Structure and inducible regulation of the human MET promoter

THEJOURNAL OF BIOICGICAL CHEMISTRY 0 1994 by The American Society for Biochemistry and Molecular Biology, Inc. Vol. 269, No. 17, Issue of April 29, pp. 12852-12857, 1994 Printed in U.S.A. Structure and Inducible Regulationof the Human MET Promoter* (Received for publication, December 14, 1993) Giovanna GambarottaSBI,Sergio PistoiSII, Silvia Giordano**,Paolo M. Comoglio**, and Claudio SantoroSBSS From the SZnter-University Consortium for Biotechnology, 34012 Pieste and the $Department of Genetics, Biology and Medical Chemistry, and **Department of Biomedical Sciences and Oncology, University of lbrino, Medical School, Torino 10126, Italy The MET oncogene, encoding the tyrosine kinase receptor for the hepatocyte growth factorlscatter factor, is expressed in epithelial cells and overexpressed in a significantproportionofhumanepithelialcancers, of transcriptionalaltersuggestingtheoccurrence ation(s).To identify the MET promoter, we isolated recombinant cDNA clonesencompassingtheentire 5'noncoding sequence of MET messenger RNAs. Using probes derived from this region, we cloned the entire genomic region spanning the first MET exon and the flanking regulatory sequences. The first exon, containing the entire untranslated sequence, is present in the MET mRNAs of 7.1, 5.9, and 4.6 kilobases, showing that the expression of the multiple transcripts is regulated by a single promoter. The start site of transcription was determined by primer extension and by rapid amplification of cDNA ends. We show thata 300-base pair fragment,containingsequencesupstreamfromthestart site, efficiently drives the expression of a reporter gene in transfected epithelial cells. This promoter fragment alsocontainsthe cis-acting elementsresponsiblefor phorbol-ester induction. tumors including gastrointestinal tract (10, 19,20) and thyroid (21) carcinomas and metastatic melanoma (22). In most of these tumors, the MET gene is not amplified. Even in the few instances where overexpression is associated with gene amplification, the level of MET transcripts is higher than expected that an from the gene copy number (23). These findings suggest aberrant transcriptional regulation may playa critical role in activation of the oncogene. To investigate the molecular mechanisms underlying the controlof MET expression in physiological as well as in pathological conditions, we sought to identify the promoter sequences. In the present work we report the cloning of cDNAs encompassing the complete 5"untranslated region of MET mRNAs and the corresponding genomic sequences. These span -30 kbp of the MET locus and contain a single large intron.Within this region we mapped the major transcription start and assayed the promoter activityof upstream DNA sequences in epithelial and fibroblast cell lines. A 300-bp fragment, proximal to the start site, was shown to confer expression and TPA-dependent induction toa reporter genein transfected epithelialcells. This sequence containsthe &-acting elements responsible for phorbol-ester induction. MATERIALSANDMETHODS Oncogenes encoding tyrosine kinase receptors are often overCell Cultures-GTL-16, MKN1, and MKN28 are human gastric carexpressed in human cancers. These include ERBBl (1-41, ERBB2 (5-7), BEK,FLG (8), and MET (9, 10). TheMET onco- cinoma cell lines (24-26). HepG2 is a human hepatocellular carcinoma gene encodes a trans-membrane tyrosine kinase identified as cell line (27) and MRC5 a human fibroblast line (28).All cell types were grown in Dulbecco's modified essential medium (Life Technologies, Inc.) the receptor for a polypeptide known as hepatocyte growth supplemented with 10% fetal calf serum and antibiotics in a 5% CO, factor (HGF)l (11, 12) or scatter factor (13). The Met receptor atmosphere at 37 "C. controls critical biological responses suchas cell growth, motilOligonucleotides-Theoligonucleotide475, (5"CCAGACTGAGGCGCTCGCC-3'1, complementary to METmRNAfrom base +38t o +56,was ity, and invasion of extracellular matrices (14, 15). In ERBBB, overexpression is mainly due to gene amplifica- used for primer extension analysis. "Primer-selectedcDNAwalking" was tion (16). However, abnormally high levelsof c-ErbB-2 protein carried out using the following primers: AF39(5"ATGCTCATGTAGAATGACATTCTGGAT-3'),complementary to METmRNA from base in tumors with a single-copy gene, suggesting +562 to +588;AF40 (5'-ACTCCCCAGAGCTCCTCTGCACCAA-3') can also be found from that amplification alone cannot account for overexpression in base +460 to +484; 193 (5'-GATGCCAGGTGCAAGCACA-3') from base all cases (17, 18). Overexpression of MET occurs frequently in +423to +441; P128(5'-TGCCCAGGAACCAGTGGAGAAG-3') from base from base +366 to +387; P127 (5'-CTCTCAGCAAGTCAGCTGTC-3') * This work was