaded microsomes was initiated by
10-fold dilution of microsomal suspension with a buffer
containing 100 mM NaCl, 1 mM EGTA, 1 mM MgCl2, and
25 mM HEPES (pH 7.2), as previously described (26). After
10 sec, the suspension was further diluted in a medium of
identical composition that contained agonists or antagonists
to be tested. 45Ca2+ efflux was stopped at 90 sec after the
second dilution with added test agents. 45Ca2+ retained in
microsomes was separated from free 45Ca2+ by rapid filtration using Whatman GF/B filters. The filters were rinsed
three times with a solution containing 100 mM NaCl, 1 mM
EGTA, 4 mM MgCl2, 10 M ruthenium red, and 25 mM
HEPES (pH 7.2). The 45Ca2+ retained in microsomes was
determined by liquid scintillation counting.
Synthesis of NAADP. The NAADP synthetic capacity was assessed as previously described (21). In brief,
membrane fraction of homogenized cells (0.3 mg/ml) was
incubated with 0.2 mM -NADP and 7 mM nicotinic acid
at 37°C in a medium containing 0.25 M sucrose and 20 mM
Tris HCl (pH 6.5) for 60 min. The content of NAADP was
determined using a sea urchin egg homogenate Ca2+ release
bioassay (21, 31).
Sea Urchin Egg Homogenate Bioassay. Homogenates from sea urchin eggs (Lytechinus pictus) were
prepared as described previously (21, 31). Frozen homogenates were thawed in a 17°C water bath and diluted to
Figure 1. Dose-dependent effects of IP3, ●; NAADP, 䉲; and
cADPR, 䊏 on Ca2+ release from VSMC microsomes. Data are representative of three independent experiments.
38
1.25% in a medium containing 2 U/ml creatine kinase, 4
mM phosphocreatine, 1 mM ATP, and 3 M fluo-3. Fluo-3
fluorescence was monitored at 490 nm excitation and 535
nm emission in a 250-l cuvette at 17°C with a circulating
water bath and continuously mixed with a magnetic stirring
bar using a Hitachi F-2000 spectrofluorimeter (Hitachi, Tokyo, Japan).
Statistical Analysis. Data presented are representative of at least three independent experiments performed in
triplicate, as indicated in figure legends. Statistical analysis
was performed using InStat (GraphPad, San Diego, CA).
Group or pairwise comparisons were evaluated by the Students t test; P values of <0.05 were considered statistically
significant.
Results
Dose-Dependent Ca2+ Release. IP3, cADPR, and
NAADP induced Ca2+ release from VSMC microsomes,
indicating that VSMC possess elements of all three intracellular Ca2+ signaling pathways. Microsomal Ca2+ release
by the agonists is dose-dependent. Maximal Ca2+ release by
10 M cADPR and 10 M NAADP was similar to that
elicited by 8 M IP3 (Fig. 1).
Effect of Specific Ca2+ Release Antagonists.
We further characterized specificity of microsomal Ca2+
release by IP3, cADPR, and NAADP. Heparin (1 mg/ml), a
specific IP3 receptor blocker, abolished IP3-elicited microsomal Ca2+ release. However, RR, an inhibitor of the ryanodine channel/receptor (RyR), failed to block IP3-mediated
microsomal Ca2+ release (Fig. 2A). cADPR-elicited microsomal Ca 2+ release was completely blocked by coadministration of cADPR either with 8-bromo-cADPR (an
antagonist of cADPR) (32) or with RR (a ryanodine channel
blocker; Fig. 2B). Heparin, an IP3 receptor blocker, had no
effect on cADPR-elicited Ca2+ release (data not shown).
NAADP-triggered Ca2+ release was not inhibited by heparin
or by RR (Fig. 2C). -NADP, a biosynthetic precursor of
NAADP, failed to induce Ca2+ release from VSMC microsomes (Fig. 2C). Pretreatment of NAADP with alkaline
phosphatase (25 U/mL) at 35°C for 10 min abolished its
Ca2+ releasing activity (data not shown). These studies provide evidence that Ca2+ release from VSMC is specific for
NAADP and not its biosynthetic precursor (-NADP) or its
degradation product (NAAD). Nifedipine, an L-type Ca2+
channel blocker, completely abolished NAADP-elicited
Ca2+ release (Fig. 3). Nifedipine had no effect on IP3- or
cADPR-mediated Ca2+ release (Fig. 3).
