Evolution and phylogenetic utility of the melanocortin-1 receptor gene (MC1R) in Cetartiodactyla

Molecular Phylogenetics and Evolution 52 (2009) 550–557 Contents lists available at ScienceDirect Molecular Phylogenetics and Evolution journal homepage: www.elsevier.com/locate/ympev Short Communication Evolution and phylogenetic utility of the melanocortin-1 receptor gene (MC1R) in Cetartiodactyla Nadia A. Ayoub *, Michael R. McGowen, Clay Clark, Mark S. Springer, John Gatesy University of California, Riverside, Department of Biology, Riverside, CA 92521, USA a r t i c l e i n f o a b s t r a c t Article history: Received 20 December 2008 Revised 27 February 2009 Accepted 10 March 2009 Available online 19 March 2009 1. Introduction Cetartiodactyla, composed of whales (cetaceans) and even-toed ungulates (terrestrial artiodactyls), is the most diverse order of medium to large bodied mammals with nearly 300 extant species (MacDonald, 2006). The group includes some of the most important domestic animals (cow, water buffalo, pig, sheep, goat, llama, camel, alpaca), as well as many threatened or endangered species. Intense effort has been devoted to understanding the higher order systematics of this clade, as well as species-level relationships within families and subfamilies (see Nikaido et al., 1999; Matthee et al., 2001; Marcot, 2007; O’Leary and Gatesy, 2008 and references therein). Despite these efforts, many phylogenetic questions remain unresolved (e.g., relationships among ruminant families – Hassanin and Douzery, 2003; patterns of species diversification within Delphinidae – Caballero et al., 2008). Different cetartiodactyl species vary considerably in coloration. Color characters have been used to distinguish closely related species (Perrin, 2002), and the adaptive significance of pigmentation (Caro, 2005) has been tested in extensive comparative analyses of terrestrial artiodactyls. For example, Stoner et al. (2003) found that artiodactyl species inhabiting open or desert environments are more likely to be lightly colored than dark. In contrast, dark coloration is significantly associated with living in the tropics or dense forest. Selection for concealment is likely the strongest evolutionary force determining coloration in terrestrial artiodactyls, but communication and thermoregulation also may be important (Stoner et al., 2003). Targeting genes that control hair and skin color may prove fruitful for phylogenetic reconstruction of cetartiodactyls and provide insights into the evolution of pigmentation. One promising candidate gene is the melanocortin-1 receptor (MC1R). Hair and skin color in mammals is largely determined by the amount, type, and * Corresponding author. Fax: +1 951 827 4286. E-mail address: nadiaa@ucr.edu (N.A. Ayoub). 1055-7903/$ - see front matter Ó 2009 Elsevier Inc. All rights reserved. doi:10.1016/j.ympev.2009.03.008 Ó 2009 Elsevier Inc. All rights reserved. distribution of melanin packaged in the melanocytes of epidermal cells and hair follicles (Jackson, 1997). MC1R, a member of the G protein-coupled superfamily, acts as a pigmentary switch in the production of melanin. When activated by a-melanocyte stimulating hormone (a-MSH) it signals via cAMP the production of eumelanin (black/brown pigment). In the absence of a-MSH, or inhibition of a-MSH by the AGOUTI protein, pheomelanin (red/yellow pigment) is synthesized (Jackson, 1997). In mice, dominant mutations in MC1R that disable binding of a-MSH lead to constitutive activity (constant signaling of eumelanin synthesis) and predominantly black coat color. Recessive loss of function mutations result in production of pheomelanin, rather than eumelanin, and predominantly yellow or red coat color (Robbins et al., 1993). Both types of phenotypic changes have been linked to missense mutations in MC1R of domestic animals, including the cetartiodactyls pig, cow, and sheep (e.g., Klungland et al., 1995; Kijas et al., 1998; Våge et al., 1999). Coat color polymorphisms in natural populations of mammals and birds also have been attributed to variation in MC1R (e.g., Nachman et al., 2003; Mundy et al., 2004; Hoekstra et al., 2006; Baião et al., 2007). Intraspecific studies suggest that MC1R may be a target of positive Darwinian selection. This gene underlies adaptive melanism in rock pocket mice (Chaetodipus intermedius; Nachman et al., 2003) and adaptive light coat color in beach mice (Peromyscus polionotus; Hoekstra et al., 2006). Furthermore, MC1R is highly polymorphic in humans and shows evidence for positive selection in European populations (Savage et al., 2008). By contrast, clinal variation in coat color of the cetartiodactyl bovid, Dall’s sheep (Ovis dalli), could not be explained by variation in MC1R (Loehr et al., 2008). Despite evidence that MC1R controls many cases of intraspecific pigment polymorphism, little is known about its role in the evolution of coloration among mammal species. A systematic investigation of 50 primate species showed no correlation between MC1R variation and coat color (Mundy and Kelly, 2003), even though MC1R from different primate species varies extensively in basal activity and the ability to bind a-MSH (Haitina et al., 2007). N.A. Ayoub et al. / Molecular Phylogenetics and Evolution 52 (2009) 550–557 