supported by grants from the Associazione Italiana +304 to+323and 475. The primers complementary to sequencesflanking Ricerche sul Cancro, and Progetto Finalizzato Consiglio Nazionale delle the left or right side of the EcoRI cloningsite inthe P-galactosidase gene ricerche Ingegneria Genetica (to C. S) and Applicazion Cliniche Ricerca of A g t l l vectorwere: ONL (5'-CAACTGGTAATGGTAGCGA-3') and Oncologica (to P.M.C.). The costs of publication of this article were ONR (5'-AACCAGCCATCGCCATCT-3'). For RACE analysis, the followdefrayed in part by the payment of page charges. This article must ing primers were used: 2 (5'-ACACGCGCGCTGCCCTGCCAGTGAC-3') therefore be hereby marked "advertisement" in accordance with 18 complementary to MET mRNA from base +127 to +151, 424 (5'-GTTU.S.C. Section 1734 solely to indicate this fact. GGGGCCGGAGGCACCGC-3')from base +64 to +83,475 and P65 (5'The nucleotide sequencefsl reportedin this paper has been submitted CCGGAATTCCCCCCCCCCC-3')complementary to the (dG) tail. to the GenBankTM/EMBL Data Bank with accession number(s)226936. cDNA Synthesis and Primer-selected cDNA WaZking-Double7 Recipient of a fellowship fromthe Associazione Italiana Ricerche sul stranded cDNA was synthetised from GTL-16 cell poly(AYRNAprimed Cancro. 1I Present address: Deuartement d'Immunoloeie. Institute Pasteur. with random deoxyoligonucleotides(141, following the directions of a cDNA synthesis kit (Pharmacia). After linkers ligation, the cDNA was Paris, France. tt To whom correspondence should be addressed: LN-CIB Padriciano inserted into the EcoRI cloning site of h g t l l vector. The library (2 x lo6 independent clones) was plated and amplified. 100 pl of the amplified 99,34012 Trieste, Italy. Tel.: 39-40-398992;Fax: 39-40-398979. The abbreviations used are: HGF, hepatocyte growth factor; TPA, library (10' pfu) were digested with 30 pg of proteinase K in 1%SDS 12-0-tetradecanoylphorbol-13-acetate; kbp, kilobase paids); bp, base and 5 m EDTA at 37 "C for 60 min. The DNA was phenol extracted, pair(s); RACE, rapid amplification of cDNA ends; pfu, plaque-forming precipitated with isopropyl alcohol,and resuspended in water. To select MET-specific cDNAa spanning the entire 5"noncoding region, 1 ng of units; PCR, polymerase chain reaction. I , 12852 The Human MET Promoter 12853 library DNAwas amplified by PCR in 10 m~ Tris-HCI, pH 9,50 mM KCI, A B 1.5 mM MgCI,, 200 mM dNTPs, 0.1% Triton X-100.58Me,SO, 2.5 units of Taq DNA polymerase (Promega), and 1 m~ each of hgtll and METspecific primers in a finalvolume of 50 pl. Vector primers wereONL or ONR. The cDNA was amplified by 20 touch-down cycles (29) with de8.2 kb (SP1) naturation at94 "C for l min, annealing decreasingfrom 65 to 56"C for 7.1 kb + cycles at thelowest 30 s, extension a t 72 "C for 1 min, and 10 additional 5.9 kb 28s annealing temperature.1 pl of amplified DNA was sequentially ream4.6 kb 4 plified two more times using MET-specific antisense primers progressively closer to the 5'-end of the first exon. DNA aliquots from each amplification round were end-filled in, kinased, digested with EcoRI, and subcloned into Bluescript vectors. Colonies were screened by hy18s bridization tooligonucleotide probes complementary to MET 5"noncoding sequences and positives were sequencedon both strands. RNA Extraction and Analysis-Total RNAs were extracted with guanidinium thiocyanate a s described (30) andpoly(AY RNA was purified FIG.1. The major MET transcripts have common I'-untransby oligo(dT)-coated magnetic beads following the supplier directions lated sequences. Northern blots, containing1pg of poly(AYRNAfrom or poly(AY RNAwere fraction(Promega). For Northern analysis, total GTL16 cells, were probed with the full-length open reading frame (14) ated over a 1.2% agarose gel and subsequently transferred to Zetaprobe of the METcDNA (panel A) or with the cDNA fragment corresponding GT membrane (Bio-Rad)by capillary blotting. Hybridization was carto the MET 5"noncoding region from base +1 to +323 (panel B ) . 28 S M sodium phosphatebuffer, pH 6.5,78 SDS, 1 mM EDTA, ried out in 0.5 and 18 S indicatethe position of ribosomal RNAs, a s detected by 1 x lo6 countdmidml of [a-J2PldCTPoligo random labeled probe (spe- ethidium bromide staining. Theposition of the SplmRNA was detected cific activity > loRcountdmidpg DNA), at 65"C for 20 h. The hybrid- by reprobing the blots with the full-length S p l cDNA (34). Arrows ized membranes were washedonce in 40mM sodium phosphate, pH6.5, indicate the calculated sizeof the MET transcripts. 