Ecotoxicology and Environmental Safety 147 (2018) 349–356 Contents lists available at ScienceDirect Ecotoxicology and Environmental Safety journal homepage: www.elsevier.com/locate/ecoenv Operating conditions influence microbial community structures, elimination of the antibiotic resistance genes and metabolites during anaerobic digestion of cow manure in the presence of oxytetracycline MARK Gokhan Turkera, Çağrı Akyola, , Orhan Inceb, Sevcan Aydinc, Bahar Incea ⁎ a b c Institute of Environmental Sciences, Boğaziçi University, Bebek, 34342 Istanbul, Turkey Department of Environmental Engineering, Istanbul Technical University, Maslak, 34469 Istanbul, Turkey Department of Genetics and Bioengineering, Nişantaşı University, Sarıyer, 34485, Istanbul, Turkey A R T I C L E I N F O A B S T R A C T Keywords: Anaerobic digestion Antibiotic resistance gene Metabolite Microbial community Oxytetracycline The way that antibiotic residues in manure follow is one of the greatest concerns due to its potential negative impacts on microbial communities, the release of metabolites and antibiotic resistant genes (ARGs) into the nature and the loss of energy recovery in anaerobic digestion (AD) systems. This study evaluated the link between different operating conditions, the biodegradation of oxytetracycline (OTC) and the formation of its metabolites and ARGs in anaerobic digesters treating cow manure. Microbial communities and ARGs were determined through the use of quantitative real-time PCR. The biodegradation of OTC and occurrence of metabolites were determined using UV-HPLC and LC/MS/MS respectively. The maximum quantity of resistance genes was also examined at the beginning of AD tests and concentration was in the order of: tetM > tetO. The numbers of ARGs were always higher at high volatile solids (VS) content and high mixing rate. The results of the investigation revealed that relationship between mixing rate and VS content plays a crucial role for elimination of ARGs, OTC and metabolites. This can be attributed to high abundance of microorganisms due to high VS content and their increased contact with elevated mixing rate. An increased interaction between microorganisms triggers the promotion of ARGs. 1. Introduction As a biochemical process of microbial and energy metabolism, anaerobic digestion (AD) is strongly dependent on the environmental aspects, such as temperature, pH, presence of inhibitors and substrate characteristics (Mata-Alvarez et al., 2011). A precise maintenance of the operating conditions and their sustained monitoring can prevent undesirable inconveniences and also enhance the efficiency of the system (Esposito et al., 2012). AD of manure generates methane-rich biogas that can be utilized in an engine-generator system to produce electricity in order to cease farm electricity purchase from the national grid (Meinen et al., 2014). Stability problems can be faced in manurebased anaerobic digesters since the microbial group is highly susceptible to the environmental and operating conditions. Veterinary antibiotics are frequently detected in slurry and manure of animals, and thereby threaten human health; since together with their metabolites, they accumulate in the environment due to their low degradation behavior and high tendency to be adsorbed onto soil and sludge particles (Bauer et al., 2014; Jechalke et al., 2014). Metabolites ⁎ are more remarkable than their precedent compounds because the presence of hydroxyl, carboxyl or keto groups increases their interaction with the environment. In order to better understand risks that antibiotics and metabolites pose to the natural environment and human heath, it is important to study their incidence (Haddad et al., 2015). Oxytetracycline (OTC) is widely used in animal husbandries to prohibit disease and enhance growth and favored by the fact that is cost-effective, has low side effects and a great variety of target microorganisms (Arikan et al., 2006; Liu et al., 2016a). Approximately 70% of OTC leaves the microorganisms without receiving complete metabolism by ways of urine and feces (Liu et al., 2016b). The accumulation of OTC in different biomass alternatives such as cattle manure, which is later used as feedstock in AD, may also upset the whole performance if the microorganisms are inhibited or suppressed (Ince et al., 2013). For instance, during the anaerobic digestion of pig manure (Álvarez et al., 2010), methane production decreased by 56%, 60% and 62% at OTC and chlortetracycline (CTC) concentrations of 10, 50 and 100 mg/L, respectively. Generally, eliminated antibiotic concentrations are reported to have adverse effects on the structure of microbial group and Corresponding author. E-mail address: cagri.akyol@boun.edu.tr (Ç. Akyol). http://dx.doi.org/10.1016/j.ecoenv.2017.08.044 Received 14 March 2017; Received in revised form 14 August 2017; Accepted 17 August 2017 0147-6513/ © 2017 Elsevier Inc. All rights reserved. Ecotoxicology and Environmental