Furthermore, the gene has been under strong purifying selection for most of primate evolution (Mundy and Kelly, 2003). Interspecific variation in MC1R needs to be examined in other taxonomic groups to determine if the patterns found in primates hold for all mammals. Other than domestic animals, only a few cetartiodactyl MC1R sequences have been characterized (Klungland et al., 1999; Loehr et al., 2008), an insufficient number to map potentially adaptive changes in the gene and to assess the phylogenetic utility of MC1R. Here, we present a phylogenetic analysis of 86 (71 newly characterized) MC1R sequences, with a concentration on Cetartiodactyla. We sampled diversely colored taxa, including very light colored animals (i.e., beluga whale, Delphinapterus; Dall’s sheep, Ovis dalli; scimitar-horned oryx, Oryx dammah; addax, Addax nasomaculatus; mountain goat, Oreamnos), and very darkly colored animals (i.e., ‘‘black fish” dolphins, Peponocephala, Globicephala, Pseudorca, Feresa; sperm whale, Physeter; lowland anoa, Bubalus depressicornis; black wildebeest, Connochaetes gnou). Our goals were threefold: (1) assess the phylogenetic utility of MC1R for cetartiodactyls and mammals in general; (2) quantify patterns of selective constraint and positive selection in this molecule; and (3) map potentially adaptive amino acid replacements in MC1R within Cetartiodactyla, a group that shows extensive variation in pigmentation. 2. Methods We analyzed 86 MC1R sequences, including published sequences for 10 cetartiodactyls, one perissodactyl (horse), and four carnivorans (cat, dog, foxes; see Table 1). Using the polymerase chain reaction (PCR), we amplified all or most of the single MC1R exon in 71 cetartiodactyl taxa (Accession nos. FJ773287–FJ773 357, see Table 1). We amplified cetaceans using the primers MC1R_Turs-40F (CCTGAGAGCAAGGACCCCTTC; all primers shown 50 to 30 ) and MC1R_Turs1057R (TCTGTGCAGCCACACCTTCAG). We sequenced these products with PCR primers and the internal primers MC1R_Turs411F (GACCGCTACATCTCCATCTTCTACG) and MC1R_Turs546R (CGTGGTTGTAGTAGGCGATGAAGAG) to obtain complete coding sequences. For all other cetartiodactyls, we PCR amplified and sequenced individuals with a combination of the following primers: MC1R_pigcow-60F (AGCCATGAGYTGAGCAGGAC), MC1R_pigcow963R (TCACCAGGAGCACTGCAG), MC1R_art408F (ATGGTGTCCAGCCTCTGCT), MC1R_art408R (AGCAGAGGCTGGACA CCAT), MC1R_art186F (GCCCCAGTGCCTGGAGGTGTC), MC1R_art 236F (GGCTGGTGAGTCTYGTGGAG), MC1R_art809R (AAGACGCCCA GCAGGATGGTGAG), MC1R_art913R (CAGGAAGAGGTTGAAGTT CTTGA). PCR reactions included 1 ll template DNA, 100 pmol each primer, 1X AccuPrimeTM PCR Buffer I (Invitrogen), and 1 unit AccuPrimeTM Taq DNA Polymerase High Fidelity (Invitrogen) in a final volume of 50 ll. Reaction conditions consisted of 45 cycles of 1 min denaturation at 94 °C, 1 min annealing at 60–64 °C, and 1 min elongation at 68 °C. MC1R sequences were aligned by eye, which was straightforward due to the rarity of gaps (see Section 3), and subjected to maximum parsimony (MP) and Bayesian phylogenetic analyses. For comparative purposes, we additionally analyzed mitochondrial cytochrome b (mt cytb; the most commonly used phylogenetic marker in Mammalia) alone and in combination with MC1R (see Table 1 for GenBank Accession Numbers). Gaps were treated as missing data in all analyses. Perissodactyl and carnivoran sequences were set as outgroups (Springer et al., 2004). Heuristic parsimony searches were conducted in PAUP* v.4.0B10 (Swofford, 2002) with 1000 replicates of random addition sequence and treebisection–reconnection branch swapping. Bootstrap support was determined with 1000 pseudoreplications and 100 addition se- 551 quences per pseudoreplicate. Bayesian analyses were performed with MRBAYES v.3.1.2 (Ronquist and Huelsenbeck, 2003) using default priors and heating parameters. Two independent concurrent runs were carried out, each with four simultaneous Markov Chain Monte Carlo (MCMC) chains, sampling every 100 generations, until the standard deviation of the split frequencies of the two runs dropped below 0.01 (1–5 million generations depending on data set and partitioning strategy). For MC1R, Bayesian analyses were repeated for 10 million generations, sampling every 500, to insure that a longer sampling time did not change topology or posterior probabilities. Majority rule consensus tree topologies and branch lengths were calculated after discarding the first 25% of generations as burn-in. Bayesian analyses were carried out on unpartitioned data sets and on data sets partitioned according to codon position. For the Bayesian analyses of the two genes combined, the data were either unpartitioned or partitioned according to codon position and gene (i.e., six partitions). MODELTEST v.3.7 (Posada and Crandall, 1998) was used to determine the best-fitting model of evolution for each partition; parameters were unlinked in partitioned analyses. We accepted the partitioned model if the Bayes factor was >10 (see McGuire et al., 2007). We examined selection acting on MC1R by calculating x (the ratio of nonsynonymous substitutions per nonsynonymous site to synonymous substitutions per synonymous site) using maximum likelihood, as implemented in the codeml program of PAML v.4 (Yang, 2007). We used two