Article Angiotensin II profile and mRNA encoding RAS proteins during bovine follicular wave Journal of the Renin-AngiotensinAldosterone System 12(4) 475–482 © The Author(s) 2011 Reprints and permission: sagepub.co.uk/journalsPermissions.nav DOI: 10.1177/1470320311403786 jra.sagepub.com Rogério Ferreira1, Bernardo Gasperin1, Joabel Santos1, Monique Rovani1, Robson AS Santos2, Karina Gutierrez1, João Francisco Oliveira1, Adelina M Reis2 and Paulo Bayard Gonçalves1 Abstract Angiotensin II (AngII) has a role in ovarian follicle development, ovulation, and oocyte meiotic resumption. The objective of the present study was to characterise the AngII profile and the mRNA encoding RAS proteins in a bovine follicular wave. Cows were ovariectomised when the size between the largest (F1) and the second largest follicle (F2) was not statistically different (day 2), slightly different (day 3), or markedly different (day 4). AngII was measured in the follicular fluid and the mRNA abundance of genes encoding angiotensin-converting enzyme (ACE), (pro)renin receptor, and reninbinding protein (RnBP) was evaluated in the follicular cells from F1 and F2. The AngII levels increased at the expected time of the follicular deviation in F1 but did not change in F2. However, the expression of the genes encoding ACE, (pro)renin receptor, and RnBP was not regulated in F1 but was upregulated during or after the follicular deviation in F2. Moreover, RnBP gene expression increased when the F1 was treated with the oestrogen receptor-antagonist in vivo. In conclusion, the AngII concentration increased in the follicular fluid of the dominant follicle during and after deviation and further supports our finding that RAS is present in the ovary regulating follicular dominance. Keywords ACE, angiotensin II, follicular growth, (pro)renin receptor, RnBP Introduction The renin–angiotensin system (RAS) is well known for its systemic control that regulates blood pressure and fluid homeostasis. According to the systemic overview, angiotensinogen is expressed by the liver and is cleaved by renin, an enzyme secreted by the kidneys, to produce the decapeptide angiotensin I (AngI). AngI is cleaved by the angiotensin-converting enzyme (ACE), largely present in endothelial cells,1 to form angiotensin II (AngII), a more powerful and active peptide of the RAS. However, the presence of the RAS components in specific tissues, such as in the ovarian follicle, takes on a new concept of ‘local’ or ‘tissue’ renin–angiotensin systems. Moreover, the regulation of local system is independent of systemic control. The local renin–angiotensin systems act as an autocrine/ paracrine factor, with a different role in heart, vessels, kidney, brain, and endocrine gland.2,3 The concentrations of AngII in the follicular fluid were higher than those in plasma in human chorionic gonadotrophin (hCG)-treated rodents.4 Also, high follicular fluid levels of AngII were found after bilateral nephrectomy,4 and in vitro perfusion of rabbit ovaries exposed to hCG.5 The angiotensin-converting enzyme catalyses the formation of AngII from AngI and the breakdown of bradykinin into inactive products. Bovine theca cells, but not granulosa cells, expressed ACE,6-8 and this enzyme had activity in the follicular fluid.7 However, the role of ACE in ovary physiology is not fully understood. Captopril (ACE inhibitor) did not inhibit ovulation in the perfused rabbit ovaries.9 In contrast, the AT2 blocker inhibited ovulation and oocyte maturation.10-12 It is suggested that in extra-renal tissues there are other enzymes that may be Laboratory of Biotechnology and Animal Reproduction – BioRep, Federal University of Santa Maria, Brazil 2 Department of Physiology, Institute of Biological Sciences, Federal University of Minas Gerais, Brazil 1 Corresponding author: Paulo Bayard Gonçalves, Departamento de Clínica de Grandes Animais, Hospital Veterinário, Universidade Federal de Santa Maria, Postal code 97105-900, Santa Maria, RS, Brazil. Email: bayard@biorep.ufsm.br Downloaded from jra.sagepub.com by guest on July 27, 2016 476 Journal of the Renin-Angiotensin-Aldosterone System 12(4) responsible for the production of AngII.13,14 Husain et al.4 obtained AngII in vitro from angiotensinogen, using plasminogen activator as catalyst enzyme. Moreover, ACE inhibitors may prevent the hydrolysis of bradykinin15,16 and the clearance of Ang1-(1–7).17 Prorenin is the precursor of renin and has been assumed to be an inactive precursor form.18 Renin is activated in kidneys and is not detected in nephrectomised animals.19 However, AngII concentration in the follicular fluid remains unaffected in