5% SDS, 1 mM EDTA for 15 min a t 65 "C, then twice in 40 m~ sodium phosphate, pH6.5, 1% SDS, 1m~ EDTA for 15 min at 65"C. Blots were +409 to +772),or to the first 323 bp of the first exon (from base +1 to air dried and exposed to x-ray films (Kodak)a t -80 "C. +323). Purified positive phages were characterized by Southern analyFor primerextensionanalysis,the19-mer oligonucleotide 475, sis after digestion with different restriction enzymes using 32P-labeled complementary to MET mRNA from base +38 to +56of the first exon, oligonucleotides derived from the 5"untranslated sequence. Positive was labeled at the5'-end with [y32PlATP.Labeled primer (25 ng) was fragments were subcloned into Bluescript vector and sequenced. To purified by chromatography through a Sephadex G-50 mini column isolate overlappinggenomic clones, a unique DNAfragment (probe 3 in (Pharmacia). The oligonucleotide (2 x lo5countdmin) was annealed to Fig. 4) was used a s probe for further screeningof the genomic library. 10 pg of total or 0.5 pg of poly(AY RNAin a volume of 20 p1 of solution Dansfections and Reporter GeneAssay-The expression vectors containing 50 m~ Tris-HCI, 75 mM KCI, and 3 mM MgCI,, pH 8.3, a t pGL2-2.7met and pGL2-O.3met were generatedby inserting a deletion 68 "C for 10 min, 55 "C for 30 min, andslowly cooled down to 42"C. The DNA fragment from -2700 to +115 and a SmaI-SmaI fragment from extension reaction was started adding 10 pl containing 10 mM dithio- -297 to + 89 into pGL2-Basic vector (Promega), respectively. Transfecthreitol, 2 m~ dNTPs, 40 unitsof RNase inhibitor RNAsin (Promega), tions were performed using subconfluent cells growing in the presence and 200 unitsof Mouse-Maloney leukemia virus reverse transcriptase of 10% fetal calf serum (5 x lo5to 1 x IO6celld100-mm diameter culture (Life Technologies, Inc.). Incubation was a t 42 "C for 90 min. The reac- dishes, in8 ml of culture medium).Cells were transfected with 10 of pg tion was stoppedby incubation at 56 "C for 10 minin 0.3 M NaOH. The expression construct DNAs plus 5 pg of pUC19 carrier DNAby the solution was neutralized with one volume of 250 m~ HCI and 50 m~ calciudphosphate precipitation method (32). After 12 h,DNA the preTris-HCI, pH 8, extracted with phenoUchloroform, and precipitated with cipitate was rinsed twice with phosphate-buffered saline, and cells were ethanol. The pellet was resuspended80% in formamide sequencingdye, further grown for 36 h in culture medium. For TPAinduction,cells were heated at 90 "C for 2 min andloaded onto a 7M urea 10% polyacrylam- transfected as above and starvedfor 24 h in medium supplemented with ide gel. After electrophoresis,the gel was dried andexposed to an x-ray 0.5% fetal calf serum; cells were induced with 160n~ TPA for 12 h. For film a t -80 "C. each set of transfections, two control constructs harboring the luciferase RACE-For the first cDNA strandsynthesis, 0.5 pg of GTL-16 gene were used: pGL2-promoter (pGL2prom) containingSV40-derived poly(AY RNA were annealed to 1 ng of the 25-mer oligonucleotide 2 promoter sequences and the promoterless pGL2-basic (Promega). Lucomplementary to the METfirst exon (bases +127 to +151) ina final ciferase assays were carried out usingcommercially available kits and volume of 30 pl containing 50mM Tris-HCI, 75 m~ KCI, 3 mM MgCI,, 10 following supplier's directions (Promega).Levels of luciferase weredemM dithiothreitol, 1mM dNTPs, pH8.3, and 10pCi of a [a-"PJdCTP. The termined and normalized to the protein concentration of extracts. sample was heated a t 68 "C for 5 min and transferredto 42 "C. cDNA synthesis was startedby adding 200 units of Mouse-Maloney leukemia RESULTS virus reverse transcriptase and incubating a t 42 "C for 60 min. The Sequence of the Complete 5'4Jntranslated MET mRNA-The reaction was stopped by phenollchloroform extraction and isopropyl alcohol precipitation. After two rinses with70% ethanol, thecDNA was human MET proto-oncogene is expressed mainlyas a long transcript, conventionally referred to as either 8 or 9 kb; in addiresuspended in 20 pl of terminal deoxynucleotidyl transferase buffer (0.1 M potassium cacodylate, 2 m~ CoCI,, 0.2 m~ dithiothreitol, pH 7.2). tion, two shorter mRNA species have been described in differFor dG tailing, 1mM dGTP and 15 units of terminal deoxynucleotidyl ent cell types (9,33). We carried out the analysis of the length transferase (Bethesda Research Laboratories) were added, and the reof the MET mRNAs in GTL-16 cells using the Spl transcript action was carried out a t 37 "C for 60 min. Tailing was stopped by inactivation a t 68 "C for 10 min andphenollchloroform extraction. The (8.2 kb; Ref. 34), the 28 S and the 18 S ribosomal RNA as the estimated size was 7.1 kb (Fig. 1) and matched cDNA was precipitated with ethanol and the pellet was resuspended markers; in 20 pl of water. For PCR amplification, the dG-tailed cDNA was boiled with the size calculatedfrom overlapping cDNA sequences (see for 3 min and diluted to 50pl containing as final concentration 10 m~ below). This determination agreeswith data reported by KuniTris-HCI, pH 9,50 m~ KCI, 1.5 m~ MgCI,, 200 m~ dNTPs, 0.1% Triton yasu et al. (35). X-100, 5% Me,SO, 2.5 units of Taq DNApolymerase (Promega), and 25 Two MET cDNAs derived from the 7.1-kb mRNA have been pmol each of MET and EcoRI-dC-tail-specific primers (424 and P65, respectively). The cDNA was amplified by 30 cycles of denaturation at described: one is representative of the major transcript (23), the 94 "C for 60 s, annealing at 60 "C for 30 s, and elongation a t 72 "C for other isderived from a minor alternatively spliced mRNA (36). 