Safety 147 (2018) 349–356 G. Turker et al. even low concentrations can inhibit their function (Lins et al., 2015). Another major concern about releasing antibiotics into the environment is associated with the antibiotic resistance genes (ARGs) and bacteria (ARB) (Arikan, 2008; Rizzo et al., 2013). The implementation of such antibiotics used in veterinary is expected to promote the selection for strains that are resistant to antibiotics employed in human medicine (Kemper, 2008). However, due to the fact that many of the ppb level of antibiotics do not have the ability to hinder the antibiotic sensitive microorganisms effectively, the theory of traditional selective pressure on the proliferation of antibiotic resistance in the microbial group may not be prevalent under environmental aspects. In this regard, an alternative mechanism, for instance horizontal gene transfer, can be recognized for the dissemination of antibiotic resistance characteristics in the environment which contains antimicrobial compounds at low levels (Kim et al., 2014). Horizontal gene transfer has an important effect on specification and enzyme activities of anaerobic microorganism. Correlations have been remarked between the use of antibiotics and the presence of sulfonamide and tetracycline-ARGs in pig farms and cattle waste lagoons in China (Zhu et al., 2013) and the USA (McKinney et al., 2010), proposing a relationship between the usage of antibiotic and environmental storage of drug resistance (Zhang et al., 2014). In the study by Zhang et al. (2013), the structural alterations of the microbial groups and the diversities of eight tetracycline resistance genes were determined through the use of real-time fluorescence quantitative polymerase chain reaction (RT-qPCR). According to results, it has been reported that trace tetracycline could seriously change the structure of microbial groups and bacteria, which do not have the ability to adapt tetracycline containing environment, were leisurely dominated by those that have the ability to adapt tetracycline. In a recent study conducted by Akyol et al. (2016), phase separation, namely as two-phase AD, was highlighted to be an alternative solution in the treatment of antibiotic-medicated manures to decrease the adverse impacts of such antibiotics on microbial groups and thereby increase methane production. Together taken, possible inhibitory impacts of antibiotics on structures of microbial community and thus ARGs are highly dependent on environmental and operating conditions selected for AD processes. The purpose of the current study is to gain an understanding into the microbial community, development of metabolites and ARGs in AD systems fed with OTC-medicated cow manure under changing operating conditions. Among the most critical operating parameters in AD systems, mixing rate (Shen et al., 2013) and solids content (Akyol et al., 2015) were chosen to interpret the relationship between the contact of feedstock and microbial communities and the occurrence of ARGs in such different conditions. In order to achieve this, anaerobic batch digesters were set up with different contents of volatile solids (VS) and rates of mixing at mesophilic temperature (37 °C) in the existence and absence of OTC. This approach may help to gain insight into microbial interactions that present among acetogens and methanogens and in which way they inhibit the development of the stability and efficiency of the anaerobic digesters considering the occurrence of antibiotic resistance genes and metabolites in anaerobic digesters with manures polluted with antibiotics. Table 1 Operational parameters in digester set-ups. Digesters Temperature (°C) Mixing rate (rpm) Volatile solids (VS) content (%) OTC presence S1 S1 S2 S2 S3 S3 S4 S4 37 90 5–6 No Yes No Yes No Yes No Yes Control Control Control 8–9 120 Control 5–6 8–9 Manure that was examined as the control in the anaerobic digestion tests was obtained from a non-medicated cow. All manure samples were kept in 5 L containers at + 4 °C prior to use. 2.2. Chemicals, OTC extraction and detection HPLC-grade chemicals were purchased from Merck (NJ, USA) and OTC was supplied from Acros Organics N.V. (NJ, USA). The extraction of OTC was carried out in accordance with the method changed from Yuan et al. (2010) and described elsewhere (Ince et al., 2013). OTC measurement was done through the use of Shimadzu high performance liquid chromatography (HPLC) instrument (Schimadzu LC-10 CE), supplied with a UV detector (UV VIS Detector, SPD 10-A) and operated at 357 nm. The analytical column was Intersil ODS-3 HPLC column, 25 cm × 4.6 mm ID, 5 µm, used at ambient temperature. Metabolites that occur due to the degradation of OTC during AD were measured by LC/MS/MS at TÜBİTAK MAM Food Institute, Turkey. The preparation and measurement of standard solutions; the drawing of calibration curve and the calculation of recovery rates were all performed. Sample measurements were conducted after getting satisfying results from rates of recovery. Each analysis was performed as explained elsewhere (Arikan et al., 2006). 