The Roles of Psyllids, Host Plants and Environment in the Aetiology of Huanglongbing in Bhutan Namgay Om Thesis submitted in fulfilment of the requirement for the degree of Doctor of Philosophy School of Science and Health Western Sydney University January 2017 Aknowledgements I am grateful to His Majesty the King of Bhutan for his kindness and generosity, and for allowing me to undertake my studies. I am sincerely grateful to the Australian Centre for International Agricultural Research (ACIAR) for providing the John Allwright Fellowship allowing me to pursue my PhD, and to the School of Science and Health, Western Sydney University, and the Elizabeth Macarthur Agricultural Institute (EMAI), NSW Department of Primary Industries, Menangle, for use of research facilities. I would like to thank my supervisors Professors George Andrew Charles Beattie and Paul Holford, and Dr Nerida J Donovan, for their selfless support, guidance, and patience throughout my candidature. I am particularly grateful to Andrew for his advice in developing my research and his assistance during sample collections. His immense knowledge, enthusiasm, and continuous support made my PhD studies far more manageable than I imagined. I also appreciate his endurance for travelling on the precipitous long and winding roads of Bhutan during field work. I thank Paul for his tremendous support, and prompt responses. Paul was most helpful in keeping me on track. His help and support in the laboratory and result analyses, and constructive comments are very much appreciated. I would like to thank Nerida for her guidance and support in conducting the real-time PCR, and for financial support that made commuting between the Western Sydney University Hawkesbury Campus and EMAI less stressful. The list of what I owe to my supervisors does not end here. It is because of them that I enjoyed the entire period of my PhD studies. I could not have imagined having any other mentors for my PhD studies. My field work in Bhutan required a lot of manpower during establishment of experiments, and for sampling and data collection. I could not have accomplished all this without the efforts and support rendered by my colleagues at the National Plant Protection Centre (NPPC), Department of Agriculture, Ministry of Agriculture and Forests of Bhutan. I would like to extend my great appreciation and thanks to:         Dr Thinlay Kinley Wangmo Tshomo Sangay Chophel Karma Lham Phuntsho Loday Tenzin Dorji Ata Ugyen I thank all of them for their assistance during field work and for enduring the steep walks along Droopchhugang-Phuensoomgang. Kinley, Tshomo, Karma and Sangay were also involved in laboratory DNA extractions and care of plants in greenhouses at the NPPC at Semtokha, Thimphu. I would also like to thank the collaborative farmers in Tsirang for allowing me to use their orchards for my field experiments. I would also like to express my gratitude to Anna Englezou and Grant Chambers for the lessons on handling the real-time PCR instruments, sharing their skills, and their countless assistance during my days at EMAI. My appreciation and thanks also go to Pat Barkley for providing references on psyllids and huanglongbing, and useful suggestions and comments. I would also like to acknowledge the support of Sandra Hardy, former project leader for the ACIAR-Bhutan project. I would also like to thank all the ACIAR-Bhutan project team members for their administrative support: ‘Citrus’ Dorjee, Lakey and Phuntsho, and Graeme Sanderson. Special thanks are due to Dr Susan Halbert (Division of Plant Industry, Florida Department of Agriculture and Consumer Services, USA), and Dr Luo Xinyu, Department of Entomology, China Agricultural University, China) for taking time to examine and identify psyllid specimens, and Dr Zoya Yefremova (Department of Zoology, The Steinhardt Museum of Natural History) and Dr Ekaterina Yegorenkova (Department of Geography and Ecology, Ulyanovsk State Pedagogical University) for identifying and describing the previously undescribed eulophid ectoparasitoid I recorded from Diaphorina communis. I am thankful to Dr Cen Yijing, South China Agricultural University, Guangzhou, Guangdong, China for providing samples of Cacopsylla citrisuga adults and Murraya DNA for use in my studies. I also owe my gratitude to Tshering Penjor (TP), Research and Development Centre, Wengkhar, Mongar for providing the samples of the wild citrus accessions. I would like to thank Paul Milham for providing information and support in soil nutrient analysis and interpretation of the soil test results. I thank Dr Jennifer Morrow, Hawkesbury Institute for the Environment (HIE) for her quick responses to my queries and help with molecular techniques and to Dr Markus Riegler (HIE) for his useful suggestions in interpreting molecular results. I also thank Dr Duong Thi Nguyen for sharing her knowledge and techniques in handling molecular analyses that saved huge amount of time. Last but not the least, I thank my family for their all-time support. My children, Demi Yoezer and Tenzee Kelzang Gyeltshen, for coping so well. My field work required me to travel to Bhutan every year for at least five months for the first three years. The emotional support, flexibility and the adaptation skills of my children added to the success of living in two countries in a year during those field work years. My mother and my husband for their all-time love and support. Statement of Authentication The work presented in this thesis is, to the best of my knowledge and belief, original except as acknowledged in the text. I hereby declare that I have not submitted this material, either in full or in part, for a degree at this or any other institution. Namgay Om January 2017 Table of Contents List of Tables ............................................................................................................ vii List of Figures ............................................................................................................. x Abstract…………………………………………………………………………….xiv Chapter 1: Introduction and literature review ........................................................... 1 1.1 Background ......................................................................................................... 1 1.2 Literature review................................................................................................. 5 1.2.1 The disease: Huanglongbing (HLB) ............................................................ 5 1.2.2 Causal agent of the Asiatic HLB ................................................................. 8 1.2.3 Impacts of huanglongbing ........................................................................... 9 1.2.4 Huanglongbing symptoms ......................................................................... 13 1.2.5 Field and laboratory confirmation of HLB infections ............................... 16 1.2.5.1 Biological indexing ............................................................................ 16 1.2.5.2 Hosts susceptible to ‘CLas’ ................................................................ 18 1.2.5.3 Light and electron microscopy ........................................................... 22 1.2.5.4 Iodine starch test and plant metabolites.............................................. 23 1.2.5.5 Serology and molecular techniques .................................................... 24 1.2.6 Psyllid fauna of Asia.................................................................................. 26 1.2.6.1 Diaphorina citri .................................................................................. 26 1.2.6.2 Other psylloids known to feed on Rutaceae ....................................... 32 1.2.7 Molecular markers used in the phylogenetic studies of plants .................. 37 1.2.8 Genes and molecular markers used in insect phylogeny ........................... 38 1.2.9 Natural enemies and biological control ..................................................... 39 1.2.10 Impacts of heat therapies on Citrus liberibacters ...................................... 43 1.2.11 Impacts of altitude, ambient temperatures and relative humidity on ‘CLas’ and its vector.............................................................................................. 44 1.3 Aims and objectives.......................................................................................... 45 Chapter 2: Phylogenetic analysis of Diaphorina communis Mathur and Diaphorina citri Kuwayama .......................................................................................................... 47 2.1 Introduction ...................................................................................................... 47 2.2 Material and methods ....................................................................................... 48 2.2.1 Specimen collection and DNA extraction ................................................. 48 2.2.2 Amplification of Diaphorina communis DNA for phylogenetic analyses…………………………………………………………………..48 2.2.3 Post PCR and sequencing .......................................................................... 51 i 2.2.4 Sequence assembly .................................................................................... 52 2.2.5 Phylogenetic relationships of Diaphorina communis ................................ 52 2.3 Results…. ......................................................................................................... 54 2.3.1 Phylogenetic analysis of Diaphorina communis ....................................... 54 2.4 Discussion ......................................................................................................... 54 Chapter 3: Transmission of ‘Candidatus Liberibacter asiaticus’ (α-Proteobacteria) by Diaphorina communis Mathur (Hemiptera: Sternorrhyncha: Liviidae) ............... 57 3.1 Introduction ...................................................................................................... 57 3.2 Materials and Methods ..................................................................................... 60 3.2.1 Field site .................................................................................................... 60 3.2.2 Preparation of test plants: mandarin and curry leaf seedlings ................... 60 3.2.2.1 Mandarin seedlings ............................................................................. 60 3.2.2.2 Curry leaf seedlings ............................................................................ 61 3.2.3 Extraction of DNA of ‘CLas’ from plants ................................................. 62 3.2.4 DNA extractions from psyllids for ‘CLas’ detection ................................ 63 3.2.5 Detection of ‘CLas’ by conventional and real-time PCR .......................... 63 3.3 Preliminary Studies in 2013 ............................................................................. 65 3.3.1 Experiment 1 (2013) .................................................................................. 65 3.3.2 Experiment 2 (2013) .................................................................................. 66 3.3.3 Experiment 3 (2013) .................................................................................. 68 3.3.4 Experiment 4 (2013). ................................................................................. 69 3.3.5 Experiment 5 (2013) .................................................................................. 71 3.4 Studies in 2014 ................................................................................................. 71 3.4.1 Experiment 1 (2014) .................................................................................. 72 3.4.2 Experiment 2 (2014) .................................................................................. 83 3.4.3 Experiment 3 (2014) .................................................................................. 86 3.5 Studies in 2015 ................................................................................................. 87 3.5.1 Experiment 1 (2015) .................................................................................. 88 3.5.2 Experiment 2 (2015) ................................................................................ 100 3.6 Discussion ....................................................................................................... 104 3.6.1 Preliminary studies in 2013 ..................................................................... 104 3.6.2 Studies in 2014 and 2015......................................................................... 105 3.7 Highlights of the study ................................................................................... 108 Chapter 4: Comparison of parasitoids of Diaphorina citri Kuwayama and Diaphorina communis Mathur (Hemiptera: Sternorrhyncha: Liviidae) .................. 109 4.1 Introduction .................................................................................................... 109 ii 4.2 Materials and methods .................................................................................... 111 4.2.1 Collection of parasitoids .......................................................................... 111 4.2.2 Molecular and phylogenetic analyses ...................................................... 111 4.2.2.1 Parasitoid DNA extraction ............................................................... 111 4.2.2.2 Amplification of DNA and sequencing ............................................ 112 4.2.2.3 Sequence analyses ............................................................................ 112 4.2.2.4 Phylogenetic relationships ................................................................ 115 4.2.3 Morphology ............................................................................................. 117 4.3 Results……. ................................................................................................... 118 4.3.1 Field observation of parasitism................................................................ 118 4.3.2 Molecular and phylogenetic analyses ...................................................... 118 4.3.2.1 COI region ........................................................................................ 118 4.3.2.2 ITS1 region ....................................................................................... 123 4.3.2.3 ITS2 region ....................................................................................... 125 4.3.3 Morphological description....................................................................... 127 4.4 Discussion ....................................................................................................... 131 4.5 Highlights of the study ................................................................................... 133 Chapter 5: Incidence of psyllids and ‘Candidatus Liberibacter asiaticus’ in mandarin orchards at different elevations in Tsirang ............................................... 134 5.1 Introduction .................................................................................................... 134 5.2 Materials and methods .................................................................................... 137 5.2.1 Site description and experimental plots ................................................... 137 5.2.2 Plant growth assessment .......................................................................... 141 5.2.3 Soil sample analysis................................................................................. 141 5.2.4 Leaf temperature measurements .............................................................. 142 5.2.5 Incidence of psyllid infestations .............................................................. 142 5.2.6 Recording of weather data ....................................................................... 143 5.2.7 Prevalence of ‘CLas’ in plant samples at different altitudes ................... 144 5.2.7.1 Sample collection from mature trees ................................................ 144 5.2.7.2 Sample collection from young plants in the plots ............................ 145 5.2.7.3 DNA extraction and amplification ................................................... 145 5.3 Results……………………………………………………………………….146 5.3.1 Plant growth assessment and soil analysis .............................................. 146 5.3.2 Ambient temperatures, relative humidity and leaf temperatures ............. 146 5.3.3 Rainfall .................................................................................................... 147 5.3.4 Psyllid incidence ...................................................................................... 154 iii 5.3.5 Incidence of ‘CLas’ ................................................................................. 156 5.3.5.1 Samples from mature trees ............................................................... 156 5.3.5.2 ‘CLas’ detection in samples from young mandarin trees along Droopchhugang-Phuensoomgang .............................................................. 161 5.4 Discussion ....................................................................................................... 164 5.4.1 Growth of mandarin seedlings................................................................. 164 5.4.2 Relationships between ambient temperatures, relative humidity, rainfall, elevation, and incidence of psyllids......................................................... 164 5.4.3 Prevalence of ‘CLas’ at different elevations ........................................... 169 5.5 Conclusions .................................................................................................... 172 5.6 Highlights of the study ................................................................................... 175 Chapter 6: Preliminary investigation into the role of Cacopsylla heterogena Li in huanglongbing .......................................................................................................... 176 6.1 Introduction .................................................................................................... 176 6.2 Materials and methods .................................................................................... 