the bilaterally nephrectomised rats.4 More recently, it was demonstrated that prorenin can have a proteolytic or a non-proteolytic activation.20,21 In the former, the propeptide is removed by various renal processing enzymes, including proconvertase 1 and cathepsin B. The latter is reversible, characterised by an unfolding of the propeptide from the enzymatic cleft.21 The (pro)renin receptor ((P)RR) not only binds renin and prorenin, but also activates prorenin by inducing a conformational change in the prorenin molecule.20,22,23. Interestingly, the rat prorenin that is not activated by human (pro)renin receptor (h(P)RR) binds and induces signalling through this receptor.24 The plasma and the tissue angiotensin levels were unaltered in transgenic rats that overexpress the h(P)RR. However, these animals displayed increased levels of aldosterone in the blood plasma and cyclo-oxygenase-2 in the renal cortex.24 These results are in agreement with the concept that (P)RR induces angiotensin-independent effects. Also, proteins that interact with renin, such as a renin-binding protein (RnBP), appear to inhibit renin in vivo RnBP.25 However, the physiological role of RnBP and the relationship between RnBP and renin metabolism, and the tissue-specific regulation of RnBP gene expression are not yet understood. Moreover, to the best of the authors’ knowledge, the presence of (P)RR and RnBP has not been demonstrated in the mammalian ovary. In addition to the well-known AngII effects on smooth muscle contraction, aldosterone secretion, and blood pressure regulation, the group has demonstrated that this peptide has a pivotal role on ovulation11 and oocyte maturation.12 However, the profile of RAS components had not been demonstrated during follicular wave development and it can be helpful to understand the mechanisms involved in the dominant follicle selection of monovular species. Cattle provide an excellent model for studying the role of local factors in the control of follicle development, as the follicular wave can be accurately monitored on a day-to-day basis by ultrasonography in vivo26-28 and the follicular environment can be easily modified by an ultrasound-guided intrafollicular injection.11,29 The present study characterised the expression of elements of new concept of local RAS, such as (P)RR and RnBP, during follicular development. The authors have also induced follicular atresia by the intrafollicular injection of an oestradiol-receptor inhibitor to test the regulation of local RAS during health/atresia transition. Materials and methods Experiment 1: angiotensin II and mRNA encoding RAS proteins during bovine follicular wave Thirty-six weaned beef cows (predominantly Hereford and Aberdeen Angus), with an average body condition score of 3 (1–5, emaciated to obese), were used in this study. The cows were given two doses of a PGF2a analogue (cloprostenol, 125 µg; Schering-Plough Animal Health, Brazil) intramuscularly (i.m.), 12 h apart. They were observed in oestrus within 3–5 days after PGF2a, and the experiment was performed during the first follicular wave of the oestrous cycle. Ovaries were then examined once a day by transrectal ultrasonography, using an 8-MHz linear-array transducer (Aquila Vet scanner, Pie Medical, Netherlands), and all follicles larger than 5 mm were drafted using three to five virtual slices of the ovary allowing a three-dimensional localisation of follicles and monitoring individual follicles during follicular wave.30 The day of the follicular emergence was designated as day 0 of the wave and was retrospectively identified as the last day on which the dominant follicle was 4 or 5 mm in diameter.31 The cows were randomly assigned to be ovariectomised by colpotomy at days 2, 3, and 4 of the follicular wave (four cows for each day) to recover the largest and the second largest follicle from each cow. This approach allowed the authors to investigate the RAS components and follicular fluid content before, during, and after follicular divergence. Experiment 2: mRNA encoding RAS proteins during initial atresia To further demonstrate that RAS proteins’ mRNA expression is upregulated during initial atresia, 20 Bos taurus taurus adult cyclic cows (as previously described) were synchronised with a progesterone-releasing intravaginal device (1 g progesterone, DIB – Intervet Schering Plough), an injection of 2 mg oestradiol benzoate i.m. (Genix, Anápolis, Brazil), and two injections of 250 µg sodium cloprostenol i.m. (12 h apart; Ciosin – Intervet Schering Plough). All treatments performed at the same time on day 0. Four days later, the progesterone devices were removed