Effect of pH on Ca2+ Release by IP3, cADPR,
and NAADP. In agreement with our previous findings in
sea urchin eggs and our observations in cultured rat mesangial cells (14, 33), IP3- or NAADP-induced Ca2+ release
was not affected by changing the pH of the incubation
buffer from 7.2 to 8.2 (Fig. 4). In contrast, the cADPRinduced Ca2+ release was inhibited by alkalinization of media (Fig. 4).
CALCIUM RELEASE FROM VSMC MICROSOMES
Downloaded from ebm.sagepub.com by guest on June 14, 2013
Figure 3. The effect of nifedipine, an L-type Ca2+ channel blocker,
on 45Ca2+ release from microsomes treated with NAADP, IP3, or
cADPR. Open bar, control; closed bar, 10 µM NAADP; gray bar, 10
µM NAADP + 100 µM nifedipine; first white hatched bar, 8 µM IP3;
first hatched gray bar, 8 µM IP3 + 100 µM nifedipine; second white
hatched bar, 10 µM cADPR; second hatched gray bar, 10 µM cADPR
+ 100 µM nifedipine. Values are mean ± SEM (n = 3). *, Significantly
different from control values (t test, P < 0.05). **, Significantly different from both control and NAADP-treated values (P < 0.01).
Figure 4. Effect of pH on Ca2+ release elicited by IP3, cADPR, and
NAADP from VSMC microsomes. Ca2+ release from microsomes
treated with 8 µM IP3, 10 µM cADPR, or 10 µM NAADP was assessed as described in the “Materials and Methods.” Data represent
specific Ca2+ release by agonist minus Ca2+ release in controls,
which was 121 ± 10 pmol/90 sec per mg of protein. Values are mean
± SEM. *, Values significantly different from values observed at pH
7.2 for three separate experiments.
Figure 2. Effects of various calcium mobilizing agents and their antagonists on Ca2+ release from VSMC microsomes. (A) Specific
Ca2+ release from VSMC microsomes by IP3. Values are mean ±
SEM (n = 3). *, Significantly different from control values (t test, P <
0.05). Open bar, control (no addition); closed bar, 8 µM IP3; hatched
bar, 8 µM IP3 + 1 mg/ml heparin; double-hatched bar, 8 µM IP3 + 10
µM ruthenium red. (B) Specific Ca2+ release from VSMC microsomes by cADPR. Values are mean ± SEM (n = 3). * = significantly
different from control values (t test, P < 0.05); open bar, control (no
addition); closed bar, 10 µM cADPR; hatched bar, 10 µM cADPR +
40 µM 8-Br-cADPR; double-hatched bar, 10 µM cADPR + 10 µM
ruthenium red. (C) Specific Ca2+ release from VSMC microsomes by
NAADP. Values are mean ± SEM (n = 3). * = significantly different
from control values (t test, P < 0.05). Open bar, control (no addition);
closed bar, 10 µM NAADP; first hatched bar, 10 µM NAADP + 1
mg/ml heparin; second hatched bar, 10 µM NAADP + 10 µM ruthenium red; double-hatched bar, 10 µM -NADP.
Presence of Functional RyR in VSMC Microsomes. Previous studies have shown that intracellular
Ca2+ release by cADPR is mediated by the RyR. We next
sought to determine which isoforms of RyR are present in
primary VSMC cultures and their role in microsomal Ca2+
release. RT-PCR studies revealed the presence of type 1
(RyR-1), type 2 (RyR-2), and type 3 (RyR-3) ryanodine
receptors (Fig. 5). Sequence analysis of the PCR products
revealed essentially 100% homology to the previously reported rat RyR-1, RyR-2, and RyR-3 sequences (see “Materials and Methods”). Negative control reactions in which
the template was omitted or the reverse transcriptase step
CALCIUM RELEASE FROM VSMC MICROSOMES
Downloaded from ebm.sagepub.com by guest on June 14, 2013
39
Figure 5. NRyR expression by VSMC. cDNA fragments of RyR-1,
RyR-2, and RyR-3 were amplified from VSMC cDNA, as described in
“Materials and Methods.” VSMC express RyR-1 (435 bp), RyR-2
(635 bp), and RyR-3 (269 bp). – refers to negative control reaction in
which the reverse transcriptase step was omitted prior to PCR amplification.
