Ecotoxicology and Environmental Safety 147 (2018) 349–356
Contents lists available at ScienceDirect
Ecotoxicology and Environmental Safety
journal homepage: www.elsevier.com/locate/ecoenv
Operating conditions influence microbial community structures, elimination
of the antibiotic resistance genes and metabolites during anaerobic digestion
of cow manure in the presence of oxytetracycline
MARK
Gokhan Turkera, Çağrı Akyola, , Orhan Inceb, Sevcan Aydinc, Bahar Incea
⁎
a
b
c
Institute of Environmental Sciences, Boğaziçi University, Bebek, 34342 Istanbul, Turkey
Department of Environmental Engineering, Istanbul Technical University, Maslak, 34469 Istanbul, Turkey
Department of Genetics and Bioengineering, Nişantaşı University, Sarıyer, 34485, Istanbul, Turkey
A R T I C L E I N F O
A B S T R A C T
Keywords:
Anaerobic digestion
Antibiotic resistance gene
Metabolite
Microbial community
Oxytetracycline
The way that antibiotic residues in manure follow is one of the greatest concerns due to its potential negative
impacts on microbial communities, the release of metabolites and antibiotic resistant genes (ARGs) into the
nature and the loss of energy recovery in anaerobic digestion (AD) systems. This study evaluated the link between different operating conditions, the biodegradation of oxytetracycline (OTC) and the formation of its
metabolites and ARGs in anaerobic digesters treating cow manure. Microbial communities and ARGs were determined through the use of quantitative real-time PCR. The biodegradation of OTC and occurrence of metabolites were determined using UV-HPLC and LC/MS/MS respectively. The maximum quantity of resistance genes
was also examined at the beginning of AD tests and concentration was in the order of: tetM > tetO. The numbers
of ARGs were always higher at high volatile solids (VS) content and high mixing rate. The results of the investigation revealed that relationship between mixing rate and VS content plays a crucial role for elimination of
ARGs, OTC and metabolites. This can be attributed to high abundance of microorganisms due to high VS content
and their increased contact with elevated mixing rate. An increased interaction between microorganisms triggers
the promotion of ARGs.
1. Introduction
As a biochemical process of microbial and energy metabolism,
anaerobic digestion (AD) is strongly dependent on the environmental
aspects, such as temperature, pH, presence of inhibitors and substrate
characteristics (Mata-Alvarez et al., 2011). A precise maintenance of
the operating conditions and their sustained monitoring can prevent
undesirable inconveniences and also enhance the efficiency of the
system (Esposito et al., 2012). AD of manure generates methane-rich
biogas that can be utilized in an engine-generator system to produce
electricity in order to cease farm electricity purchase from the national
grid (Meinen et al., 2014). Stability problems can be faced in manurebased anaerobic digesters since the microbial group is highly susceptible to the environmental and operating conditions.
Veterinary antibiotics are frequently detected in slurry and manure
of animals, and thereby threaten human health; since together with
their metabolites, they accumulate in the environment due to their low
degradation behavior and high tendency to be adsorbed onto soil and
sludge particles (Bauer et al., 2014; Jechalke et al., 2014). Metabolites
⁎
are more remarkable than their precedent compounds because the
presence of hydroxyl, carboxyl or keto groups increases their interaction with the environment. In order to better understand risks that
antibiotics and metabolites pose to the natural environment and human
heath, it is important to study their incidence (Haddad et al., 2015).
Oxytetracycline (OTC) is widely used in animal husbandries to prohibit
disease and enhance growth and favored by the fact that is cost-effective, has low side effects and a great variety of target microorganisms
(Arikan et al., 2006; Liu et al., 2016a). Approximately 70% of OTC
leaves the microorganisms without receiving complete metabolism by
ways of urine and feces (Liu et al., 2016b). The accumulation of OTC in
different biomass alternatives such as cattle manure, which is later used
as feedstock in AD, may also upset the whole performance if the microorganisms are inhibited or suppressed (Ince et al., 2013). For instance, during the anaerobic digestion of pig manure (Álvarez et al.,
2010), methane production decreased by 56%, 60% and 62% at OTC
and chlortetracycline (CTC) concentrations of 10, 50 and 100 mg/L,
respectively. Generally, eliminated antibiotic concentrations are reported to have adverse effects on the structure of microbial group and
Corresponding author.
E-mail address: cagri.akyol@boun.edu.tr (Ç. Akyol).
http://dx.doi.org/10.1016/j.ecoenv.2017.08.044
Received 14 March 2017; Received in revised form 14 August 2017; Accepted 17 August 2017
0147-6513/ © 2017 Elsevier Inc. All rights reserved.
Ecotoxicology and Environmental Safety 147 (2018) 349–356
G. Turker et al.
even low concentrations can inhibit their function (Lins et al., 2015).