179 6.2.1 Psyllid samples for phylogenetic analyses and morphological identification. ........................................................................................... 179 6.2.2 Psyllid DNA extraction for phylogenetic studies .................................... 179 6.2.3 Psyllid DNA amplifications and sequencing ........................................... 187 6.2.4 Phylogenetic relationships of green psyllids on citrus and Zanthoxylum sp………………………………………………………………………..187 6.2.5 Detection of ‘CLas’ in green psyllids and their host plants .................... 188 6.2.5.1 Development of primers for the wingless gene of the green psyllids……………………………………………………………………188 6.2.5.2 Collection of psyllid and plant samples for detection of ‘CLas’ and detection procedures .................................................................................. 189 6.3 Results………………………………………………………………………. 192 6.3.1 Morphological descriptions of green psyllids on citrus........................... 192 6.3.2 Psyllids on Zanthoxylum sp. .................................................................... 192 6.3.3 Phylogenetic analyses .............................................................................. 195 6.3.3.1 Psyllid sequence analysis ................................................................. 195 6.3.3.2 Phylogenetic relationships of psyllids derived from the mitochondrial COI gene………………………………………………………………….200 6.3.3.3 Phylogenetic relationships of psyllids derived from the 16S gene... 200 6.3.3.4 Psyllids phylogeny based on the ITS region .................................... 201 6.3.4 Detection of ‘CLas’ in green psyllids and host plants ............................. 205 6.3.4.1 Primer development.......................................................................... 205 6.3.4.2 Detection of ‘CLas’ in Cacopsylla heterogena and host plants ....... 205 iv 6.2.1.1 Detection of ‘CLas’ in Zanthoxylum sp. and its psyllids.................. 206 6.4 Discussion ....................................................................................................... 210 6.4.1 Phylogeny of psyllids .............................................................................. 210 6.4.2 Detection of ‘CLas’ in Cacopsylla heterogena and host plants .............. 214 6.4.3 Detection of ‘CLas’ in Zanthoxylum sp., Cacopsylla sp. and Cornopsylla rotundiconis ............................................................................................. 215 6.5 Highlights of the study ................................................................................... 216 Chapter 7: Molecular and morphological characterisation of Murraya species and wild citrus taxa from Bhutan and their relevance to huanglongbing ....................... 217 7.1 Introduction .................................................................................................... 217 7.2 Materials and methods .................................................................................... 224 7.2.1 Collection of Murraya accessions ........................................................... 224 7.2.1 Collection of the wild citrus .................................................................... 224 7.2.2 DNA extractions from Murraya .............................................................. 224 7.2.3 DNA extraction from the wild citrus ....................................................... 226 7.2.4 Plant genomic DNA amplification .......................................................... 226 7.2.4.1 ITS region ......................................................................................... 228 7.2.4.2 matK-5’trnK spacer .......................................................................... 228 7.2.4.3 psbM-trnDGUC spacer ........................................................................ 228 7.2.4.4 rpS4-trnT spacer ............................................................................... 228 7.2.4.5 trnCGCA-ycf6 region .......................................................................... 229 7.2.4.6 trnL-trnL-trnF region ....................................................................... 229 7.2.5 ‘CLas’ detection, gel electrophoresis and sequencing............................. 230 7.2.6 Phylogenetic nomenclature for Murraya................................................. 230 7.2.7 Phylogenetic relationships of Murraya spp. ............................................ 231 7.2.8 Morphology of Murraya.......................................................................... 241 7.2.9 Phylogenetic relationships of wild citrus................................................. 242 7.3 Results……………………………………………………………………….243 7.3.1 Sequence analysis of the Murraya accessions ......................................... 243 7.3.2 Phylogenetic relationships of Murraya ................................................... 243 7.3.2.1 trnL-trnL-trnF region ....................................................................... 243 7.3.2.2 matK-5' trnK region .......................................................................... 247 7.3.2.3 rpS4-trnT region ............................................................................... 247 7.3.2.4 ITS region ......................................................................................... 247 7.3.2.5 Phylogenetic relationships of Murraya inferred from combination of five cpDNA and ITS region ....................................................................... 251 v 7.3.3 Morphology of Murraya accessions from Bhutan .................................. 254 7.3.4 Morphological description of wild citrus accessions .............................. 264 7.3.5 Sequence analysis of wild citrus.............................................................. 264 7.3.6 Phylogenetic relationships of wild citrus based on four cpDNA regions…………………………………………………………………..269 7.3.7 Phylogenetic relationships of wild citrus based on the nuclear ITS regions…………………………………………………………………..272 7.3.8 Detection of ‘CLas’ in Murraya and wild citrus ..................................... 274 7.4 Discussion ....................................................................................................... 276 7.4.1 Phylogenetic relationships and morphology of Murraya from Bhutan... 276 7.4.2 Phylogenetic relationships of wild citrus from Bhutan ........................... 281 7.4.3 Detection of ‘CLas’ in Murraya and wild citrus ..................................... 285 7.5 Highlights of the study ................................................................................... 286 Chapter 8: General Discussion .............................................................................. 287 8.1 Key findings and their significance ................................................................ 288 8.1.1 Phylogenetic relationships of Diaphorina communis and Diaphorina citri…………………………………………………............................... 288 8.1.2 ‘Candidatus Liberibacter asiaticus’ and Diaphorina communis ............. 288 8.1.3 Comparison of parasitoids of Diaphorina citri and Diaphorina communis………………………………………………………………. 289 8.1.4 Incidence of psyllids and ‘CLas’ at different elevations ......................... 289 8.1.5 Cacopsylla heterogena and ‘CLas’ ......................................................... 292 8.1.6 Murraya species and ‘CLas’.................................................................... 294 8.1.7 Identity of wild citrus and testing of accessions for ‘CLas’ .................... 296 8.2 Future research ............................................................................................... 296 8.2.1 Diaphorina communis and ‘CLas’ .......................................................... 296 8.2.2 ‘Candidatus Liberibacter asiaticus’ and Ct values .................................. 297 8.2.3 Incidence of ‘CLas’ and Diaphorina citri at higher elevations ............... 299 8.2.4 Phylogeny of Cacopsylla heterogena ...................................................... 300 8.2.5 Cacopsylla heterogena and ‘CLas’ ......................................................... 300 8.2.6 Morphology of Murraya species: ............................................................ 301 8.2.7 Wild citrus ............................................................................................... 301 8.3 Implications for citriculture in Bhutan ........................................................... 304 References ............................................................................................................ 306 vi List of Tables Table 2.1. GenBank accessions used for phylogenetic analyses of Diaphorina communis and Diaphorina citri ................................................................................. 53 Table 3.1. ‘Candidatus Liberibacter asiaticus’-titres in Diaphorina communis adults caged for 54 d on branches of ‘CLas’-infected mature mandarin trees ..................... 68 Table 3.2. Numbers of live Diaphorina communis adults, eggs, and nymphs on NSC mandarin the experiment cages during the acquisition and transmission experiment in 2014………………………………………………………………………………….76 Table 3.3. Numbers of live Diaphorina communis adults, eggs, and nymphs on 2014-curry leaf seedlings in the cages during acquisition and transmission study…………………………………………………………………………………77 Table 3.4. ‘Candidatus Liberibacter asiaticus’ titres of stumps of mature mandarin trees (inoculum source) and NSC mandarin seedlings used in the acquisition and transmission study by Diaphorina communis adults in 2014 (Experiment 1)…. ...... 80 Table 3.5. ‘Candidatus Liberibacter asiaticus’ titres of stumps of mature mandarin trees (inoculum source) and 2014-curry leaf seedlings used in the acquisition and transmission study by Diaphorina communis adults in 2014 (Experiment 1)... ........ 81 Table 3.6. Real-time PCR detection of ‘CLas’ in pooled samples of Diaphorina communis adults representative of the population released in the cages ................... 82 Table 3.7. Real-time PCR results of the experiment to determine transmission of 'CLas' by Diaphorina communis adults from curry leaf to mandarin seedlings at Baychhu in 2014 ........................................................................................................ 85 Table 3.8. NSC mandarin and 2015-curry leaf seedling allocations in the BugDorm cages used in 2015 for transmission of 'CLas' from infected mandarin stumps by Diaphorina communis. ............................................................................................... 89 Table 3.9. Ct values of samples of Baychhu mature mandarin tree stumps before and after ATI of Experiment 1 (2015) ....................................................................... 91 Table 3.10. ‘Candidatus Liberibacter asiaticus’ titres in pooled samples of Diaphorina communis adults and nymphs representing the samples released in the cages on the first three occasions ............................................................................... 93 Table 3.11. ‘Candidatus Liberibacter asiaticus’ titres in Diaphorina communis adults collected at the end of ATI for Experiment 1 (2015) ...................................... 94 Table 3.12. 'CLas' titres in samples of 2015-curry leaf seedlings collected before and after the ATI of Experiment 1 (2015) ................................................................. 96 Table 3.13. ‘CLas’ titres in NSC mandarin seedlings before and after the ATI of the Experiment 1 (2015) .................................................................................................. 98 Table 3.14. Number of eggs, nymphs and adults of Diaphorina communis present on 2015-curry leaf seedlings .................................................................................... 102 Table 3.15. ‘CLas’ titres in Diaphorina communis adults, and the NSC mandarin and 2015B-curry leaf seedlings during the experiment to determine transmission of ‘CLas’ by Diaphorina communis adults from 2015-curry leaf seedlings………….103 vii Table 4.1. GenBank sequences used in molecular analyses of sequence data obtained from different populations of parasitoids of Diaphorina communis and Diaphorina citri collected in Bhutan ....................................................................... 114 Table 4.2. Specimens of parasitoids used for molecular analysis and the GenBank accession numbers of the three genetic regions analysed ........................................ 116 Table 4.3. Sequence polymorphisms within and between populations of parasitoids of Diaphorina citri and Diaphorina communis…………………………………… 121 Table 4.4. Comparative characters of females of Tamarixia drukyulensis sp. n. with females of Tamarixia radiata……………………………………………………... 130 Table 4.5. Comparative characters of males of Tamarixia drukyulensis sp. n. with males of Tamarixia radiata…………………………………………………..........130 Table 5.1. Locations of experimental sites along Droopchhugang-Phuensoomgang in Tsirang…..………………………………………………………………………139 Table 5.2. Average numbers of leaves per terminal shoot of mandarin seedlings planted at different elevations .................................................................................. 147 Table 5.3. Average monthly rainfall (mm) in June, July, August and September 2014–2015 at elevations ranging from 1500 m to 800 m ASL along DroopchugangPhuensoomgang in Tsirang. ..................................................................................... 153 Table 5.4. Average annual rainfall, minimum and maximum ambient temperatures, and minimum and maximum relative humidity in 2014 at elevations ranging from 800–1500 m ASL along Droopchugang-Phuensoomgang in Tsirang……………..153 Table 5.5. Incidence of Diaphorina citri, Diaphorina communis and Cacopsylla heterogena nymphs and adults on mandarin at different altitudes along Droopchhugang-Phuensoomgang, Tsirang. ............................................................. 155 Table 5.6. FAM Ct values (‘CLas’) for bark samples from 10 mature mandarin trees at each elevation along Droopchhugang-Phuensoomgang ...................................... 158 Table 5.7. qPCR FAM Ct values (‘CLas’) for roots of from 10 mature mandarin trees at each elevation along Droopchhugang-Phuensoomgang May 2015 and March 2016………………………………………………………………………………...159 Table 5.8. qPCR ‘CLas’ FAM Ct values for mandarin tissue samples collected from a range of altitudes in Mendrelgang Gewog, Tsirang Dzongkhag........................... 160 Table 5.9. FAM Ct values (‘CLas’) for bark samples collected from 12 young mandarin seedlings at each elevation planted along DroopchhugangPhuensoomgang……………………………………………………………………162 Table 5.10. FAM Ct values (‘CLas’) for root samples collected from 12 young mandarin trees planted along Droopchhugang-Phuensoomgang. ............................ 163 Table 6.1. Summary of species of psyllids feeding on Rutaceae in Asia ............... 178 Table 6.2. Host plants and locations where psyllid specimens were collected ...... 180 Table 6.3. Locations where Cacopsylla heterogena was collected in 2015 and 2016 for detection of 'CLas' .............................................................................................. 191 viii Table 6.4. List of GenBank accessions of psyllids used for molecular phylogeny…………………………………………………………………………..196 Table 6.5. Sequence analysis of psyllids. ............................................................... 199 Table 6.6. Screening of Cacopsylla heterogena collected in 2015 and 2016 in Bhutan for the presence of ‘CLas’ by real-time PCR .............................................. 207 Table 6.7. Detection of 'CLas' in host plants of Cacopsylla heterogena. .............. 208 Table 6.8. Detection of 'CLas' in Zanthoxylum sp., Cacopsylla sp. and Cornopsylla rotundiconis ............................................................................................................ 209 Table 7.1. A list of Murraya samples collected from Bhutan and China and citrus samples from Bhutan used for molecular analyses .................................................. 225 Table 7.2. List of primers used for the molecular analysis of Murraya and wild Citrus specimens from Bhutan. ................................................................................ 227 Table 7.3. Proposed names for various taxa of Murraya. ...................................... 230 Table 7.4. Sequences of Murraya and Bergera accessions used for molecular analyses in this study................................................................................................ 232 Table 7.5. GenBank accessions of citrus and hybrids used for molecular analyses of chloroplast regions. .................................................................................................. 235 Table 7.6. GenBank accessions of citrus and hybrids used for molecular phylogeny based on the ITS region ........................................................................................... 238 Table 7.7. Sequence analysis of the cpDNA and the ITS region of the Murraya accessions…………………………………………………………………………..245 Table 7.8. ANOVA of the morphology of leaves taken from accessions of Murraya elongata from Bhutan, China and Việt Nam ........................................................... 258 Table 7.9. Sequence analysis of wild citrus accessions ......................................... 268 Table 7.10. Detection of 'CLas' in the accessions of Murraya species and wild citrus accession NCBT.9. ................................................................................................... 275 Table 8.1. A comparison of the descriptions of the flowers of Citrus cavaleriei and Citrus latipes ............................................................................................................ 303 Table 8.2. A comparison of the descriptions of the fruit of Citrus cavaleriei and Citrus latipes ............................................................................................................ 303 ix List of Figures Figure 1.1. Administrative map of Bhutan showing the twenty dzongkhags (administrative and judicial districts).. ......................................................................... 3 Figure 1.2. Yellow shoots on orange trees in Florida. ............................................. 15 Figure 1.3. Blotchy mottle on mandarin leaves, Zn deficiency –like leaves ........... 