was not performed prior to PCR amplification failed to produce a product (Fig. 5). Assessment of Ca2+-dependent,
high-affinity [3H]-ryanodine binding is a well-established
method for detection and quantification of RyRs (15, 29,
30). We observed that [3H]-ryanodine (30 nM) binds to
VSMC microsomes with high affinity. [3H]-ryanodine binding was Ca2+-dependent and was blocked by 10 M RR
(Fig. 6A). Ca2+ (50 M) enhanced [3H]-ryanodine binding
to VSMC microsomes by 76% compared with nonspecific
binding in the absence of Ca2+ (Fig. 6A). This Ca2+dependent [3H]-ryanodine binding was completely blocked
by 10 M RR, an RyR blocker (Fig. 6A). Further studies
were undertaken to define the specificity of Ca2+-dependent
[3H]-ryanodine binding (as defined by [3H]-ryanodine binding to VSMC microsomes in the presence of 50 M Ca2+
that is inhibited by 10 M RR). We measured the binding
in the presence of caffeine and CMP, established agonists of
RyR (26, 30, 34). Both caffeine and CMP significantly enhanced Ca2+-dependent specific [3H]-ryanodine binding
(Fig. 6B). Moreover, Ca2+-dependent binding was inhibited
by calmodulin (CaM), a protein that interacts with the RyR
and appears to be required for cADPR-elicited Ca2+ release
(35).
Effect of IP3, cADPR, and NAADP on Ca2+dependent [3H]-Ryanodine Binding. cADPR significantly inhibited Ca2+-dependent [3H]-ryanodine binding to
VSMC microsomes (Fig. 7), whereas NAADP had no effect
on [3H]-ryanodine binding. IP3 significantly augmented
Ca2+-dependent [3H]-ryanodine binding to VSMC microsomes (Fig. 7).
The functional relevance of RyR in VSMC was determined by examining the release of Ca2+ from passively
preloaded microsomes with 45Ca2+. Both caffeine and CMP
significantly enhanced Ca2+ release from VSMC microsomes (Fig. 8). The increment of Ca2+ release as well as
enhanced [3H]-ryanodine binding in response to both caffeine and CMP were all blocked by RR (Fig. 8).
40
Figure 6. [3H]-ryanodine binding to VSMC microsomes. (A) Specific
[3H]-ryanodine binding. The microsomes were incubated with 30 nM
[3H]-ryanodine (see “Materials and Methods” for details) without adding Ca2+ (control, open bar); or in the presence of 50 µM Ca2+ without (hatched bar) or with (closed bar) 10 µM ruthenium red. Each bar
denotes mean ± SEM, n = 3 experiments. * denotes value significantly different from control (t test, P < 0.05). (B) The effect of RyR
agonists or antagonists upon specific Ca 2+ -dependent [ 3 H]ryanodine binding to VSMC microsomes. All binding studies were
performed in the presence of 50 µM Ca2+. Open bar, control, no
additions; closed bar, 20 mM caffeine; hatched bar, 0.5 mM 4-Clmethyl-phenol (CMP); double-hatched bar, 5 µM calmodulin (CaM).
* denotes values significantly different from control (t test, P < 0.05).
Synthesis of cADPR and NAADP by VSMC.
Recently, we reported the ability of VSMC to synthesize
cADPR by ADPR cyclase (20). However, the capacity for
NAADP synthesis in primary VSMC cultures has not yet
been documented. Membrane fractions of VSMC were incubated with -NADP and nicotinic acid as described in
“Materials and Methods” (21), and NAADP content was
assessed by the sea urchin egg homogenate Ca2+ release
bioassay (36). VSMC have a high capacity for NAADP
synthesis, similar to that of rat mesangial cells, which are
contractile cells with smooth muscle-like properties (37, 38)
(Fig. 9).
CALCIUM RELEASE FROM VSMC MICROSOMES
Downloaded from ebm.sagepub.com by guest on June 14, 2013
Figure 7. Effects of 10 µM cADPR, 10 µM NAADP, and 8 µM IP3 on
calcium-dependent [3H]-ryanodine binding to VSMC microsomes. All
binding studies were performed in the presence of 50 µM Ca2+. Each
bar denotes mean ± SEM, n = 3 experiments. * values are significantly different (t test, P < 0.05) from controls.
Figure 8. Microsomal Ca2+ release from VSMC by RyR agonists.