Another major concern about releasing antibiotics into the environment is associated with the antibiotic resistance genes (ARGs) and
bacteria (ARB) (Arikan, 2008; Rizzo et al., 2013). The implementation
of such antibiotics used in veterinary is expected to promote the selection for strains that are resistant to antibiotics employed in human
medicine (Kemper, 2008). However, due to the fact that many of the
ppb level of antibiotics do not have the ability to hinder the antibiotic
sensitive microorganisms effectively, the theory of traditional selective
pressure on the proliferation of antibiotic resistance in the microbial
group may not be prevalent under environmental aspects. In this regard, an alternative mechanism, for instance horizontal gene transfer,
can be recognized for the dissemination of antibiotic resistance characteristics in the environment which contains antimicrobial compounds
at low levels (Kim et al., 2014). Horizontal gene transfer has an important effect on specification and enzyme activities of anaerobic microorganism. Correlations have been remarked between the use of antibiotics and the presence of sulfonamide and tetracycline-ARGs in pig
farms and cattle waste lagoons in China (Zhu et al., 2013) and the USA
(McKinney et al., 2010), proposing a relationship between the usage of
antibiotic and environmental storage of drug resistance (Zhang et al.,
2014). In the study by Zhang et al. (2013), the structural alterations of
the microbial groups and the diversities of eight tetracycline resistance
genes were determined through the use of real-time fluorescence
quantitative polymerase chain reaction (RT-qPCR). According to results, it has been reported that trace tetracycline could seriously change
the structure of microbial groups and bacteria, which do not have the
ability to adapt tetracycline containing environment, were leisurely
dominated by those that have the ability to adapt tetracycline. In a
recent study conducted by Akyol et al. (2016), phase separation,
namely as two-phase AD, was highlighted to be an alternative solution
in the treatment of antibiotic-medicated manures to decrease the adverse impacts of such antibiotics on microbial groups and thereby increase methane production. Together taken, possible inhibitory impacts
of antibiotics on structures of microbial community and thus ARGs are
highly dependent on environmental and operating conditions selected
for AD processes. The purpose of the current study is to gain an understanding into the microbial community, development of metabolites
and ARGs in AD systems fed with OTC-medicated cow manure under
changing operating conditions. Among the most critical operating
parameters in AD systems, mixing rate (Shen et al., 2013) and solids
content (Akyol et al., 2015) were chosen to interpret the relationship
between the contact of feedstock and microbial communities and the
occurrence of ARGs in such different conditions. In order to achieve
this, anaerobic batch digesters were set up with different contents of
volatile solids (VS) and rates of mixing at mesophilic temperature
(37 °C) in the existence and absence of OTC. This approach may help to
gain insight into microbial interactions that present among acetogens
and methanogens and in which way they inhibit the development of the
stability and efficiency of the anaerobic digesters considering the occurrence of antibiotic resistance genes and metabolites in anaerobic
digesters with manures polluted with antibiotics.
Table 1
Operational parameters in digester set-ups.
Digesters
Temperature (°C)
Mixing rate (rpm)
Volatile solids
(VS) content (%)
OTC
presence
S1
S1
S2
S2
S3
S3
S4
S4
37
90
5–6
No
Yes
No
Yes
No
Yes
No
Yes
Control
Control
Control
8–9
120
Control
5–6
8–9
Manure that was examined as the control in the anaerobic digestion
tests was obtained from a non-medicated cow. All manure samples were
kept in 5 L containers at + 4 °C prior to use.
2.2. Chemicals, OTC extraction and detection
HPLC-grade chemicals were purchased from Merck (NJ, USA) and
OTC was supplied from Acros Organics N.V. (NJ, USA). The extraction
of OTC was carried out in accordance with the method changed from
Yuan et al. (2010) and described elsewhere (Ince et al., 2013). OTC
measurement was done through the use of Shimadzu high performance
liquid chromatography (HPLC) instrument (Schimadzu LC-10 CE),
supplied with a UV detector (UV VIS Detector, SPD 10-A) and operated
at 357 nm. The analytical column was Intersil ODS-3 HPLC column,
25 cm × 4.6 mm ID, 5 µm, used at ambient temperature.
Metabolites that occur due to the degradation of OTC during AD
were measured by LC/MS/MS at TÜBİTAK MAM Food Institute,
Turkey. The preparation and measurement of standard solutions; the
drawing of calibration curve and the calculation of recovery rates were
all performed. Sample measurements were conducted after getting satisfying results from rates of recovery. Each analysis was performed as
explained elsewhere (Arikan et al., 2006).
2.3. Anaerobic digesters set-up
The experimental set-up composed of 8 anaerobic batch digesters
with 1000 mL volume. The digesters were run at 37 ± 1 °C in an incubating shaker. Operating conditions in digester set-ups are summarized in Table 1. Accordingly, 2 sets of anaerobic digesters were run with
2 different mixing ratios as 90 rpm and 120 rpm; in which 2 different
VS ratio ranges (5–6% and 8–9%) were examined. Furthermore, a
control digester was operated for non-medicated cow manure in every
digester configuration. VS-dilution was applied to fresh manure samples with tap water to have an ultimate active volume of 600 mL. An
already-operating lab-scale cow manure digester was used to obtain
inoculum and the experimental digesters were seeded at a ratio of 1:10
(v:v).
2.4. Analytical methods
2. Materials and methods
Samples were gathered on every 10 days from the digesters for OTC
measurement and other physicochemical and molecular analyses.