2.3. Anaerobic digesters set-up The experimental set-up composed of 8 anaerobic batch digesters with 1000 mL volume. The digesters were run at 37 ± 1 °C in an incubating shaker. Operating conditions in digester set-ups are summarized in Table 1. Accordingly, 2 sets of anaerobic digesters were run with 2 different mixing ratios as 90 rpm and 120 rpm; in which 2 different VS ratio ranges (5–6% and 8–9%) were examined. Furthermore, a control digester was operated for non-medicated cow manure in every digester configuration. VS-dilution was applied to fresh manure samples with tap water to have an ultimate active volume of 600 mL. An already-operating lab-scale cow manure digester was used to obtain inoculum and the experimental digesters were seeded at a ratio of 1:10 (v:v). 2.4. Analytical methods 2. Materials and methods Samples were gathered on every 10 days from the digesters for OTC measurement and other physicochemical and molecular analyses. Alkalinity, total solids (TS), VS were applied pursuant to standard methods (American Public Health Association (APHA), 2005). Perkin Elmer Clarus 600 Gas Chromatograph (GC) supplied with a flame ionization detector (FID) was used to measure volatile fatty acid (VFA) concentrations. Air flow and H2 rates in the FID detector were 450 mL/ min and 45 mL/min, respectively, and Elite FFAP (30 m, 0.32 mm ID, 0.25 µm df) was used as a column. The set point of the oven was 100 °C while highest temperature of inlet was 240 °C. Carrier gas was Helium at a rate of 0.8 mL/min. Cumulative biogas production in the digesters was recorded by 2.1. Animal medication and manure sampling Manure samples were collected from Holstein race (2.5–3.5 years old, 400–500 kg body mass) dairy cows that were held in a barn at the Faculty of Veterinary Medicine, Istanbul University. OTC injection solution (20 mg OTC /kg body weight) in accordance with the standard dose in veterinary practice was used to medicate cows for once. Same dosages were injected to both right and left body parts between musculus semitendinosus and musculus semimembranosus muscles. All manure samples were obtained from rectum of the same animal in every 24 h for the following 120 h and mixed homogenously (Ince et al., 2013). 350 Ecotoxicology and Environmental Safety 147 (2018) 349–356 G. Turker et al. as explained: 45 cycles of 10 s at 94 °C following the initial denaturation for 10 min at 94 °C, then 5 s at the specific annealing temperature as shown in Table S1. To confirm the specificity in each tube of reaction via the identification of primer-dimer absence and nonspecific products, a melting curve analysis for every PCR run was developed by SYBR Green I detection. The reactions of every sample displayed solely one melting peak, which meant a specific amplification and precise quantification. Extensive information about preparing the standard curves and efficiencies of qPCR was shared in previous investigations (Aydin et al., 2015a). Samples taken from digesters were analyzed by specific primers coding for four different tetracycline resistance genes. These included two diversified ARG types: Out of four genes, only two coding for ribosomal protection protein, tetM and tetO, was found. The qPCR analysis also confirmed that antibiotic resistance genes were not extant in the control digester. Positive amplicons were amplified again and High Pure PCR purification Kit (Roche, Germany) was used to clean them according to manufacturer's protocol. Cleaned products were sequenced to verify their identification. Sequences were analyzed in databank at www.ebi.ac.uk. Sequence analysis showed that sequences were resembled to tetM and tetO genes by 99% and 100%, respectively (EM_ENV:HE580607 and TR:F2 × 9A4_9BACT). Sequences were given below: > 18-tet_M Milligas Counters (Ritter Digital Counter, U.S.A.). Moreover, HP Agilent 6850 GC with a thermal conductivity detector (HP Plot Q column 30 m × 0.53 mm) was used to measure gas compositions. Helium was used as the carrier gas at a rate of 2 mL/min. The temperature of oven was 70 °C. 2.5. Genomic DNA (gDNA) extraction, total RNA extraction and cDNA synthesis Fast DNA Spin Kit for Soil (Q-Biogene, Bio 101 Thermo Electron Corporation, Belgium) and a Ribolyser (Fast PrepTM FP120 Bio 101 Thermo Electron Corporation, Belgium) were used in accordance with the manufacturers’ instructions to extract total gDNAs from 1 mL slurry samples. Qubit 2.0 Fluorometer (Invitrogen, U.K.) was employed to determine the concentrations of the gDNA. gDNAs were kept at −20 °C until needed for further studies. The total RNAs were insulated from 500 mL slurry samples via PureLink RNA extraction kit (Invitrogen, U.K.) according to advised procedures. Total RNA was stored at −80 °C until cDNA synthesis. The cDNAs were synthesized by a SuperScript cDNA synthesis kit (Invitrogen, U.K.) through a