15 Figure 1.4. Corky veins and mottling on pomelo leaves, Limethang Research Station, Mongar, Bhutan. ........................................................................................... 15 Figure 1.5. Lop–sided fruit and aborted seeds ......................................................... 16 Figure 1.6. Diaphorina communis adult on a mandarin leaf at Kamichhu, Bhutan, and adult of Cacopsylla citrisuga on pomelo flush at Dura Sakalgre, Garo Hills, Meghalaya, India ........................................................................................................ 37 Figure 2.1. Adults and nymphs of Diaphorina communis on Bergera koenigii. ..... 50 Figure 2.2. Scanning electron micrographs of the abdomens of fifth instar nymphs of Diaphorina communis and Diaphorina citri showing the differences in marginal setae………………………………………………………………………………….51 Figure 2.3. Phylogenetic analysis of Diaphorina communis based on COI using maximum likelihood (ML)......................................................................................... 55 Figure 2.4. Phylogenetic analysis of Diaphorina communis based on the 16S gene………………………………………………………………………………….56 Figure 3.1. Curry leaf fruit and a seedling tray with curry leaf seedlings 30 d after sowing……………………………………………………………………………….61 Figure 3.2. A BugDorm rearing sleeve on a branch of a ‘CLas’- infected mandarin tree at Baychhu……………………………………………………………………...66 Figure 3.3. BugDorm rearing cages with mandarin seedlings used for rearing nymphs of Diaphorina communis…………………………………………………...69 Figure 3.4. Average monthly minimum and maximum temperatures and relative humidity recorded at Baychhu in 2014 and 2015…………………………………...73 Figure 3.5. A mandarin stump used as a source of ‘CLas’ for acquisition and transmission by adult Diaphorina communis; BugDorm rearing cages placed over mandarin stumps in the field; close up of a BugDorm with a Set A curry leaf seedling and mandarin stump; cages while maintained under shade cloth at Baychhu until 20 October 2014, and during transmission studies from Set A 2014 curry leaf to mandarin…………………………………………………………………………….75 Figure 3.6. Eggs of Diaphorina communis on mandarin and curry leaf seedlings. . 78 Figure 3.7. Average (n= 4) number of second generation Diaphorina communis adults following their development on curry leaf and mandarin seedlings in the choice and no-choice test conducted in the laboratory at NPPC in 2014. ................. 87 Figure 3.8. Average numbers of live Diaphorina communis adults in experimental cages (Mean±SE) for six weeks after 50 adults were released into each cage on May 8 2015………………………………………………………………………………..92 x Figure 4.1. Parasitised psyllid nymphs and thoraxic exit holes ............................. 119 Figure 4.2. Phylogenetic relationships among the parsitoids of Diaphorina communis and Diaphorina citri collected in Bhutan based on COI……………….122 Figure 4.3. Molecular analysis of the ITS1 region of parasitoids collected from Diaphorina citri and Diaphorina communis in Bhutan……………………………124 Figure 4.4. Phylogenetic analysis of the ITS2 region of parasitoids of Diaphorina citri and Diaphorina communis................................................................................126 Figure 4.5. Micrographs of Tamarixia drukyulensis female and male. ................. 128 Figure 5.1. Symptoms of huanglongbing on a ‘Candidatus Liberibacter asiaticus’infected seedling mandarin tree at Richina. ............................................................. 135 Figure 5.2. Dying mature mandarin trees, stumps of dead seedling mandarin trees, lime leaves with symptoms of huanglongbing and Diaphorina citri adults on mandarin leaves at the Waklay orchard, Pemathang, Gosarling, Tsirang ............... 136 Figure 5.3. Google Earth view of locations of experimental sites along Droopchhugang-Phuensoomgang in Tsirang. View facing north from directly above Droopchhugang-Phuensoomgang ............................................................................ 140 Figure 5.4. Google Earth view of locations of experimental sites along Droopchhugang-Phuensoomgang in Tsirang. .......................................................... 140 Figure 5.5. The experimental site at 783 m ASL at ‘Meme’ Tshering’s orchard at Phuensoomgang, Gosarling, Tsirang and a plot with four mandarin seedlings at 1053 m ASL at Mandoge Subba’s orchard in Pemathang, Gosarling, Tsirang……. ....... 141 Figure 5.6. A PVC pipe containing a Tinytag data-logger and a Davis rain gauge…………….…… ........................................................................................... 144 Figure 5.7. Results of analysis of soil samples collected from the eight experimental sites in Tsirang in June 2015. ................................................................................... 148 Figure 5.8. Comparison of average leaf temperature and ambient temperature at the experimental sites in Tsirang in May, June, July and August 2014......................... 149 Figure 5.9. Monthly average minimum and maximum ambient temperatures recorded at the experiment sites along Droopchhugang-Phuensoomgang. ............. 150 Figure 5.10. Monthly average minimum and maximum relative humidity along Droopchugang−Phuensoomgang in Tsirang. ........................................................... 151 Figure 5.11. Monthly total rainfall (mm) recorded from June 2013 to October 2015 at the sites along Droopchugang-Phuensoomgang .................................................. 152 Figure 5.12. Wart-like tubular leaf gall of an unidentified cecidomyiid observed between 800 m and 1400 m ASL during the study, and larvae within a gall……...173 Figure 5.13. Map of peak UV indexes using a modified scale to highlight the absolute peaks. The location of Bhutan is circled in red and indicated with an arrow……………………………………………………………………………….174 Figure 5.14. Spider mites on abaxial leaf surfaces of Zanthoxylum sp. (1600 m ASL) and mandarin (650 m ASL) ............................................................................ 174 xi Figure 6.1. Sequences of primers and probes used for the amplification of the wingless (wg) gene of the citrus green psyllids based on the primers (WGf and WGr) designed by Li et al. (2008) and the sequences from Cacopsylla spp…. ................ 189 Figure 6.2. Cacopsylla heterogena: ovipositing female; eggs; nymphs; adult. ..... 193 Figure 6.3. Leaves and fruits of the Zanthoxylum sp. from where Cornopsylla rotundiconis and the undescribed Cacopsylla sp. were collected. ........................... 193 Figure 6.4. Cornopsylla rotundiconis: adult male; slender nymph with honeydew….. ........................................................................................................... 194 Figure 6.5. Unidentified Cacopsylla sp. from Zanthoxylum .................................. 194 Figure 6.6. Phylogenetic analysis based on the COI gene of psyllids ................... 202 Figure 6.7. Phylogenetic analysis of the 16S rDNA region of psyllids ................. 203 Figure 6.8. Phylogenetic analysis based on the ITS region of psyllids.................. 204 Figure 6.9. Phylogenetic analysis of a reduced data set of the ITS region of the Cacopsylla species using the unidentified Cacopsylla species as the outgroup…………………………………………………………………………… 204 Figure 7.1 Nymph of Cacopsylla heterogena on wild citrus at Wengkhar; leaf distortion caused by Cacopsylla heterogena on wild citrus at Wengkhar ............... 221 Figure 7.2. Foliage of wild citrus at Basochhu ...................................................... 222 Figure 7.3. The trnL-trnL-trnF region of Murraya showing the positions and directions of primers ................................................................................................ 229 Figure 7.4. Phylogenetic analysis of the trnL-trnL-trnF region of Murraya ......... 246 Figure 7.5. Evolutionary history inferred based on the matK-5' trnK region of Murraya....................................................................................................................248 Figure 7.6. Molecular phylogenetic analysis inferred based on the rps4-trnT region of Murraya......................... ...................................................................................... 249 Figure 7.7. Phylogenetic relationships of Murraya based on the ITS region. ....... 250 Figure 7.8. Phylogenetic relationships inferred from the combination of five cpDNA regions and the ITS region of Murraya accessions from Bhutan using ML............ 252 Figure 7.9. Phylogenetic relationships inferred from the combination of five cpDNA regions and the ITS region of Murraya accessions from Bhutan using maximum parsimony……………… ......................................................................................... 253 Figure 7.10. Leaves, leaflets and flowers of Bhutanese accessions of Murraya elongata from Baychhu and leaves, leaflets and an inflorescence of Murraya elongata from Reldri, Phuentsholing. ...................................................................... 255 Figure 7.11. Fruit and seeds of Murraya elongata from Baychhu. ........................ 256 Figure 7.12. Plot of factor coordinates for Data Set A for the first two principal components………… .............................................................................................. 257 Figure 7.13. Plot of the coordinates for each observation (case) using the first two factors from principal components analysis of leaves from accessions of Murraya elongata from four locations. ................................................................................... 261 xii Figure 7.14. Plot of factor coordinates for Data Set B for the first two principal components.. ............................................................................................................ 262 Figure 7.15. Plot of the coordinates for each observation (case) using the first two factors from principal components for all observations (leaves) from accessions of Murraya elongata, Murraya paniculata, Murraya sumatrana and Murraya heptaphylla………… ............................................................................................... 263 Figure 7.16. Accession NCBT.1 showing leaves with large winged petioles, whole and cross-sectioned fruit, and leaf distortion caused by Cacopsylla heterogena…. 265 Figure 7.17. Accession NCBT.9 showing leaves with large winged petioles, flowers that are mostly borne singly and Cacopsylla heterogena damage on leaves. .......... 266 Figure 7.18. Accession NCBT.3 showing leaves without large petioles, a cross section of a fruit; side view of a fruit and the top view of a fruit ............................ 267 Figure 7.19. Phylogenetic relationships of wild citrus from Bhutan based on combinations of four chloroplast genes (matK-5’trnK, psbM-trnDGUC, trnL-trnLtrnF, rpS4-trnT) inferred using ML ......................................................................... 270 Figure 7.20. Phylogenetic relationships of wild citrus from Bhutan based on combinations of four chloroplast genes (matK-5’trnK, psbM-trnDGUC, trnL-trnLtrnF, rpS4-trnT) inferred using parsimony.. ............................................................ 271 Figure 7.21. Phylogenetic analysis of citrus accessions based on the ITS region using maximum likelihood....................................................................................... 273 Figure 7.22. Fruit of Murraya elongata from Yingde, China. ............................... 279 Figure 7.23. Fruit and seeds of Murraya sumatrana from Bogor Botanic Garden, Indonesia…….. ........................................................................................................ 279 Figure 7.24. Murraya elongata A. DC. ex Hook. Wallich Herbarium type specimen……........................................................................................................... 280 Figure 8.1. Leaflets of Zanthoxylum sp. with mottling symptoms ......................... 294 xiii Abstract ‘Candidatus Liberibacter asiaticus’ (‘CLas’) (α-Proteobacteria) is the pathogen associated with the Asiatic form of huanglongbing (HLB), the most serious disease of citrus in Asia and the Americas, in Bhutan. The principal vector of the disease, Diaphorina citri Kuwayama (Hemiptera: Sternorrhyncha: Liviidae), is also present in Bhutan. Recent detection of ‘CLas’ in the black psyllid, Diaphorina communis Mathur (Hemiptera: Liviidae), prompted my PhD study. I examined the molecular characteristics of Diaphorina communis and Diaphorina citri and found that the mitochondrial COI and 16S regions can distinguish the two species, and is useful for the identification of nymphs in the absence of adults and fifth instar nymphs. Investigations into whether Diaphorina communis can acquire ‘CLas’ and transmit it from ‘CLas’-infected mandarin (Citrus reticulata Blanco) to healthy seedlings of mandarin and curry leaf (Bergera koenigii L.) and vice versa were conducted under field conditions at Baychhu (27.2975ºN, 89.9669ºE, 784 m ASL), Wangdue Phodrang Dzongkhag. Several experiments were conducted starting with preliminary experiments in 2013, and transmission experiments in 2014 and 2015. Results showed that Diaphorina communis did not reproduce on mandarin and preferred curry leaf to mandarin given the choice. Further, a low (~6%) proportion of Diaphorina communis acquired ‘CLas’ after 16–47 d and 39 d of acquisition and transmission intervals in 2014 and 2015, respectively. No transmission of ‘CLas’ from ‘CLas’-infected mandarin to healthy mandarin and curry leaf by Diaphorina communis could be established based on periodic testing of mandarin and curry leaf seedlings. No transmission of ‘CLas’ from curry leaf to mandarin or curry leaf could be achieved. Phylogenetic analyses based on ITS 1 and 2, and the COI region as well as the morphological descriptions revealed that the individuals of the parasitoid reared from parasitised nymphs of Diaphorina communis belonged to a new species of xiv Tamarixia. The name of the new species has been proposed as Tamarixia drukyulensis sp. n. (Hymenoptera: Eulophidae). Assessment of the effect of altitude, ambient temperature, relative humidity and rainfall on leaf temperatures of mandarin plants, HLB, and distribution of psyllids, was made using eight sites ranging from 800 m to 1500 m ASL along Droopchhugang-Phuensoomgang in Tsirang. My investigations revealed that, in contrast to my hypotheses, leaf temperatures were lower than ambient temperature at all elevations and did not influence the low incidences of ‘CLas’ and Diaphorina citri at higher elevations; mandarin seedlings grew better at 800–1000 m ASL than seedlings planted at 1100 and 1500 m ASL in spite of higher incidences of ‘CLas’ and Diaphorina citri at 800–1100 m ASL; ambient temperatures and relative humidity at all elevations were within the range of conditions favourable for development and survival of Diaphorina citri. UV radiation could have a role in the distribution of psyllids in addition to the interaction of rainfall and ambient temperatures at elevations ≥ 1200 m ASL; Diaphorina communis were observed on Bergera koenigii at 800, 900 and 1000 m but not on mandarin seedlings in the experimental plots. Cacopsylla heterogena Li (Hemiptera: Sternorrhyncha: Psyllidae) was found on the mandarin seedlings from 1300 m to 1500 m ASL in the experimental plots in Tsirang. It was also recorded on citrus above and below this range in other locations. The molecular phylogenetic analyses using COI, 16S and ITS regions revealed that green psyllids on citrus belonged to one species, Cacopsylla heterogena. Two species of psyllids occurring on Zanthoxylum sp. were identified as Cornopsylla rotundiconis Lou, Li, Li & Cai and an unidentified Cacopsylla sp. (Hemiptera: Sternorrhyncha: Psyllidae). However, the molecular phylogenetic analyses could not resolve the separation of Cacopsylla heterogena from Cacopsylla citrisuga (Yang & Li), a species occurring in China. Real-time PCR analyses did not detect ‘CLas’ in Cornopsylla rotundiconis and the unidentified Cacopsylla sp. Only a small portion (~2%) of adults of individuals of Cacopsylla heterogena were ‘CLas’ positive despite most citrus plants from the same the locations where the insect was collected xv being positive for ‘CLas’; no nymphs were ‘CLas’ positive. The insects on the Zanthoxylum sp. were regarded as not harbouring ‘CLas’. The Murraya plants occurring in Baychhu, Wangdue Phodrang and in Reldri along Rinchending-Pasakha at Phuentsholing (26.8400°N, 89.4045°E, 400 m ASL) were identified as Murraya elongata A. DC. ex Hook. f. based on molecular analyses using five cpDNA (matK-5’trnK spacer, psbM-trnDGUC spacer; rpS4-trnT spacer, trnCGCA-ycf6 region trnL-trnL-trnF region) and the ITS region. Analyses of morphological features of leaves also separated it from Murraya paniculata (L.), and Murraya heptaphylla Spanoghe but not from Murraya sumatrana Roxburgh. Morphological differentiation between Murraya elongata and Murraya sumatrana was, therefore, based on the shapes of fruit and seeds. Adults of both Diaphorina communis and Diaphorina citri were observed on Murraya elongata in Baychhu but the eggs and nymphs occurring on these plants were confirmed as those of Diaphorina citri. No confirmation of the presence of ‘CLas’ in Murraya elongata could be established. The identity of a wild citrus species observed at near Wengkhar in Mongar and at Basochhu in Wangdue Phodrang could not be resolved based on four cpDNA and ITS, and morphological descriptions. Although, leaf damage and nymphs of Cacopsylla heterogena were observed on these wild citrus, leaf samples tested for ‘CLas’ did not indicate any presence of the pathogen. The study provides information on the role of other citrus-feeding psyllids and host plants that could be involved in the transmission of HLB in Asia. It has implications for management of HLB and citrus production in Bhutan and other countries with similar situations. Based on my results, it should be feasible to grow citrus above 1200 m ASL if suitable varieties can be found and if powdery mildew is controlled. Citrus production below 1200 m should also be feasible if all citrus below 1200 m in Bhutan is progressively removed and replanted at high densities with certified