Alkalinity, total solids (TS), VS were applied pursuant to standard
methods (American Public Health Association (APHA), 2005). Perkin
Elmer Clarus 600 Gas Chromatograph (GC) supplied with a flame ionization detector (FID) was used to measure volatile fatty acid (VFA)
concentrations. Air flow and H2 rates in the FID detector were 450 mL/
min and 45 mL/min, respectively, and Elite FFAP (30 m, 0.32 mm ID,
0.25 µm df) was used as a column. The set point of the oven was 100 °C
while highest temperature of inlet was 240 °C. Carrier gas was Helium
at a rate of 0.8 mL/min.
Cumulative biogas production in the digesters was recorded by
2.1. Animal medication and manure sampling
Manure samples were collected from Holstein race (2.5–3.5 years
old, 400–500 kg body mass) dairy cows that were held in a barn at the
Faculty of Veterinary Medicine, Istanbul University. OTC injection solution (20 mg OTC /kg body weight) in accordance with the standard
dose in veterinary practice was used to medicate cows for once. Same
dosages were injected to both right and left body parts between musculus semitendinosus and musculus semimembranosus muscles. All manure
samples were obtained from rectum of the same animal in every 24 h
for the following 120 h and mixed homogenously (Ince et al., 2013).
350
Ecotoxicology and Environmental Safety 147 (2018) 349–356
G. Turker et al.
as explained: 45 cycles of 10 s at 94 °C following the initial denaturation for 10 min at 94 °C, then 5 s at the specific annealing temperature
as shown in Table S1. To confirm the specificity in each tube of reaction
via the identification of primer-dimer absence and nonspecific products, a melting curve analysis for every PCR run was developed by
SYBR Green I detection. The reactions of every sample displayed solely
one melting peak, which meant a specific amplification and precise
quantification. Extensive information about preparing the standard
curves and efficiencies of qPCR was shared in previous investigations
(Aydin et al., 2015a).
Samples taken from digesters were analyzed by specific primers
coding for four different tetracycline resistance genes. These included
two diversified ARG types: Out of four genes, only two coding for ribosomal protection protein, tetM and tetO, was found. The qPCR analysis also confirmed that antibiotic resistance genes were not extant in
the control digester. Positive amplicons were amplified again and High
Pure PCR purification Kit (Roche, Germany) was used to clean them
according to manufacturer's protocol. Cleaned products were sequenced
to verify their identification. Sequences were analyzed in databank at
www.ebi.ac.uk. Sequence analysis showed that sequences were resembled to tetM and tetO genes by 99% and 100%, respectively
(EM_ENV:HE580607 and TR:F2 × 9A4_9BACT).
Sequences were given below:
> 18-tet_M
Milligas Counters (Ritter Digital Counter, U.S.A.). Moreover, HP Agilent
6850 GC with a thermal conductivity detector (HP Plot Q column 30 m
× 0.53 mm) was used to measure gas compositions. Helium was used
as the carrier gas at a rate of 2 mL/min. The temperature of oven was
70 °C.
2.5. Genomic DNA (gDNA) extraction, total RNA extraction and cDNA
synthesis
Fast DNA Spin Kit for Soil (Q-Biogene, Bio 101 Thermo Electron
Corporation, Belgium) and a Ribolyser (Fast PrepTM FP120 Bio 101
Thermo Electron Corporation, Belgium) were used in accordance with
the manufacturers’ instructions to extract total gDNAs from 1 mL slurry
samples. Qubit 2.0 Fluorometer (Invitrogen, U.K.) was employed to
determine the concentrations of the gDNA. gDNAs were kept at −20 °C
until needed for further studies. The total RNAs were insulated from
500 mL slurry samples via PureLink RNA extraction kit (Invitrogen,
U.K.) according to advised procedures. Total RNA was stored at −80 °C
until cDNA synthesis. The cDNAs were synthesized by a SuperScript
cDNA synthesis kit (Invitrogen, U.K.) through a process of reverse
transcription polymerase chain reaction (RT-PCR) through the use of
primers of hexamer. cDNA synthesis was operated for 10 min at 25 °C,
60 min at 42 °C and 5 min at 85 °C. The gDNA and cDNA samples were
kept at −20 °C until needed for further studies.
GTAGATCCCTTCAGTAACATCGGCCACCGTGGACAGAGGTACAACGAA
AACGG
ATAATACGCTTTTAGAACGTCAGAGAGGAATTACAATTCAGACGG
CGATAACC
TCTTTTCAGTGGAAAAATACTAAGGTGAACATCATAGACACGCCAA
GA
> 15-tet_O
GGGAGCGTAGATGAAGGCACAACAAGGACAGATACAATGAATTTG
GAGCGTC
2.6. Quantification of microbial community and antibiotic resistance genes
Abundances of microbial communities (active bacteria and methanogenic archaea) and tetracycline (tetB, tetK, tetM, tetO) resistance gene
in anaerobic digesters operated with different VS concentrations and
mixing rates were measured by qPCR with SYBR Green using specific
primers. The primers used in this investigation are shown in Table S1.