different input trees. The first was based on independent data by suturing together a tree built from a supermatrix for all terrestrial artiodactyls (Marcot, 2007) with a tree built from mt cytb for cetaceans (May-Collado and Agnarsson, 2006). The second was based on our MC1R Bayesian tree with the highest posterior probability from the unpartitioned analysis. Each tree was fully resolved by running a heuristic maximum likelihood (ML) search in PAUP* using the MC1R data matrix and swapping on the respective input trees (for the tree based on independent data, the ML search was additionally constrained to agree with the input tree). The transition/transversion ratio was calculated from the data, and codon frequencies were estimated from base frequencies. To test for positive selection acting on particular sites (codons), we performed likelihood ratio tests (LRTs) comparing model M1a (nearly neutral: x0 < 1, x1 = 1) to M2a (positive selection: x0 < 1, x1 = 1, x2 > 1) and M7 (beta distribution with 0 < x < 1) to M8 (beta distribution with 0 < x < 1, x1 > 1) (Yang, 2007). We assessed significance using a v2 distribution and 2 degrees of freedom. We additionally compared M8 to M8a (beta distribution with 0 < x < 1, x1 = 1) using the LRT, testing against a v2 distribution with 1 degree of freedom. 3. Results and discussion 3.1. Phylogenetic utility of MC1R Our final data matrix consisted of 945 aligned characters, which included all but the last 18 bp of MC1R coding sequence. Gaps were limited to a 9 bp insertion in the two sampled suids and a 3 bp deletion within Phocoenidae. The number of parsimony informative characters was 313, with third codon positions accounting for more than half of those characters (Fig. 1). We compared levels of homoplasy in MC1R to mt cytb, by calculating consistency and retention indices (CI and RI) for each gene with PAUP*. CI and RI were much higher for MC1R than for mt cytb indicating that homoplasy was much lower for the nuclear gene. This pattern was found at all codon positions despite a similar proportion of parsimony informative characters at first and second codon positions in the two genes (Fig. 1). Homoplasy was highest at the rapidly evolving third codon positions of mt cytb. By contrast, the third codon posi- 552 N.A. Ayoub et al. / Molecular Phylogenetics and Evolution 52 (2009) 550–557 Table 1 Taxon sampling for this study. Species name Common name MC1Ra Cytochrome bb Sample originc Order Cetartiodactyla Cetacea Suborder Odontoceti Super Fam. Delphinoidea Fam. Delphinidae Sub. Fam. Delphininae Stenella attenuata Delphinus delphis Stenella coeruleoalba Tursiops truncatus Lagenodelphis hosei Pantropical spotted dolphin Short-beaked common dolphin Striped dolphin Bottlenose dolphin Fraser’s dolphin FJ773287 FJ773288 FJ773289 FJ773290 FJ773291 AF084097 AF084085 AF084082 AF084094 AF084099 Z18473 Z31912 Z37941 Z38274 Z30468 Sub. Fam. Stenoninae Steno bredanensis Rough-toothed dolphin FJ773292 AF084077 Z38282 Sub. Fam. Globicephalinae Peponocephala electra Globicephala macrorhynchus Pseudorca crassidens Grampus griseus Feresa attenuata Melon-headed whale Short-finned pilot whale False killer whale Risso’s dolphin Pygmy killer whale FJ773293 FJ773294 FJ773295 FJ773296 FJ773297 AF084053 AF084055 AF084057 AF084059 AF084052 Z34003 – CRC Z39091 Z38069 Z39083 Z3944 – MML Sub. Fam. Lissodelphininae Cephalorhynchus commersonii Lagenorhynchus obscurus Lagenorhynchus obliquidens Commerson’s dolphin Dusky dolphin Pacific white-sided dolphin FJ773298 FJ773299 FJ773300 AF084073 AF084066 AF084067 Z480 – USNM (#550154) Z37807 Z25409 Incertae sedis Lagenorhynchus acutus Lagenorhynchus albirostris Atlantic white-sided dolphin White-beaked dolphin FJ773301 FJ773302 AF084075 AF084074 Z7842 Z17318 Sub. Fam. Orcininae Orcinus orca Killer whale FJ773303 AF084061 Z6004 – TMMC Fam. Phocoenidae Neophocoena phocaenoides Phocoena phocoena Phocoenoides dalli Finless porpoise Harbor porpoise Dall’s porpoise FJ773304 FJ773305 FJ773306 AF334489 U72039 U09679 Z984 Z28452 – TMMC Z38979 – TMMC Fam. Monodontidae Delphinapterus leucas Beluga FJ773307 X92531 Z35275 Super Fam. Inioidea Fam. Pontoporiidae Pontoporia blainvillei La Plata dolphin FJ773308 AF334488 Z9834 Super Fam. Ziphoidea Fam. Ziphiidae Mesoplodon bidens Ziphius cavirostris Sowerby’s beaked whale Cuvier’s beaked whale FJ773309 FJ773310 X92538 X92540 Z3859 Z2157 – NMFS Super Fam. Physeteroidea Fam. Physeteridae Physeter macrocephalus Giant sperm whale FJ773311 AF304073 MIL Suborder Mysticeti Fam. Balaenopteridae Megaptera novaeangliae Balaenoptera physalus Humpback whale Fin whale FJ773312 FJ773313 X75584 NC 001321 ROS-6A02_556 ROS Suborder Ruminantia Fam. Bovidae Sub. Fam. Bovinae Bos taurus Bubalus depressicornis Boselaphus tragocamelus Tragelaphus oryx Domestic cow Lowland anoa Nilgai Eland NM_174108 FJ773314 FJ773315 FJ773316 J01394 D88641 AJ222679 AF022057 ARC ZSSD ARC Sub. Fam. Cephalophinae Cephalophus dorsalis Cephalophus maxwelli Bay duiker Maxwell’s duiker FJ773319 FJ773320 AF153884 AF153894 NYZS NYZS Sub. Fam. Antilopinae Saiga tatarica Antidorcas marsupialis Gazella granti Gazella leptoceros Gazella thomsoni Neotragus moschatus Saiga antelope Springbok Grant’s gazelle Slender-horned gazelle Thomson’s gazelle Suni FJ773321 FJ773322 FJ773323 