pathogen-free trees under strict quarantine. xvi Chapter 1: Introduction and literature review __________________________________________________________________ 1.1 Background Citrus is one of the most important agricultural commodities to the economy of Bhutan (Figure 1.1). It is an important cash crop for many small farmers and is the leading export commodity of Bhutan (RNR Statistical Coordination Section, Policy and Planning Division 2015). The majority of citrus cultivars grown in Bhutan and elsewhere in the region are mandarins (Ladaniya 2008). However, the industry, as elsewhere throughout most of the world, faces major challenges, particularly huanglongbing (HLB) (Ahlawat & Baranwal 2003; Doe Doe et al. 2003; Donovan et al. 2012a; Bové 2014). Huanglongbing is the most serious disease of citrus (da Graça 1991; 2008; Bové 2006; Gottwald 2010). It is caused by three putative species of phloem-limited αProteobacteria that have not been cultured (Halbert & Manjunath 2004; Bové 2006; Manjunath et al. 2008; Gottwald 2010): ‘Candidatus Liberibacter asiaticus’ (‘CLas’) which causes an Asiatic form of HLB; ‘Candidatus L. africanus’ (‘CLaf’) which causes an African form of the disease; and ‘Candidatus L. americanus’ (‘CLam’) which has only been recorded from Brazil. The incidence of ‘CLam’ is declining as the incidence of ‘CLas’ increases (Lopes et al. 2008; 2010; 2013). ‘Candidatus Liberibacter asiaticus’ is more tolerant of warm to hot ambient temperatures than ‘CLaf’ and ‘CLam’ (Bové 2006; Gottwald 2010; Lopes 2010; 2013). ‘Candidatus Liberibacter asiaticus’ has been recorded in Asia (Aubert 1992; Halbert & Manjunath 2004; Bové 2006), where it is assumed to have originated (Halbert & Manjunath 2004; Bové 2006; Beattie et al. 2012), New Guinea (Weinert et al. 2004), Ethiopia (De Bac et al. 2010), and the Americas, including Cuba in the Caribbean, where it has spread rapidly since 2004 (Halbert & Manjunath 2004; Bové 2006; Luis et al. 2009; Lopes et al. 2008 & 2010; Manjunath et al. 2008 & 2010; Martínez et al. 1 2009). ‘Candidatus Liberibacter africanus’ occurs in Africa and the south east of the Arabian Peninsula, and the Mascarene island (Bové 2006; da Graça 2008; Aubert 2009; Phahladira et al. 2012). ‘Candidatus Liberibacter americanus’ has only been recorded in Brazil (Bové 2006; Lopes et al. 2010). The Asiatic citrus psyllid, Diaphorina citri Kuwayama, can transmit each of the three pathogens, and the African citrus psyllid (Trioza erytreae (del Guerico) (Triozidae) can transmit the Asiatic and African pathogens (Aubert 1987; Halbert & Manjunath 2004, Bové 2006; Yamamoto et al. 2006; Gasparoto et al. 2010). ‘Candidatus Liberibacter asiaticus’ has recently been recorded in the black psyllid, Diaphorina communis Mathur, collected from HLB-symptomatic mandarin (Citrus reticulata Blanco) in Bhutan (Donovan et al. 2012a; 2012b) and in the pomelo psyllid, Cacopsylla citrisuga (Yang & Li), collected from symptomatic and ‘CLas’positive lemon (Citrus × limon L.) trees in China (Cen et al. 2012a). Transmission by Cacopsylla citrisuga has also been reported (Cen et al. 2012b). The symptoms of HLB (cited as citrus greening) were first recorded in southern Bhutan in Phuentsholing during surveys between 1972–1990 (Lama & Amtya 1991; Lama & Amatya 1993). In the mid-1990s, orchards in West-Central Region showed symptoms attributed to HLB, and the presence of the disease was confirmed in 2002 (Ahlawat & Baranwal 2003; Doe Doe et al. 2003) though earlier records from Bangladesh, India and Nepal suggest that both the disease and the psyllid may have been present in southern Bhutan since the mid-1960s (Catling 1968a; Catling et al. 1978; Lama & Amtya 1991; Lama & Amatya 1993; Ohtsu et al. 1998). Currently, many citrus orchards in the West-Central and the Southern Regions of Bhutan are affected by HLB (pers. obs.). This has led to reduced yield and premature death of many trees which is more apparent in the low altitude areas e.g., in Tsirang Dzongkhag (pers. obs.). The recent detection of ‘CLas’ in adult Diaphorina communis in Bhutan (Donovan et al. 2012a) has intensified interest in the impact of HLB in Bhutan and the Indian subcontinent. 2 Figure 1.1. Administrative map of Bhutan showing the twenty dzongkhags (administrative and judicial districts). The dzongkhags are further divided into 205 gewogs which are administrative units below a dzongkhag). The gewogs in turn are divided into chiwogs which are comprised of groups of villages. (Image: http://www.nationsonline.org/oneworld/map/bhutan_map.htm with modifications). The only information on this psyllid is contained in the records of Mathur (1935, 1975) in which it was first recorded as Diaphorina sp. n. (Mathur 1935) with Bergera koenigii L. (as Murraya koenigii (L.) Spreng.; curry leaf) as the host plant. Despite these observations, transmission of ‘CLas’ by Diaphorina communis and the role of curry leaf in the epidemiology of the disease have not been determined. With the exception of the recent report of transmission of ‘CLas’ by Cacopsylla citrisuga (Cen et al. 2012b), all transmission studies on HLB pathogens have focused on Diaphorina citri and Trioza erytreae (da Graça 1991; Bové 2006; Beattie & Barkley 2009; Lopes et al. 2010). Moreover, curry leaf was not known to be a host of ‘CLas’ or the other HLB pathogens prior to commencement of this study. Further, HLB-symptoms are less common at higher altitude than at lower altitudes. Based on the above knowledge, 3 the scope of my study was initially designed to compare the molecular characterisation of Diaphorina communis to that of Diaphorina citri (Chapter 2) and to investigate whether Diaphorina communis could acquire and transmit ‘CLas’ from infected mandarin to healthy mandarin and curry leaf and vice versa (Chapter 3), identify natural enemies of Diaphorina communis (Chapter 4), and to evaluate the effect of altitude, ambient temperature and relative humidity on leaf temperatures of mandarin plants, HLB, and distribution of Diaphorina communis and Diaphorina citri (Chapter 5). The rest of my study (Chapters 6 & 7) stemmed from observations made during the initial year of my study. These observations indicated (a) that Diaphorina communis does not develop on mandarin, secondly, (b) the presence of a previously unrecorded green psyllid species in Bhutan, initially on mandarin and subsequently on lime, lemon, orange and a wild citrus taxon, and (c) the presence of a wild species of Murraya not previously recorded in Bhutan. Therefore, in Chapter 6, I focused on morphological and molecular identification of the green psyllid species, and the presence or absence of ‘CLas’ in it and its host plants; in Chapter 7, I focused on the molecular and morphological characterisation of a wild species of Murraya and its status as host of ‘CLas’. The outcomes of my studies have significant importance for management of HLB in Bhutan and more widely on the Indian subcontinent where Diaphorina citri and Diaphorina communis occur. The research also has implications for understanding the role of other citrus-feeding psyllids in transmission of HLB and other citrus diseases in Asia. Moreover, my results will influence world-wide quarantine practices for psyllids and HLB. 4 1.2 Literature review 1.2.1 The disease: Huanglongbing (HLB) Although huanglongbing is the official common name of the disease (Moreno et al. 1996; van Vuuren 1996; Bové 2006), it is also known by several other names. These include likubin (decline) in Taiwan, citrus dieback in India, citrus leaf mottle yellows in the Philippines, citrus vein-phloem degeneration (CVPD) in Indonesia, greening or blotchy-mottle disease in South Africa, and greening disease in Florida and Brazil (da Graça 1991; Bové 2006). Huanglongbing literally means ‘yellow dragon disease’ in Mandarin, but the intended meaning when this name was first used by farmers in the Chaozhou region of Guangdong in the early 1900s was ‘yellow shoot disease’ (Zhao 1981; Bové 2006). Huanglongbing was unanimously adopted by citrus virologists as the official name of the disease at the 13th Conference of the International Organisation of Citrus Virologists in Fuzhou, Fujian, China, in 1995 (van Vuuren 1996; Moreno et al 1996; Bové 2006) in honour of Prof Lin Kung Hsiang who was the first to demonstrate transmissibility of the disease (Lin 1956a). The following literature review mainly focuses on the Asiatic form of the disease. It is widely assumed (Lin 1956a; 1956b; Zhao 1981; da Graça 1991; Bové 2006) that the first report of HLB symptoms in English was by Reinking (1919) in his descriptions of maladies of citrus in China and that the disease originated in China. However, Reinking (1919) did not describe the disease. He described die-back resulting from overcrowding of orange trees with intercrops, leaf mottling leaf was attributed to nutrient deficiency, and most yellowing of leaves was attributed to poor growing conditions. Lin (1956a; 1956b) claimed, based on Reinking (1919), interviews with farmers, and his studies on graft transmission that the disease was present in southern China in the late 1800s. However, Diaphorina citri was not recorded in Guangdong until 1934 (Hoffman 1936) and in Fujian in 1947 (Huang 1953; Beattie et al. 2012), despite it being described from specimens collected in Taiwan in 1907 (Kuwayama 1907). Huanglongbing could not have been widespread in southern China in the absence of Diaphorina citri and, according to Lin (1956a; 1956b), the disease did not reach ‘devastating proportions’ until the mid 1940s, a 5 decade after Diaphorina citri was recorded in Guangdong. Moreover, HLB was not recorded in Fujian until 1947 (Huang 1953; Beattie et al. 2012) or in Taiwan (as likubin) until 1951 (Su 2000). Beattie et al. (2008; 2009) hypothesised that ‘CLas’ may have been introduced to Guangdong with plants imported from India or Indochina in the late 1920s and early 1930s, the latter coinciding with first record of Diaphorina citri in Guangdong. Aubert (1992) and Beattie et al. (2009) also speculated that the disease spread to Taiwan, the Philippines, Indonesia, Thailand and Malaysia through movement of plant material from Guangdong. Beattie et al. (2009) noted that Husain and Nath (1927) were the first to unknowingly, but unambiguously, describe symptoms now associated with HLB when they described feeding damage by Diaphorina citri in Sargodha, Lyallpur, Gujranwala and other parts of Punjab region of pre-partition India. They noted that the insect probably ‘injected some poison’ into the trees causing premature death of trees and making the fruit small and insipid’ in taste. Prior to this, Citrus trees in India were observed to exhibit sudden wilting, reduced vigour and growth, and death of twigs, branches and trees as early as the mid 1700s (Capoor 1963; Fraser & Singh 1966; Raychaudhuri et al. 1972; Raychaudhuri 1991). The causes of these symptoms were attributed to many factors ranging from water logging and nutritional deficiencies to fungal and viral infections including, Citrus tristeza virus (Capoor 1963). The cause of symptoms associated with the disease, as distinct from symptoms caused by other maladies, was subsequently recognised in the late 1960s to be HLB (Fraser 1966; Fraser et al. 1966; Varma et al. 1993). By 1967, the disease was then reported from different Northeastern States of India including Arunachal Pradesh, Assam, Bihar, Manipur, Meghalaya, Sikkim, and West Bengal (Fraser 1966; Nariani & Raychaudhuri 1968; Bhagabati 1993; Varma et al. 1993). Many of these states share land borders with Bhutan. In Bhutan, mandarin trees with HLBlike symptoms were observed in the mid 1990s in Punakha in the West Central Region (Doe Doe et al. 2003). The presence of ‘CLas’ in this region of Bhutan was confirmed by 2002 (Ahlawat & Baranwal 2003; Doe Doe et al. 2003). 6 Wallace (1978), in reviewing leaf-mottle yellows disease in the Philippines, concluded that the ‘mottle leaf’ studied by Lee (1921) was caused by Zn deficiency, and the severity of leaf mottle on mandarin and Valencia orange scions on pomelo rootstock was due to the susceptibility of the stock to CTV. Reinking (1921), in his report on ‘Citrus diseases of the Philippines, Southern China, Indo-China and Siam’, did not mention symptoms similar to those of HLB. The first valid records of HLB in the Philippines stem from reports by Martinez & Wallace (1967a; 1967b) and Catling (1968b). Numerous trees became unproductive by 1957 (Martinez & Wallace 1967a; 1967b), and the disease reached epidemic proportions that drastically reduced the total area of citrus production by 1960s (Altamirano et al. 1976). Martinez & Wallace (1967a) demonstrated CTV and seedling yellow complex diseases were present in all citrus trees with leaf mottling. This was supported by transmission tests using the black citrus aphid, Toxoptera citricida (Kirkaldy), but it was not clear whether the symptoms were caused by a different strain of the virus that was not present in other countries facing similar tree decline problem. Their attempts to transmit citrus leaf mottle yellows with Diaphorina citri were initially inconclusive (Martinez & Wallace 1967a), but they subsequently (Martinez & Wallace 1967b; 1969) demonstrated that it was the vector of this disease. In Indonesia, Tirtawidjaja et al. (1965) who sought to determine the causes of citrus decline, observed that West Indian lime (Citrus x aurantiifolia (Christm.) Swing.) seedlings inoculated with scions from chlorotic trees showed collapsed phloem and starch accumulation that was generally accompanied by vein clearing. However, seedlings that showed vein clearing did not always show collapsed phloem and starch accumulation. Graft inoculation of ‘djeruk Siem’ mandarin (Citrus reticulata Blanco) and rough lemon (Citrus × taitensis Risso (= Citrus jambhiri Lushington)) showed that collapsed phloem and starch accumulation were induced only when grafted with scions from trees showing these symptoms. Unlike on West Indian lime, ‘djeruk Siem’ mandarin and rough lemon did not show collapsed phloem and starch accumulation or chlorosis when inoculated with scions from chlorotic trees. Further, transmission with Toxoptera citricida (cited as Aphis tavaresi del Guercio) and other insects, including Diaphorina citri, revealed that transmission with 7 Diaphorina citri resulted in starch accumulation and phloem necrosis. Tirtawidjaja et al. (1965) concluded that CVPD was caused by a distinct virus(es), not Citrus tristeza virus or other known viral diseases at the time. They hypothesised that the ‘virus’ could be the same as the pathogen causing ‘likubin’ in Taiwan (Matsumoto et al. 1961). Surveys between 1960 and 1980 revealed that CVPD was widespread in Java and Sumatra (Tirtawidjaja 1980). The disease and the vector have since spread eastward through the Indonesian archipelago to Timor and to New Guinea (Weinert et al. 2004; Davis et al. 2005). 1.2.2 Causal agent of the Asiatic HLB The Asiatic form HLB is caused by a phloem-restricted bacterium ‘Candidatus Liberibacter asiaticus’ (α-Protebacteria) (Jagoueix et al. 1994). It, and its congeneric putative species, ‘CLaf’’ and ‘CLam’, have not been cultured artificially, despite recent claims (Schaad et al. 2009; Sechler et al. 2009), and Koch’s postulates have not been fulfilled (Bové 2006; Gottwald 2010). The Asiatic form is more heat tolerant than ‘CLaf’ and ‘CLam’, and can withstand ambient temperatures above 30ºC (Bové 2006; Lopes et al. 2010 & 2013; Gasparoto et al. 2012; Hoffman et al. 2013). As noted above, the transmissible nature of the casual agent of the disease in Asia was demonstrated in 1956 in China by Professor KH Lin (Lin Kung Hsiang) through his work on graft-inoculation (Bové 2006). However, the pathogen was considered to be a virus (Tirtawidjaja et al. 1965; Martinez & Wallace 1967a; 1967b; Zhao 1981) before Laflèche & Bové (1970) suggested it may be a mycoplasma-like organism, based on its presence in the phloem of infected tissue and its nonculturable nature. However, mycoplasmas do not have a cell wall (van Iterson & Ruys 1960), and subsequent studies revealed that the liberibacters possess a threelayered envelop consisting of an inner and outer membrane enclosing a thin layer of peptidoglycan (Moll & Martin 1974; Garnier et al. 1984a) typical of Gram-negative bacteria (Beveridge 1981). Jagoueix et al. (1994) cloned and sequenced the 16S ribosomal DNA (16S rDNA) of the Asiatic and African HLB organism and compared them with 16S rDNA sequences from GenBank and established that the 8 liberibacters belong to the α-Proteobacteria. A putative genus name ‘Liberobacter’ was proposed (Jagoueix et al. 1994). Following the Rules of International Code of Nomenclature of Bacteria, the spelling of the putative genus was changed to Liberibacter because the connecting vowel preceding ‘bacter’, of masculine gender and Latin origin, should be ‘i’ not ‘o’ (Garnier et al. 2000). 