60 s. 1 p1 of amplified DNA was reamplifiedonce using P65- and MET- The difference consists of an alternativelyspliced exon encodspecific primer 475 closer to the 5'-end of the first exon. The PCR ing 18 amino acid residues in the central portion of the Met products were sequentiallyend-filled in, kinased, digested withEcoRI, protein (37).However, neither one of these cDNAs accounts for cloned in Bluescriptvector (Stratagene) and sequenced on both strands the complete 7.1-kb mRNA,since the 5'-untranslatedsequence by dideoxy sequencing. Screening of Genomic Libraries-2 x lo6 pfu of a AEMBL3 human is apparently incomplete. From the 194-bp sequence upstream to theAUG of the Met genomic library (31)were screened with32P-labeledMET cDNA probes corresponding either to the first 364 bpof the coding region (from base leader sequence published by Park et al. (361,we derived a m- + Iu - - The Human MET Promoter 12854 1 A G C A C G C G A G G C A G A C A G A C A C G T G C T G G G G C G G G C A ~ G C G A G C G C C T C A 91 A G C T 175 - .- 51 G T C T G G T C G C C T G G C G G T G C C T C C G G C C C C A A C G C G C C C G G G C C G C C G C G ~ 424 101 G G C C G C G C G C G C C G A T G C C C G G C T G A G T C A C T G G C A G G G C A G C G C G C G T G ~ 4 2 + 6 0 -I + 56 -I ++ 151 T G G G A A G G G G C G G A G G G A G T G C G G C C G G C G G G C G G G C G G G G C G C T G G G C T ~ V 201 C A G C C C G G C C G C A G T G A C C C G G A G G C C C T C G C C G C C C G C G G C G C C C C G A G ~ 4- 56 + 4 a -I 251 C G C T T T G T G A G C A G A T G C G G A G C C G A G T G G A G G G C G C G A G C C A G A T G C G G ~ AF56 301 G G C G A C A G C T G A C T T G C T G A G A G G A G G C G G G G A G G C G C G G A C G C G T G T G G ~ 4 P127 351 T C C T T G C G C C G C T G A C T T C T C C A C T G G T T C C T G G G C A C C G A A A G A T A A A C ~ 4 n28 401 C T C T C A T A A T G A A G G C C C C C G C T G T G C T T G C A C C T G G C A T C C T C G T G C T C ~ M K A P A V L A P G I L V L FIG.2. Sequence of the 5"noncoding region of the human MET cDMA. The 5'-untranslated sequenceof the human MET cDNA is 408 bp long. Arrows represent antisense oligonucleotides used for RNA and cDNA analysis. The arrowhead indicates the 5'-end of the published cDNA (36). 0.3met A+ TOT. FIG.3. Identification of the transcriptionstart site. Primer extension analysisof the 5'-end of the MET mRNAs. cDNA synthesis was camed out by priming 0.5pg of poly(AY(A') or 10 pg oftotal(TOT)RNA from GTL16 cells with labeledoligonucleotide 475 (seeFig. 2). The size of the primer extension products were determined by comparing themon a sequencing gel to the DNAsequenceof pGL2-0.3 met, primed with the same oligonucleotide. Numbers and arrows on the left indicate thedistance (in nucleotides)from the 5' of the primer 475 used both for the open arrowhead (corresponding sequence andthe primer extension. The to position +56) indicates the major transcription start site. Filled arrowheads indicate the 5'-ends of the RACE products (see text). number of oligonucleotide primers tobe used for primer extensplicing of coding exons.' sion analysis. Sincewe could not detect clear extension products Genomic Organization of MET 5'-Noncoding Region-To isoof this region, probably due to sequence complexity, we perlate the genomic clones corresponding to the MET 5"untransformed primer selected cDNA walking as an alternative stratlated and promoter sequences, we screened a AEMBL3 human egy. This procedure allows for selective amplification of cDNA genomic library with two cDNA probes: a fragment encompassclones by PCR, using a downstream primer complementary to ing 364 bp of the MET 5'-coding sequence (from base +409 to the known cDNA sequence and, as upstreamprimer, an oligo- +772) and a fragment carrying 323 bp of the actual5'-end of the nucleotide derived from a sequence flanking thevector cloning untranslated region (probe 1 and 2, respectively, in Fig. 4A 1. 