Open bar, control; 20 mM caffeine without (first closed bar) or with
(first hatched bar) 10 µM RR and 0.5 M 4-Cl-methyl-phenol (CMP)
without (second closed bar) or with (second hacted bar) 10 µM ruthenium red. Each bar denotes mean ± SEM, n = 3 experiments. *
values are significantly different (t test, P < 0.05) from controls.
Discussion
Intracellular Ca2+ release is fundamental to many responses to environmental stimuli, including contractility,
proliferation, apoptosis, and gene expression (39, 40). Studies of sea urchin eggs (7, 9, 10) and ascidian eggs (22) have
led to the identification of three functionally distinct intracellular Ca2+ signaling pathways. Of the three, the IP3dependent mechanism has a ubiquitous distribution (41). In
general, the IP3 signaling system is involved in transduction
of signals elicited by fast-onset, short-acting agents such as
vasoactive peptides (2, 41). Since the initial description of
the cADPR signaling pathway in sea urchin eggs (7, 42),
more recent studies have shown that a variety of both contractile and noncontractile cells possess this signaling pathway (9, 11, 43). cADPR sensitizes RyR to Ca2+ and activates CICR (9, 10). cADPR production is increased by a
Figure 9. Biosynthesis of nicotinic acid adenine dinucleotide phosphate (NAADP) by rat mesangial cells (open bar) and VSMC (closed
bar) using sea urchin egg homogenate bioassay as described in
“Materials and Methods.”
variety of pro-inflammatory cytokines and hormones, including retinoic acid and triiodothyronine (12, 20). Unlike
the IP3 and cADPR Ca2+ release systems, much less is
known about regulation of NAADP-elicited Ca2+ release in
mammalian cells. It has been shown that NAADP-sensitive
Ca2+ stores can be physically separated from intracellular
Ca2+ stores sensitive to IP3 and cADPR (9, 44). We have
recently demonstrated that the capacity for NAADPinduced Ca2+ release may be widespread in mammalian
cells (14). Cells possess many discrete intracellular Ca2+
stores (45, 46), which may be differentially regulated by
these functionally distinct intracellular Ca2+ signaling pathways. However, the coexistence of all three signaling pathways has only been described in a few cell types, including
sea urchin eggs, mouse pancreatic acinar cells, and human
Jurkat T lymphocytes (46). The primary aim of this study
was to directly compare these Ca2+ signaling pathways in
primary cultures of VSMC.
We found that IP3, cADPR, and NAADP elicited Ca2+
release in a dose-dependent fashion from VSMC microsomes, providing evidence that all three Ca2+ signaling
pathways are present in cultured VSMC (Fig. 1). Specificity
of Ca2+ release triggered by the IP3, cADPR, and NAADP
pathways was verified using specific agonists and antagonists (Figs. 2 and 3). It has been previously reported that
Ca2+ release through intracellular Ca2+ channels can be
regulated by pH (47). Ca2+ release from VSMC microsomes
was differentially affected by IP3, cADPR and NAADP at
pH 7.2 and 8.2 (Fig. 4), providing further evidence that
these Ca2+ agonists signal through functionally distinct
pathways. Alkalinization of the media may alter the binding
of cADPR to its receptor or may affect activation of RyRs
by pharmacological agonists (48).
Previous studies in other cell systems have provided
evidence that IP3 and cADPR promote intracellular Ca2+
release through activation of different receptor complexes;
the receptor involved in NAADP-elicited intracellular Ca2+
release has not yet been characterized. In VSMC, IP3R-1 is
CALCIUM RELEASE FROM VSMC MICROSOMES
Downloaded from ebm.sagepub.com by guest on June 14, 2013
41
the predominant intracellular Ca2+ release channel activated
through binding of IP3 (49, 50). Several lines of evidence
support the presence of functionally competent ryanodine
receptors in VSMC (51). RyR-3 and possibly RyR-1 receptors have been identified in VSMC (52). By RT-PCR we
have identified the presence of functional RyR-1, RyR-2,
and RyR-3 in VSMC (Fig. 5). We found that [ 3 H]ryanodine specifically binds to VSMC microsomes in a
Ca2+-dependent manner. Specificity of Ca2+-dependent
[3H]-ryanodine binding was verified using established RyR
agonists and antagonists.