and the ovaries were monitored daily until the largest follicle of the growing cohort reached a diameter of 7–8 mm. At this moment, an intrafollicular injection of fulvestrant (a selective oestrogen receptor antagonist) in a final concentration of 100 µM (based on a previous dose–response experiment; data not shown) or saline was given. The cows were ovariectomised 12 (n = 3/group) or 24 hours (n = 4/ group) after the intrafollicular injection. The injections were given as previously described.11 Follicles After ovariectomy, follicular fluid, granulosa, and theca cells were recovered from F1 and F2 (experiment 1) and Downloaded from jra.sagepub.com by guest on July 27, 2016 477 Ferreira et al. Table 1. Primers used in the expression analysis of candidate genes. Primer sequences and concentrations used to amplify each product are described Gene Sequence Conc. (µM) Reference or accession no. ACE F R ACTCCTGGAGGTCCATGTACGA ACGTAGGCGTGCAGGTTCAG 200 200 AJ309016.1 Aromatase F R GTGTCCGAAGTTGTGCCTATT GGAACCTGCAGTGGGAAATGA 300 300 Luo and Wiltbank52 CYP17 F R GAATGCCTTTGCCCTGTTCA CGCGTTTGAACACAACCCTT 200 200 Buratini et al.32 GAPDH F R GATTGTCAGCAATGCCTCCT GGTCATAAGTCCCTCCACGA 200 200 NM_001034034.1 (pro)renin receptor F R TGATGGTGAAAGGAGTGGACAA TTTGCCACGCTGTCAAGACT 200 200 ENSBTAT00000023668 RnBP F R GGCAGGACATGGAGAAGGAA TGGGAATGATCCAGCCAGAA 200 200 NM_001046223.1 F: forward primer, R: reverse primer, Conc.: primer concentration used for gene amplification from fulvestrant- or saline-treated follicles (experiment 2) and stored at –80ºC. Follicular fluid oestradiol levels from all follicles were determined by ELISA following the manufacturer’s instructions (Cayman Biochemical). Crosscontamination of the theca and the granulosa cells was tested by RT-PCR to detect cytochrome P450 aromatase (CYP19A1) and 17a-hydroxylase (CYP17A1) mRNA. The granulosa cells that expressed CYP17A1 and the theca cells that expressed CYP19A1 were discarded.32 Follicular fluid from F1 and F2 (experiment 1) was recovered to measure AngII and stored in the presence of the following protease inhibitors: 10-5 M phenylmethylsulfonyl fluoride, 10-5 M pepstatin A, 10-5 M EDTA, 10-5 M p-hydroxymercuribenzoate, and 9 × 10-4 M orthophenanthroline, all purchased from Sigma-Aldrich Corp. AngII was measured as described by Costa et al.33 Nucleic acid extraction and real-time RT-PCR Total RNA was extracted using Trizol (theca cells) or a silicabased protocol (granulosa cells; Qiagen, Mississauga, ON, Canada) according to the manufacturer’s instructions and was quantified by absorbance at 260 nm. Total RNA (1 µg) was first treated with 0.2 U DNase (Invitrogen) at 37°C for 5 min to digest any contaminating DNA, followed by heating to 65°C for 3 min. The RNA was reverse transcribed (RT) in the presence of 1 µM oligo(dT) primer, 4 U Omniscript RTase (Omniscript RT Kit; Qiagen, Mississauga, ON, Canada), 0.5 µM dideoxynucleotide triphosphate (dNTP) mix, and 10 U RNase Inhibitor (Invitrogen) in a volume of 20 µl at 37°C for 1 h. The reaction was terminated by incubation at 93°C for 5 min. Real-time polymerase chain reaction (PCR) was conducted in a Step One Plus instrument (Applied Biosystems, Foster City, CA) with Platinum SYBR Green qPCR SuperMix (Invitrogen) and bovine-specific primers (table 1). Common thermal cycling parameters (3 min at 95°C, 40 cycles of 15 s at 95°C, 30 s at 60°C, and 30 s at 72°C) were used to amplify each transcript. Melting-curve analyses were performed to verify product identity. The samples were run in duplicate and were expressed relative to GAPDH as the housekeeping gene. The relative quantification of gene expression across treatments was evaluated using the ddCT method 34. Briefly, the dCT is calculated as the difference between the CT of the investigated gene and that of GAPDH in each sample. The ddCT of each investigated gene is calculated as the difference between the dCT in each treated sample and the dCT of the sample with lower gene expression (higher dCT). The fold change in relative mRNA concentrations was calculated using the formula 2–ddCT. Bovine-specific primers (table 1) were taken from the literature or designed using Primer Express Software v. 3.0 (Applied Biosystems) and synthesised by Invitrogen. Statistical analysis The differences in continuous data between the dominant and the subordinate follicle were assessed by a paired Student’s t test using the cow as subject. The regulation of AngII and mRNA-encoding RAS proteins was analysed by ANOVA and a multicomparison between days or groups was performed by least square means. Data were tested for normal distribution using the Shapiro–Wilk