Triplicate samples were collected from the digesters on Days 0, 10, 20
and 30 and these were employed to measure the tetracycline resistance
genes. The qPCR assays were done through the use of Roche Light
Cycler DNA Master SYBR Green I kit and Roche Light Cycler 2.0 (Roche
Diagnostics GmbH, Mannheim, Germany). The output of the qPCR assays was analyzed by Light Cycler Software 4.05. Light Cycler Software
4.05 program supplied from Roche. The protocol of amplification was
AAAGGGGAATCCACTATCCAGACAGCAGTGACATCTTTTCAGTGGGAG
GATGT
AAAAGTCAACATTATAGATACGCCAAAGATTTCCATTAACCCTCCC
TAAT
Fig. 1. Concentrations of oxytetracycline (OTC) during mesophilic
anaerobic digestion of medicated cow manure slurry (S1:
90 rpm & 5–6% VS, S2: 90 rpm & 8–9% VS, S3: 120 rpm & 5–6% VS,
S4: 120 rpm & 8–9% VS).
351
Ecotoxicology and Environmental Safety 147 (2018) 349–356
G. Turker et al.
Fig. 2. Concentrations of 4-epi-oxytetracycline (EOTC), α-apooxytetracycline (α-Apo-OTC) and β-apo-oxytetracycline (β-ApoOTC) during thermophilic anaerobic digestion of medicated cow
manure slurry (S1: 90 rpm & 5–6% VS, S2: 90 rpm & 8–9% VS, S3:
120 rpm & 5–6% VS, S4: 120 rpm & 8–9% VS).
2.7. Statistical analysis
Table 2
OTC elimination and OTC half-life values in the anaerobic digesters.
SPSS version 11.5 (SPSS Inc., Chicago, Illinois, USA) was employed
to conduct statistical analyses. Data normality was assessed through the
examination of histogram and q-q plots and by using the Shapiro-Wilk's
test. The Levene's test was also used for testing variance homogeneity.
To make a comparison between the variations in production of biogas,
elimination of OTC, microbial community over the process of anaerobic
digestion either a one-way analysis of variance (ANOVA) or independent samples t-test was applied. Multiple comparisons was generated by the application of the Tukey's test. Values were expressed as
mean and standard deviation. Remarkable variation were detected at
the p < 0.05 significance level.
Digesters
OTC elimination (%)
OTC half-life (days)
S1
S2
S3
S4
55
56
64
73
27
27
24
21
Both OTC metabolites were detected at a slightly low level (about
5%) comparing to that of initial OTC levels in the digesters, which were
already present in fresh manure samples. Following the digester operation, EOTC and α-Apo-OTC concentrations showed no significant
change and remained at in the vicinity of 0.1 mg/L in high-mixing digesters. However, EOTC concentrations increased from 0.1 to 0.2 mg/L
and from 0.14 to 0.36 mg/L in S1 and S2, respectively. As can be seen in
Fig. 2, comparatively higher concentrations of β-Apo-OTC (up to
0.65 mg/L in S2) were measured in the digesters. This can indicate that
β-Apo-OTC exists at more elevated concentrations in manure samples.
On day 30, β-Apo-OTC concentrations decreased to concentrations
between 0.05 and 0.2 mg/L in all digesters. Based on the results, mixing
rate was observed to correlate with OTC elimination and OTC half-life.
On the other hand, no positive correlation was found between VS
content and OTC elimination and OTC half-life.
Arikan et al. (2006) reported 59% of the removal of OTC in anaerobic calf manure digesters at the end of 64 days and OTC half-life was
measured as 56 days. Álvarez et al. (2010) indicated that total concentrations of OTC over the anaerobic digestion of pig manure in diversified batch assays reduced from 13.5, 56.9 and 95.0 mg/L to 5.7,
26.6, and 30.7 mg/L within 21 days yielding a comprehensive removal
of OTC of 57%, 53%, and 67%, respectively. Furthermore, they reported that EOTC was generated in every assay for the first 7 days,
reaching the highest concentrations of 0.9, 3 and 5 mg/L in the 10, 50
and 100 mg OTC/L assays, respectively. OTC elimination rates reported
in the literature are in agreement with this study. On the other hand,
variations in OTC half-life values can be attributed to the fact that the
biotransformation mechanism of OTC parent compound to its metabolites can vary for different environmental and operating conditions in
anaerobic digestion tests, initial OTC concentrations as well as the
substrates and the seed sludge. The addition of antibiotics (diet containing antibiotics in manure or externally antibiotic-spiked manure)
also affects the fate of these compounds in anaerobic digestion systems.
3. Results and discussion
3.1. Behavior of OTC and its metabolites during anaerobic digestion
OTC concentrations were measured every 10 days of the particular
anaerobic batch tests, whereas 3 most commonly detected metabolites
of OTC, also known as 4-epi-oxytetracycline (EOTC), a-apo-oxytetracycline (α-Apo-OTC) and β-apo-oxytetracycline (β-Apo-OTC), were
monitored at the beginning and at the end of 30-days digestion period.