We report here for the first time that [3H]-ryanodine
binding to VSMC microsomes is significantly enhanced by
IP3 (Fig. 7). This observation provides evidence that the IP3
receptor complex can activate the ryanodine receptor/
channel to facilitate Ca2+-induced Ca2+ release (CICR) by
cADPR or other agonists of RyR. IP3 and cADPR may
thereby complement each other in inducing Ca2+ release by
CICR in VSMC microsomes.
We found that cADPR inhibits [3H]-ryanodine binding
to VSMC microsomes (Fig. 7). This observation would suggest that cADPR and ryanodine compete for binding to a
similar site on the ryanodine receptor (10). However, in
other cell systems, both stimulatory (53–55) and inhibitory
(56) effects of cADPR on [3H]-ryanodine binding have been
described. Ca2+ release from VSMC microsomes was induced by RyR agonists (caffeine or CMP) and inhibited by
RyR antagonists (RR), providing further evidence for the
functional relevance of RyRs in VSMC. Unlike IP3 and
cADPR, NAADP had no effect on [3H]-ryanodine binding
(Fig. 7), again confirming that Ca2+ signaling by NAADP is
independent of IP3 and cADPR controlled Ca2+ signaling
pathways. Previous studies have demonstrated that the enzyme ADP-ribosyl cyclase, which synthesizes cADPR from
-NAD, also catalyzes the production of NAADP from
-NADP (57, 58). Recent studies have shown that a variety
of mammalian cells possess a capacity for NAADP biosynthesis, utilizing a reaction that requires high concentrations
of -NADP and nicotinic acid (14). The physiologic relevance of this pathway, or the presence of other pathways
responsible for NAADP biosynthesis in vivo, remain to be
established. In addition, the intracellular receptor for
NAADP has not yet been characterized. However, widespread distribution of binding sites for NAADP has recently
been reported in brain tissues (59).
In summary, we have established the presence of functionally distinct intracellular Ca2+ signaling pathways triggered by IP3, cADPR, and NAADP in VSMC. Although the
presence of all three intracellular Ca2+ signaling pathways
has only been described in a few cell types (46), it is likely
that future studies will document the coexistence of these
pathways in a wide variety of both contractile and noncontractile cells. The functional relevance of intracellular Ca2+
release directed by IP3, cADPR, and NAADP remains to be
established, and may depend in large part upon cell type.
For example, the IP3 and cADPR pathways are functionally
42
redundant during fertilization of sea urchin eggs (60, 61). In
pancreatic acinar cells, the IP3, cADPR, and NAADP pathways interact to coordinate apical release of secretory granules (62). IP3R-1-deficient T cells are resistant to apoptosis
in response to a variety of stimuli (39) and have defects at
antigen-specific signaling (63), indicating that an intact IP3
system is essential for these processes.
Abnormalities in intracellular Ca2+ signaling have recently been described in a variety of cardiovascular diseases. For example, end-stage heart disease is associated
with downregulation of RyR-2 and an upregulation of
IP 3 R-1 (64). Angiotensin II-mediated hypertrophy of
VSMC is dependent upon an increase in intracellular Ca2+
levels (23). The specific intracellular Ca2+ signaling pathway(s) responsible for this effect have yet to be elucidated.
Future studies will define the role of IP3, cADPR, and
NAADP in normal VSMC function and response to pathobiologic stimuli.
The excellent secretarial assistance of Ms. Cherish Grabau is gratefully acknowledged.
1. Hotchkiss R, Karl I. Calcium: a regulator of the inflammatory response
in endotoxemia and sepsis. New Horizons 4:58–71, 1996.
2. Berridge M. The biology and medicine of calcium signaling. Mol Cell
Endocrinol 98:119–124, 1994.
3. Clapham D. Calcium signaling. Cell 80:259–268, 1995.
4. Streb H, Irvine RF, Berridge MJ, Schulz I. Release of Ca2+ from a
nonmitochondrial intracellular store in pancreatic acinar cells by inositol-1,4,5-trisphosphate. Nature 306:67–9, 1983.
5. Berridge M. Inositol triphosphate and calcium signaling. Ann NY
Acad Sci 766:31–43, 1995.
6. Berridge M. Elementary and global aspects of calcium signaling. J
Physiol 499:291–306, 1997.
7. Lee H. Cyclic ADP-ribose: a calcium mobilizing metabolite of NAD
(+). Mol Cell Biochem 138:229–235, 1994.