2 site. We analyzed a h g t l l cDNA library preparedfrom GTL-16 x lo6 pfu were analyzed yielding seven and three independent poly(AY RNAprimed with randomoligonucleotides. Several 5'- positive clones with probe 1and 2, respectively. No unique DNA extended cDNAs were isolated, and theiroverlapping sequences fragments among the two clone types showed cross-hybridizaaccount for a cDNA fragment 408 bp long and GC-rich (Fig. 2). tion. This indicates that exon sequences are split apart by a When added to thepreviously reported cDNA sequence, the es- large intron. The complete genomic region encompassing the timated full-length cDNA was 7.1 kbp. Further amplification intron was cloned by further screening of the genomic library to the derived witha probe derived from unique sequences of clone hP21 cycles, using a downstream primer corresponding 5'-end ofMET cDNA(oligonuc1eotide475: bases +38to +56), did (probe 3, in Fig. 4A). not yield longer products(data not shown),thus indicating that Restriction mapping and DNA sequencing of genomic fragthe complete 5"untranslated region was cloned. ments hybridizing with cDNA probes revealed the presence of Identification of the MET Dunscription Start-To confirm two exons separated by a long intron (-24 kb). The intron is that the firstexon identified encodes the complete 5'-untrans- located 14 bp upstream the first MET codon and shows canonilated region of MET mRNA, we performed both primer exten- cal acceptor and donor consensus splicing sequences (Fig. 4B). sion and RACE analysis. Primer extensions, camed out on To exclude the possible presence of additional exons within the total andpoly(AY RNAfrom GTL-16 cells using theoligonucle- 24-kb intron, unique DNA restriction fragmentsscattered otide 475 as primer (see Fig. 21, yielded a 56-bases long cDNA along the intron were used as probes on Northern blots with (Fig. 3).The length of this fragment matched that obtained by mRNA from cell lines expressing all the known MET trancDNA walking. scripts. No transcripts were detected (data not shown). For RACE analysis we used primers complementary to seThe genomic sequence of the first 297 bp of the MET proquences which were progressively upstream to theGC-rich re- moter (Fig. 5) lacks TATAA and CCAATbox consensus elegion of the 5'-untranslated M E T mRNA (oligonucleotides 2, ments, a feature thatseveral housekeeping and constitutively 424, and 475 in Fig. 2). The sequences of two amplified cDNAs expressed genes have in common. Genes coding for other tyroare consistent with the primer extension result, although 12 sine kinase receptors such as UFO (38), RET (39), insulin reand 16 bpshorter (Fig. 3). Northern analysis was carried out to ceptor (40), and epidermalgrowthfactor receptor (41) lack check if the previously described multiple MET transcripts con- TATAA and CCAATbox promoter elements. Analysis of the tain sequences derived from the first exon. The probe derived sequence for transcription factor-binding sites with a computfrom the firstexon hybridized with all majorMET mRNA species (Fig. 11, suggesting thatall major MET mRNAs originate * S. Giordano, R. Sordella, G. Gambarotta, C. Santoro, and P.Comofrom the same transcription start site and differ by alternative glio, manuscript in preparation. The Human MET Promoter 12855 A 7A1 h 4A1 B exon 1 exon 2 ~ A A A A d TIITCXClTCATlT~(N)wCbG + ATAAACCTCTCATAATG FIG.4. Genomic organization of the 5'-flanking regionof the human MET gene. A , three representative overlapping genomic clones (h7A1, h4A1, and hP21) are shown. They span thecomplete 5'-flanking sequences of the human MET locus. Therestriction sites of the region are shown on the top. Exon 1and 2 areindicated by open boxes;the probes used to screen the human genomic library are indicated by filled boxes. The arrowhead indicates the first translated codon: H , HindIII; N , NcoI; P,PstI; S, SmaI; E,EcoRI. B , sequences at the MET exonl-intron-exon2 junctions are shown. Exonsequences are boxed and the firstcodon is indicated. The invariant nucleotides at both ends of the intron are underlined. -297CCCGGGGTGACACTCGCCTCCCAAGCGCCAGGAGGGGGAG-25s ____) cn AFl SPI - I ~ G C A G A ~ ~ G G A A A C G C G A C C C ~ ~ ~ ~ G G G $ C C-98A G ELcl SFl -9 C G G C G C G G A C G G C A G G A A ~ ~ ~ G G C C G A T T T C C C T-58C T "" -57 GGGTGGTGCCAGTCCCCACCTCAGCGGTCCTCGGAACCCG-18 -17 CGGACTAGGGGACGGACAGCACGCGAGGCAGACAGACACG+Z i-+ FIG.5. Sequences of the MET promoter. Nucleotides are numbered with the respect to the transcription start site at +1 (arrow). Sequence motifs for transcription factors are outlined. Two inverted repeats at -204 and -264 are underlined by arrows. erized data base (42) identified several regions that represent consensus binding motifs for transcription factors. In particular, consensus Spl-binding sites (43) arelocated at -76, -130, and -141 bp relative to the transcriptionstart. Other interesting elements to observe are thetwo AP2 sites at bases -109 and -186 (441, one GATA-1-binding site (45) at -244 and an Etsl consensus site (46) at -82. It has been reported thatAP2 may