OTC concentrations and its metabolites are shown in Figs. 1 and 2,
respectively. Initial concentrations of OTC were measured in the range
of 1.1–3.4 mg/L at the start up and this variation occurred since OTC
was injected directly to the animal and manure samples were collected,
mixed and used throughout the study as mentioned earlier. Although
OTC-containing fresh manure samples were mixed homogeneously, due
to the sorption tendency of OTC to solid particles, it is almost impossible to get 100% homogeneous slurry. During the digestion tests,
higher concentrations of OTC were measured for high VS conditions
due to higher amounts of OTC sorped to biosolids. A little decrement
was observed in OTC concentrations through the first 10 days of the AD.
Diametrically opposed to the early days, sharp decreases in OTC concentrations were engaged between days 10 and 20. OTC concentrations
were measured as 0.8, 1.3, 0.4 and 0.6 mg/L in S1, S2, S3 and S4, respectively, and remained relatively stable until the end of the digestion
period. After 30 days of operation, a reduction in OTC levels in a range
of 55–73% of the initial concentration was determined (Table 2). S4,
which was operated with higher VS content at 120 rpm, exhibited the
greatest OTC elimination. Consequently, calculated OTC half-life value
was lower in S4 as 21 days, followed by S3 and both S1 and S2 as 24
and 27 days, respectively.
352
Ecotoxicology and Environmental Safety 147 (2018) 349–356
G. Turker et al.
Fig. 3. Cumulative biogas production values from digesters
containing medicated and non-medicated cow manure slurries
at (a) 90 rpm mixing rate and (b) 120 rpm mixing rate (S1:
90 rpm & 5–6% VS, S2: 90 rpm & 8–9% VS, S3: 120 rpm & 5–6%
VS, S4: 120 rpm & 8–9% VS).
concentrations (Table S2). Acetic acid concentrations reached up to
550 mg/L in all non-medicated digesters during the first days of the
operation period. The presence of OTC adversely affected the production of acetic acid, staying at a concentration below 100 mg/L. Mixing
rate seemed to influence the production of propionic acid since comparatively higher concentrations of propionic acid was produced in the
digesters operated at 120 rpm. No accumulation of VFAs was observed
after 10th day in any digesters. By the existence of excessive total alkalinity in each digester due to the buffering capacity of cow manure
slurry, alkalinity was maintained at favorable levels both in nonmedicated and OTC-medicated digesters in order that methanogenesis
rate was not affected negatively.
Previous investigations have reported supporting results in methane
production over anaerobic digestion of OTC containing cattle manure.
With concentrations such as 3.1 mg OTC/L, Arikan et al. (2006) reported a 27% decrease in CH4 production. In another study, 2%, 5%
and 7% methane reduction was reported when OTC concentrations
were 1 mg/L, 5 mg/L and 25 mg/L (Loftin et al., 2005). Yet, an absence
of inhibition even at concentrations up to 125–250 mg OTC/L was reported in several studies (Lallai et al., 2002). These contradicts might be
the consequence of various environmental and operating conditions
maintained in each study, such as the source of inoculum and manure,
ratio of inoculum/manure, concentration of antibiotics, temperature,
reactor configuration, etc.
Likewise, Wang et al. (2015) highlighted that the degradation half-life
of OTC in manure from swine fed OTC (9.04 days) was significantly
shorter than that of the manure directly treated with OTC (9.65 days).
The elimination of such antibiotics is reported to be highly dependent on environmental and operational parameters in AD systems
(Akyol et al., 2016). Furthermore, concentrations of OTC, EOTC, α
-Apo-OTC and β-Apo-OTC were found in AD tests is believed to be
owing to large quantities of OTC being attached to grains in manure
matrix instead of degrading to unknown constituents (Loke et al.,
2003). The findings in this study show that AD of animal manure prior
to its final disposal promotes the elimination of OTC and its metabolites.
3.2. Biogas production and digestion stability
Anaerobic batch digesters were incubated at 37 °C for 30 days.
Biogas production in each digester sets is given in Fig. 3. The existence
of OTC did not affect the biogas composition, and methane content of
the biogas in the digesters ranged between 55% and 65%. Initial concentrations of 2.2, 3.4, 1.1 and 2.2 mg OTC/L caused 24%, 20%, 14%
and 17% reduction in biogas production in S1, S2, S3 and S4, respectively. Minimum methane was achieved in the OTC-medicated digester
(S1) that was operated with low VS content at 90 rpm mixing rate. The
results indicated that mixing rate did not have a remarkable impact in
the control digesters. In spite of monitoring of acetic and propionic acid
accumulation was observed on low levels at the first days of the digestion period, these concentrations did not inhibit system (Frankewhittle et al., 2014). Major types of VFA were determined as acetic acid
and propionic acid. Other types of VFA were determined at very low
3.3. Quantification of active bacteria and methanogenic archaea
Quantitative alterations in the concentration of 16S rRNA in terms
of bacteria and methanogenic archaea were detected by using qPCR in
353
Ecotoxicology and Environmental Safety 147 (2018) 349–356
G. Turker et al.
Fig. 4. Quantitative changes in (a) bacterial (b) Methanobacteriales (c) Methanomicrobiales (d) Methanosarcinales (e) Methanoasaeta 16S rRNA gene concentrations in the digesters (S1:
90 rpm & 5–6% VS, S2: 90 rpm & 8–9% VS, S3: 120 rpm & 5–6% VS, S4: 120 rpm & 8–9% VS).