process of reverse transcription polymerase chain reaction (RT-PCR) through the use of primers of hexamer. cDNA synthesis was operated for 10 min at 25 °C, 60 min at 42 °C and 5 min at 85 °C. The gDNA and cDNA samples were kept at −20 °C until needed for further studies. GTAGATCCCTTCAGTAACATCGGCCACCGTGGACAGAGGTACAACGAA AACGG ATAATACGCTTTTAGAACGTCAGAGAGGAATTACAATTCAGACGG CGATAACC TCTTTTCAGTGGAAAAATACTAAGGTGAACATCATAGACACGCCAA GA > 15-tet_O GGGAGCGTAGATGAAGGCACAACAAGGACAGATACAATGAATTTG GAGCGTC 2.6. Quantification of microbial community and antibiotic resistance genes Abundances of microbial communities (active bacteria and methanogenic archaea) and tetracycline (tetB, tetK, tetM, tetO) resistance gene in anaerobic digesters operated with different VS concentrations and mixing rates were measured by qPCR with SYBR Green using specific primers. The primers used in this investigation are shown in Table S1. Triplicate samples were collected from the digesters on Days 0, 10, 20 and 30 and these were employed to measure the tetracycline resistance genes. The qPCR assays were done through the use of Roche Light Cycler DNA Master SYBR Green I kit and Roche Light Cycler 2.0 (Roche Diagnostics GmbH, Mannheim, Germany). The output of the qPCR assays was analyzed by Light Cycler Software 4.05. Light Cycler Software 4.05 program supplied from Roche. The protocol of amplification was AAAGGGGAATCCACTATCCAGACAGCAGTGACATCTTTTCAGTGGGAG GATGT AAAAGTCAACATTATAGATACGCCAAAGATTTCCATTAACCCTCCC TAAT Fig. 1. Concentrations of oxytetracycline (OTC) during mesophilic anaerobic digestion of medicated cow manure slurry (S1: 90 rpm & 5–6% VS, S2: 90 rpm & 8–9% VS, S3: 120 rpm & 5–6% VS, S4: 120 rpm & 8–9% VS). 351 Ecotoxicology and Environmental Safety 147 (2018) 349–356 G. Turker et al. Fig. 2. Concentrations of 4-epi-oxytetracycline (EOTC), α-apooxytetracycline (α-Apo-OTC) and β-apo-oxytetracycline (β-ApoOTC) during thermophilic anaerobic digestion of medicated cow manure slurry (S1: 90 rpm & 5–6% VS, S2: 90 rpm & 8–9% VS, S3: 120 rpm & 5–6% VS, S4: 120 rpm & 8–9% VS). 2.7. Statistical analysis Table 2 OTC elimination and OTC half-life values in the anaerobic digesters. SPSS version 11.5 (SPSS Inc., Chicago, Illinois, USA) was employed to conduct statistical analyses. Data normality was assessed through the examination of histogram and q-q plots and by using the Shapiro-Wilk's test. The Levene's test was also used for testing variance homogeneity. To make a comparison between the variations in production of biogas, elimination of OTC, microbial community over the process of anaerobic digestion either a one-way analysis of variance (ANOVA) or independent samples t-test was applied. Multiple comparisons was generated by the application of the Tukey's test. Values were expressed as mean and standard deviation. Remarkable variation were detected at the p < 0.05 significance level. Digesters OTC elimination (%) OTC half-life (days) S1 S2 S3 S4 55 56 64 73 27 27 24 21 Both OTC metabolites were detected at a slightly low level (about 5%) comparing to that of initial OTC levels in the digesters, which were already present in fresh manure samples. Following the digester operation, EOTC and α-Apo-OTC concentrations showed no significant change and remained at in the vicinity of 0.1 mg/L in high-mixing digesters. However, EOTC concentrations increased from 0.1 to 0.2 mg/L and from 0.14 to 0.36 mg/L in S1 and S2, respectively. As can be seen in Fig. 2, comparatively higher concentrations of β-Apo-OTC (up to 0.65 mg/L in S2) were measured in the digesters. This can indicate that β-Apo-OTC exists at more elevated concentrations in manure samples. On day 30, β-Apo-OTC concentrations decreased to concentrations between 0.05 and 0.2 mg/L in all digesters. Based on the results, mixing rate was observed to correlate with OTC elimination and OTC half-life. On the other hand, no positive correlation was found between VS content and OTC elimination and OTC half-life. Arikan et al. (2006) reported 59% of the removal of OTC in anaerobic calf manure digesters at the end of 64 days and OTC half-life was measured as 56 days. Álvarez et al. (2010) indicated that total concentrations of OTC over the anaerobic digestion of pig manure in diversified batch assays reduced from 13.5, 56.9 and 95.0 mg/L to 5.7, 26.6, and 30.7 mg/L within 21 days yielding a comprehensive removal of OTC of 57%, 53%, and 67%, respectively. Furthermore, they reported that EOTC was generated in every assay for the first 7 days, reaching the highest concentrations of 0.9, 3 and 5 mg/L in the 10, 50 and 100 mg OTC/L assays, respectively. OTC elimination rates reported in the literature are in agreement with this study. On the other hand, variations in OTC half-life values can be attributed to the fact that the biotransformation mechanism of OTC parent compound to its metabolites can vary for different environmental and operating conditions in anaerobic digestion tests, initial OTC concentrations as well as the substrates and the seed sludge. The addition of antibiotics (diet containing antibiotics in manure or externally antibiotic-spiked manure) also affects the fate of these compounds in anaerobic digestion systems. 