FJ773324 FJ773325 FJ773317 AF064487 AF036281 AF034723 AF187699 AF030607 AJ222683 NYZS HEC ARC NYZS NYZS MAT Sub. Fam. Hippotraginae Kobus leche Kobus megaceros Red lechwe Nile lechwe FJ773326 FJ773327 AF096623 AF096620 HEC NYZS (continued on next page) 553 N.A. Ayoub et al. / Molecular Phylogenetics and Evolution 52 (2009) 550–557 Table 1 (continued) Species name Common name MC1Ra Cytochrome bb Sample originc Kobus kob Kobus ellipsiprymnus Redunca fulvorufula Redunca redunca Pelea capreolus Damaliscus dorcas Damaliscus lunatus Alcelaphus lichtensteini Alcelaphus caama Connochaetes gnou Connochaetes taurinus Oryx dammah Oryx gazella Addax nasomaculatus Hippotragus niger Hippotragus equinus Aepyceros melampus Kob Waterbuck Mountain reedbuck Bohor reedbuck Vaal rhebok Blesbok Tsassaby Lichtenstein’s hartebeest Red hartebeest Black wildebeest Blue wildebeest Scimitar-horned oryx Fringe-eared oryx Addax Sable antelope Roan antelope Impala FJ773328 FJ773329 FJ773330 FJ773331 FJ773332 FJ773333 FJ773334 FJ773335 FJ773336 FJ773337 FJ773338 FJ773339 FJ773340 FJ773341 FJ773342 FJ773343 FJ773318 AF052939 AF096625 AF096627 AF096626 AF022055 AF036287 AF016635 AF016636 AF300932 AF016637 AF016638 AJ222685 AF249973 AF034722 AF036285 AF022060 AF036289 ZSSD HEC HEC ARC HEC NYZS HEC HEC HEC HEC ZSSD ZSSD ZSSD ZSSD HEC HEC HEC Sub. Fam. Caprinae Ovis aries Ovis dalli Ovis canadensis Capra hircus Capra nubiana Oreamnos americanus Ovibos moschatus Domestic sheep Dall’s sheep Bighorn sheep Domestic goat Nubian ibex Mountain goat Musk ox Y13965 FJ773344 FJ773345 Y13958 FJ773346 FJ773347 Y13956 AF034730 AF034728 AF112140 AB044308 AF034740 AF190632 U17862 Sub. Fam. Pantholopinae Pantholops hodgsoni Chiru FJ773348 AF034724 NYZS Fam. Cervidae Sub. Fam. Capreolinae Odocoileus virginianus Rangifer tarandus Alces alces Capreolus capreolus White-tailed deer Caribou Moose Roe deer FJ773349 Y13959 FJ773350 Y13960 AY607035 AJ000029 AY035873 Y14951 CRO Sub. Fam. Cervinae Cervus elaphus hippelaphus Cervus elaphus roosevelti Cervus duvauceli Elaphurus davidianus Dama dama Red deer Roosevelt’s elk Barasingha deer Pere David’s deer Fallow deer Y13962 FJ773351 FJ773352 FJ773353 Y13963 AY244491 AY347752 AY607041 AF423194 AJ000022 CRO CRO NYZS Fam. Moschidae Moschus sp. Musk deer FJ773354 AF026883 NYZS-Bu75 Fam. Giraffidae Okapia johnstoni Giraffa camelopardalis Okapi Giraffe FJ773355 FJ773356 AY121993 X56287 NYZS NYZS Suborder Suina Fam. Suidae Sus scrofa Babyrousa babyrussa Domestic pig Babirusa NM_001008690 FJ773357 X56295 Z50106 NYZS Suborder Tylopoda Fam. Camelidae Lama pacos Alpaca EU220010 U06425 Order Perissodactyla Equus caballus Domestic horse AF288357 X79547 Order Carnivora Fam. Felidae Felis catus Domestic cat NM_01009324 U20753 Fam. Canidae Canis familiaris Alopex lagopus Vulpes vulpes Domestic dog Arctic fox Red fox NM_001014282 AJ786717 X90844 X94920 AY598511 AB292748 CRO CRO NYZS CRO CRO Taxonomy follows Agnarsson and May-Collado (2008). a GenBank accession nos. generated by this study are shown in bold. b Downloaded GenBank accession nos. c Numbered samples that start with ‘‘Z” were loaned from Southwest Fisheries Science Center (SWFSC), NOAA (La Jolla, California). Some samples from SWFSC were from other institutions and these are indicated: Cascadia Research Collective (CRC), Mote Marine Lab (MML), Smithsonian Institution (USNM), The Marine Mammal Center – Sausalito (TMMC), and National Marine Fisheries Service – Southwest Region Fishery Observer Program (NMFS). Other DNA samples were from M. Milinkovitch (MIL), H. Rosenbaum (ROS), P. Arctander (ARC), C. Matthee (MAT), K. Hecker (HEC), M. Cronin (CRO), O. Ryder – Zoological Society of San Diego (ZSSD), and G. Amato – New York Zoological Society (NYZS). tion of MC1R had higher CI and RI than any of the mt cytb codon positions (Fig. 1). The partitioned and unpartitioned Bayesian analyses of MC1R resulted in 50% majority rule consensus trees with identical 554 N.A. Ayoub et al. / Molecular Phylogenetics and Evolution 52 (2009) 550–557 1 1st position 2nd position 3rd postition 0.8 0.6 0.4 0.2 0 MC1R mt cytb proportion parsimony informative characters MC1R mt cytb CI MC1R mt cytb RI Fig. 1. Proportion of parsimony informative characters, Consistency Index (CI), and Retention Index (RI) for the codon positions of MC1R and mt cytb. CI and RI were calculated on MP trees. topologies (Fig. 2) but slightly different posterior probabilities for some nodes. However, the harmonic mean of the log likelihood scores (HLM) was significantly better for the partitioned than the unpartitioned analysis (DHLM = 212; 2lnBayes factor = 424). The 50% majority rule bootstrap tree (171 MP trees) had no topological conflicts with the Bayesian consensus tree (Fig. 2) and all but three clades that received high support in the partitioned Bayesian analysis (95% posterior probability, pp) also received high parsimony bootstrap support (>70% bs). The phylogenetic hypothesis based on MC1R (Fig. 2) was largely consistent with previous estimates of cetartiodactyl relationships (Matthee et al., 2001; Marcot, 2007; Agnarsson and May-Collado, 2008; O’Leary and Gatesy, 2008). At the level of suborder, we found support for (Tylopoda, (Suina, ((Mysticeti, Odontoceti), Ruminantia))), but MC1R did not favor monophyly of