anaerobic digestion of cow manure in the presence of OTC. A lower
inhibition effect on microbial community was observed in the S3 digester, which was operated at low VS content and high mixing rate.
all digesters. The presence of temporary variations in the quantities of
total genes under various operating conditions of the digesters was
shown by the concentration profiles. The quantity of active bacteria and
methanogenic archaea in the anaerobic digesters is presented in Fig. 4.
qPCR assay showed that the first significant impacts (p < 0.05) of OTC
on the populations of bacteria and archaea were remarked on 10th day.
Moreover, the most remarkable impact on the active methanogenic
archaea was observed at the end of 30 days in S1, S2, S3 and S4 digesters. The most abundant genera in AD were Methanobacteriales and
Methanomicrobiales, proposing dominance of hydrogenotrophic methanogens over acetoclastic methanogens (Methanosarcinales and Methanoasaeta). Biogas and methane production showed a significant
(p < 0.05) positive association between acetoclastic methanogens and
hydrogenotrophic methanogens. This also underlines the necessity to
obtain optimum conditions of growth for acetoclastic methanogens in
an attempt to optimize the production of biogas, elimination of OTC
and resistance genes during AD.
Several pieces of research have also enlightened how the alterations
structure of community are remarkably higher for archaea than they
are for bacteria and that alterations in structure of bacterial community
have no significant impact on the variety and structure of the methanogenic community in the bioreactors (Aydin et al., 2015a). Accordingly, it is probable that the biodegradation of OTC and formation of
metabolites may depend on the archaeal community shift over
3.4. Quantification of antibiotic resistance genes
To investigate the emergence of antibiotic resistance in AD, qPCR
assays were employed to underline the impact of operating conditions
on the number of resistance genes. In this study, tetB, tetK, tetM and tetO
were selected to monitor resistance gene promotion in anaerobic digestion. These included two diversified types of ARGs: the efflux pump
genes tetB, tetK; the ribosomal protection genes tetM, tetO. qPCR analysis showed that only ribosomal protection type resistance was present
in digesters as seen in Fig. 5. tetB and tetK were not quantified during
operation of anaerobic digesters since the results obtained from quantification of resistance genes showed that a less familiar type of ribosome protection mechanism was more widespread than efflux pump
genes. These results are also consistent with other previous investigations (Aydin et al., 2015b). The maximum quantity of resistance genes
was also observed at the beginning of anaerobic digestion tests and
concentration was in the order of: tetM > tetO. As resistance gene
numbers were monitored according to environmental parameters, it has
been found that gene copy number of resistance genes in low mixing
rate digesters were higher than the gene copy number of high mixing
354
Ecotoxicology and Environmental Safety 147 (2018) 349–356
G. Turker et al.
Fig. 5. Quantities of (a) tetM (b) tetO in the anaerobic digesters (S1: 90 rpm & 5–6% VS, S2: 90 rpm & 8–9% VS, S3: 120 rpm & 5–6% VS, S4: 120 rpm & 8–9% VS).
University Research Fund (Project No: 11Y00P4).
rate digesters. The highest maximum concentration of ARGs was found
in tetM in the S2 and S4 digesters. The results of the investigation revealed that relationship between mixing rate and VS content plays a
crucial role for the elimination of antibiotic resistance genes, OTC and
metabolites. This can be attributed to high abundance of microorganisms due to high VS content that caused higher and their increased
contact with elevated mixing rate.
Appendix A. Supporting information
Supplementary data associated with this article can be found in the
online version at http://dx.doi.org/10.1016/j.ecoenv.2017.08.044.
References
4. Conclusion
Akyol, Ç., Demirel, B., Onay, T.T., 2015. Recovery of methane from tannery sludge: the
effect of inoculum to substrate ratio and solids content. J. Mater. Cycles Waste
Manag. 17, 808–815. http://dx.doi.org/10.1007/s10163-014-0306-2.
Akyol, Ç., Ince, O., Cetecioglu, Z., Alkan, F.U., Ince, B., 2016. The fate of oxytetracycline
in two-phase and single-phase anaerobic cattle manure digesters and its effects on
microbial communities. J. Chem. Technol. Biotechnol. 91, 806–814. http://dx.doi.
org/10.1002/jctb.4649.
Álvarez, J.A., Otero, L., Lema, J.M., Omil, F., 2010. The effect and fate of antibiotics
during the anaerobic digestion of pig manure. Bioresour. Technol. 101, 8581–8586.
http://dx.doi.org/10.1016/j.biortech.2010.06.075.
American Public Health Association (APHA), 2005. Standard Methods for the
Examination of Water and Wastewater, 21st ed. American Public Health Association,
Washington, DC.
Arikan, O.A., 2008. Degradation and metabolization of chlortetracycline during the
anaerobic digestion of manure from medicated calves. J. Hazard. Mater. 158,
485–490. http://dx.doi.org/10.1016/j.jhazmat.2008.01.096.