3. Results and discussion 3.1. Behavior of OTC and its metabolites during anaerobic digestion OTC concentrations were measured every 10 days of the particular anaerobic batch tests, whereas 3 most commonly detected metabolites of OTC, also known as 4-epi-oxytetracycline (EOTC), a-apo-oxytetracycline (α-Apo-OTC) and β-apo-oxytetracycline (β-Apo-OTC), were monitored at the beginning and at the end of 30-days digestion period. OTC concentrations and its metabolites are shown in Figs. 1 and 2, respectively. Initial concentrations of OTC were measured in the range of 1.1–3.4 mg/L at the start up and this variation occurred since OTC was injected directly to the animal and manure samples were collected, mixed and used throughout the study as mentioned earlier. Although OTC-containing fresh manure samples were mixed homogeneously, due to the sorption tendency of OTC to solid particles, it is almost impossible to get 100% homogeneous slurry. During the digestion tests, higher concentrations of OTC were measured for high VS conditions due to higher amounts of OTC sorped to biosolids. A little decrement was observed in OTC concentrations through the first 10 days of the AD. Diametrically opposed to the early days, sharp decreases in OTC concentrations were engaged between days 10 and 20. OTC concentrations were measured as 0.8, 1.3, 0.4 and 0.6 mg/L in S1, S2, S3 and S4, respectively, and remained relatively stable until the end of the digestion period. After 30 days of operation, a reduction in OTC levels in a range of 55–73% of the initial concentration was determined (Table 2). S4, which was operated with higher VS content at 120 rpm, exhibited the greatest OTC elimination. Consequently, calculated OTC half-life value was lower in S4 as 21 days, followed by S3 and both S1 and S2 as 24 and 27 days, respectively. 352 Ecotoxicology and Environmental Safety 147 (2018) 349–356 G. Turker et al. Fig. 3. Cumulative biogas production values from digesters containing medicated and non-medicated cow manure slurries at (a) 90 rpm mixing rate and (b) 120 rpm mixing rate (S1: 90 rpm & 5–6% VS, S2: 90 rpm & 8–9% VS, S3: 120 rpm & 5–6% VS, S4: 120 rpm & 8–9% VS). concentrations (Table S2). Acetic acid concentrations reached up to 550 mg/L in all non-medicated digesters during the first days of the operation period. The presence of OTC adversely affected the production of acetic acid, staying at a concentration below 100 mg/L. Mixing rate seemed to influence the production of propionic acid since comparatively higher concentrations of propionic acid was produced in the digesters operated at 120 rpm. No accumulation of VFAs was observed after 10th day in any digesters. By the existence of excessive total alkalinity in each digester due to the buffering capacity of cow manure slurry, alkalinity was maintained at favorable levels both in nonmedicated and OTC-medicated digesters in order that methanogenesis rate was not affected negatively. Previous investigations have reported supporting results in methane production over anaerobic digestion of OTC containing cattle manure. With concentrations such as 3.1 mg OTC/L, Arikan et al. (2006) reported a 27% decrease in CH4 production. In another study, 2%, 5% and 7% methane reduction was reported when OTC concentrations were 1 mg/L, 5 mg/L and 25 mg/L (Loftin et al., 2005). Yet, an absence of inhibition even at concentrations up to 125–250 mg OTC/L was reported in several studies (Lallai et al., 2002). These contradicts might be the consequence of various environmental and operating conditions maintained in each study, such as the source of inoculum and manure, ratio of inoculum/manure, concentration of antibiotics, temperature, reactor configuration, etc. Likewise, Wang et al. (2015) highlighted that the degradation half-life of OTC in manure from swine fed OTC (9.04 days) was significantly shorter than that of the manure directly treated with OTC (9.65 days). The elimination of such antibiotics is reported to be highly dependent on environmental and operational parameters in AD systems (Akyol et al., 2016). Furthermore, concentrations of OTC, EOTC, α -Apo-OTC and β-Apo-OTC were found in AD tests is believed to be owing to large quantities of OTC being attached to grains in manure matrix instead of degrading to unknown constituents (Loke et al., 2003). The findings in this study show that AD of animal manure prior to its final disposal promotes the elimination of OTC and its metabolites. 