1.2.3 Impacts of huanglongbing Huanglongbing is the most severe disease of citrus: there is no known cure for the disease on a field scale (Bové 2006; Gottwald 2010). Infection leads to reduced yields, poor fruit quality, premature tree death and higher than normal production costs (da Graça 1991; Roistacher 1996; Bové 2006; Gottwald 2010; Lopes et al 2009). The first unambiguous impact of the disease was reported by Husain & Nath (1927) in the Punjab region of pre-partitioned India in their description of damage caused by Diaphorina citri. Husain & Nath (1927) noted that psyllid infestations led to the death of fresh leaves and buds, sparse foliage on branches and a slow drying up of trees, reduced yield and ‘insipid’ fruits which are all now associated with damage caused by HLB. They commented that the psyllid appeared to inject ‘some poison’ into the trees, and that the impact on the citrus industry in the region was serious and of greatest importance to the citrus industry. However, for several decades, quantitative data were lacking to support the impact of the ‘citrus decline problem’ in India (which was attributed to CTV by some authors) until the Government of India requested Australian Government for a specialist to evaluate the causes of the citrus problem (Fraser & Singh 1966). Fraser (1966) noted that the problem was becoming a substantial threat causing much concern in many districts of India and suggested that citrus greening may in part be the cause. Raychaudhri (1991) reported that the citrus dieback problem affected profitable citrus cultivation so much that growers contemplated to replacing citrus with other crops. Huanglongbing is the major limiting factor for citrus production in many parts of Asia and Africa (Aubert et al. 1985; da Graça 1991; Aubert 1992; Buitendag & von 9 Broembsen 1993; Bové 2006; Gottwald 2010). Records of Jiaogan mandarin production over 40 years in Shantou in China showed sporadic reductions of production area and yield following each epidemic of HLB caused by ‘CLas’ (Aubert 1990). An epidemiological study over 8 years in Réunion showed 65% infection by ‘CLas’ of pathogen-free trees planted seven years earlier. The trees subsequently became non-productive (Aubert et al. 1996). Huanglongbing infection at the nursery level accelerates deterioration of a citrus orchard, and orchards established with asymptomatic plants from infected areas can result in 100% infection of trees within three years of planting (Aubert 1990). Martinez & Wallace (1967b) reported that 60–90% of citrus trees in certain orchards of the Philippines were infected by leaf mottle disease with many trees showing progressing symptoms of declining in 1960. A survey of 83 orchards in Lipa, Philippines revealed that citrus production decreased from 11,680 t in 1955–1960 to 6,300 t in 1964. The production decline was estimated to to have reached 1,000 t by 1968 (Martinez et al. 1971). The Philippine citrus production area of 25,000 ha in 1960s was reduced to 40% by 1990s (Aubert 1992). From 1960 to 1970, three million trees were lost in Indonesia due to the disease (Gottwald et al. 2007). A survey in Java in 1984 revealed that orchards that appeared healthy 3–4 years earlier were all infected by HLB (Aubert et al. 1985), an indication of rapid development and spread of the disease. Efforts initiated in 1970 to control the disease through injection of an antibiotic, tetracycline, in a nation-wide program met with total failure (Bové et al. 2000). An attempt to re-establish the citrus industry in Bali following the removal of 3.6 million infected trees between 1984 and 1987 and subsequent planting of pathogen-free trees also ended in failure. By 1995, 76% of trees replanted between 1991 and 1993 expressed symptoms of the disease. Efforts to re-establish the industry were subsequently impeded as a consequence of an economic crisis in Indonesia in 1998 (Bové et al. 2000). FAO production statistics show peaks and troughs in production related to plantings of new trees followed by HLB epidemics, with major peaks and troughs occurring every 8–10 10 years and declines in cropping area falling by up to 82% over two years (from 132,195 ha in 1996 to 96,000 in 1998). In Thailand, where citrus is an important cash crop, Roistacher (1996) reported that HLB destroyed almost 10–15% of tangerine trees each year. He noted that the disease was exceptionally destructive in the northern regions and cited an economic analysis by Grenzebach (1994) that showed a 12-years cycle of production in which most trees declined to a point of non-profitability after eight years, only four years after they became profitable. Akarapisan (2012) reported that HLB was primarily responsible for a 41% reduction in annual tangerine yields between 2006 and 2009, from 871,644 t to 514,678 t, and that the area planted to tangerines had fallen by 43.6 % over the same period, from 67,922 ha to 38,295 ha. Cyclical impacts of the disease are also evident on FAO production statistics for Thailand. Similar impacts appear to be evident in production statistics for Malaysia and Việt Nam. Severe impacts of the disease are now being recorded in the Americas where ‘CLas’ was first recorded in Brazil in South America in 2004 and in Florida in North America in 2005 (Gottwald 2010; Lopes et al. 2010; 2013; Bassanezi et al. 2011). Where HLB is present, there is a rapid spread of the disease and symptom development in the orchard (Bassanezi et al. 2009). Within 4 years of the pathogen being detected in Brazil, nearly three million trees were removed in an effort to eradicate the disease (Bassanezi et al. 2009). Bassanezi & Bassanezi (2008) calculated the incidence and severity of the disease and their impacts on yield in the absence of disease control in relation to tree age. Their calculations showed that the disease incidence would reach 50% in 0–2-years trees two years after the initial appearance of disease symptoms, whereas in trees older than 10 years, it would take 10 years to get to the same level of incidence. Similarly, the disease severity in younger trees (0–2 years) would reach 100% in almost two years compared with the duration of 12 years for older trees. This showed that disease incidence and severity progression is relatively faster in younger trees than older trees and would result in massive yield reduction of these trees 2–4 years after the appearance of the first symptoms (Bassanezi & Bassanezi 2008). Bassanezi et al. (2011) assessed the 11 severity of HLB symptoms and impacts and yields of Brazilian sweet orange cultivars. They performed a single tree approach for estimating yield losses for 949 trees. For each assessed tree, symptomatic and asymptomatic fruits were counted and weighed separately. For disease severity, each tree was divided into an upper and lower hemisphere, and each hemisphere was further divided into four quadrants. The 8 quadrants were then assessed on 0–5 scale corresponding to 0–100% of the canopy section area with HLB symptoms. The mean of the eight sections represented the disease severity of the tree. Results showed poor correlation between the number of symptomatic fruits per tree and disease severity for all cultivars although symptomatic fruits weighed less than the asymptomatic fruits. Bassanezi et al. (2011) noted that the poor correlation between symptomatic fruits and disease severity is an indication that either fewer fruits are set on symptomatic branches or that more symptomatic fruits have prematurely abscise from the trees as the disease severity increased. They (Bassanezi et al. 2011) used a negative exponential model to describe the relationship between relative yield and HLB severity. Relative yield was calculated by dividing yield from symptomatic tree by the mean yield from asymptomatic trees. The results showed a relative yield of 14–19% for trees with 100% of canopy with symptoms using this model (Bassanezi et al. 2011). In the presence of HLB, the cost of production is higher. This results from having to grow seedlings under protection, conduct surveys to detect HLB symptoms and the vector, remove infected trees, and apply insecticides (Lopes et al. 2008; Morris et al 2008; Hodges & Spreen 2012). With the discovery of HLB in Florida and implementation of new State and Federal laws to prevent spread of the disease, the additional cost of growing a citrus plant was estimated to be of US $8–10/plant (Morris et al. 2008; Spann et al. 2008). Hodges & Spreen (2012) reported that the estimated total revenue of the Florida orange growers was $10.9 billion without HLB compared to $9.2 billion with HLB thus causing a 16% reduction during five years from 2006/07 to 2010/11. The economic impact analysis of orange processing with and without HLB showed that without HLB, the total revenues impact during the five year period was $28,816 compared to $24,275 with HLB. Without HLB, the labour income impact was $11.1 billion compared to $9.3 billion with HLB. Overall, HLB has adverse impacts on the gross domestic product, income, and significant 12 employment impacts on the agriculture sector (Hodges & Spreen 2012). At present, the overall citrus production in Florida has been reduced by more than 70% and the production of oranges for the 2017 season is forcast to be 67 milllion boxes compared to the 240 million boxes prior to HLB (Halbert, pers. comm.). 1.2.4 Huanglongbing symptoms The symptoms caused by HLB are not specific, but some are very characteristic of HLB (Bové 2006). Lin (1956b) described ‘yellow shoots’ (Figure 1.2), leaf drop and rotting of rootlets as characteristic symptoms of the disease. Infected trees exhibiting early symptoms are conspicuous because of yellowing (chlorosis) of leaves on infected branches with medium to advanced symptoms stand out from leaves on healthy branches or branches with leaves exhibiting mild symptoms (McClean & Schwarz 1970; Aubert 2008; Bové 2006). As the disease progresses, whole trees, particularly those with severe symptoms, may appear yellow (Bové 2006). Initial leaf symptoms are characterised by leaves with patchy yellow and green or pale green and yellow mottling. This is referred to as ‘blotchy mottle’ (Figure 1.3A). Veins of such leaves can become yellow (McClean & Schwarz 1970). Blotchy mottling is, by definition, not symmetrical on opposing leaf surfaces (adaxial or abaxial) separated by leaf midribs. These symptoms differ from those of zinc (Zn) deficiencies that are characteristically presented as symmetrical chlorosis on both sides of midribs (Bové 2006). Moreover, Zn-deficient leaves (Figure 1.3B) exhibit interveinal chlorosis whereas with botchy-mottled leaves also exhibit yellowing of veins (Schneider 1968). Schneider (1968) described botchy mottle as a primary symptom. Leaves exhibit secondary symptoms as disease severity progresses. Chlorosis becomes more evenly distributed and leaves become small, leathery and upright. Veins become corky (Figure 1.4). These symptoms are mostly due to accumulation of starch in the parenchyma cells as movement of sugars ceases due to hyperplasia and necrosis that leads to vein phloem collapse (Salibe & Cortez 1966; Matsumoto et al. 1961; Tirtawidjaja et al. 1965; Su & Huang 1990; Schneider 1966; McClean & Schwarz 1970; Achor et al. 2008; Etxeberria et al. 2009; Gonzalez et al. 2012). Ultimately, leaves with severe symptoms abscise, leaving sparse foliage 13 (McClean & Schwarz 1970). Mineral deficiencies symptoms that appear on the severely symptomatic leaves with secondary symptoms resemble Zn, Fe, Mn, Ca, S and B deficiencies among which Zn-like deficiency symptoms are the most common (Schneider 1968; McClean & Schwarz 1970). Fruits of infected trees exhibit ‘colour inversion’ manifested as abnormal colouring from the stylar to the penduncular ends. These symptoms are more apparent in temperate regions where cool conditions in autumn and winter lead to chlorophyll depletion in the rinds in contrast to fruit grown in the tropics that remain green (Hodgson 1967). Fruit also become lop-sided (Figure 1.5A), a symptom that is more apparent when fruit are cut open parallel to the fruit axis (Bové 2006). Schneider (1968) explained that lop-sided fruit ripen on one side as the other side remains immature with the external surface of the latter remaining green, the symptom leading to use of the common name, ‘greening’, for the disease in South Africa. Infected fruits may also have aborted seeds (Figure 1.5B) which appear as brown and shriveled seeds when fruit are cut open (Bové 2006); the fruit, themselves, become dry and insipid (Schneider 1968; McClean & Schwarz 1970, da Graça 1991; Bové 2006). These latter symptoms were among those attributed by Husain & Nath (1927) to Diaphorina citri injecting ‘some poison’ into trees. These symptoms may also be induced by other causes. Yellow shoot can result from damage on the trunks by phytophthora gummosis (Bové 2006), water-logging, winter yellows (Broadbent & Fraser 1979) and, as noted above, mineral deficiencies. Citrus tristeza virus infections and B deficiency can lead to corky veins (Aubert 2008). Moreover, temperature, light, host susceptibility, and virulence of the putative ‘Candidatus Liberibacter’ species and strain can affect symptom expression (da Graça 1991; Bové 2006; Folimonova et al. 2009). 14 Figure 1.2. Yellow shoots on orange trees in Florida (GAC Beattie). Figure 1.3. Blotchy mottle on mandarin leaves (A), Zn deficiency –like leaves (B) (Photos: N. Om). Figure 1.4. Corky veins and mottling on pomelo leaves, Limethang Research Station, Mongar, Bhutan (Photos: GAC Beattie). 15 Figure 1.5. Lop–sided fruit (left), aborted seeds (right) (Photos: Pat Barkley). 1.2.5 Field and laboratory confirmation of HLB infections Several techniques can be used to confirm the presence of HLB pathogens in symptomatic tissues. These techniques include biological indexing (Lin 1956a; Tirtawidjaja 1972; Tatineni et al. 2008), electron and light microscopy (Schwarz, 1965, Laflèche & Bové 1970; Manthey 2008), an iodine-starch test (Eng 2007) and serological and molecular methods (Villechanoux et al. 1992; Garnier & Bové 1996; Hocquellet et al. 1999; Li et al. 2006; 2007a; 2009). The accuracy of these procedures is often affected by the uneven distribution of the pathogens within the tree and non-specific symptom exhibition (Bové 2006; Manjunath et al. 2008; Li et al. 2009). Selection of tissues for testing is generally based on sampling of symptomatic leaves. As noted above, Koch’s postulates have not been proven for the HLB liberibacters and the pathogens have not been cultured (Jagoueix et al. 1994; Bové 2006; Li et al. 2009). 1.2.5.1 Biological indexing Biological indexing was initially used to demonstrate that symptoms of a malady now known to be caused by ‘CLas’ were caused by a graft-transmissible plant pathogen (Lin 1956a). Lin (1956a) based his tests on mandarin trees with yellow shoots. Tirtawidjaja (1972) reported 45% disease transmission using infected tips of twigs grafted onto Cleopatra mandarin compared to 40% and 7% transmission with leaf segments with midvein attached, and leaf segments alone, respectively. On 16 rough lemon (Citrus × taitensis Risso), transmission was 26% using bark with buds compared to 2% transmission with bark alone (Tirtawidjaja 1972). This showed that the pathogen was unevenly distributed in the plants. Uneven distribution of the pathogen was also noted by others who concluded the pathogen to be present only in symptomatic branches (Martinez et al. 1971; Huang 1979; Gonzales & Viñas 1981). Teixeira et al. (2008) observed that samples negative by two PCR techniques, i.e., with no or very few liberibacters, were located near blotchy mottle leaf samples i.e., samples with high amounts of liberibacters, reflecting, locally, an uneven distribution of liberibacters. da Graça (1991) cited references to the use of sweet oranges, Orlando tangelo (Citrus × aurantium), Key, Kagzi or Indian acid lime (Citrus × aurantiifolia (Christm.) Swingle) and mandarins as indicator plants. Although, biological indexing was the earliest method used to demonstrate the grafttransmissibility of the disease (Lin 1956a), its use is limited by the uneven distribution of the pathogen within a tree, and the long latent period before the development of symptoms. Recently, it has been noted that ‘CLas’ is not confined to symptomatic portions of HLB-infected trees (Gottwald et al. 2008; Tatineni et al. 2008; Li et al. 2009). Using real–time PCR, Gottwald et al. (2008) analysed two entire trees and detected ‘CLas’ not just in the symptomatic branches but in the scions, rootstock, and in almost 76% and 26% of the main branches and roots, respectively, using leaf veins, petiole tissue and cambium samples. Tatineni et al. (2008) examined different parts of ‘CLas’infected trees and detected the pathogen in all floral parts, except in the endosperm and embryo. To determine systemic infection of HLB, Tatineni et al. (2008) also tested fully expanded young to mature leaves collected from a branch further away from the site of graft inoculation and detected the pathogen in all samples except one. The bacterium was also detected in the roots of infected trees grown in a greenhouse. All samples were tested using conventional and real–time PCR (Tatineni et al. 2008). Li et al. (2009) performed quantitative PCR to quantify the distribution of ‘CLas’ genomes in six species of citrus. Root samples were taken from one symptomatic, field-grown tree each of Persian lime (Citrus × latifolia (Yu. Tanaka) Tanaka, Palestine sweet lime (‘Citrus limettioides Tan.’), and lemon (Citrus × limon (L.) 17 Burm. f.), or three trees each of sweet orange (Citrus × aurantium L), Mexican/Tahitian lime (Citrus aurantiifolia) and kaffir lime (Citrus hystrix DC). They (Li et al. 2009) assayed samples from midribs, petioles, leaf blades, green stem bark, mature bark and roots. No significant difference was observed in the pathogen genome level based on the tissue type (midrib/petiole, leaf blade, bark) from the same tree, but differences were observed among tissues samples from different trees. The pathogen genome level ranged from 1 × 1010 to 6 × 1010 copies per gram of root tissue in all greenhouse plants and in one field-grown tree. The pathogen was also consistently detected in symptomatic fruits. Higher titres of the pathogen in fruit were detected in locular membranes and septa than in the peduncle, pericarp, or central axis. Greenhouse trees, that were systematically sampled, showed higher genome levels in midribs than in the bark taken from lower portions of the tree. The pathogen was detected in all samples of leaf blades, midribs, stem barks and roots (Li et al. 2009). Sagaram et al. (2008) found a wide variation in concentration of ‘CLas’ among tissues with the highest concentration in fruit peduncles. These studies indicate that the pathogen can be present in infected trees almost systematically but may not be present at a detectable level (Gottwald et al. 2008). The PCR method used detects all living and dead DNA (Li et al. 2009). Therefore, detection of pathogen based on quantitative PCR from any plant part does not guarantee detection of only viable bacteria. Thus, variable results may be obtained when used for biological indexing. 