test and normalised when necessary. All analyses were performed using JMP software (SAS Institute Inc., Cary, NC) and p < 0.05 was considered statistically significant. Data are presented as means ± SEM. Downloaded from jra.sagepub.com by guest on July 27, 2016 478 Journal of the Renin-Angiotensin-Aldosterone System 12(4) Results Follicular Diameter (mm) Follicular Size ** 12 Ovarian follicle model * 9 The cows were ovariectomised at days 2, 3, and 4 of the first wave of follicular development. This experimental design allowed the recovery of follicles when the follicular size of the largest and the second largest was not different (day 2; p > 0.05), slightly different (day 3; p < 0.05), or markedly different (day 4; p < 0.01) (figure 1).28 The mRNA abundance levels of CYP19 in granulosa cells increased in the dominant follicles and decreased in the subordinate follicles during development (figure 1). These results confirm that the ovaries obtained at days 2, 3, and 4 of the first follicular wave were before, during, and after follicular deviation, respectively. The samples were discarded when cross-contaminations between the theca and the granulosa cells were detected, or the amount of the follicular fluid or the extracted RNA was insufficient to be processed. When one follicle was discarded, the data of both follicles (the largest and the second largest) from the same cow were excluded from the statistical analysis. 6 3 0 CYP19 Relative mRNA abundance 2,5 ** * 2 1,5 1 0,5 0 Estradiol Estradiol (ng/mL) 500 ** 400 * 300 200 Follicular fluid AngII concentration 100 The concentration of AngII was measured in the follicular fluid to test the hypothesis that AngII is differentially regulated in the dominant and the subordinate follicles during the follicular wave. The AngII concentrations increased in the follicular fluid during deviation only in the dominant follicle (figure 2). In the second largest follicle, AngII concentration did not significantly change throughout the follicular wave and the deviation was very high (data not shown). 0 Day 2 Day 3 Day 4 Relative to Follicular Wave Figure 1. Follicular diameter, granulosa cells aromatase (CYP19) relative mRNA abundance and follicular fluid oestradiol concentration of the largest (black bar) and the second largest (open bar) follicle (mean ± SEM) collected at days 2 (n = 4), 3 (n = 4), and 4 (n = 4) of the first follicular wave of a cycle. Asterisk (* or **) indicates statistical difference between the largest and the second largest follicle assessed by a paired Student’s t test using the cow as subject. *p ≤ 0.05. **p ≤ 0.001. RAS component gene expression The results provide evidence that ACE, (P)RR, and RnBP are differentially regulated in the granulosa cells of the F1 a AngII (pg/mL) 200 150 F2 a 500 400 b 300 100 200 50 100 0 0 Day 2 Day 3 Day 4 Relative to Follicular Wave Day 2 Day 3 Day 4 Relative to Follicular Wave Figure 2. Angiotensin II (AngII) in the follicular fluid of the largest (F1) and the second largest follicle (F2) from cows ovariectomised at days 2 (n = 2), 3 (n = 4), and 4 (n = 4) of the first follicular wave of a cycle. A paired Student’s t test did not point to a difference between F1 and F2, values are represented in different graphs. Bars with no common letter are different (a ≠ b, p ≤ 0.05). Downloaded from jra.sagepub.com by guest on July 27, 2016 479 Ferreira et al. ACE Relative mRNA abundance ** 1500 1000 500 Relative mRNA abundance 3 2000 ACE 2 1 0 0 (pro)renin receptor (pro)renin receptor 2,5 * Relative mRNA abundance Relative mRNA abundance 15 12 9 6 3 2 1,5 1 0,5 0 0 RnBP RnBP * Relative mRNA abundance Relative mRNA abundance 60 4 ** 40 20 * 3 2 1 0 0 12h 24h Time after fulvestrant treatment Day 2 Day 3 Day 4 Relative to Follicular Wave Figure 3. Expression of renin–angiotensin system-related genes in granulosa cells during follicular development. Granulosa cells were recovered from the largest (black bar) and the second largest (open bar) follicle (mean ± SEM) collected at days 2 (n = 3), 3 (n = 4), and 4 (n = 4) of the first follicular wave of a cycle. Asterisk (* or **) indicates statistical difference between the largest and the second largest follicle assessed by a paired Student’s t test using the cow as subject. *p ≤ 0.05. **p ≤ 0.001. ACE: angiotensin-converting enzyme, RnBP: renin-binding protein. second largest follicle during follicular wave development (figure 3). The mRNA expression of (P)RR was upregulated in the granulosa cells at the expected moment of follicular deviation, while RnBP mRNA increased during and after the deviation process. Nevertheless, ACE mRNA expression