mediate TPA and CAMP transcriptional induction (47). The presence of target sites for erythroid-specific factors is also intriguing. Analysis of the MET Promoter-"0 assess the promoter activity of the cloned 5"flanking sequences of the MET locus, a 2.7-kbp DNA fragment, was inserted into the Sad-XhoI of sites the pGL2-Basic vector upstream the luciferase reporter gene (pGL2-2.7 met). This construct was transiently transfectedin the gastriccarcinoma cell lines GTL-16, MKN1, MKN28, and in the fibroblast cell line MRC-5. The luciferase activity wasanalyzed and the transcriptionefficiency expressed as percentage of that measured incells transfected with a construct carrying the SV40 promoter(pGL2-promoter). Thefragment encompassing the 300 bp upstream to the start site (pGL2-0.3 met) was sufficient to promote transcription with significant effiG C G ciency: the activities measured inGTL-16, MKN1, or MKN28 epithelial cells ranged between 55 and 65% of that observed with the SV40 promoter. The activity measured inMRC5 fibroblasts was low, around 7% (Fig. 6).The transcriptionactivity of the longer fragment encompassing 2.7 kb, varied in different cells, showing a mean of 57% in GTL-16, 40% in MKN1, and 37% in MKN28 cells. In MRC5 fibroblasts was again low, close to 8%. Induction of MET Promoter Sequences-We have recently shown that MET transcription can be induced by TPA (48). To check if the cis-acting elements which mediate the TPA response are present within the cloned MET promoter, we transfected the epithelialcell line MKNl with pGL2-met constructs and treatedor mock-treated with TPA for 12 h. Bothconstructs responded to TPA (Fig. 7). The induction was in the rangeof a 2-fold increase for both constructs, suggesting that theinducible elements arelocated within theproximal 300 bp of the MET promoter. The SV40-derived construct(pGL2-promoter)was used as a positive control (49). Similar results were obtained with the other cell lines (data not shown). DISCUSSION In this paper, we have characterized the genomic organization of the 5' region of the human MET gene, and we have The Human MET Promoter 100 GTL-16 - 70 60 - 30 - 20 10 -1 T 40 50 70 - basic 2.7 0.3 SV40 100 basic 2.7 0.3 SV40 basic 2.7 0.3 SV40 100 MKN-1 90 80 70 60 50 40 40 30 30 20 20 10 10 basic 2.7 0.3 SV40 FIG.6. Transcriptional activity of the MET promoter. The MET promoter constructs pGL2-0.3 met (0.3) or pGL2-2.7 met (2.7) were transiently transfected into the human GTL16, MKN1, MKN28, andMRC5 cells. Luciferase levels were determined 48 h later and normalized for protein concentration of the extracts. The promoter activity of MET constructs is shown as percentage of the luciferase activity obtained by transfecting the same celltypes with pGL2-promoter(SV40),an expression vector containing SV40-derived promoter sequences. The promoterless construct pGL2-basic (basic) was used as negative control. The values are calculated from at least four independent experiments carried outin duplicates, using two different plasmid preparations. identified the promoter sequences. The 5'-noncoding region of the MET mRNA is 408 bp long. This cDNA sequence, when added to the previously reported ones (23, 36), accounts for a 7.1-kb transcript. The calculated mRNA corresponds in size t o the major MET transcript detected by Northern analysis. We have mapped the major transcription start site and cloned the genomic sequences encompassing the entire 5"noncoding region. These contain a large intron (-24 kb) which splits noncoding and coding sequences. The finding that the sequence encoded by the first exon is present in the multiple MET mRNAs shows that all these transcripts originate from a single start site andare likely to be controlled by a common promoter. This promoter region is included within the first 300bp upstream the start site. This has beenshown by transient transfection assays, where the 300-bp short sequence was as effective as the long2.7-kb sequence in conferring efficient expression of the reporter gene. Analysis of this sequence indicates that the MET promoter lacks TATAA and CCAAT elements. The absence of consensus TATAA and CCAAT boxes is a common feature in promoters of several tyrosine kinase receptor genes, such as the insulin receptor (40), the epidermal growth factor receptor (411,RET (39), and UFO (38). Like these genes, the MET promoter is characterized by the presence of several GC boxes known to be the potential targets for the transcription factor Spl (43). Both the long and the short constructs showed some degree of epithelial tissue specificity since they were not significantly active in a fibroblast line not expressing the MET gene (10). These data indicate that the300 bp proximalto the transcription start site also contains the cis-acting elements