1.2.5.2 Hosts susceptible to ‘CLas’ Several species and hybrids of Rutaceae and some non-rutaceous plants are known hosts of ‘CLas’. Different hosts react differently to the pathogen. Beattie & Barkley (2009) compiled an extensive list of hosts of different forms of HLB. Species and hybrids of Aurantioideae within the Aurantieae recorded as expressing symptoms or known to be susceptible are:  Aegle marmelos (L.) Corr. (Ramadugu et al. 2016);  Aeglopsis chevalieri Swingle (Ramadugu et al. 2016); 18  Atalantia buxifolia (Poir.) Oliv. (Deng et al. 2008): (Severinia buxifolia (Poir.) Tenore (Martinez & Wallace 1969; Su et al. 1995; Koizumi et al. 1996; Hung et al. 2000, 2001; Hu 2012; Hu et al. 2014);  Balsamocitrus daweii Stapf (Koizumi et al. 1996; Ramadugu et al. 2016);  Citropsis gilletiana Swing. & M. Kell. Jour. (Hu 2012);  Citrus amblycarpa (Hassk.) Ochse (Tirtawidjaja 1981; Ramadugu et al. 2016);  Citrus australasica F. Mueller: Microcitrus australasica (F. J. Muell.) Swingle (Koizumi et al. 1996; Ramadugu et al. 2016);  Citrus cavaleriei H. Léveillé ex Cavalerie: Citrus ichangensis Swingle (Miyakawa & Zhao 1990);  Citrus glauca (Lindl.) Burkill hybrid: Eremocitrus glauca (Lindl.) Swing. (Ramadugu et al. 2016);  Citrus hystrix DC (Miyakawa & Zhao 1990);  Citrus japonica Thunb.: Fortunella sp., Fortunella hindsii and Fortunella japonica (Miyakawa & Zhao 1990; Ramadugu et al. 2016);  Citrus maxima (Burm.) Merr.: Citrus grandis (L.) Osbeck (Nariani 1981; Miyakawa & Zhao 1990; Ramadugu et al. 2016);  Citrus medica L. (Su & Matsumoto 1972; Nariani 1981);  Citrus halimii B.C. Stone (Ramadugu et al. 2016);  Citrus latipes (Swing.) Tan. (Ramadugu et al. 2016);  Citrus reticulata Blanco: Citrus reticulata (Tirtawidjaja et al. 1965; Tirtawidjaja 1981); Citrus depressa Hayata; Citrus keraji hort. ex Tan.; Citrus oto hort. ex. Yu. Tanaka and Citrus unshiu (Mack.) Marc (Miyakawa & Zhao 1990); Citrus leiocarpa hort. ex Tanaka (Ramadugu et al. 2016); Citrus sunki hort. ex Tanaka (Su & Matsumoto 1972; Miyakawa & Zhao 1990; Ramadugu et al. 2016); 19  Citrus trifoliata L.: Poncirus trifoliata (L.) Raf. (Martinez & Wallace 1969; Miyakawa 1980; Nariani 1981; Miyakawa & Zhao 1990; Koizumi et al. 1996; Ramadugu et al. 2016); trifoliate and hybrids (Gonzales et al. 1972); × Citroncirus sp. (Ramadugu et al. 2016);  Citrus × aurantiifolia (Christm.) Swingle: Citrus aurantifolia (Christm.) Swingle (Schwarz et al. 1973; Tirtawidjaja 1981; Miyakawa & Zhao 1990); Citrus × davaoensis (Wester) Yu. Tanaka) (Ramadugu et al. 2016);  Citrus × aurantium L.: Citrus hassaku hort. ex Tanaka, Citrus natsudaidai Hayata, Citrus nobilis Lour., Citrus sinensis (L.) Osbeck, Citrus paradisi Macfad. (Fraser & Singh 1969; Su & Matsumoto 1972; Nariani 1981; Miyakawa & Zhao 1990; Koizumi et al. 1993; 1994; 1996; Pelz–Stelinski et al. 2010; Fan et al. 2012); Citrus intermedia hort. ex. Tanaka, Citrus taiwanica Tan. & Shimada, Citrus neo-aurantium Tanaka, Citrus nobilis Lour., Citrus lycopersiciformis hort. ex. Tan., Citrus maderaspatna, Citropsis daweana Swing. & M. Kell (Ramadugu et al. (2016);  Citrus × insitorum Mabb.: (× Citroncirus webberi J. Ingram & H. E. Moore (Martinez & Wallace 1969, Nariani 1981, Miyakawa & Zhao 1990);  Citrus × junos Siebold ex Tanaka (Miyakawa & Zhao 1990);  Citrus × limon (L.) Osbeck: Citrus limon (L.) Burm. f., Citrus limonia Osbeck, Citrus meyeri Tan. (Tirtawidjaja 1981; Gonzales et al. 1972; Miyakawa & Zhao 1990); Citrus limettioides Tan.; Citrus excelsa Wester (Ramadugu et al. 2016);  Citrus longispina Wester (winged lime) (Ramadugu et al. 2016);  Citrus × volkameriana Osbeck: Citrus volkameriana Osbeck (Ramadugu et al. 2016);  Citrus × macrophylla Wester: Citrus macrophylla (Ramadugu et al. 2016);  Citrus × microcarpa Bunge (Su & Matsumoto 1972); × Citrofortunella microcarpa (Hu 2012); 20  Citrus × taitensis Risso: Citrus jambhiri Lush. (Tirtawidjaja 1981; Koizumi et al. 1993; 1994; Ramadugu et al. 2016);  Citrus × webberi Wester: Citrus webberi Wester (Ramadugu et al. 2016);  Limonia acidissima L. (Koizumi et al. 1996; Su et al. 1995; Hung et al. 2000);  × Microcitronella sp.: Citrus australasica × calamondin (Ramadugu et al. 2016);  Murraya paniculata (L.) Jack: Tirtawidjaja et al. (1981); Aubert et al. (1985); Li & Ke (2002); Damsteegt et al. (2010); Walter et al. (2012); Ramadugu et al. (2016); Murraya exotica L. (Lopes et al. 2010)  Pamburus missionis (Wight) Swingle: Atalantia missionis Oliver (Tirtawidjaja 1981);  Triphasia trifolia (Burm. f.) P. Wilson (Koizumi et al. 1996). A few species of Aurantioideae within the Clauseneae are recorded as hosts or possible hosts of ‘CLas’:  Bergera koenigii L. (Ramadugu et al. 2016);  Clausena indica Oliv. (Clausena indica (Dalz.) Oliver (Tirtawidjaja 1981); and  Clausena lansium (Lour.) Skeels (Tirtawidjaja 1981, Koizumi et al. 1996, Ding et al. 2005). Some species in the Rutoideae recorded as being host of ‘CLas’ are:  Casimiroa edulis La Llave & Lex. (Ramadugu et al. 2016);  Choisya ternata Kunth ‘Sundance’ (Hu 2012);  Choisya ternata Kunth × Choisya dumosa (Torr.) A. Gray: Choisya aztec ‘Pearl’ (Hu 2012);  Esenbeckia runyonii C.V.Morton (Hu 2012);  Zanthoxylum ailanthoides Siebold & Zucc. (Ramadugu et al. 2016); 21  Zanthoxylum fagara (L.) Sarg (Hu 2012). However, HLB infections in Casimiroa and Zanthoxylum species may be transient (Halbert, pers. com.) Some non–rutaceous species recorded as hosts of ‘CLas’ are:  Catharanthus roseus (L.) G. Don (= Vinca rosea L.) (Gentianales: Apocynaceae) (Tirtawidjaja 1981; Garnier & Bové 1983; Garnier et al. 1984b; Zhou et al. 2008);  Cleome rutidosperma (Capparales: Capparaceae) (Brown et al. 2011);  Cuscuta sp. (Solanales: Convolvulaceae) (Tirtawidjaja 1981);  Cuscuta australis R. br. (Solanales: Convolvulaceae) (Su & Huang 1990); Cuscuta campestris (Ghosh et al. 1977; Garnier & Bové 1983), and Cuscuta pentagona (Duan et al. 2008, Zhou et al. 2008);  Nicotiana tobacum L. (Solanales: Solanaceae) cited as Nicotiana xanthii (Garnier & Bove 1993)  Pisonia aculeate (Caryophyllales: Nyctaginaceae) (Brown et al. 2011);  Pithecellobium lucidum Benth (Fabales: Fabaceae) (Fan et al. 2011);  Solanum lycopersicum L. (Solanales: Solanaceae) (cited as Lycopersicon esculentum cvs. Manapal and FL47) (Duan et al. 2008); and  Trichostigma octandrum (Caryophyllales: Phytolaccaceae) (Brown et al. 2011). 1.2.5.3 Light and electron microscopy Schwarz (1965) reported the presence of a compound that exhibits a bright-violet blue florescence under ultraviolet light when extracts of fruit tissues infected with ‘Ca. L. africanus’ were separated using paper chromatography. The fluorescent substance was identified as gentisoyl glucose (Hooker 1993). Significant amounts occur in fruits of trees with leaves exhibiting severe HLB symptoms than in fruit of 22 trees less symptomatic foliage (Hooker 1993). Hooker (1993) concluded that gentisoyl glucose was not a specific test for HLB since increased levels of gentosoyl glucose were also found associated with diseases other than HLB (e.g., CTV). Phloem hyperplasia and necrosis caused by ‘CLas’, and starch accumulation resulting from degeneration of the phloem, were observed under light microscopy by Matsumoto et al. (1961) and, subsequentlyby others including Tirtawidjaja et al. (1965), Schneider (1966, 1968), Aubert (2008) and Su & Huang (1990). ‘Candidatus Liberibacter africanus’ was first observed by electron microscopy in sweet orange phloem in 1970 (Laflèche & Bové 1970). The technique was subsequently used by Catling et al. (1978), Bové & Garnier (1984) and Wu & Zhang (1985) to observe ‘CLas’, but it was not suitable for differentiating between ‘CLas’ and ‘CLaf’. Nevertheless, it remained the only technique for detection of the pathogens until 1992 (Garnier & Bové 1996). 1.2.5.4 Iodine starch test and plant metabolites Iodine starch test is based on Schneider (1968), who observed that starch accumulated in parenchyma cells of leaves infected with ‘CLaf’. Eng et al. (2007) described different iodine formulations and types of abrasive paper used in iodine starch test. Iodine formulations of 1.2% and 1% gave 90% positive results using leaves from PCR-positive honey mandarin trees. Increased levels of host-plant metabolites associated with HLB symptomatic leaves were reported by Manthey (2008) who detected high levels of hydroxycinnamates and flavonoids in HLB-infected leaves using reversed–phase high pressure liquid chromatography–mass spectrometry (HPLC–MS). HLPC–MS also detected higher concentrations of limonin glucoside in symptomatic leaves than in healthy leaves (Manthey 2008). 23 1.2.5.5 Serology and molecular techniques Bové (2006) noted that 13 monoclonal antibodies specific for the HLB pathogens were produced between 1987 and 1993, the number limited by the fact that the bacteria were not available in culture. However, the technique could not accurately separate ‘CLaf’ and strains of ‘CLas’ and was superseded by the use of molecular techniques (Garnier & Bové 1996). Villechanoux et al. (1992) were the first to use molecular techniques to detect the pathogens. They obtained two DNA probes, In-2.6 and AS-1.7, through differential hybridisation of DNA from infected and healthy periwinkle plants. The probes could detect strains from India, China, and Southeast Asia. Jagoueix et al. (1994) designed primers based on the sequence of these probes that amplify portions of the 16S rDNA of the Asian and African HLB strains: OI1 and OI2C from Asiatic strain and OI3c from the African strain. Jagoueix et al. (1996) used the same primers to amplify rDNA and showed that the pair OI1/OI2c amplified both ‘CLaf’ and ‘CLas’ while the pair O2c/OA1 amplified ‘CLaf’. Thus, in places where both ‘CLaf’ and ‘CLas’ were suspected, use of the OI2c/OI1/OA1 primers were recommended (Jagouiex et al. 1996; Bové 2006). Moreover, digestion of the amplified DNA with the restriction enzyme, XbaI, allowed distinction between ‘CLaf’ and ‘CLas’, producing two fragments of 520 bp and 640 bp for ‘CLas’, and three fragments of 520 bp, 506 bp and 130 bp for ‘CLaf’ (Jagouiex et al. 1996). Subsequently, another PCR method based on ribosomal protein genes of the beta operon using primers A2 and J5 was developed for distinguishing ‘CLaf’ from ‘CLas’ (Hocquellet et al. 1999; Bové 2006). A third putative HLB liberibacter species, ‘Candidatus Liberibacter americanus’ (‘CLam), was found in São Paulo, Brazil, in 2004 when attempts to detect ‘CLas’ in strongly symptomatic sweet orange plants using the primers OI1/OI2c/OA1 yielded negative results in contrast to the positive controls of ‘CLas’ and ‘CLaf’ (Teixeira et al. 2005b). This led to a new pair of primers, GB1 and GB3, for detection of ‘CLam’. 24 More recent PCR methods include:  nested PCR, where a second primer set is added to amplify the product of the first PCR, was used to analyze lemon and wampee samples regardless of HLB symptoms and was found to be 104 more sensitive than single step PCR (Ding et al. 2005). Multiplex PCR can detect all three forms of HLB pathogens in a single test using all the different primer sets together (Bové 2006; Li et al. 2006);  loop mediated isothermal amplification (LAMP) was developed to facilitate rapid detection of the HLB pathogens in laboratories without a thermocycler (Okuda et al. 2005) and has been adapted and improved over the years to detect ‘CLas’ in both plant and psyllid samples (Rigano et al. 2014; Manjunath et al. 2015); and  real-time PCR using 16S rDNA-based TaqMan primer-probes developed to provide rapid, sensitive and robust tests for ‘CLaf’, ‘CLam’ and ‘CLas’ (Li et al. 2006; 2007a). Comparison of results of the real-time PCR test designed by Li et al. (2006) used for detecting ‘CLas’ and assessments based on visual inspection of symptoms in Florida revealed that the incidence of infection was two-fold greater than determined by the visual inspections due to the test being able to detect the pathogen in asymptomatic tissues (Irey et al. 2006). Li et al. (2007a) compared conventional PCR, LAMP and TaqMan real-time PCR to assess their sensitivity, accuracy and specificity in detecting HLB pathogens. The results showed that TaqMan real-time PCR was 10–100 times more sensitive than conventional PCR or LAMP (Li et al. 2007a). Lin et al. (2010) developed a system comprising nested PCR and TaqMan PCR that can be performed sequentially in the same tube. This dual system involving two primer pairs and two different annealing temperatures proved to be a very sensitive and quantitative system to detect ‘CLas’. PCR has also been used to detect liberibacters in psyllids. Hung et al. (2004) used conventional PCR to detect ‘CLas’ in third, fourth and fifth instar, and adult Diaphorina citri, including single specimens. 25 Teixeira et al. (2005a) used conventional PCR with GB1/GB3 primer pair to detect ‘CLam’ in Diaphorina citri in Brazil. TaqMan based real-time PCR developed by Li et al. (2006) was adapted by Manjunath et al. (2008) to detect ‘CLas’ in Diaphorina citri in Florida. Psyllids collected from asymptomatic trees and locations where HLB was not confirmed tested positive for ‘CLas’ (Manjunath et al. 2008). This suggested that testing of psyllids may be a rapid means of determining the presence of HLB pathogens in regions where presence of the disease is suspected in the absence of symptomatic trees. Real-time and conventional PCRs were also used by Lee et al. (2015) to test both plant and psyllid samples for HLB in the experiment to determine the latent period for HLB. They (Lee et al. 2015) were able to show that HLB-free plants became infectious in less than 15 days of feeding by pathogen-bearing Diaphorina citri adults, as shown by HLB-positive second-generation adults and plant parts where the second-generation psyllid nymphs developed. Conventional and real-time PCR were used by Donovan et al. (2012a) to detect ‘CLas’ in adult Diaphorina communis collected in Bhutan. Real-time method of Li et al. (2006) and conventional PCR using primers A2/J5 (Hocquellet et al. 1991) were applied for detection of ‘CLas’ in the current study. 1.2.6 Psyllid fauna of Asia 1.2.6.1 Diaphorina citri Diaphorina citri was described by Kuwayama (1907) from males and females collected on citrus in Taiwan. It was described as Euphalerus citri (Kuwayama) by Crawford (1912), and this name was briefly used in literature (Lal 1917; 1918; Fletcher 1917; 1919, Crawford 1913; 1917; 1919). Crawford (1912) based his descriptions on one female from Adra (now in) West Bengal, India, previously described by JT Jenkins in 1909 (Husain & Nath 1927), and 17 specimens including both sexes, collected by George Compere from the Philippines. Crawford (1912) commented that Compere found the same insect in India on citrus trees in considerable numbers during a visit to India (in 1907). Crawford (1924) transferred the species to Diaphorina. Crawford (1919) and Kuwayama (1931) considered Diaphorina citri to be widely distributed and common throughout the Eastern 26 Hemisphere—in Taiwan, the Philippines, Malaysia, Indonesia (Java, Ambon, Moluccas) and southern China. Clausen (1933) noted its presence in Myanmar and Sri Lanka. Lal (1917; 1918), Fletcher (1917; 1919), Husain & Nath (1927), Pruthi & Batra (1938) and Pruthi & Mani (1945) mentioned it as pest in pre-partition India. It was recorded in Brazil about 1940, but not elsewhere in the Americas until 1998, when it was found in Florida (Halbert & Manjunath 2004). It has since spread rapidly in the Americas and continues to do so (Halbert & Manjunath 2004; Halbert & Núñez 2004; Halbert et al. 2010; Hall et al. 2013). It also occurs in Réunion and Arabia (Halbert & Manjunath 2004) and was recorded in New Guinea in 2002 (Weinart et al. 2004) and Pacific islands of Hawaii (Conant et al. 2006), Guam (Poe & Shea 2007), American Samoa (www.aphis.usda.gov) and Samoa (Richard Davis, pers. comm., 2012). It can transmit ‘CLaf’, ‘CLam’ and ‘CLas’ (Aubert 1987; Halbert & Manjunath 2004; Bové 2006; Lopes et al. 2010; 2013). In Bhutan, Diaphorina citri was recorded in Phuentsholing, a town in the south on the border with India, during surveys between 1972 and 1990 (Lama & Amtya 1991; Lama & Amatya 1993), but the psyllid is now found in 14 of the 16 citrus growing districts (NPPC report; pers. obs.). The presence of Diaphorina citri in southern China, as reported by Crawford (1919), was based on the collection of six specimens collected in Macau by Frederick Muir in November 1906. Mention of its presence in southern China by Clausen (1933) was most probably based on these specimens. It is not clear from the literature whether its distribution in southern China extended from Macau into Guangdong or elsewhere in mainland China, or whether specimens collected by Muir were from established populations. The host plant was not recorded (Crawford 1919). Huang (1953), citing Hoffmann (1936), stated that the psyllid was first recorded in Guangzhou in 1934. Hoffmann (1936) reported receiving adult specimen collected from lemon (Citrus × limon (L.) Osbeck), wong p’ei (wampee, huangpi: Clausena lansium (Lour.) Skeels), Kam (Citrus × aurantium L. as Citrus nobilis Lour.), Kat (Citrus × aurantium as Citrus nobilis Lour. var. delicosa (Ten.) Swingle)), sweet orange (Citrus × aurantium as Citrus sinensis Osbeck)), and pomelo (Citrus maxima (Burm.) Merr. as Citrus grandis Osbeck). By spring of 1935, both nymphs and 27 adults of Diaphorina citri were recorded feeding on different citrus plants in orchards at Lingnan University (now Zhongshan University) and nearby orchards on Honam Island, Guangzhou (Hoffmann 1936). A. Description of adult Diaphorina citri and sex ratio Husain & Nath (1927) cited Crawford’s (1912) description of the adult Diaphorina citri as: body length of 2.4 mm; generally brown coloured; variable abdomen colour from usual greyish brown to bluish or orange depending on the contents of the abdomen; orange abdomen colour related to gravid females or sexual maturity; antennae 10 segmented with black tips, and shorter than the head; forewings broadest at half of the apex and subhyaline. Halbert & Manjunath (2004) reported that Diaphorina citri has very clear wing pattern that allows for easy differentiation from other species. In contrast to Crawford (1912) and Husian & Nath (1927), Wenninger & Hall (2008) reported that females with green or bluish abdomens can be gravid and even males can have orange abdomens, and that abdomen colour has no relation to sexual maturity. The ratio of males to females is approximately 1:1. In field samples, Catling (1968b, 1970) recorded 44.8% males, and Aubert & Quilici (1988) 49% and 54.5% in separate samples. Males have abdomen tips bent upwards in contrast to the straight end of the females (Husain & Nath 1927). Adults