upregulation was only observed after the expected moment of follicular deviation, when the subordinate follicle undergoes atresia (figure 3). On the theca cells, there was no regulation of ACE, (P)RR, or RnBP gene expression during the follicular growth or between the dominant and the subordinate follicle (data not shown). The mRNA encoding RAS proteins was further assessed after the intrafollicular injection of fulvestrant to induce atresia. The authors have previously confirmed that the intrafollicular injection of fulvestrant (100 µM) decreased Figure 4. Expression of renin–angiotensin system-related genes in granulosa cells 12 or 24 h after intrafollicular selective oestrogen receptor antagonist (fulvestrant) treatment. Granulosa cells were recovered from (black bar) saline- and (open bar) fulvestrant-treated follicles 12 h (n = 3/group) and 24 h (n = 4/group) after intrafollicular injection (mean ± SEM). Asterisk (*) indicates statistical difference between groups (p ≤ 0.05). ACE: angiotensin-converting enzyme, RnBP: renin-binding protein. CYP19A1 gene expression and induced follicular atresia from 12 h after treatment. The ACE and (P)RR (at 12 and 24 h) and the RnBP (at 12 h after intrafollicular injection) mRNA expression in granulosa cells did not differ between fulvestrant- and saline-treated follicles. However, RnBP mRNA expression was upregulated in fulvestrant-treated follicles at 24 h after intrafollicular injection (figure 4; p < 0.05). Discussion The authors used a well-established experimental model proposed by Rivera et al.35 and found that the concentration of AngII in the follicular fluid of the dominant follicle increased at the expected time of follicular deviation. Downloaded from jra.sagepub.com by guest on July 27, 2016 480 Journal of the Renin-Angiotensin-Aldosterone System 12(4) There is evidence that AngII is involved in the mechanism of follicular deviation in cattle. Recently, it was found that AngII is required for dominance and the follicle development when FSH levels are low during the cow follicular wave after follicular deviation.36 It is well known that the concentration of AngII in follicular fluid increases after LH surge in the bovine;37 however, AngII concentration had not been measured during the follicular wave development in mammals. The expression of genes codifying for ACE, (P)RR, and RnBP was upregulated in the second largest follicle during and after follicular divergence. Berisha et al.8 observed an upregulation of ACE gene in the highest steroidogenic follicles (with a diameter greater than 12 mm) in ovarian follicles from an abattoir. However, Daud et al.9 observed low ACE levels in pre-ovulatory follicles and suggested a role for ACE in follicular atresia. Moreover, in the ovariectomised rats, the replacement of oestrogen reduced the ACE activity in the aorta and the kidney tissue and plasma.38 These results together suggest that oestrogen secretion by a dominant follicle can suppress ACE expression in a dominant follicle. ACE mRNA upregulation in subordinate follicles may be a consequence of low oestradiol levels, as previously suggested.38 The fact that ACE inhibits the accumulation of nitric oxide,39 a factor involved in the prevention of follicular cell apoptosis40 and the stimulation of bovine granulosa cell oestradiol secretion,41 suggests that ACE can be involved in follicular atresia.38 In contrast, kinins induced nitric oxide synthesis39,42 and ACE is a major kininase that inactivates kinins.43 Therefore, one cannot rule out a possible interaction between these two systems to promote follicular atresia in cattle. The authors observed that the ACE gene is upregulated but did not result in a concomitant increase of AngII levels in the follicular fluid of the second largest follicle. Captopril, an ACE inhibitor, did not inhibit the hCG-induced ovulation in the rabbit perfused ovaries.9 In contrast, treatment with saralasin, an AT1 and AT2 blocker, is able to inhibit ovulation and oocyte maturation in rabbits10 and cattle.11,12 There are some possible reasons for the discrepant results between captopril and saralasin, which may also explain the upregulation of ACE without increasing AngII. For example, ACE inhibitors have other effects, including the prevention of the hydrolysis of bradykinin15,16 and the clearance of Ang1(1–7).17 Alternative enzymes have been demonstrated to be able to cleave AngI into AngII, such as members of plasminogen activator family,44 cathepsin D, and chymase,13 giving rise to the possibility of an alternative pathway to produce AngII in ovarian follicular cells. The perfusion of the isolated rabbit ovaries