8. Galione A, White A. Ca2+ release induced by cyclic ADP-ribose.
Trends Cell Biol 4:431–436, 1994.
9. Lee H. Mechanisms of calcium signaling by cyclic ADP-ribose and
NAADP. Physiol Rev 77:1133–1164, 1997.
10. Dousa T, Chini E, Beers K. Adenine nucleotide diphosphates: emerging second messengers acting via intracellular Ca release. Am J Physiol 271:C1007–C1024, 1996.
11. Bennett D, Cheek T, Berridge M, De Smedt H, Parys J, Missiaen L,
Bootman M. Expression and function of ryanodine receptors in nonexcitable cells. J Biol Chem 271:6356–6362, 1996.
12. Yusufi A, Cheng J, Thompson M, Dousa T, Warner G, Walker H,
Grande J. cADP-ribose/ryanodine channel/Ca2+-release signal transduction pathway in mesangial cells. Am J Physiol 281:F92–F102,
2001.
13. Lee H, Aarhus R. A derivative of NADP mobilizes Ca2+ stores insensitive to inositol triphosphate and cyclic ADP-ribose. J Biol Chem
270:2152–2157, 1995.
14. Yusufi A, Cheng J, Thompson M, Chini E, Grande J. NAADP elicits
specific microsomal Ca2+ release from mammalian cells. Biochem J
353:531–536, 2001.
15. Mackrill J, Challiss R, O’Connell D, Lai F, Nahorski S. Differential
expression and regulation of ryanodine receptor and myo-inositol
1,4,5-triphosphate receptor Ca2+ release channels in mammalian tissues and cell lines. Biochem J 327:251–258, 1997.
16. Takasawa S, Akiyama T, Nata K, Kuroki M, Tohgo A, Noguchi M,
CALCIUM RELEASE FROM VSMC MICROSOMES
Downloaded from ebm.sagepub.com by guest on June 14, 2013
17.
18.
19.
20.
21.
22.
23.
24.
25.
26.
27.
28.
29.
30.
31.
32.
33.
34.
35.
36.
37.
Kobayashi S, Kato I, Katada T, Okamoto H. Cyclic ADP-ribose and
inositol 1,4,5-triphosphate as alternate second messengers for intracellular Ca2+ mobilization in normal and diabetic -cells. J Biol Chem
273:2497–2500, 1998.
Sundaresan S, Weiss J, Bauer-Dantoin A, Jameson J. Expression of
ryanodine receptors in the pituitary gland: evidence for a role in gonadotropin-releasing hormone signaling. Endocrinology 138:2056–
2065, 1997.
Beers K, Chini E, Dousa T. All-trans-retinoic acid stimulates synthesis
of cyclic ADP-ribose in renal LLC-PK1 cells. J Clin Invest 95:2385–
2390, 1995.
Chini E, de Toledo F, Thompson M, Dousa T. Effect of estrogen upon
cyclic ADP ribose metabolism: -estradiol stimulates ADP ribosyl
cyclase in rat uterus. Proc Natl Acad Sci U S A 94:5872–5876, 1997.
de Toledo F, Cheng J, Dousa T. Retinoic acid and triidothyronine
stimulate ADP-ribosyl cyclase activity in rat vascular smooth muscle
cells. Biochem Biophys Res Commun 238:847–850, 1995.
Cheng J, Yusufi AN, Thompson MA, Chini EN, Grande JP. Nicotinic
acid adenine dinucleotide phosphate: a new Ca2+ releasing agent in
kidney. J Am Soc Nephrol 12:54–60, 2001.
Albrieux M, Lee H, Villaz M. Calcium signaling by cyclic ADPribose, NAADP, and inositol triphosphate are involved in distinct
functions in ascidian oocytes. J Biol Chem 273:14566–14574, 1998.
Berk BC, Vekshtein V, Gordon HM, Tsuda T. Angiotensin IIstimulated protein synthesis in cultured vascular smooth muscle cells.
Hypertension 13:305–314, 1989.
Chini E, Klener P, Beers K, Chini C, Grande J, Dousa T. Cyclic
ADP-ribose metabolism in rat kidney: high capacity for synthesis in
glomeruli. Kidney Int 51:1500–1506, 1997.
Chamley-Campbell J, Campbell GR, Ross R. The smooth muscle cell
in culture. Physiol Rev 59:1–61, 1979.