are weak flyers and usually found feeding on the lower side of the leaves forming an angle of 30–45 °C to the leaf surface (Husain & Nath 1927; Hall et al. 2013). B. Life cycle and seasonal fecundity Husain & Nath (1927) reported that adults mate shortly after eclosion. Pande (1971) observed that mating took place 12–60 h after eclosion. The fecundity of Diaphorina citri females is high. Husain & Nath (1927) recorded up to 807 eggs per female, Pande (1971) 180–520, Huang (1990) up to 1,900 with averages ranging from 630–1230, Liu & Tsai (2000) a maximum fecundity of 748 eggs at 28°C on orange jasmine, and Tsai & Liu (2000), means of 858, 626, 572 and 612, and 28 maxima of 1378, 830, 818 and 994, respectively, on grapefruit, orange jasmine, rough lemon and sour orange seedlings. The eggs are about 0.3 mm long, almondshaped with a thick base that narrows towards the distal end with a curve. Newly laid eggs are pale and then turn yellow and subsequently orange just before hatching (Husain & Nath 1927). They may be laid on tender shoots in such large numbers that the shoots are rendered orange. Just before hatching, two red spots are visible that develop into the nymph’s eyes (Husain & Nath 1927). Incubation periods for eggs are influenced by ambient temperatures. Husain & Nath (1927) reported that egg hatch took 4–6 d in summer and 22 d in winter in the Punjab. Pande (1971) reported 4–6 d from late spring to mid autumn, and 8–18 d from late autumn to late winter in nearby Rajasthan (Pande 1971). Tsai & Liu (2000) observed that development took around 4 d at 25°C. Pre-oviposition period and fecundity are affected by light intensity and duration (Yang et al. 2006). They (Yang et al. 2006), citing Chinese literature, noted that light intensity below 11000 1x and light duration less than 18 h per day increased the number of eggs laid and pre-oviposition period. There are five nymphal instars (Husain & Nath (1927; Yang 1984). Husain & Nath (1927) reported a total duration of 11–25 d in the Punjab, with each instar lasting about 3 d in summer and 4 d in winter, the exception for first instar that lasted 11 or 12 d in winter. Catling (1970) reported development taking 11–15 d in the Philippines. Yang et al. (2006) noted that nymphal development, especially for females, depended on obtained nutrients from phloem. Husain & Nath (1927) reported a total life span of 15–47 d in the Punjab, and Pande (1971) 25–30 d from early spring to mid autumn, and 35–75 d from late autumn to late winter in Rajasthan. A similar trend of development was observed by Xu et al. (1988a) with an average period of nymphal development of 31.3 and 10.3 d in spring and summer, respectively, in Fujian. Females were observed to live longer with decreasing temperature when observed within a range of 15–33°C, average longevity of females was recorded 88 d at 15°C while individual female longevity was 117 d at 15°C, and 51 d at 30°C under 29 artificial conditions (Liu & Tsai 2000). Similar observation was made by Pande (1971) who recorded average longevity as 40 and 45 d for males and females, respectively. Husain & Nath (1927) noted that all stages of Diaphorina citri occur throughout the year in the Punjab, with slower development in winter. Most activity was observed when host plants produce new flush growth, particularly after monsoonal rain (Husain & Nath 1927). Husain & Nath (1927) recorded nine annual generations under experimental conditions, with considerable overlap between generations (Husain & Nath 1927). Pande (1971) reported up to 10 overlapping generations in Rajisthan. Literature reviewed by Yang et al. (2006) indicated that, depending on climate, 6–11 generations may occur in regions of China where the psyllid occurs, and that overwintering stages comprise mostly adults. Diapause does not occur (Husain & Nath 1927). In China, due to warmer winters in recent years, Diaphorina citri is now able to survive inland and in northern of regions where it did not occur previously (Yang et al. 2006). Yang et al. (2006) also noted that local weather conditions and host phenology are key factors in determining the active life stages during winter. All life cycle stages are active in the presence of young flush growth and favourable warm winter temperatures in Taiwan (Yang et al. 2006). In the absence of young flush growth in winter, only adults are present with restricted movement in Guangzhou in southern China. C. Acquisition and transmission of liberibacters by Diaphorina citri Huanglongbing is mainly spread in the field by Diaphorina citri (Halbert & Manjunath 2004). Early reports on acquisition and transmission of ‘CLas’ by Diaphorina citri include studies by Tirtawidjaja et al. (1965), Celino et al. (1966), Salibe & Cortez (1966), Capoor et al. (1967; 1974), Martin & Wallace (1967), Raychaudhuri et al. (1972), Huang et al. (1984; 1990) and Xu et al. (1985; 1988b; 1988c). 30 Following observations on the graft transmissibility of the disease by Salibe & Cortez (1966) in the Philippines, Celino et al. (1966) conducted transmission tests with adult Diaphorina citri collected from citrus orchards with mottling symptoms. The adults were allowed to feed on healthy sweet orange seedlings for two weeks or more. They (Celino et al. 1966) established that Diaphorina citri transmitted the disease. The results were confirmed using buds from symptomatic orange seedlings resulting from psyllid feeding to graft inoculate onto healthy seedlings of ‘szinkom’ and ‘ladu’ mandarins. All test plants showed symptoms within 90–150 d (Celino et al. 1966). Capoor et al. (1974) found that 68% of plants became infected when grown singly with a single psyllid that had fed on an infected plant for 24 h. A minimum acquisition period of 15 min was achieved with psyllids in groups of five when starved for 2 h before feeding. This resulted in 90% infection of the test plants. A low percentage of infection was achieved with feeding for 15 min, but 100% infection was achieved after feeding for 1 h. Capoor et al. (1974) reported a minimum incubation period of 8–12 d before transmission could occur. Xu et al. (1988b) reported that the incubation period could vary from 1–2 d or from 23–25 d depending on the psyllid. Pelz-Stelinski et al. (2010) reported 4–10% transmission with single psyllid compared to 88% infection with groups of 100 or more psyllids. Capoor et al. (1974) showed that psyllids remain infective throughout their lives after acquiring the pathogen. They (Capoor et al. 1974) also reported that fourth and fifth instars were able to acquire and transmit the pathogen in contrast to the younger instars, and higher numbers of nymphs feeding resulted in higher percent of infection as shown by 100% infection with 25 nymphs feeding on a test plant compared to 15% infection with a single nymph. Xu et al. (1988b; 1988c) reported that fourth and fifth instars could acquire and transmit the pathogen and that adults emerging from such nymphs were infective. Huang et al. (1984) obtained low transmission rates by adult Diaphorina citri with acquisition feeding and infection feeding periods of one month each. They reported that successful transmission was obtained with test psyllids that acquired the pathogen as nymphs. 31 Inoue et al. (2009) were the first to use PCR to confirm transmission of the disease by Diaphorina citri. Inoue et al. 2009 monitored the concentration of ‘CLas’ in fifth instar nymph and adult Diaphorina citri. They observed that the bacterial titre in the adults did not increase significantly, and the psyllids failed to transmit the pathogen on test plants compared to fifth instar nymphs. Titres increased significantly by 25-, 360- and 130-fold from the first acquisition day to 10, 15 and 20 d with acquisition by fifth instars leading to 67% transmission by emerging adults. They suggested that bacterium multiplies in the nymph, and the adults eclosing from infected nymphs are able to transmit the pathogen more effectively than adults that acquired the pathogen after eclosion. Pelz-Stelinski et al. (2010) reported similar results. Inoue et al. (2009) noted that the adult psyllids did not transmit the bacterium persistently after a 24 h acquisition period as suggested by Capoor et al. (1974), and attributed the different outcomes to different techniques and strains of the pathogen used in the two studies. Capoor et al. (1974) used indicator plants, whereas Inoue et al. (2009) used both conventional and quantitative PCR to detect infection. Huang et al. (1990) reported high transmission rates during the spring in Taiwan, the peak period for production of new flush by citrus trees. Chavan (2004) also reported that, in the Indian state of Maharashtra, maximum infection in nymphs (66.6%) and adults (45–50%) occurred in late winter and early spring. Transovarial transmission of ‘CLaf’ in Trioza erytreae was reported by van den Berg et al. (1991–1992). Hansen et al. (2008) reported transovarial transmission of ‘Candidatus Liberibacter solanacearum’ (syn. ‘Candidatus L. psyllaurous’), the cause of Zepra chip disease of potato, by Bactericera cockerelli (Šulc). Pelz- Stelinski (2010) reported 2–6% transovarial transmission of ‘CLas’ by Diaphorina citri in contrast to Capoor et al. (1974), Xu et al. (1988b) and Hung et al. (2004) reported no transovarial transmission of the pathogen by the psyllid. 1.2.6.2 Other psylloids known to feed on Rutaceae Several psyllid species other than Diaphorina citri and Trioza erytreae are known to feed on Rutaceae, including species and hybrids of Citrus. Only limited studies have 32 been undertaken to determine if they can transmit liberibacters. Species (some possibly conspecific: Kandasamy 1986; Burckhardt 1994; Inoue et al. 2006; Inoue 2010; Cen et al. 2012a) in Asia include:  Cacopsylla (Psylla) citricola (Yang & Li);  Cacopsylla (Psylla) citrisuga (Yang & Li);  Cacopsylla (Psylla) evodiae (Miyataki);  Cacopsylla heterogena Li; (Li 2011 cited by Cen et al. 2012a); Chapter 6 of the current study;  Cacopsylla (Psylla) murrayi (Mathur);  Cacopsylla toddaliae (Yang);  Diaphorina communis Mathur;  Diaphorina murrayi Kandasamy; and  Trioza citroimpura Yang & Li. Burckhardt (1994) commented that Cacopsylla citricola and Cacopsylla citrisuga may be identical to Cacopsylla murrayi. Diaphorina communis was first collected on curry leaf at Dehra Dun (700 mASL), Uttar Pradesh, northern India, in 1932 (Mathur 1935), but it was not described until four decades later (Mathur 1975). Diaphorina mathuri Loginova is a synonym of Diaphorina communis (Hodkinson 1986). Other hosts include orange jasmine and citrus (Mathur 1975). It was reported as major pest of curry leaf in the Jammu region of India by Tara & Sharma (2010). It was recently recorded as host of ‘CLas’ in Bhutan (Donovan et al. 2012a; Chapter 3 of the current study), where it has been recorded on citrus and more commonly, on curry leaf at elevations ranging from ~200 to 1223 m ASL. Mathur (1975) provided keys and complete descriptions to distinguish nine species of Diaphorina, including Diaphorina citri and Diaphorina communis, from each other. Key distinguishing features separating adult Diaphorina communis from other 33 Diaphorina species are that they are black with more densely maculated wings. The shape of the head, genal cones and genitalia are also distinguishing features. The following description of Diaphorina communis adults is based on Mathur (1935, 1975). The wings and body are generally black with greyish-brown tinge. The body length of males (2.1 mm) is shorter than that of females (2.4 mm). The head is smaller than the thorax, and 0.6 mm wide, including the eyes. Antennae are 10segmented, 0.52 mm long and pale-yellow with few setae. The thorax is arched and sparsely pubescent. The pronotum is flat, convexly round when viewed dorsally. The legs are coarsely pubescent. The tibiae are longer than femora. Hind tibiae lack a basal spur but have seven tooth-like spines at the apex. The forewings are large and more than two times longer than wide, widest subapically, roundish at the apex and narrow at the base. The first marginal cell is almost equal in length and width, but shorter and wider than the second. Each of the four cells has one spot, two spots present between Cu1 and Cu2 and 1 spot near the clavus; veins are lined with two rows of tiny setae. The hind wings have 7 or 8 simple, and 4–6 hooked setae on the coastal margin. The abdomen is long and has sparse hairs. Male genitalia are smaller than the abdomen, and the anal valve is pyriform in shape and about 0.38 mm long. Female genitalia are smaller than the abdomen and the ovipositor is pointed. Mathur (1975) also described the five nymphal instars. The nymphs cause little damage to curry leaf plants if present in small numbers, but when they are numerous, the leaves wilt and fall off gradually, and young growth can be killed completely and tender branches deformed (Mathur 1935). The female lays her oval (0.26 × 0.14 mm), smooth and light yellowish eggs singly scattered about in leaf axils on the ventral surface of leaflets and tender branches (Mathur 1935). Mathur (1935) recorded a female laying 600 eggs over 35 d in summer, and egg hatch in 3–5 d in summer, 4–6 d in autumn and 9–14 d in late winter. Full grown fifth instars are about 1.62 mm long and 1.45 mm wide, dark grey with a green tinge and black antennae. The abdominal margin of fifth instar is lined with 45–50 lanceolate setae (Mathur 1975). 34 Mathur (1935) observed that all instars could walk at a steady pace and exude large quantities of honeydew in the form of translucent filaments. He (Mathur 1935) also observed:  that nymphal development varied from 11–37 d in summer, 66–79 d in winter, and 33–40 d in spring;  that the longevity of males and females in summer was 59 and 45 d, respectively;  that female longevity was longer in the cold season than in summer;  that all developmental stages were present on the host plant from mid spring to mid autumn;  nine annual generations, with considerable over-lapping; and  life cycles of 14–41 d in summer, 70–83 d in winter, and 47–54 d in spring. Cacopsylla citricola and Cacopsylla citrisuga were collected from pomelo (Citrus maxima (Burm.) Merr.) and citron (Citrus medica L.) trees at elevations ranging from 750 to 1650 mASL in western Yunnan (Yang & Li 1984). The latter (Figure 1.6) was collected from a pomelo tree by GAC Beattie at Dura Sakalgre (25.4983°N, 90.2932°E, 1190 m ASL) in the Garo Hills of Meghalaya, India, on 25 October 2009. These records suggest that Cacopsylla citricola occurs on Citrus at 700–1800 m ASL in humid subtropical regions of Laos, Myanmar, Yunnan in China, and Meghalaya, Nagaland, Manipur and Mizoram in northeast India (Beattie et al. 2012). ‘Candidatus Liberibacter asiaticus’ was recently detected in Cacopsylla citrisuga nymphs collected 1200 mASL from ‘Eureka’ lemon (Citrus × limon L.) trees in Yunnan (Cen et al. 2012a) and subsequently reported to transmit the pathogen (Cen et al. 2012b). Inoue et al. (2006) recorded Cacopsylla evodiae feeding on orange jasmine in Japan, and noted that it occurs on Tetradium glabrifolium (Champ. ex Benth.) T. G. Hartley (cited as Euodia meliifolia (Hance) Benth.) [Rutoideae] and feeds on ‘Zanthoxylum beecheyanum var. alatum (Nakai) Hara’ [Rutoideae]. Inoue (2010) listed Toddalia asiatica (L.) Lamarck [Rutoideae] as another host, and noted that Cacopsylla evodiae 35 is probably most closely related to Cacopsylla murrayi and similar to Cacosylla toddaliae (Yang), which feeds on Toddalia asiatica in both Taiwan and Japan, and Cacopsylla fagarae (Fang & Yang), which feeds on Zanthoxylum cuspidata Champ. (cited as Fagara cuspidata (Champ.) Engl.) in Taiwan (Beattie et al. 2012). Cacopsylla murrayi has been recorded on curry leaf, citron, acid lime (Citrus × limon (L.) Osbeck, cited as Citrus acida Korel) and sour orange (Citrus × aurantium L.) in northern India (Mathur 1975; Lahiri & Biswas 1979; 1980). Osman & Lim (1992) recorded it feeding on curry leaf plants in Malaysia, and observed it occasionally on citrus plants. Comments by Lahiri & Biswas (1980) suggest that it may have been introduced to Meghalaya. They (Lahiri & Biswas 1980) reported that it inflicted great loss to citrus cultivation: foliage of infested plants became deformed, resulting in a depleted photosynthetic activity over and above the loss caused by intake of plant sap by the nymphs (Beattie et al. 2012). Cacopsylla toddaliae occurs on Toddalia asiatica (L.) Lam. [Rutoideae] in Japan and Taiwan (Inoue 2010). Diaphorina murrayi was recorded on curry leaf by Kandasamy (1986) in Chennai (Madras) in Tamil Nadu, Southern India. Prior to my study, Cacopsylla heterogena was known to occur on citrus in China (Li 2011, Cen et al. 2012a). Adult males (42) and females (24) of Trioza citroimpura were collected and described from mandarin trees 540 mASL in southern Yunnan (Yang & Li 1984), near the Laos and Myanmar. Prior to this record, Trioza erytreae was the only species of Trioza known to feed and develop on Rutaceae (Hollis 1984; Beattie et al. 2012). 36 Figure 1.6. Diaphorina communis adult on a mandarin leaf at Kamichhu, Bhutan, May 2009 (left); adult of Cacopsylla citrisuga on pomelo flush at Dura Sakalgre, Garo Hills, Meghalaya, India (right) (GAC Beattie). 1.2.7 Molecular markers used in the phylogenetic studies of plants Molecular techniques such as DNA sequencing are fast, convenient and produce large distinct data sets and have become a widely-used tool for phylogenetic studies (Johnson & Soltis 1994). In plants, chloroplast DNA (cpDNA) has been widely used to infer phylogenetic relationships at different levels, because it has a stable genetic structure, is haploid and generally uniparentally inherited, there is no (or very rare) recombination, and universal primers can be used to amplify target sequences (Palmer et al. 1988; Taberlet et al. 1991; Gielly & Taberlet 1994; Small et al. 2004; Dong et al. 2012). It comprises of protein coding regions, and introns and intergenic spacers that do not encode proteins usually referred to as non-coding regions (Shaw et al. 2007). The non-coding regions evolve more rapidly and contain greater variation than the coding regions (Shaw et al. 2005; 2007; 2014) that is applicable for lower taxonomic levels (Small et al. 2004; 2005). Many of the non-coding regions have been used in the molecular phylogeny of a wide range of plants including those belonging to the Rutaceae (Nocolasi et al. 2000; Morton et al. 2003; Bayer et al. 2009; Morton 2009 & 2015; Lu et al. 2011; Nguyen 2011; French et al. 2016). However, because cpDNA is uniparentaly inherited, it reveals information of only one parent, and limits the use of cpDNA in plants of hybrid and polyploid origins (Small et al. 2004). This limitation is compensated by use of the nuclear ribosomal DNA (rDNA). 