Odontoceti (toothed whales). All families for which we sampled multiple species were recovered as monophyletic with high support (>70% bs and 95% pp), including Delphinidae, Phocoenidae, Ziphiidae, Balaenopteridae, Bovidae, Cervidae, Giraffidae, and Suidae (Fig. 2). Support for relationships among ruminant families was low, with cervids basal and giraffids sister to a controversial clade composed of Moschidae + Bovidae (see Hassanin and Douzery, 2003; O’Leary and Gatesy, 2008). Within Cetacea, the branching pattern of delphinoid families and Pontoporiidae was congruent with previous analyses (e.g., Cassens et al., 2000), but Ziphiidae, Balaenopteridae, and Physeteridae displayed unconventional, weakly supported, relationships. Placing the cetacean root is often difficult in molecular analyses due to the long branch separating them from other cetartiodactyls. In addition, Physeter has a much longer MC1R branch than any other cetacean, which likely contributes to its basal placement. However, morphology and transposons strongly group Physeter with other odontocetes (Geisler and Sanders, 2003; Nikaido et al., 2007). Several traditionally recognized subfamilies also were recovered as monophyletic with varying levels of support. Within Delphinidae, Delphininae was monophyletic, Lissodelphininae was unresolved, and Globicephalinae included the morphologically disparate Steno bredanensis. Recent, independent evidence from multiple nuclear genes also suggested that Steno is included in a clade with globicephalines (Caballero et al., 2008; McGowen et al., 2008). Within Cervidae, Cervinae was recovered but not Capreolinae. Within bovids, Cephalophinae, and Caprinae were each monophyletic. As in most previous molecular studies (see Marcot, 2007), we did not recover Hippotraginae (sensu MacDonald, 2006), but the three included tribes (Reduncini, Alcelaphini, and Hippotragini) were each monophyletic (Fig. 2). Overall, unresolved or poorly supported relationships were due to a lack of character changes rather than homoplasy. Short internodes within Cetacea and Ruminantia, like the ones seen in MC1R, are common in molecular data sets, and likely reflect rapid radiations in these groups (e.g. see O’Leary and Gatesy, 2008). MC1R agreed well with our Bayesian analysis of mt cytb for the same set of taxa (Fig. 2) and with a recent supermatrix analysis of terrestrial artiodactyls (Marcot, 2007). Of 59 clades resolved by our Bayesian analysis of MC1R, 42 also were resolved by our partitioned Bayesian analysis of mt cytb, 27 with high support by both genes (P0.95 pp). Only 12 clades recovered by MC1R conflicted with the mt cytb topology, but none strongly contradicted wellsupported nodes in the mt cytb tree. In addition, our combined analysis of MC1R with mt cytb increased support to P0.95 pp for 12 clades that were weakly supported by MC1R alone (Fig. 2). Marcot (2007) analyzed a supermatrix of 16 genes for 198 cetartiodactyl species. This parsimony analysis included all of the terrestrial artiodactyl species in our analysis. Our results are highly consistent with the strict consensus tree presented by Marcot (2007). Of 42 comparable nodes in our MC1R tree, only six conflict with Marcot’s analysis (Fig. 2). 3.2. Selection on MC1R The vast majority of MC1R sites (codons) appear to have evolved under strong purifying selection (x0 = 0.07, p0 = 0.95 under model M1a). The likelihood of the nearly neutral model (M1a) was almost identical to the positive selection model (M2a). The positive selection model, M8, was significantly better than the purifying selection model, M7 (2DL = 23, P < 0.0001), but the small class of positively selected sites (under M8) could not be distinguished from neutrality (under M8a) (2DL = 2.62, P = 0.11, MC1R input tree; 2DL = 3.03, P = 0.08, independent input tree). When allowed to vary among branches, x ranged from 0.0001–0.55, excepting several short branches where a single substitution resulted in a change in amino acid. The other exception was for the branch leading to domestic dog (Canis familiaris), which has experienced five nonsynonymous changes and no synonymous changes relative to the foxes (Vulpes and Alopex). Previous studies of MC1R variation in domestic and wild populations have identified a number of amino acid replacements at conserved sites that are correlated with changes in coat color. We identified three replacements in our sample of cetartiodactyls that occurred at positions previously shown to affect coloration. The caribou, Rangifer tarandus, has R67S and Q233R replacements, and residue 240 has changed from A to T in alpaca, Lama pacos (amino acid positions are numbered according to the cow MC1R sequence). The replacement R67C causes loss of function in MC1R, and is associated with light coat colors in natural populations of beach mice (Peromyscus polionotus) and likely in mammoths (Hoekstra et al., 2006; Römpler et al., 2006). Caribou, which has an S at this position, can vary in coat color, ranging from light to grayish brown. We do not know the color of the animal sampled, and an examination of intraspecific variation in both coat color and MC1R sequence is needed to assess the phenotypic effect of this replacement. Another replacement occurred in caribou at a position correlated