3.2. Biogas production and digestion stability Anaerobic batch digesters were incubated at 37 °C for 30 days. Biogas production in each digester sets is given in Fig. 3. The existence of OTC did not affect the biogas composition, and methane content of the biogas in the digesters ranged between 55% and 65%. Initial concentrations of 2.2, 3.4, 1.1 and 2.2 mg OTC/L caused 24%, 20%, 14% and 17% reduction in biogas production in S1, S2, S3 and S4, respectively. Minimum methane was achieved in the OTC-medicated digester (S1) that was operated with low VS content at 90 rpm mixing rate. The results indicated that mixing rate did not have a remarkable impact in the control digesters. In spite of monitoring of acetic and propionic acid accumulation was observed on low levels at the first days of the digestion period, these concentrations did not inhibit system (Frankewhittle et al., 2014). Major types of VFA were determined as acetic acid and propionic acid. Other types of VFA were determined at very low 3.3. Quantification of active bacteria and methanogenic archaea Quantitative alterations in the concentration of 16S rRNA in terms of bacteria and methanogenic archaea were detected by using qPCR in 353 Ecotoxicology and Environmental Safety 147 (2018) 349–356 G. Turker et al. Fig. 4. Quantitative changes in (a) bacterial (b) Methanobacteriales (c) Methanomicrobiales (d) Methanosarcinales (e) Methanoasaeta 16S rRNA gene concentrations in the digesters (S1: 90 rpm & 5–6% VS, S2: 90 rpm & 8–9% VS, S3: 120 rpm & 5–6% VS, S4: 120 rpm & 8–9% VS). anaerobic digestion of cow manure in the presence of OTC. A lower inhibition effect on microbial community was observed in the S3 digester, which was operated at low VS content and high mixing rate. all digesters. The presence of temporary variations in the quantities of total genes under various operating conditions of the digesters was shown by the concentration profiles. The quantity of active bacteria and methanogenic archaea in the anaerobic digesters is presented in Fig. 4. qPCR assay showed that the first significant impacts (p < 0.05) of OTC on the populations of bacteria and archaea were remarked on 10th day. Moreover, the most remarkable impact on the active methanogenic archaea was observed at the end of 30 days in S1, S2, S3 and S4 digesters. The most abundant genera in AD were Methanobacteriales and Methanomicrobiales, proposing dominance of hydrogenotrophic methanogens over acetoclastic methanogens (Methanosarcinales and Methanoasaeta). Biogas and methane production showed a significant (p < 0.05) positive association between acetoclastic methanogens and hydrogenotrophic methanogens. This also underlines the necessity to obtain optimum conditions of growth for acetoclastic methanogens in an attempt to optimize the production of biogas, elimination of OTC and resistance genes during AD. Several pieces of research have also enlightened how the alterations structure of community are remarkably higher for archaea than they are for bacteria and that alterations in structure of bacterial community have no significant impact on the variety and structure of the methanogenic community in the bioreactors (Aydin et al., 2015a). Accordingly, it is probable that the biodegradation of OTC and formation of metabolites may depend on the archaeal community shift over 3.4. Quantification of antibiotic resistance genes To investigate the emergence of antibiotic resistance in AD, qPCR assays were employed to underline the impact of operating conditions on the number of resistance genes. In this study, tetB, tetK, tetM and tetO were selected to monitor resistance gene promotion in anaerobic digestion. These included two diversified types of ARGs: the efflux pump genes tetB, tetK; the ribosomal protection genes tetM, tetO. qPCR analysis showed that only ribosomal protection type resistance was present in digesters as seen in Fig. 5. tetB and tetK were not quantified during operation of anaerobic digesters since the results obtained from quantification of resistance genes showed that a less familiar type of ribosome protection mechanism was more widespread than efflux pump genes. These results are also consistent with other previous investigations (Aydin et al., 2015b). The maximum quantity of resistance genes was also observed at the beginning of anaerobic digestion tests and concentration was in the order of: tetM > tetO. As resistance gene numbers were monitored according to environmental parameters, it has been found that gene copy number of resistance genes in low mixing rate digesters were higher than the gene copy number of high mixing 354 Ecotoxicology and Environmental Safety 147 (2018) 349–356 G. Turker et al. Fig. 5. Quantities of (a) tetM (b) tetO in the anaerobic digesters (S1: 90 rpm & 5–6% VS, S2: 90 rpm & 8–9% VS, S3: 120 rpm & 5–6% VS, S4: 120 rpm & 8–9% VS). University Research Fund (Project No: 11Y00P4). rate digesters. The highest maximum concentration of ARGs was found in tetM in the S2 and S4 digesters. The results of the investigation revealed that relationship between mixing rate and VS content plays a crucial role for the elimination of antibiotic resistance genes, OTC and metabolites. This can be attributed to high abundance of microorganisms due to high VS content that caused higher and their increased contact with elevated mixing rate. Appendix A. Supporting information Supplementary data associated with this article can be found in the online version at http://dx.doi.org/10.1016/j.ecoenv.2017.08.044. References 4. Conclusion Akyol, Ç., Demirel, B., Onay, T.T., 2015. Recovery of methane from tannery sludge: the effect of inoculum to substrate ratio and solids content. J. Mater. Cycles Waste Manag. 