Arikan, O.A., Sikora, L.J., Mulbry, W., Khan, S.U., Rice, C., Foster, G.D., 2006. The fate
and effect of oxytetracycline during the anaerobic digestion of manure from therapeutically treated calves. Process Biochem. 41, 1637–1643. http://dx.doi.org/10.
1016/j.procbio.2006.03.010.
Aydin, S., Ince, B., Ince, O., 2015a. Application of real-time PCR to determination of
combined effect of antibiotics on Bacteria, Methanogenic Archaea, Archaea in
anaerobic sequencing batch reactors. Water Res. 76, 88–98. http://dx.doi.org/10.
1016/j.watres.2015.02.043.
Aydin, S., Ince, B., Ince, O., 2015b. Development of antibiotic resistance genes in microbial communities during long-term operation of anaerobic reactors in the
This study may provide an understanding into the potential of different operating conditions in anaerobic digestion to reduce antibiotic
resistance genes and metabolites. Additionally, different operating
conditions in anaerobic digesters such as mixing rate and VS content
changes microbial community dynamics and could promote on the
hydrogenotrophic methanogenesis pathways of microorganisms that
are present in the anaerobic digesters. Alterations in the structure of
microbial communities result in alterations in biodegradation capacity
of OTC, decreasing the release of antibiotic resistance genes and metabolites. AD processes operated under optimum conditions can result
in reduction in the formation and dissemination of resistance genes and
metabolites of OTC. As a further investigation, the class 1 integron gene
(intl1) can be determined as a powerful indicator of the existing horizontal gene transfer mechanism.
Acknowledgements
This study was supported by the Scientific and Technical Research
Council of Turkey (TUBITAK, Project No: 109Y275) and Boğaziçi
355
Ecotoxicology and Environmental Safety 147 (2018) 349–356
G. Turker et al.
microbial metabolism in anaerobic lagoons by selected sulfonamides, tetracyclines,
lincomycin, and tylosin tartrate. Environ. Toxicol. Chem. 24, 782–788. http://dx.doi.
org/10.1897/04-093R.1.
Loke, M.L., Jespersen, S., Vreeken, R., Halling-Sørensen, B., Tjørnelund, J., 2003.
Determination of oxytetracycline and its degradation products by high-performance
liquid chromatography-tandem mass spectrometry in manure-containing anaerobic
test systems. J. Chromatogr. B Anal. Technol. Biomed. Life Sci. 783, 11–23. http://dx.
doi.org/10.1016/S1570-0232(02)00468-3.
Mata-Alvarez, J., Dosta, J., Macé, S., Astals, S., 2011. Codigestion of solid wastes: a review of its uses and perspectives including modeling. Crit. Rev. Biotechnol. 31,
99–111. http://dx.doi.org/10.3109/07388551.2010.525496.
McKinney, C.W., Loftin, K.A., Meyer, M.T., Davis, J.G., Pruden, A., 2010. Tet and Sul
antibiotic resistance genes in livestock lagoons of various operation type, configuration, and antibiotic occurrence. Environ. Sci. Technol. 44, 6102–6109. http://dx.
doi.org/10.1021/es9038165.
Meinen, R.J., Kephart, K.B., Graves, R.E., 2014. Economic feasibility and evaluation of a
novel manure collection and anaerobic digestion system at a commercial swine finisher enterprise. Biomass Bioenergy 63, 10–21. http://dx.doi.org/10.1016/j.
biombioe.2014.01.032.
Rizzo, L., Manaia, C., Merlin, C., Schwartz, T., Dagot, C., Ploy, M.C., Michael, I., FattaKassinos, D., 2013. Urban wastewater treatment plants as hotspots for antibiotic
resistant bacteria and genes spread into the environment: a review. Sci. Total
Environ. 447, 345–360. http://dx.doi.org/10.1016/j.scitotenv.2013.01.032.
Shen, F., Tian, L., Yuan, H., Pang, Y., Chen, S., Zou, D., Zhu, B., Liu, Y., Li, X., 2013.
Improving the mixing performances of rice straw anaerobic digestion for higher
biogas production by computational fluid dynamics (CFD) simulation. Appl.
Biochem. Biotechnol. 171, 626–642. http://dx.doi.org/10.1007/s12010-013-0375-z.
Wang, Y., Chen, G., Liang, J., Zou, Y., Wen, X., Liao, X., Wu, Y., 2015. Comparison of
oxytetracycline degradation behavior in pig manure with different antibiotic addition
methods. Environ. Sci. Pollut. Res. 22, 18469–18476. http://dx.doi.org/10.1007/
s11356-015-5170-7.
Yuan, S., Wang, Q., Yates, S., Peterson, N., 2010. Development of an efficient extraction
method for oxytetracycline in animal manure for high performance liquid chromatography analysis. J. Environ. Sci. Heal. Part B 45, 612–620.
Zhang, H., Luo, Y., Wu, L., Huang, Y., Christie, P., 2014. Residues and potential ecological
risks of veterinary antibiotics in manures and composts associated with protected
vegetable farming. Environ. Sci. Pollut. Res. 22, 5908–5918. http://dx.doi.org/10.