with dark coat colors. Melanic mice, Chaetodipus intermedius, possess a Q233H substitution compared to wildtype mice (Nachman et al., 2003). Replacements at residue 233 are also correlated with melanic plumage in two bird species: R233H in arctic skua, and R233C in great skua (Stercorarius parasiticus and Catharacta skua respectively; Mundy et al., 2004). These 555 N.A. Ayoub et al. / Molecular Phylogenetics and Evolution 52 (2009) 550–557 0.95 pp (MC1R) 0.95 pp (MC1R + mt cytb) mt cytb Marcot (2007) mt cytb + Marcot (2007) Stenella attenuata Delphinus delphis - 1 Stenella coeruleoalba Tursiops truncatus Lagenodelphis hosei Delphinidae 1 Steno bredanensis Peponocephala electra Globicephala macrorhynchus Pseudorca crassidens - 2 Grampus griseus Feresa attenuata Lagenorhynchus acutus Phocoenidae 3 Cephalorhynchus commersonii Lagenorhynchus obscurus Lagenorhynchus obliquidens Lagenorhynchus albirostris Orcinus orca Neophocoena phocaenoides Monodontidae 4 Phocoena phocoena Phocoenoides dalli - 3 Delphinapterus leucas - 4 Pontoporia blainvillei - 5 Mesoplodon bidens Ziphius cavirostris - 6 Megaptera novaeangliae - 7 Balaenopteridae 7 Balaenoptera physalus Physeter macrocephalus- 8 Bos taurus Bubalus depressicornis - 9 Tragelaphus oryx Boselaphus tragocamelus Neotragus moschatus Aepyceros melampus Cephalophus dorsalis Cephalophus maxwelli Saiga tatarica Antidorcas marsupialis Gazella granti Gazella leptoceros Gazella thomsoni Kobus leche Kobus megaceros Kobus kob Kobus ellipsiprymnus Redunca fulvorufula Redunca redunca Pelea capreolus Damaliscus dorcas Damaliscus lunatus Alcelaphus lichtensteini Alcelaphus caama - 10 Connochaetes gnou - 11 Connochaetes taurinus Oryx dammah Oryx gazella Addax nasomaculatus - 12 Hippotragus niger Hippotragus equinus Ovis aries Ovis dalli - 13 Ovis canadensis Capra hircus Capra nubiana Oreamnos americanus - 14 Ovibos moschatus Pantholops hodgsoni Moschus sp. - 15 Okapia johnstoni - 16 Giraffa camelopardalis Odocoileus virginianus Cervus elaphus hippelaphus - 17 Cervus elaphus roosevelti Dama dama Elaphurus davidianus Cervus duvauceli Rangifer tarandus - 18 Alces alces Capreolus capreolus Sus scrofa Babyrousa babyrussa - 19 Lama pacos - 20 Equus caballus Felis catus Canis familiaris Alopex lagopus Vulpes vulpes Outgroups Delphinidae 2 Pontoporiidae 5 Ziphiidae 6 Physeteridae 8 Bovidae 9 Bovidae 10 Bovidae 11 Bovidae 12 Bovidae 13 Bovidae 14 Moschidae 15 Giraffidae 16 Cervidae 17 Cervidae 18 Suidae 19 Camelidae 20 0.1 substitutions/site Fig. 2. Majority rule consensus topology and branch lengths for the partitioned Bayesian analysis of MC1R. Well-supported clades in the analysis of MC1R are indicated by thickened light brown branches (0.95 pp indicates Bayesian posterior probability >0.95). Twelve additional nodes have >0.95 pp when mt cytb and MC1R were analyzed in a combined partitioned Bayesian analysis (thickened red branches). Congruence of the Bayesian MC1R tree with a partitioned Bayesian analysis of mt cytb from the same taxa (see Table 1) is indicated by white circles at nodes. Nodes consistent with the parsimony supermatrix analysis of Marcot (2007) are marked by gray circles (applicable only to terrestrial artiodactyls). Black circles show nodes in agreement with both our Bayesian mt cytb tree and Marcot (2007). Perissodactyls and carnivorans (bottom) are set as outgroups. Brackets to the right of species names delimit cetartiodactyl families; identity of families can be tracked by matching numbers after species names with numbers associated with paintings of familial representatives. Artwork is by Carl Buell. 556 N.A. Ayoub et al. / Molecular Phylogenetics and Evolution 52 (2009) 550–557 Table 2 MC1R derived amino acid replacements in select light and darkly colored species. Replacements that unambiguously mapped onto the MC1R Bayesian tree (Fig. 2) are shown. Bolded replacements are unique to that taxon. Taxa Amino acid replacements Color Delphinapterus leucas Ovis dalli Oryx dammah Addax nasomaculatus Oreamnos americanus Peponocephala, Globicephala, Pseudorca, Feresa Physeter macrocephalus D118G, S230C, F283L, I287V, N290S T95M, K307N R109Q None R9W, A64S, V188I, R223W, S262L None Light Light Light Light Light Dark S/P13A, S47T, L53V, A/I63V, I64V, V82A, V119A, I120A, V122A, I124T, S154G, N184H, M203L, Q216R, K226R, R227T, T244A L26P, F76L, G126S, P159S, I197V, I205V None Dark Bubalus depressicornis Connochaetes gnou Dark Dark replacements at position 233 likely lead to constitutive activity of MC1R and the observed dark coloration. Given that the wild-type residue in birds is R, it seems unlikely that the Q233R replacement in caribou causes a functional change. The replacement A240T is perfectly correlated with red coloration in domestic pigs (Kijas et al., 1998). Alpaca, which can vary in coat color, has a V at this residue. Two genomic sequences were available for alpaca on GenBank. The notes for the sequence included in our phylogenetic analyses (EU220010) say that this is a ‘‘fawn” animal. The other sequence available on GenBank (EU135880), which was not included in our phylogenetic analysis, has a note that says it is a ‘‘bay (black/ brown)” animal. Both sequences possess 240V, suggesting that the replacement does not affect coat color in alpaca. However, the ‘‘bay” sequence has a V87M replacement, which is convergent with birds possessing black plumage (Mundy et al., 2004; Baião et al., 2007). Although we failed to detect positive selection acting on MC1R using likelihood ratio tests of models implemented in PAML, the gene could still be of adaptive significance for some cetartiodactyls. Isolated instances of adaptive change may occur in the broader context of overall purifying selection at an amino acid site. In the case of MC1R, a single amino acid replacement (many of which are found at different positions) can cause a large change in coloration (see previous paragraph). Even when a change in MC1R sequence is selectively advantageous, synonymous substitutions may exceed nonsynonymous substitutions at that site (e.g., Nachman et al., 2003). For some of the taxa we sampled, such as the delphinids, addax, or black wildebeest, we can exclude MC1R as a determinant of color differences because no amino acid changes were observed (Table 2). For other taxa, MC1R variation exists, which may have functional consequences that affect coloration. For instance, we observed unique amino acid replacements at conserved sites in the predominantly white Delphinapterus, Ovis dalli, and Oreamnos, as well as in the predominantly black Physeter and Bubalus depressicornis (Table 2). However, as mentioned in the introduction, a previous study of intraspecific variation in Ovis dalli MC1R found no correlation between the K307N replacement and individual coat color (Loehr et al., 2008). Denser sampling of the bovids, including other Bubalus species and the black and red African buffalos (Syncerus caffer caffer and S. caffer nana, respectively) could provide insights into the effect of MC1R replacements on color variation in this group. Ultimately, in vitro assays are needed to determine if MC1R is disabled in the light animals or constitutively active in the dark animals. In summary, MC1R has experienced strong purifying selection throughout cetartiodactyl evolution, similar to primates. Occasional amino acid replacements have produced dramatic effects on coat color in domestic animals, but functional assays are needed to assess the impact of MC1R variation in wild cetartiodactyl species. We additionally found that MC1R has high phylogenetic utility, with little homoplasy and broad topological congruence with independent data. The conserved nature of MC1R allows reconstruction of relationships among distantly related cetartiodactyls, yet the gene is still informative at the species level. A detailed examination of MC1R across all mammals will likely improve phylogenetic resolution of the mammalian tree of life, and potentially aid in understanding the role of MC1R in the evolution of pigmentation. Acknowledgments Funding was from NSF EF-O629860 awarded to M.S. and J.G., and NSF DEB-0640313 to J.G. A. Dizon, P. Morin, S. Chivers, and K. Robertson (Southwest Fisheries Science Center) loaned cetacean DNA samples. Some of these samples were from the following institutions: Cascadia Research Collective, Mote Marine Lab, Smithsonian Institution, The Marine Mammal Center – Sausalito, and National Marine Fisheries Service – Southwest Region Fishery Observer Program. M. Milinkovitch, P. Arctander, C. Matthee, M. Cronin, K. Hecker, H. Rosenbaum, G. Amato (New York Zoological Society), and O. Ryder (Zoological Society of San Diego) loaned other DNA samples. An anonymous reviewer and C. Steiner provided helpful comments on previous drafts of the paper. References Agnarsson, I., May-Collado, L.J., 2008. The phylogeny of Cetartiodactyla: the importance of dense taxon sampling, missing data, and the remarkable promise of cytochrome b to provide reliable species-level phylogenies. Mol. Phylogenet. Evol. 48, 964–985. Baião, P.C., Schreiber, E.A., Parker, P.G., 2007. The genetic basis of the plumage polymorphism in red-footed boobies (Sula sula): a melanocortin-1 receptor (MC1R) analysis. J. Hered. 98, 287–292. Caballero, S., Jackson, J., Mignucci-Giannoni, A.A., Barrios-Garrido, H., BeltránPedreros, S., Montiel-Villalobos, M.G., Robertson, K.M., Baker, C.S., 2008. Molecular systematics of South American dolphins Sotalia: sister taxa determination and phylogenetic relationships, with insights into a multilocus phylogeny of the Delphinidae. Mol. Phylogenet. Evol. 46, 252–268. Caro, T., 2005. The adaptive significance of coloration in mammals. Bioscience 55, 125–136. Cassens, I., Vicario, S., Waddell, V.G., Balchowsky, H., Van Belle, D., Ding, W., Fan, C., Lal Mohan, R.S., Simões-Lopes, P.C., Bastida, R., Meyer, A., Stanhope, M.J., Milinkovitch, M.C., 2000. Independent adaptation to riverine habitats allowed survival of ancient cetacean lineages. Proc. Natl. Acad. Sci. USA 97, 11343– 11347. Geisler, J.H., Sanders, A.E., 2003. Morphological evidence for the phylogeny of Cetacea. J. Mammal. Evol. 10, 23–129. Haitina, T., Ringholm, A., Kelly, J., Mundy, N.I., Schiöth, H.B., 2007. High diversity in functional properties of melanocortin 1 receptor (MC1R) in divergent primate species is more strongly associated with phylogeny than coat color. Mol. Biol. Evol. 24, 2001–2008. Hassanin, A., Douzery, E.J.P., 2003. Molecular and morphological phylogenies of Ruminantia and the alternative position of Moschidae. Syst. Biol. 52, 206–228. Hoekstra, H.E., Hirschman, R.J., Bundey, R.A., Insel, P.A., Crossland, J.P., 2006. A single amino acid mutation contributes to adaptive beach mouse color pattern. Science 313, 101–104. Jackson, I.J., 1997. Homologous pigmentation mutations in human, mouse, and other model organisms. Hum. Mol. Genet. 