17, 808–815. http://dx.doi.org/10.1007/s10163-014-0306-2. Akyol, Ç., Ince, O., Cetecioglu, Z., Alkan, F.U., Ince, B., 2016. The fate of oxytetracycline in two-phase and single-phase anaerobic cattle manure digesters and its effects on microbial communities. J. Chem. Technol. Biotechnol. 91, 806–814. http://dx.doi. org/10.1002/jctb.4649. Álvarez, J.A., Otero, L., Lema, J.M., Omil, F., 2010. The effect and fate of antibiotics during the anaerobic digestion of pig manure. Bioresour. Technol. 101, 8581–8586. http://dx.doi.org/10.1016/j.biortech.2010.06.075. American Public Health Association (APHA), 2005. Standard Methods for the Examination of Water and Wastewater, 21st ed. American Public Health Association, Washington, DC. Arikan, O.A., 2008. Degradation and metabolization of chlortetracycline during the anaerobic digestion of manure from medicated calves. J. Hazard. Mater. 158, 485–490. http://dx.doi.org/10.1016/j.jhazmat.2008.01.096. Arikan, O.A., Sikora, L.J., Mulbry, W., Khan, S.U., Rice, C., Foster, G.D., 2006. The fate and effect of oxytetracycline during the anaerobic digestion of manure from therapeutically treated calves. Process Biochem. 41, 1637–1643. http://dx.doi.org/10. 1016/j.procbio.2006.03.010. Aydin, S., Ince, B., Ince, O., 2015a. Application of real-time PCR to determination of combined effect of antibiotics on Bacteria, Methanogenic Archaea, Archaea in anaerobic sequencing batch reactors. Water Res. 76, 88–98. http://dx.doi.org/10. 1016/j.watres.2015.02.043. Aydin, S., Ince, B., Ince, O., 2015b. Development of antibiotic resistance genes in microbial communities during long-term operation of anaerobic reactors in the This study may provide an understanding into the potential of different operating conditions in anaerobic digestion to reduce antibiotic resistance genes and metabolites. Additionally, different operating conditions in anaerobic digesters such as mixing rate and VS content changes microbial community dynamics and could promote on the hydrogenotrophic methanogenesis pathways of microorganisms that are present in the anaerobic digesters. Alterations in the structure of microbial communities result in alterations in biodegradation capacity of OTC, decreasing the release of antibiotic resistance genes and metabolites. AD processes operated under optimum conditions can result in reduction in the formation and dissemination of resistance genes and metabolites of OTC. As a further investigation, the class 1 integron gene (intl1) can be determined as a powerful indicator of the existing horizontal gene transfer mechanism. Acknowledgements This study was supported by the Scientific and Technical Research Council of Turkey (TUBITAK, Project No: 109Y275) and Boğaziçi 355 Ecotoxicology and Environmental Safety 147 (2018) 349–356 G. Turker et al. microbial metabolism in anaerobic lagoons by selected sulfonamides, tetracyclines, lincomycin, and tylosin tartrate. Environ. Toxicol. Chem. 24, 782–788. http://dx.doi. org/10.1897/04-093R.1. Loke, M.L., Jespersen, S., Vreeken, R., Halling-Sørensen, B., Tjørnelund, J., 2003. Determination of oxytetracycline and its degradation products by high-performance liquid chromatography-tandem mass spectrometry in manure-containing anaerobic test systems. J. Chromatogr. B Anal. Technol. Biomed. Life Sci. 783, 11–23. http://dx. doi.org/10.1016/S1570-0232(02)00468-3. Mata-Alvarez, J., Dosta, J., Macé, S., Astals, S., 2011. Codigestion of solid wastes: a review of its uses and perspectives including modeling. Crit. Rev. Biotechnol. 31, 99–111. http://dx.doi.org/10.3109/07388551.2010.525496. McKinney, C.W., Loftin, K.A., Meyer, M.T., Davis, J.G., Pruden, A., 2010. Tet and Sul antibiotic resistance genes in livestock lagoons of various operation type, configuration, and antibiotic occurrence. Environ. Sci. Technol. 44, 6102–6109. http://dx. doi.org/10.1021/es9038165. Meinen, R.J., Kephart, K.B., Graves, R.E., 2014. Economic feasibility and evaluation of a novel manure collection and anaerobic digestion system at a commercial swine finisher enterprise. Biomass Bioenergy 63, 10–21. http://dx.doi.org/10.1016/j. biombioe.2014.01.032. Rizzo, L., Manaia, C., Merlin, C., Schwartz, T., Dagot, C., Ploy, M.C., Michael, I., FattaKassinos, D., 2013. Urban wastewater treatment plants as hotspots for antibiotic resistant bacteria and genes spread into the environment: a review. Sci. Total Environ. 