Herrmann-Frank A, Richter M, Sarkozi S, Mohr U, Lehmann-Horn F.
4-Chloro-m-cresol, a potent and specific activator of the skeletal
muscle ryanodine receptor. Biochim Biophys Acta 1289:31–40, 1996.
Lowry O, Rosebrough A, Farr A, Randall R. Protein measurement
with folin phenol reagent. J Biol Chem 193:265–275, 1951.
Coussin F, Macrez N, Morel JL, Mironneau J. Requirement of ryanodine receptor subtypes 1 and 2 for Ca2+-induced Ca2+ release in vascular myocytes. J Biol Chem 275:9596–9603, 2000.
DiJulio D, Watson E, Pessah I, Jacobson K, Ott S, Buck E, Singh J.
Ryanodine receptor type III (Ry3R) identification in mouse parotid
acini. J Biol Chem 272:15687–15696, 1997.
Richter M, Schleithoff L, Deufel T, Lehmann-Horn F, HerrmannFrank A. Functional characterization of a distinct ryanodine receptor
mutation in human malignant hyperthermia-susceptible muscle. J Biol
Chem 272:5256–5260, 1997.
Chini E, Beers K, Chini C, Dousa T. Specific modulation of cyclic
ADP-ribose-induced Ca2+ release by polyamines. Am J Physiol
269:C1042–C1047, 1995.
Walseth T, Lee H. Synthesis and characterization of antagonists of
cyclic-ADP-ribose-induced Ca2+ release. Biochim Biophys Acta
1178:235–242, 1993.
Chini E, Liang M, Dousa T. Differential effect of pH upon cyclicADP-ribose and nicotinate-adenine dinucleotide phosphate-induced
Ca2+ release systems. Biochem J (London) 335:499–504, 1998.
Islam M, Leibiger I, Leibiger B, Rossi D, Sorrentino V, Ekstrom T,
Westerblad H, Andrade F, Berggren P. In situ activation of the type 2
ryanodine receptor in pancreatic  cells requires cAMP-dependent
phosphorylation. Proc Natl Acad Sci U S A 95:6145–6150, 1998.
Lee H. Modulator and messenger functions of cyclic ADP-ribose in
calcium signaling. Recent Prog Horm Res 51:355–389, 1996.
Aarhus R, Graeff R, Dickey D, Walseth T, Lee H. ADP-ribosyl cyclase and CD38 catalyze the synthesis of a calcium-mobilizing metabolite from NADP. J Biol Chem 270:30327–30333, 1995.
Bonventre J. Calcium and calcium-related signalling pathways in glomerular mesangial cells. Clin Exp Pharmacol Physiol 23:65–70, 1996.
38. Schlondorff D. Roles of the mesangium in glomerular function. Kidney Int 49:1583–1585, 1996.
39. Marks AR. Intracellular calcium-release channels: regulators of cell
life and death. Am J Physiol 272:H597–H605, 1997.
40. Berridge MJ. Calcium signalling and cell proliferation. Bioessays
17:491–500, 1995.
41. Berridge MJ. Inositol trisphosphate and calcium signalling. Nature
361:315–325, 1993.
42. Clapper D, Walseth T, Dargie P, Lee H. Pyridine nucleotide metabolites stimulate calcium release from sea urchin egg microsomes desensitized to inositol trisphosphate. J Biol Chem 262:9561–9568,
1987.
43. Li Q, Yamada Y, Yasuda K, Ihara Y, Okamoto Y, Kaisaki PJ, Watanabe R, Ikeda H, Tsuda K, Seino Y. A cloned rat CD38-homologous
protein and its expression in pancreatic islets [published erratum appears in Biochem Biophys Res Commun 1994 204(2):1001]. Biochem
Biophys Res Commun 202:629–636, 1994.
44. Genazzani A, Empson R, Galione A. Unique inactivation properties of
NAADP-sensitive Ca2+ release. J Biol Chem 271:11599–11602, 1996.
45. Pozzan T, Rizzuto R, Volpe P, Meldolesi J. Molecular and cellular
physiology of intracellular calcium stores. Physiol Rev 74:595–636,
1994.
46. da Silva CP, Guse AH. Intracellular Ca2+ release mechanisms: multiple pathways having multiple functions within the same cell type?
Biochim Biophys Acta 1498:122–133, 2000.