with IGF-1, an important local factor that controls follicular dominance, increases the follicular growth and the intrafollicular plasminogen activator activity.45 Moreover, the same authors stimulated in vitro both follicular growth and the intrafollicular AngII content using streptokinase, an exogenous PA. The present results provide, to the authors’ knowledge, the first direct evidence of differential regulation of local RAS components during follicular deviation in the bovine ovary. However, the hypothesis that (P)RR is regulating the AngII production in the ovarian follicle during the follicular deviation was not confirmed. The regulatory pattern of AngII was different from that observed for (P)RR in the dominant follicle. Many factors may account for these differences. One is that the (P)RR system seems to have at least two different functions. One is angiotensin independent, that (P)RR induces an intracellular signal and a downstream effect. Another is an angiotensin-dependent function related to the increased catalytic activity of receptor-bound (pro)renin.46 Oestradiol seems to affect negatively renin activity in the follicular fluid38 and a high prorenin-like activity was observed in the atretic follicles.47 Renin and ACE were demonstrated in the granulosa and the thecal cells of antral follicles in cattle,6 which may explain the presence of AngII but not the differential regulatory pattern of AngII in a dominant follicle. Therefore, on the basis of the actual knowledge, one cannot speculate about the biological function of the upregulation of (P)RR mRNA in the subordinate follicles. Renin-binding protein is a protein that binds to renin and inhibits its activity. It can be found as a complex with renin called high molecular weight renin48 and as a single protein.49 In the present study, RnBP was highly expressed in the subordinated follicle and it increased expression during follicular deviation. This result was further confirmed when the authors assessed RnBP mRNA expression in in vivoderived follicles 24 h after the intrafollicular treatment with the selective oestrogen receptor antagonist, fulvestrant. In rat, the tissue distribution of RnBP mRNA was similar to that of renin mRNA and was highly expressed in the ovary.50 Moreover, the same authors suggested a regulation of RnBP gene expression by oestradiol, and the intravenous injection of the RnBP into rats resulted in a rapid and strong inhibition of plasma renin activity that persisted for at least 2 h. However, knockout of the gene encoding for this protein in mice did not show any effect on RAS activity or blood pressure.51 Therefore, more studies are necessary to understand the role of RnBP in the control of ovarian renin activity and AngII production. The authors have presented here a regulatory pattern of AngII and mRNA expression of local RAS enzymes throughout the follicular wave development in cattle. AngII concentration increased in the dominant follicle during and after the follicular deviation, which supports the recent finding that AngII is required for the follicular development when the levels of FSH decrease during deviation. Using an in vivo model, it was found that the expression of ACE, RnBP, and (P)RR mRNA is upregulated in the second largest follicle during and after the follicular deviation and that intrafollicular injection of the oestradiol receptor antagonist upregulates RnBP mRNA expression, suggesting an Downloaded from jra.sagepub.com by guest on July 27, 2016 481 Ferreira et al. interaction between oestradiol and the RAS system in bovine follicle. In conclusion, the findings support the hypothesis that a local RAS is present in the ovary regulating follicular dominance in cattle. Acknowledgments The authors would like to thank Fazenda do Leão, Dr José Manoel Ferreira, and Dr Vinicius de Oliveira for providing the animals and facilities. Funding This study was supported by the Brazilian Council of Scientific and Technological Development (CNPq, grant number 502074/2008-6). Conflict of interest statement None declared. References 1. Peach MJ. Renin–angiotensin system: biochemistry and mechanisms of action. Physiol Rev 1977; 57: 313–370. 2. Phillips MI and Sumners C. Angiotensin II in central nervous system physiology. Regul Pept 1998; 78: 1–11. 3. Kim S and Iwao H. Molecular and cellular mechanisms of angiotensin II-mediated cardiovascular and renal diseases. Pharmacol Rev 2000; 52: 11–34. 4. Husain A, Bumpus FM, Silva PD and Speth RC. Localization of angiotensin II receptors in ovarian follicles and the identification of angiotensin II in rat ovaries. Proc Natl Acad Sci USA 1987; 84: 2489–2493. 