447, 345–360. http://dx.doi.org/10.1016/j.scitotenv.2013.01.032. Shen, F., Tian, L., Yuan, H., Pang, Y., Chen, S., Zou, D., Zhu, B., Liu, Y., Li, X., 2013. Improving the mixing performances of rice straw anaerobic digestion for higher biogas production by computational fluid dynamics (CFD) simulation. Appl. Biochem. Biotechnol. 171, 626–642. http://dx.doi.org/10.1007/s12010-013-0375-z. Wang, Y., Chen, G., Liang, J., Zou, Y., Wen, X., Liao, X., Wu, Y., 2015. Comparison of oxytetracycline degradation behavior in pig manure with different antibiotic addition methods. Environ. Sci. Pollut. Res. 22, 18469–18476. http://dx.doi.org/10.1007/ s11356-015-5170-7. Yuan, S., Wang, Q., Yates, S., Peterson, N., 2010. Development of an efficient extraction method for oxytetracycline in animal manure for high performance liquid chromatography analysis. J. Environ. Sci. Heal. Part B 45, 612–620. Zhang, H., Luo, Y., Wu, L., Huang, Y., Christie, P., 2014. Residues and potential ecological risks of veterinary antibiotics in manures and composts associated with protected vegetable farming. Environ. Sci. Pollut. Res. 22, 5908–5918. http://dx.doi.org/10. 1007/s11356-014-3731-9. Zhang, W., Huang, M., Qi, F., Sun, P., Van Ginkel, S.W., 2013. Effect of trace tetracycline concentrations on the structure of a microbial community and the development of tetracycline resistance genes in sequencing batch reactors. Bioresour. Technol. 150, 9–14. http://dx.doi.org/10.1016/j.biortech.2013.09.081. Zhu, Y.-G., Johnson, T.A., Su, J.-Q., Qiao, M., Guo, G.-X., Stedtfeld, R.D., Hashsham, S.A., Tiedje, J.M., 2013. Diverse and abundant antibiotic resistance genes in Chinese swine farms. Proc. Natl. Acad. Sci. USA 110, 3435–3440. http://dx.doi.org/10.1073/pnas. 1222743110. treatment of pharmaceutical wastewater. Water Res. 83, 337–344. http://dx.doi.org/ 10.1016/j.watres.2015.07.007. Bauer, A., Lizasoain, J., Nettmann, E., Bergmann, I., Mundt, K., Klocke, M., Rincón, M., Amon, T., Piringer, G., 2014. Effects of the antibiotics chlortetracycline and enrofloxacin on the anaerobic digestion in continuous experiments. BioEnergy Res. 7, 1244–1252. http://dx.doi.org/10.1007/s12155-014-9458-0. Esposito, G., Frunzo, L., Giordano, A., Liotta, F., Panico, A., Pirozzi, F., 2012. Anaerobic co-digestion of organic wastes. Rev. Environ. Sci. Biotechnol. 11, 325–341. http://dx. doi.org/10.1007/s11157-012-9277-8. Franke-whittle, I.H., Walter, A., Ebner, C., Insam, H., 2014. Investigation into the effect of high concentrations of volatile fatty acids in anaerobic digestion on methanogenic communities. Waste Manag. 34, 2080–2089. http://dx.doi.org/10.1016/j.wasman. 2014.07.020. Haddad, T., Baginska, E., Kümmerer, K., 2015. Transformation products of antibiotic and cytostatic drugs in the aquatic cycle that result from effluent treatment and abiotic/ biotic reactions in the environment: an increasing challenge calling for higher emphasis on measures at the beginning of the pi. Water Res. http://dx.doi.org/10.1016/ j.watres.2014.12.042. Ince, B., Coban, H., Turker, G., Ertekin, E., Ince, O., 2013. Effect of oxytetracycline on biogas production and active microbial populations during batch anaerobic digestion of cow manure. Bioprocess Biosyst. Eng. 36, 541–546. http://dx.doi.org/10.1007/ s00449-012-0809-y. Jechalke, S., Heuer, H., Siemens, J., Amelung, W., Smalla, K., 2014. Fate and effects of veterinary antibiotics in soil. Trends Microbiol. 22, 536–545. http://dx.doi.org/10. 1016/j.tim.2014.05.005. Kemper, N., 2008. Veterinary antibiotics in the aquatic and terrestrial environment. Ecol. Indic. 8, 1–13. http://dx.doi.org/10.1016/j.ecolind.2007.06.002. Kim, S., Yun, Z., Ha, U., Lee, S., Park, H., Kwon, E.E., Cho, Y., Choung, S., Oh, J., Angelo, C., Chandran, K., 2014. Transfer of antibiotic resistance plasmids in pure and activated sludge cultures in the presence of environmentally representative micro-contaminant concentrations. Sci. Total Environ. 468–469, 813–820. http://dx.doi.org/ 10.1016/j.scitotenv.2013.08.100. Lallai, A., Mura, G., Onnis, N., 2002. The effects of certain antibiotics on biogas production in the anaerobic digestion of pig waste slurry. Bioresour. Technol. 82, 205–208. http://dx.doi.org/10.1016/S0960-8524(01)00162-6. Lins, P., Reitschuler, C., Illmer, P., 2015. Impact of several antibiotics and 2-bromoethanesulfonate on the volatile fatty acid degradation, methanogenesis and community structure during thermophilic anaerobic digestion. Bioresour. Technol. 190, 148–158. http://dx.doi.org/10.1016/j.biortech.2015.04.070. Liu, Y., He, X., Fu, Y., Dionysiou, D.D., 2016a. Degradation kinetics and mechanism of oxytetracycline by hydroxyl radical-based advanced oxidation processes. Chem. Eng. J. 284, 1317–1327. http://dx.doi.org/10.1016/j.cej.2015.09.034. Liu, Y., He, X., Fu, Y., Dionysiou, D.D., 2016b. Kinetics and mechanism investigation on the destruction of oxytetracycline by UV-254 nm activation of persulfate. J. Hazard. Mater. 305, 229–239. http://dx.doi.org/10.1016/j.cej.2015.09.034. Loftin, K.A., Henny, C., Adams, C.D., Surampali, R., Mormile, M.R., 2005. Inhibition of 356