47. Worley PF, Baraban JM, Supattapone S, Wilson VS, Snyder SH. Characterization of inositol trisphosphate receptor binding in brain: regulation by pH and calcium. J Biol Chem 262:12132–12136, 1987.
48. Chini E, Liang M, Dousa T. Differential effect of pH upon cyclicADP-ribose and nicotinate adenine dinucleotide phosphate-induced
Ca2+ release systems. Biochem J 335:499–504, 1998.
49. Furuichi T, Yoshikawa S, Miyawaki A, Wada K, Maeda N, Mikoshiba
K. Primary structure and functional expression of the inositol 1,4,5trisphosphate-binding protein P400. Nature 342:32–38, 1989.
50. Marks AR, Tempst P, Chadwick CC, Riviere L, Fleischer S, NadalGinard B. Smooth muscle and brain inositol 1,4,5-trisphosphate receptors are structurally and functionally similar. J Biol Chem
265:20719–20722, 1990.
51. Zhang ZD, Kwan CY, Daniel EE. Subcellular-membrane characterization of [3H]ryanodine-binding sites in smooth muscle. Biochem J
290:259–266, 1993.
52. Giannini G, Clementi E, Ceci R, Marziali G, Sorrentino V. Expression
of a ryanodine receptor-Ca2+ channel that is regulated by TGF-.
Science 257:91–94, 1992.
53. Meszaros LG, Bak J, Chu A. Cyclic ADP-ribose as an endogenous
regulator of the non-skeletal type ryanodine receptor Ca2+ channel.
Nature 364:76–79, 1993.
54. Guse AH, da Silva CP, Berg I, Skapenko AL, Weber K, Heyer P,
Hohenegger M, Ashamu GA, Schulze-Koops H, Potter BV, Mayr GW.
Regulation of calcium signalling in T lymphocytes by the second
messenger cyclic ADP-ribose. Nature 398:70–73, 1999.
55. Bourguignon LY, Chu A, Jin H, Brandt NR. Ryanodine receptorankyrin interaction regulates internal Ca2+ release in mouse Tlymphoma cells. J Biol Chem 270:17917–17922, 1995.
56. Zhang X, Wen J, Bidasee K, Besch H, Wojcikiewicz J, Lee B, Rubin
R. Ryanodine and inositol trisphosphate receptors are differentially
distributed and expressed in rat parotid gland. Biochem J 340:519–
527, 1999.
57. Genazzani A, Mezna M, Dickey D, Michelangeli F, Walseth T, Galione A. Pharmacological properties of the Ca2+-release mechanism
sensitive to NAADP in the sea urchin egg. Br J Pharmacol 121:1489–
1495, 1997.
58. Lee H. Calcium signaling by cyclic ADP-ribose and NAADP. Cell
Biochem Biophys 28:1–17, 1998.
59. Patel S, Churchill GC, Sharp T, Galione A. Widespread distribution of
binding sites for the novel Ca2+-mobilizing messenger, nicotinic acid
CALCIUM RELEASE FROM VSMC MICROSOMES
Downloaded from ebm.sagepub.com by guest on June 14, 2013
43
adenine dinucleotide phosphate, in the brain. J Biol Chem 275:36495–
36497, 2000.
62. Petersen OH, Cancela JM. New Ca2+-releasing messengers: are they
important in the nervous system? Trends Neurosci 22:488–495, 1999.
60. Galione A, McDougall A, Busa WB, Willmott N, Gillot I, Whitaker
M. Redundant mechanisms of calcium-induced calcium release underlying calcium waves during fertilization of sea urchin eggs. Science
261:348–352, 1993.
63. Jayaraman T, Ondriasova E, Ondrias K, Harnick DJ, Marks AR. The
inositol 1,4,5-trisphosphate receptor is essential for T-cell receptor
signaling. Proc Natl Acad Sci U S A 92:6007–6011, 1995.
61. Lee HC, Aarhus R, Walseth TF. Calcium mobilization by dual receptors
during fertilization of sea urchin eggs. Science 261:352–355, 1993.
44
64. Go L, Moschella M, Watras J, Handa K, Fyfe B, Marks A. Differential
regulation of two types of intracellular calcium release channels during
end-stage heart failure. J Clin Invest 95:888–894, 1995.
CALCIUM RELEASE FROM VSMC MICROSOMES
Downloaded from ebm.sagepub.com by guest on June 14, 2013