5. Yoshimura Y, Koyama N, Karube M, et al. Gonadotropin stimulates ovarian renin–angiotensin system in the rabbit. J Clin Invest 1994; 93: 180–187. 6. Schauser KH, Nielsen AH, Winther H, Dantzer V and Poulsen K. Localization of the renin–angiotensin system in the bovine ovary: cyclic variation of the angiotensin II receptor expression. Biol Reprod 2001; 65: 1672–1680. 7. Kobayashi S, Berisha B, Amselgruber WM, Schams D and Miyamoto A. Production and localisation of angiotensin II in the bovine early corpus luteum: a possible interaction with luteal angiogenic factors and prostaglandin F2 alpha. J Endocrinol 2001; 170: 369–380. 8. Berisha B, Schams D and Miyamoto A. The mRNA expression of angiotensin and endothelin system members in bovine ovarian follicles during final follicular growth. J Reprod Devel 2002; 48: 573–582. 9. Daud AI, Bumpus FM and Husain A. Characterization of angiotensin I-converting enzyme (ACE)-containing follicles in the rat ovary during the estrous cycle and effects of ACE inhibitor on ovulation. Endocrinology 1990; 126: 2927–2935. 10. Yoshimura Y, Karube M, Koyama N, Shiokawa S, Nanno T and Nakamura Y. Angiotensin II directly induces follicle rupture and oocyte maturation in the rabbit. FEBS Lett 1992; 307: 305–308. 11. Ferreira R, Oliveira JF, Fernandes R, Moraes JF and Gonçalves PB. The role of angiotensin II in the early stages of bovine ovulation. Reproduction 2007; 134: 713–719. 12. Barreta MH, Oliveira JFC, Ferreira R, et al. Evidence that the effect of angiotensin II on bovine oocyte nuclear maturation is mediated by prostaglandins E2 and F2α. Reproduction 2008; 136: 733–740. 13. Paul M, Poyan Mehr A and Kreutz R. Physiology of local renin–angiotensin systems. Physiol Rev 2006; 86: 747–803. 14. Sihn G, Rousselle A, Vilianovitch L, Burckle C and Bader M. Physiology of the (pro)renin receptor: Wnt of change? Kidney Int 2010; 78: 246–256. 15. Gainer JV, Morrow JD, Loveland A, King DJ and Brown NJ. Effect of bradykinin-receptor blockade on the response to angiotensin-converting-enzyme inhibitor in normotensive and hypertensive subjects. N Engl J Med 1998; 339: 1285–1292. 16. Campbell DJ. The kallikrein–kinin system in humans. Clin Exp Pharmacol Physiol 2001; 28: 1060–1065. 17. Yamada K, Iyer SN, Chappell MC, Ganten D and Ferrario CM. Converting enzyme determines plasma clearance of angiotensin-(1-7). Hypertension 1998; 32: 496–502. 18. Do YS, Shinagawa T, Tam H, Inagami T and Hsueh WA. Characterization of pure human renal renin. Evidence for a subunit structure. J Biol Chem 1987; 262: 1037–1043. 19. Sealey JE, White RP, Laragh JH and Rubin AL. Plasma prorenin and renin in anephric patients. Circ Res 1977; 41: 17–21. 20. Nguyen G, Delarue F, Burckle C, Bouzhir L, Giller T and Sraer JD. Pivotal role of the renin/prorenin receptor in angiotensin II production and cellular responses to renin. J Clin Invest 2002; 109: 1417–1427. 21. Suzuki F, Hayakawa M, Nakagawa T, et al. Human prorenin has ‘gate and handle’ regions for its non-proteolytic activation. J Biol Chem 2003; 278: 22217–22222. 22. Nabi AH, Kageshima A, Uddin MN, Nakagawa T, Park EY and Suzuki F. Binding properties of rat prorenin and renin to the recombinant rat renin/prorenin receptor prepared by a baculovirus expression system. Int J Mol Med 2006; 18: 483–488. 23. Batenburg WW, Krop M, Garrelds IM, et al. Prorenin is the endogenous agonist of the (pro)renin receptor. Binding kinetics of renin and prorenin in rat vascular smooth muscle cells overexpressing the human (pro)renin receptor. J Hypertens 2007; 25: 2441–2453. 24. Kaneshiro Y, Ichihara A, Sakoda M, et al. Slowly progressive, angiotensin II-independent glomerulosclerosis in human (pro)renin receptor-transgenic rats. J Am Soc Nephrol 2007; 18: 1789–1795. 25. Takahashi S, Inoue H and Miyake Y. The human gene for renin-binding protein. J Biol Chem 1992; 267: 13007–13013. Downloaded from jra.sagepub.com by guest on July 27, 2016 482 Journal of the Renin-Angiotensin-Aldosterone System 12(4) 26. Savio JD, Keenan L, Boland MP and Roche JF. Pattern of growth of dominant follicles during the oestrous cycle of heifers. J Reprod Fertil 1988; 83: 663–671. 27. Ginther OJ, Kastelic JP and Knopf L. Composition and characteristics of follicular waves during the bovine estrous cycle. Anim Reprod Sci 1989; 20: 187–200. 28. Evans ACO and Fortune JE. Selection of the dominant follicle in cattle occurs in the absence of differences in the expression of messenger ribonucleic acid for gonadotropin receptors. Endocrinology 1997; 138: 2963–2971. 29. Kot K, Gibbons JR and Ginther OJ. A technique for intrafollicular injection in cattle: Effects of hCG. Theriogenology 1995; 44: 41–50. 