1007/s11356-014-3731-9.
Zhang, W., Huang, M., Qi, F., Sun, P., Van Ginkel, S.W., 2013. Effect of trace tetracycline
concentrations on the structure of a microbial community and the development of
tetracycline resistance genes in sequencing batch reactors. Bioresour. Technol. 150,
9–14. http://dx.doi.org/10.1016/j.biortech.2013.09.081.
Zhu, Y.-G., Johnson, T.A., Su, J.-Q., Qiao, M., Guo, G.-X., Stedtfeld, R.D., Hashsham, S.A.,
Tiedje, J.M., 2013. Diverse and abundant antibiotic resistance genes in Chinese swine
farms. Proc. Natl. Acad. Sci. USA 110, 3435–3440. http://dx.doi.org/10.1073/pnas.
1222743110.
treatment of pharmaceutical wastewater. Water Res. 83, 337–344. http://dx.doi.org/
10.1016/j.watres.2015.07.007.
Bauer, A., Lizasoain, J., Nettmann, E., Bergmann, I., Mundt, K., Klocke, M., Rincón, M.,
Amon, T., Piringer, G., 2014. Effects of the antibiotics chlortetracycline and enrofloxacin on the anaerobic digestion in continuous experiments. BioEnergy Res. 7,
1244–1252. http://dx.doi.org/10.1007/s12155-014-9458-0.
Esposito, G., Frunzo, L., Giordano, A., Liotta, F., Panico, A., Pirozzi, F., 2012. Anaerobic
co-digestion of organic wastes. Rev. Environ. Sci. Biotechnol. 11, 325–341. http://dx.
doi.org/10.1007/s11157-012-9277-8.
Franke-whittle, I.H., Walter, A., Ebner, C., Insam, H., 2014. Investigation into the effect of
high concentrations of volatile fatty acids in anaerobic digestion on methanogenic
communities. Waste Manag. 34, 2080–2089. http://dx.doi.org/10.1016/j.wasman.
2014.07.020.
Haddad, T., Baginska, E., Kümmerer, K., 2015. Transformation products of antibiotic and
cytostatic drugs in the aquatic cycle that result from effluent treatment and abiotic/
biotic reactions in the environment: an increasing challenge calling for higher emphasis on measures at the beginning of the pi. Water Res. http://dx.doi.org/10.1016/
j.watres.2014.12.042.
Ince, B., Coban, H., Turker, G., Ertekin, E., Ince, O., 2013. Effect of oxytetracycline on
biogas production and active microbial populations during batch anaerobic digestion
of cow manure. Bioprocess Biosyst. Eng. 36, 541–546. http://dx.doi.org/10.1007/
s00449-012-0809-y.
Jechalke, S., Heuer, H., Siemens, J., Amelung, W., Smalla, K., 2014. Fate and effects of
veterinary antibiotics in soil. Trends Microbiol. 22, 536–545. http://dx.doi.org/10.
1016/j.tim.2014.05.005.
Kemper, N., 2008. Veterinary antibiotics in the aquatic and terrestrial environment. Ecol.
Indic. 8, 1–13. http://dx.doi.org/10.1016/j.ecolind.2007.06.002.
Kim, S., Yun, Z., Ha, U., Lee, S., Park, H., Kwon, E.E., Cho, Y., Choung, S., Oh, J., Angelo,
C., Chandran, K., 2014. Transfer of antibiotic resistance plasmids in pure and activated sludge cultures in the presence of environmentally representative micro-contaminant concentrations. Sci. Total Environ. 468–469, 813–820. http://dx.doi.org/
10.1016/j.scitotenv.2013.08.100.
Lallai, A., Mura, G., Onnis, N., 2002. The effects of certain antibiotics on biogas production in the anaerobic digestion of pig waste slurry. Bioresour. Technol. 82,
205–208. http://dx.doi.org/10.1016/S0960-8524(01)00162-6.
Lins, P., Reitschuler, C., Illmer, P., 2015. Impact of several antibiotics and 2-bromoethanesulfonate on the volatile fatty acid degradation, methanogenesis and
community structure during thermophilic anaerobic digestion. Bioresour. Technol.
190, 148–158. http://dx.doi.org/10.1016/j.biortech.2015.04.070.
Liu, Y., He, X., Fu, Y., Dionysiou, D.D., 2016a. Degradation kinetics and mechanism of
oxytetracycline by hydroxyl radical-based advanced oxidation processes. Chem. Eng.
J. 284, 1317–1327. http://dx.doi.org/10.1016/j.cej.2015.09.034.
Liu, Y., He, X., Fu, Y., Dionysiou, D.D., 2016b. Kinetics and mechanism investigation on
the destruction of oxytetracycline by UV-254 nm activation of persulfate. J. Hazard.
Mater. 305, 229–239. http://dx.doi.org/10.1016/j.cej.2015.09.034.
Loftin, K.A., Henny, C., Adams, C.D., Surampali, R., Mormile, M.R., 2005. Inhibition of
356