responsible for the tissue-restricted expression of MET. In several other TATA-less promoters, it hasalready been shownthat relatively short fragmentsare capable to confer tissue-dependent expression and that their activity relies on the presence of Spl-binding sites (50,51). The MET promoter contains several Spl sites and these are efficiently bound by the specific factor in vitro (data not shown). The 300-bp MET promoter contains additional putative binding sites for truns-ucting regulatory proteins such as two sites for AP2, a factor known to mediate the induction by TPA and CAMP(47).AP2 sites are found in other tyrosine kinase receptor promoters lacking canonical TPA-responsiveelements (38a site for PEA3.This 41,52). At position -82 there is consensus motif is also knownto be a growth factor- and aTPA-responsive element (53-55). Consistently with these structural features, the isolated MET promoter responds to TPA induction in vitro. This finding agrees with data obtained in vivo, where TPA stimulates the expression of the endogenous MET (48). These data indicate that MET is an inducible gene and that its enhanced expression involves transcriptional activation. The Human MET Promoter 10. Di Renzo, M. F., Narsimhan, R. P., Olivero, M.,Bretti, S., Giordano, S . , Medico, E., Gaglia, P., Zara, P., and Comoglio, P. M. (1991) Oncogene 6, 1997-2003 11. Bottaro, D. P., Rubin, J. S., Faletto, D. L., Chan, A. M.-L., Kmiecick, T. E., MKN-1 -+ basic -+ - + 2.7 0.3 -+ SV40 FIG.7. "PA-induction of the humanMET promoter. MKNl cells were transfected with MET promoter and control constructs (symbols as in legend to Fig. 6) and mock-treated (open bars) or TPA-treated (filled bars) for 12 h. The pGL2-promoter construct was used as a positive control(49). Luciferase activity is referred as percentage of that obtained with pGL2-promoter in non-induced cells. Overexpression of the MET oncogene is found in tumors of epithelial origin with high frequency (10, 19, 56); often this overexpression does not correlate with geneamplification suggesting the occurrence of alterations at transcriptional level (20, 21). This feature distinguishes MET from other tyrosine kinase receptor genes, such as ERBB2, ERBBl, BEK, and FLG, whose overexpression is associated with gene amplification (18). However, for ERBB2, it has been recently shownthat mammary tumor cells carrying a single copy gene overexpress the protein asconsequence of a transcriptional alteration (57). The availability of the cloned promoter will allow detailed analysis of the transcriptional regulation of the MET gene and of the possible alterations occurring in overexpressing tumors. Acknowledgments-We are grateful to Licio Collavin and other members of Claudio Schneider's laboratory for suggestions on cDNAsynthesis and primer extension analysis. We thank Gianni Del Sal for helpful suggestions, Claudio Schneider, Iain Mattaj, and Dirk Bohmann for critical reading of the manuscript. Elaine Wright and Antonella Cignetto are gratefully acknowledged for the excellent secretarial help. REFERENCES 1. Lu, S.-H., Hsieh, L.-L., Luo. F.-C., and Weinstein, I. B. (1988)Znt.J. Cancer 4, 502-505 2. Weidner, K. M., Behrens, J.,Vanderkerckhone,J.,and Birchmeier, W. (1990)J. Cell. Biol. 111,2907-2911 3. Libermann, T. A,, Nusbaum, H. R., Razon, N., Kris, R., Lax, J., Soreq, H., Whittle, N., Waterfield, M. D., Ullrich, A,, and Schlessinger, J. (1985) J. Cell. Sci. 3 (suppl.), 161-172 4. Yamamoto, T.,kawa, S., Akiyama, T., Semba, K., Nomura, N., Miyajima, N., Saito, T., and Toyoshima, K. (1986) Nature 319, 230-234 5. Slamon, D. J.,Clark, G. M., Wong, S. G . ,Levin, W. J.,Ullrich, A., and McGuire, W. L. (1987) Science 236, 177-182 6 . Slamon, D. J.,Godolphin,W., Jones, L. A,,Holt, J. A., Wong, S . G.,Keith, D. E., Levin, W. J., Stuart, S . G., Udove, J., Ullrich, A,, and Press, M.F. (1989) Science 244,707-712 7. Cohen, J. A., Weiner, D. B, More, K. F., Kokai, Y., Williams, W. Y., Maguire, H. C., LiVolsi, V.A., and Greene, M. I. (1989) Oncogene 4 , 8 1 4 8 8. Adnane, J., Gaudray, P., Dionne, C. A,, Crumley, G., Jaye, M., Schlessinger, J., Jeanteur, I?, Birnbaum, D., and Theillet, C. (1991) Oncogene 6,659-663 9. Giordano, S., Ponzetto, C., Di Renzo, M. F.,Cooper, C. S., and Comoglio, P.M. (1989) Nature 339, 155-156 View publication stats 12857 Vande Woude, G. P., and Aaronson, S . A. (1991) Science 261,802404 12. Naldini, L., Vigna, E., Narsimhan, R. P., Gaudino, G . , Zarnegar, R., Michalopoulos, G., and Comoglio, P. M. (1991) Oncogene 6,501404 13. Naldini, L., Weidner,M.,Vigna, E., Gaudino, G., Bardelli, A. Ponzetto, C., Narsimhan, R. P., Hartmann, G., Zarnegar, R., Michalopoulos, G., Birchmeier, W., and Comoglio, P. M. (1991) EMBO J. 10, 2867-2878 14. Giordano, S., Zhen, Z., Medico, E., Gaudino, G . , Galimi, F., and Comoglio, P. M. (1993) Proc. Natl. Acad. Sci. U. S. A. 90, 649-653 15. Weidner, K. M., Sachs, M., and Birchmeier, W. (1993) J. Cell. Biol. 121, 145154 16. King, C . R., Kraus. M. H., and Aaranson, S. A. (1985)Science 229, 974-976 17. King, C.R., Swain, S . M., Porter, L., Steinberg, S . M., Lippman, M. E., and Gelmann, E. P. (1989) Cancer Res 49,4185-4191 18. Kury,F. D., Schneeberger, C., Sliutz, G., Kubista, E., Salzer, N., Medl, M., Leodolter, S., Swoboda, H., Zeillinger, R., and Spona, J. (1990) Oncogene 6, 1403- 1408 19. Prat, M. P., Narsimhan, R. P., Crepaldi, T., Nicotra, M. R., Natali, P. G., and Comoglio, P.M. (1991)Int. J. Cancer 49,323-328 20. Liu, C., Park, M., and Tsao, M.