30. Jaiswal RS, Singh J and Adams GP. Developmental pattern of small antral follicles in the bovine ovary. Biol Reprod 2004; 71: 1244–1251. 31. Rivera GM and Fortune JE. Development of codominant follicles in cattle is associated with a follicle-stimulating hormone-dependent insulin-like growth factor binding protein-4 protease. Biol Reprod 2001; 65: 112–118. 32. Buratini J Jr, Teixeira AB, Costa IB, et al. Expression of fibroblast growth factor-8 and regulation of cognate receptors, fibroblast growth factor receptor-3c and -4, in bovine antral follicles. Reproduction 2005; 130: 343–350. 33. Costa APR, Fagundes-Moura CR, Pereira VM, et al. Angiotensin-(1–7): a novel peptide in the ovary. Endocrinology 2003; 144: 1942–1948. 34. Livak KJ and Schmittgen TD. Analysis of relative gene expression data using real-time quantitative PCR and the 2-[Delta][Delta]CT Method. Methods 2001; 25: 402–408. 35. Rivera GM, Chandrasekher YA, Evans AC, Giudice LC and Fortune JE. A potential role for insulin-like growth factor binding protein-4 proteolysis in the establishment of ovarian follicular dominance in cattle. Biol Reprod 2001; 65: 102–111. 36. Ferreira R, Gasperin B, Bohrer RC, et al. The Role of Angiotensin II in Bovine Follicular Growth. 41th Annual Meeting of the Society for the Study of Reproduction. 714 ed. 41th Annual Meeting of the Society for the Study of Reproduction: Society for the Study of Reproduction, 2008, p 240–241. 37. Acosta TJ, Ozawa T, Kobayashi S, et al. Periovulatory changes in the local release of vasoactive peptides, prostaglandin F2α, and steroid hormones from bovine mature follicles in vivo. Biol Reprod 2000; 63: 1253–1261. 38. Brosnihan KB, Senanayake PS, Li P and Ferrario CM. Bi-directional actions of estrogen on the renin–angiotensin system. Braz J Med Biol Res 1999; 32: 373–381. 39. Zhang X, Xie YW, Nasjletti A, Xu X, Wolin MS and Hintze TH. ACE inhibitors promote nitric oxide accumulation to modulate myocardial oxygen consumption. Circulation 1997; 95: 176–182. 40. Dineva JD, Vangelov IM, Nikolov GG, Konakchieva R and Ivanova MD. Nitric oxide stimulates the production of atrial natriuretic peptide and progesterone by human granulosa luteinized cells with an antiapoptotic effect. Endocr Regul 2008; 42: 45–51. 41. Faes MR, Caldas-Bussiere MC, Viana KS, Dias BL, Costa FR and Escocard RM. Nitric oxide regulates steroid synthesis by bovine antral granulosa cells in a chemically defined medium. Anim Reprod Sci 2009; 110: 222–236. 42. Kuhr F, Lowry J, Zhang Y, Brovkovych V and Skidgel RA. Differential regulation of inducible and endothelial nitric oxide synthase by kinin B1 and B2 receptors. Neuropeptides 2010; 44: 145–154. 43. Kuoppala A, Lindstedt KA, Saarinen J, Kovanen PT and Kokkonen JO. Inactivation of bradykinin by angiotensinconverting enzyme and by carboxypeptidase N in human plasma. Am J Physiol Heart Circ Physiol 2000; 278: H1069–1074. 44. Peterson MC, Morioka N, Zhu C, Ryan JW and LeMaire WJ. Angiotensin-converting enzyme inhibitors have no effect on ovulation and ovarian steroidogenesis in the perfused rat ovary. Reprod Toxicol 1993; 7: 131–135. 45. Yoshimura Y, Aoki N, Sueoka K, et al. Interactions between insulin-like growth factor-I (IGF-I) and the renin–angiotensin system in follicular growth and ovulation. J Clin Invest 1996; 98: 308–316. 46. Nguyen G and Danser AH. Prorenin and (pro)renin receptor: a review of available data from in vitro studies and experimental models in rodents. Exp Physiol 2008; 93: 557–563. 47. Schultze D, Brunswig B and Mukhopadhyay AK. Renin and prorenin-like activities in bovine ovarian follicles. Endocrinology 1989; 124: 1389–1398. 48. Takahashi S, Ohsawa T, Miura R and Miyake Y. Purification of high molecular weight (HMW) renin from porcine kidney and direct evidence that the HMW renin is a complex of renin with renin binding protein (RnBP). J Biochem 1983; 93: 265–274. 49. Takahashi S, Ohsawa T, Miura R and Miyake Y. Purification and characterization of renin binding protein (RnBP) from porcine kidney. J Biochem 1983; 93: 1583–1594. 50. Tada M, Takahashi S, Miyano M and Miyake Y. Tissuespecific regulation of renin-binding protein gene expression in rats. J Biochem 1992; 112: 175–182. 51. Schmitz C, Gotthardt M, Hinderlich S, et al. Normal blood pressure and plasma renin activity in mice lacking the reninbinding protein, a cellular renin inhibitor. J Biol Chem 2000; 275: 15357–15362. 52. Luo W and Wiltbank MC. Distinct regulation by steroids of messenger RNAs for FSHR and CYP19A1 in bovine granulosa cells. Biol Reprod 2006; 75: 217–225. Downloaded from jra.sagepub.com by guest on July 27, 2016