6, 1613–1624. Kijas, J.M.H., Wales, R., Törnsten, A., Chardon, P., Moller, M., Anderson, L., 1998. Melanocortin receptor 1 (MC1R) mutations and coat color in pigs. Genetics 150, 1177–1185. Klungland, H., Våge, D.I., Gomez-Raya, L., Adalsteinsson, S., Lien, S., 1995. The role of the melanocyte-stimulating hormone (MSH) receptor in bovine coat color determination. Mamm. Genome 6, 636–639. Klungland, H., Roed, K.H., Nesbo, C.L., Jakobsen, K.S., Våge, D.I., 1999. The melanocyte-stimulating hormone receptor (MC1-R) gene as a tool in evolutionary studies of artiodactyles. Hereditas 131, 39–46. Loehr, J., Worley, K., Moe, J., Carey, J., Coltman, D.W., 2008. MC1R variants correlate with thinhorn sheep colour cline but not individual colour. Can. J. Zool. 86, 147– 150. MacDonald, D.W., 2006. The Encyclopedia of Mammals. University of Oxford Press, Oxford. Marcot, J.D., 2007. Molecular phylogeny of terrestrial artiodactyls. In: Prothero, D.R., Ross, S.E. (Eds.), The Evolution of Artiodactyls. Johns Hopkins University Press, Baltimore, MD, pp. 4–18. N.A. Ayoub et al. / Molecular Phylogenetics and Evolution 52 (2009) 550–557 Matthee, C.A., Burzlaff, J.D., Taylor, J.F., Davis, S.K., 2001. Mining the mammalian genome for artiodactyl systematics. Syst. Biol. 50, 367–390. May-Collado, L., Agnarsson, I., 2006. Cytochrome b and Bayesian inference of whale phylogeny. Mol. Phylogenet. Evol. 38, 344–354. McGowen, M.R., Clark, C., Gatesy, J., 2008. The vestigial olfactory receptor subgenome of odontocete whales: phylogenetic congruence between genetree reconciliation and supermatrix methods. Syst. Biol. 57, 574–590. McGuire, J.A., Witt, C.C., Altshuler, D.L., Remsen, J.R., 2007. Phylogenetic systematics and biogeography of hummingbirds: Bayesian and maximum likelihood analyses of partitioned data and selection of an appropriate partitioning strategy. Syst. Biol. 56, 837–856. Mundy, N.I., Kelly, J., 2003. Evolution of a pigmentation gene, the melanocortin-1 receptor, in primates. Am. J. Phys. Anthropol. 121, 67–80. Mundy, N.I., Badcock, N.S., Hart, T., Scribner, K., Janssen, K., Nadeau, N.J., 2004. Conserved genetic basis of a quantitative plumage trait involved in mate choice. Science 303, 1870–1873. Nachman, M.W., Hoekstra, H.E., D’Agostino, S.L., 2003. The genetic basis of adaptive melanism in pocket mice. Proc. Natl. Acad. Sci. USA 100, 5268–5273. Nikaido, M., Rooney, A., Okada, N., 1999. Phylogenetic relationships among cetartiodactyls based on insertions of short and long interspersed elements: hippopotamuses are the closest extant relatives of whales. Proc. Natl. Acad. Sci. USA 96, 10261–10266. Nikaido, M., Piskurek, O., Okada, N., 2007. Toothed whale monophyly reassessed by SINE insertion analysis: the absence of lineage sorting effects suggests a small population of a common ancestral species. Mol. Phylogenet. Evol. 43, 216–224. O’Leary, M.A., Gatesy, J., 2008. Impact of increased character sampling on the phylogeny of Cetartiodactyla (Mammalia): combined analysis including fossils. Cladistics 24, 397–442. 557 Perrin, W.F., 2002. Coloration. In: Perrin, W.F., Würsig, B., Thewissen, J.G.M. (Eds.), Encyclopedia of Marine Mammals. Academic Press, San Diego, pp. 236–245. Posada, D., Crandall, K.A., 1998. MODELTEST: testing the model of DNA substitution. Bioinformatics 14, 817–818. Robbins, L.S., Nadeau, J.H., Johnson, K.R., Kelly, M.A., Roselli-Rehfuss, L., Baack, E., Mountjoy, K.G., Cone, R.D., 1993. Pigmentation phenotypes of variant extension locus alleles result from point mutations that alter MSH receptor function. Cell 72, 827–834. Römpler, H., Rohland, N., Lalueza-Fox, C., Willerslev, E., Kuznetsova, T., Rabeder, G., Bertranpetit, J., Schöneberg, T., Hofreiter, M., 2006. Nuclear gene indicates coatcolor polymorphism in mammoths. Science 313, 62. Ronquist, F., Huelsenbeck, J.P., 2003. MrBayes 3: Bayesian phylogenetic inference under mixed models. Bioinformatics 19, 1572–1574. Savage, S.A., Gerstenblith, M.R., Goldstein, A.M., Mirabello, L., Fargnoli, M.C., Peris, K., Landi, M.T., 2008. Nucleotide diversity and population differentiation of the melanocortin 1 receptor gene, MC1R. BMC Genet. 9, 31. Springer, M.S., Stanhope, M.J., Madsen, O., de Jong, W.W., 2004. Molecules consolidate the placental mammal tree. Trends Ecol. Evol. 19, 430–438. Stoner, C.J., Caro, T.M., Graham, C.M., 2003. Ecological and behavioral correlates of coloration in artiodactyls: systematic analyses of conventional hypotheses. Behav. Ecol. 14, 823–840. Swofford, D.L., 2002. PAUP. Phylogenetic Analysis Using Parsimony (and Other Methods). Version 4. Sinauer Associates, Sunderland, MA. Våge, D.I., Klungland, H., Lu, D., Cone, R.D., 1999. Molecular and pharmacological characterization of dominant black coat color in sheep. Mamm. Genome 10, 39–43. Yang, Z., 2007. PAML 4: a program package for phylogenetic analysis by maximum likelihood. Mol. Biol. Evol. 24, 1586–1591. Available from: http:// abacus.gene.ucl.ac.uk/software/paml.html.