-S. (1992) Oncogene 7, 181-185 21. Di Renzo, M. F., Olivero, M., Ferro, S . , Prat, M. P., Bongarzone, I., Pilatti, S., Pierotti, M., and Comoglio, P.M. (1992) Oncogene 7,2549-2553 22. Natali, P. G . , Nicotra, M. R., Di Renzo, M. F., Prat, M., Bigotti, A., Cavaliere, R., and Comoglio, P.M. (1993) Br J. Can. 68, 746-750 23. Ponzetto, C., Giordano, S . , Peverali, F., Della Valle, G., Abate, M., Vaula, G., and Comoglio, P.M. (1991) Oncogene 6,553-559 24. Rege-Cambrin, G., Scaravaglio, P., Carozzi, F., Giordano, S . , Ponzetto, C., Comoglio, P. M., and Saglio, G . (1992) Cancer Genet. Cytogenet.64,170-173 25. Kuniyasu, H., Yasui, W., Kitadai, Y., Yokozaki,H., Ito, H., and Tahara, E. (1992) Biochem. Biophys. Res. Commun. 189,227-232 26. Motoyama, T., Hojo, H., and Watanabe, H. (1986)ActaPathol. Jpn. 36.6-3 27. Knowles, B., Howe, C. C., and Arden, D.P. (1980) Science 290,497-499 28. Jacobs, J. (1970) Nature 227, 168-170 29. Don, R. H., Cox, P. T., Wainwright, B. J., Baker, K., and Mattick, J. S.(1991) Nucleic Acids Res. 19, 4008-4017 30. Sambrook, J., Fritsch, E.F., and Maniatis, T. (1989) Molecular Cloning: a Laboratory Manual 2"d ed., Cold Spring Harbor Press, Cold Spring Harbor, NY 31. Santoro, C., Marone, M., Ferrone, M., Costanzo, F., Colombo, M.,Minganti, C., Cortese, R., and Silengo, L. (1986)Nucleic Acids. Res. 14, 2863-2876 32. Ausubel, F. M., Brent, R., Kingston, R. E., Moore, D. D.,Seidman, J. G., Smith, J. A., and Struhl, K.(1987) Current Protocols in Molecular Biology, John Wiley and Sons, New York 33. Park, M., Dean, M., Cooper, C. S . , Schmidt, M., OBrien, S. J.,Blair, D. G . , and Vande Woude, G . F. (1986) Cell 46,896904 34. Kadonaga, J., Carner, K., Masiarz, F., and Tjian, R. (1987) Cell 51, 1079-1090 35. Kuniyasu, H., Yasui, W., Yokosaki,H., Kitadai, Y., and Tahara, E.(1993)Int. J. Cancer 55.72-75 36. Park, M., Dean, M., Kaul, K., Braun, M. J., Gonda, M. A,, and Vande Woude, G. (1987) Proc. Natl. Acad. Sci. U. S. A. 84,63794383 37. Rodriguez, G. A,, Naujokas, M. A,, and Park, M. (1991) Mol. Cell. Biol. 11, 2962-2970 38. Schulz, A. S., Schleithoff, L., Faust, M., Bartram, C. R., and Janssen, J. W. G . (1993) Oncogene 8,509-513 39. Itoh, F., Ishizaka, Y., Tahira, T., Yamomoto, M., Miya, A,, Imai, K., Yachi, A., Takai, S., Sugimura, T., and Nagao, M. (1992) Oncogene 7,1201-1206 and Ebina, Y. (1987) J. Biol. 40. Araki, E., Shimada, F.,Uzawa,H.,Mori,M., Chem. 262, 16186-16191 41. Ishii, S . . Xu, Y.-H., Stratton, R. H., Roe, B. A,, Merlino, G. T., and Pastan, I. (1985) Proc. Natl. Acad. Sci. U. S. A. 82, 49204924 42. Faisst, S . , and Meyer, S. (1992) Nucleic Acids Res. 20, 3-26 43. Kadonaga, J., and TJian, R. (1986) Prcc. Natl. Acad. Sci. U. S. A. 89, 58895893 44. Mitchell, P. J., Wang, C., and Tjian, R. (1987) Cell 60, 847-861 45. %ai, S.-F., Martin, D. I., Zon, L. I., DAndrea, A. D., Wong, G . G., and Orkin, S . K. (1989)Nature 339,44-51 46. Martin, M. E., Piette, J., Yaniv, M., Tang, W.J., and Folk, W. R. (1988)Proc. Natl. Acad. Sci. U. S . A. 86,5839-5843 47. Imagawa, M., Chiu, R., and Karin, M. (1987) Cell 51,251-260 48. Boccaccio, C., Gaudino, G., Gambarotta, G., Galimi, F., and Comoglio, P. M. (1994) J. B i d . Chem. 12846-12851 49. Angel, I?, Imagawa, M., Chiu, R., Stein, B., Imhra, R. J., Rahmsdorf, H. J., Jonat, C., Herrlich, P., and Karin, M. (1987) Cell 49, 729-739 50. Faber, P. W., van Rooij,H., Schipper, H., Brinkmann, A,, and Trapman, J. (1993) J. Biol. Chem. 268, 92969301 51. Innis, J. W., Moore, D., Kash, S., Ramamurthy, V., Sawagodo, M., and Kellems, R. (1991) J. Biol. Chem. 266,21765-21772 52. Hudson, L. G., Ertl, A. P., and Gill, G . N. (1990)J. Biol. Chem. 265,4389-4393 53. Xin, J.-H., Cowie, A., Lachance, P., and Hassell, J. A. (1992) Genes & Deu. 6, 481-496 54. Gutman, A,, and Wasylyk, B. (1990) Zhm!.s Genet. 7 , 4 9 4 4 55. Wasylyk,C., Flores, P., Gutman, A., and Wasylyk, B. (1989) EMBO J. 8, 3371-3378 56. Kuniyasu, H.,Yasui, W., Kitada,Y., Yokozaki, H.,Ito, H., and Tahara, E. (1992) Biochem. Biophys. Res. Commun. 189,227-232 57. Hollywood, D. P., and Hurst, H. C. (1993) EMBO J. 6, 2369-2375