37 Although rDNA is ‘biparentally inherited, the process of concerted evolution, array expansion/contraction and the presence of paralogous sequences can make isolation of both parental copies difficult’ (Small et al. 2004). The interal transcribed spacer (ITS) of 18S-26S nuclear rDNA, which includes the 5.8S subunit, an evolutionarily highly conserved sequence, and two spacers known as ITS-1 and ITS-2 is commonly used for plant phylogenetics (Baldwin 1992; Baldwin et al 1995; Álvarez &Wendel 2003) and has been used in Rutaceae (Morton 2009 & 2015; Othman et al. 2010; Nguyen 2011; French et al. 2016). Other nuclear genes employed in molecular phylogeny of plants includes the lowcopy nuclear genes: Adh (alcohol dehydrogenase), G3PDH (glyceraldehyde 3phosphate dehydrogenase), GBSSI (granule-bound starch synthase), MADS-box genes (e.g. pistil/ala, apetalal, apetala3, leafY), PHY (phytochrome) and PGI (phospho-glucose isomerase (Small et al. 2004), hyb (beta-carotene hydroxylase) and mdh (malate dehydrogenase) (Schwartz 2011; Schwartz et al. 2015). Sang et al. (2002) commented that although low-copy nuclear genes in plants are a ‘rich source of phylogenetic information’ and have the potential to improve phylogenetic reconstruction and resolve close interspecific relationships (especially where universal markers such as cpDNA and rDNA are unable to do so), they remain underutilised because of complicaitons related to evolutionary dynamics of nuclear genes, and lack of universisal markers or primers. 1.2.8 Genes and molecular markers used in insect phylogeny In insects, the most commonly studied regions are those within the mitochondrial DNA (mtDNA) and the nuclear ribosomal DNA (rDNA) (Zhang & Hewitt 1997; Caterino et al. 2000; Cameroon 2014). The frequently used mtDNA genes and regions are COI and COII (cytochrome oxidase I & II), and 16S rDNA, followed by 12S rDNA, COIII, ND5 (NADH dehydrogenase 5), cytb (cytochrome b) with ND1, ND2, and ND4 being less commonly used (Hwang & Kim 1999; Caterino et al. 2000; Mandal et al. 2014). For the nuclear rDNA, the 18S rRNA is used for higher taxonomic levels, and popular regions for lower levels are the ITS and 28S regions; among the nuclear protein-coding genes, EF-1α (elongation factor 1-alpha) PEPCK 38 (phosphoenolpyruvate carboxykinase), DDC (dopa-decarboxylase), wingless, white gene among others have been used (Caterino et al. 2000; Danforth et al. 2005; Simon et al. 2010). 1.2.9 Natural enemies and biological control There are two primary parasitoids of Diaphorina citri, the ectoparasitic eulophid, Tamarixia radiata (Waterston) (Hymenoptera: Eulophidae), and the endoparasitic encyrtid, Diaphorina aligarhensis (Shafee, Alam and Agarwal) (Hymenoptera: Encyrtidae). A number of hyperparasitoids are associated with them in Southeast Asia, with species composition varying across the region (Waterhouse 1998; Halbert & Manjunath 2004). Both primary parasitoids were described from India, Tamarixia radiata as Tetrastichus radiatus by Waterston (1922) and Diaphorina aligarhensis by Shafee et al. (1975), and both species have been introduced, or spread naturally, to regions to where Diaphorina citri has spread (Beattie et al. 2012). Tamarixia radiata adults are 0.92–1.04 mm long with a black body, and hyaline wings with pale veins. They have a short generation time and high reproduction under laboratory conditions with total development period of 11.4 d. Females lay 1– 2 eggs under Diaphorina citri nymphs, and pupation takes place in the mummified nymphs (Mann & Stelinski 2010). Adults of Tamarixia radiata emerge from the thorax of the nymph leaving an exit hole (Aubert 11987). Diaphorencyrtus aligarhensis adults are ~1–1.5 mm in length with yellow legs and antennae, black head and thorax. Sexual dimorphism is exhibited by differences in the morphology of antennae and the abdomen: females have smooth, clubbed antennae while males have hairy and slightly longer antennae that are not clubbed (Rohrig 2011). The total life cycle takes about 16–18 d under laboratory condition at 25°C (Rohrig 2011). One to two weeks-old females produced an average of 6.6 offspring under laboratory conditions (Skelly & Hoy 2004). nd aligarhensis parasitises 2 Diaphorencyrtus th to 4 instar nymphs of Diaphorina citri by ovipositing, usually, a single egg into the host. Diaphorina citri nymphs continue to feed and grow after parasitism until they are killed by the developing parasitoid. The mature 39 parasitoid leaves the mummified body of the Diaphorina citri nymph through its abdomen (Rohrig 2011). The introduction of both parasitoids to Réunion led to successful biological control of their host (Aubert et al. 1996). Chien et al. (1989) introduced Tamarixia radiata to Taiwan from Réunion in 1983–1986 to control Diaphorina citri; its establishment was confirmed by March 1986. Although it was well established by 1987, parasitism was variable (Chien et al. 1989). Chien et al. (1989; 1991) considered Diaphorina aligarhensis to be indigenous to Taiwan, and to be quite active in host searching. However, its rare occurrence during January to May results in resurgence of Diaphorina citri in spring (Chien et al. 1989). Chien et al. (1991), and Chein & Chu (1996) reported that the efficacy of Tamarixia radiata and Diaphorina aligarhensis as parasitoids of Diaphorina citri was influenced by environmental stability. Chien & Chu (1996) reported that populations of Diaphorina citri were kept at 0 to 0.7 adults per 100 mm of branch under a stable environment, whereas they reached 0.1 to 2.5 adults in an area where host plants were pruned every 3–4 months and insecticides were sprayed. Gavarra et al. (1990) reported that Diaphorina aligharensis was the more important of the two species in orchards in Luzon and Mindanao in the Philippines where average parasitism over one year ranged from 8.5–31%, and 10–70%, respectively. Over the same interval, parasitism by Tamarixia radiata ranged from 0.3–67% and 6.7% to 22.2%, respectively. Average percent parasitism by Diaphorina aligarhensis and Tamarixia radiata in Luzon (n = 2977 nymphs) was 16.3% and 6.2%, respectively. Average percent parasitism by the two parasitoids in Mindanao (n = 620) was 36% and 10.8%, respectively. Leong (2006) reported that parasitism by Tamarixia radiata and Diaphorina aligharensis in Sarawak ranged from 4.4– 22.3% and 2.6–35.3%, respectively. Peak parasitism by the two species occurred in November and December and coincided with peak abundance of Diaphorina citri. In Malaysia, parasitism suspected to be from Tamarixia radiata ranging from 20% in January to 36% in May on fourth and fifth instars of Diaphorina citri on Murraya 40 paniculata were observed during field surveys (Osman & Lim 1992). Introduction of Tamarixia radiata to Guadeloupe successfully reduced Diaphorina citri populations (Étienne et al. 2001). In Mauritius, biological control of Diaphorina citri using Tamarixia radiata was not successful in contrast to the control of Trioza erytreae by its parasitoid, Tamarixia dryi (Toowara 1998). Toowara (1998) noted that the success of control of Trioza erytreae was because its parasioid was able to survive on another host when citrus had no flush growth and population of Trioza erytreae was low but Tamarixia radiata did not have an anternaive host while its host, Diaphorina citri, flourished on Murraya in the absence of citrus flush. Biological control with Tamarixia radiata and Diaphorina aligarhensis was initiated in the United States of America but Diaphorina aligarhensis failed to establish (Hall 2008). More recently, Tamarixia radiata has been released in California (Hoddle 2012). However, the parasitism rates of Tamarixia radiata in Florida are lower than in Réunion and other locations (Hall & Nguyen 2010). Environmental factors, competition with other organisms, genetic traits, chemical and nutrient sprays in the orchards could all affect the efficiency of Tamarixia radiata (Hall & Nguyen 2010), and these factors probably affect biological control by other natural enemies. Species of ladybirds (Coleoptera: Coccinellidae), hoverflies (Diptera: Syrphidae), lacewings (Neuroptera: Hemerobiidae, Chrysopidae), bugs (Hemiptera: Reduviidae) and spiders (Aranae: Anyhpaenidae, Clubionidae, Salticidae, Oxyopidae) prey on the adults and nymphs (Waterhouse 1998; Michaud 2002). Aubert (1987) reported that the Citrus sooty mould fungus, Capnodium citri Berk. & Desm. (Polychaeton citri (Persoon) Léveillé) (Capnodiales: Capnodiaceae) (Reynolds 1999; Chomnunti et al. 2011), caused fungal epizootics affecting artificially reared Trioza erytreae and Diaphorina citri nymphs when the relative humidity was at saturation point. Aubert (1987) also cited Grech & Samways (1985), who reported that Cladosporium sp. nr. oxysporum Berk. & M.A. Curtis (Capnodiales: Davidiellaceae) caused death and hyphal growth on Trioza erytreae 41 nymphs. Samways & Gretch (1986) reported that this species caused death and hyphal growth on Trioza ertyreae nymphs, and that it had a considerable initial impact on populations of the psyllid in the field. Hall (2008) cited Aubert’s (1987) report on sooty mould fungus and Cladosporium Link. However, Aubert’s report for the sooty mould fungus was erroneous due to misidentification (Bernard Aubert, pers. comm. with Andrew Beattie, 28 January 2013). Hirsutella citriformis Speare (Hypocreales: Ophiocordycipitaceae) and another fungus, Isaria fumosorosea Wize (syn. Paecilomyces fumosoroseus (Wize) A.H.S. Br. & G. Sm) (Eurotiales: Trichocomaceae) were found infecting adult Diaphorina citri in citrus orchards in Indonesia (Subandiyah et al. 2000). Étienne et al. (2001) recorded low levels of Hirsutella citriformis infection of nymphs and adults of Diaphorina citri in the humid areas of Guadeloupe. In a recent two year study in Florida, Hall et al. (2012) found high numbers of adult Diaphorina citri infected with Hirsutella citriformis during the humid summer of the first year but not during the second year. Hall et al. (2012) attributed low incidence of dead psyllids to low psyllid populations and application of copper and mineral oil sprays in the orchards during the second year. Exposure of uninfected adult psyllids to Hirsutella citriformis infected Diaphorina citri resulted in the death of the former psyllids within 7–9 d (Subandiyah et al. 2000; Meyer et al. 2007; Hall et al. 2012). In contrast, Isaria fumosorosea killed psyllids within 3 d (Meyer et al. 2007). This difference in the rapidity of parasitism is probably due to the mechanism involved. Hirsutella citriformis penetrates into the haemolymph of the psyllid and grows until the host dies, whereas Isaria fumosorosea does not appear to enter the haemolymph but rather releases toxins to kill the psyllids then utilises the dead insect for development (Meyer et al. 2007; 2008). Species of entomopathogens associated with Diaphorina citri in China include Acrostalagmus aphidum Oudem (Hypocreales: Hypocreaceae), Isaria (Paecilomyces) javanicus (Friederichs & Bally) Samson & Hywel-Jones (Eurotiales: Trichocomaceae), Lecanicillium lecanii (Zimm.) Zare & W. Gams (Hypocreales: incertae sedis) (syn Cephalosporium lecanii Zimm. and Verticillium lecanii (Zimm.) 42 Viégas), and Beauveria (Balsamo) bassiana Vuillemin (Hypocreales: Clavicipitaceae) (Yang et al. 2006). Hall (2008) cited Isaria fumosorosea, Hirsutella citriformis, Lecanicillium lecanii, Beauveria bassiana, Cladosporium sp. nr. Oxysporum Berk. & M.A. Curtis, and Capnodium citri Berk. & Desm as entomopathogens of Diaphorina citri. Notwithstanding the effectiveness of these natural enemies and impacts of orchard chemicals on their effectiveness, biological control has limited scope in orchards where HLB is present (Halbert & Manjunath 2004). Reliance on it is limited to suppression of Diaphorina citri populations on Citrus and other hosts in home gardens, parks and recreational areas. 1.2.10 Impacts of heat therapies on Citrus liberibacters ‘Candidatus Liberibacter asiaticus’ is more heat tolerant than the other two citrus liberibacters, ‘CLaf’ and ‘CLam’ (Bové 2006; da Graça 2008; Lopes et al. 2010; Lopes et al. 2013). Several studies have been undertaken on the impacts of heat therapies on the pathogens. Early work by Lin & Lo (1965) showed that ‘CLas’infected trees treated with vapour saturated hot air at 48, 49, and 50 °C for 31, 35, or 40 min recovered after treatment and remained healthy for 28 months. Martinez et al. (1971) demonstrated that 70% of the budsticks from infected tree treated in a hot water bath at 45°C for 5 h survived the treatment and when budded onto healthy seedlings, 35.7% of the budded trees did not show HLB symptoms. They (Martinez et al. 1971) also treated infected seedlings with dry heat at 45°C for 5 h. Buds from treated seedlings when budded onto test plants, some showed symptoms while some did not. Similar tests with a hot water bath and with moist air were also conducted by Raychaudhuri et al. (1974). Hot water treatment of buds at 50°C for 30 min yielded viable buds and none of the plants produced HLB symptoms (6 of 6). Similarly, buds treated with hot, moist air at 45°C for 6 h, and 47°C for 4 h resulted in 100% viable buds but with only 5 of 8 plants in both treatment with no HLB symptoms. Plants placed in a hot water bath at 55°C for 15 min resulted in only 2 out of 6 plants remaining HLB-free, while treatment with hot moist air at 51°C for 1 h did not yield any HLB-free plants (0/8 plants) though plants produced viable buds 43 in boht instances (Raychaudhuri et al. 1974). In Taiwan, separate studies conducted by Su & Chang (1976) and Huang (1978) demonstrated recovery of infected seedlings. Su & Chang (1976) observed recovery of seedlings of Ponkan orange on Rangpur lime treated with hot air at 40°C in a growth chamber for 10 d whereas reducing the days to three or seven did not suppress infection. Diseased seedlings held at 30 and 40°C for 8 and 16 h cycle resulted in notable recovery of the plants with healthy normal shoots (Su & Chang 1976). Huang (1978) demonstrated that diseased buds grafted on Rangpur lime treated at 40°C during the light and 30°C during the dark for 4 weeks or longer showed no HLB symptoms after two years. Cheema et al. (1982) obtained a low incidence (20%) of HLB when infected buds were treated at 47°C for 2 h and then budded onto grapefruit seedlings. Lopes et al. (2013) observed low ‘CLas’ titres in plants maintained at 24–38°C compared to plants held at 12 to 24°C or 18 to 30°C. Hoffman et al. (2013) used a 16 h light period at 40°C and an 8 h dark period at 30°C for four months to heat-treat dormant budwood of grapefruit, sweet orange, lemon and pomelo. Their results showed that only 12.5% (3 of 24) of treated budwood was ‘CLas’ positive after 12 months of treatment compared to 52% (11 of 21) for untreated budwood. In a separate experiment, 2.5 years old grapefruit plants were exposed to 42°C for 19 h and 30°C for 5 h, and 45°C for 16 h and 30°C for 8 h for a period of 2, 4, and 6 d with intermittent cooler periods to reduce heat damage to the trees (Hoffman et al. 2013). All 27 surviving test plants had undetectable level of the pathogen 60 d after treatment (Hoffman 2013). 1.2.11 Impacts of altitude, ambient temperatures and relative humidity on ‘CLas’ and its vector Aubert et al. (1985; 1988), and Yang et al. (2006) reported that the incidence of Diaphorina citri on its Citrus hosts declined with increasing altitude above sea level. Aubert (1987) observed that Diaphorina citri was more sensitive to high rainfall and humidity. Beattie et al. (2012) suggested that high saturation deficits favour Diaphorina citri. This suggestion was based on observations in Pakistan where 44 ambient temperature recorded were ≥ 45°C at 160 to > 600 m ASL, and in Bhutan where ambient temperatures of 36°C can occur at 1300 to 1500 m ASL. Beattie et al. (2012) also noted that, in contrast to observations made by Liu & Tsai (2000), Diaphorina citri can thrive at ambient temperatures above 33°C if relative humidity is not high. In Bhutan, Diaphorina citri and HLB are common in orchards near Punakha (27.5805°N, 89.8653°E, 1200 m ASL) where the saturation deficits exceed 0.55 kPa (Beattie et al. 2012). Beattie et al. (2012) assumed that, under such conditions, the psyllid can survive due to the impacts of evaporative cooling on leaf temperatures and psyllid body temperatures. Hoffman et al. (1975) observed increased survival of the psyllid, Acizzia russellae Webb & Moran (Hemiptera: Psylliade) on the host plant (Acacia karoo Hayne, Fabales: Fabaceae) at 43°C and 46°C and saturation deficits at 30–40 mm Hg (= 5.33 kPa) compared to lower or higher saturation deficits under laboratory conditions. They (Hoffman et al. 1975) hypothesised evaporative cooling by the host plant or the psyllid at these ranges caused the increased survival whereas death due to less evaporative cooling and thermal condition, and dessication occurred at low and very high saturation deficits respectively. Preliminary experiments with potted trees conducted in China on the effect of saturation deficits and high leaf temperatures on ‘CLas’ showed low titres of the pathogen in plants kept in clear polycarbonate cylinders compared to plants kept at ambient temperature and humidity during September and October (Beattie et al. 2012). Leaf temperatures were also higher in the cylinder caged plants than the control plants. 1.3 Aims and objectives The overall aim of the study was to determine the roles of vectors, environment and potential host species in the aetiology of huanglongbing in Bhutan. The specific objectives of the research were to determine:  the phylogenetic relationships between Diaphorina citri; 45 Diaphorina communis and  whether Diaphorina communis can acquire ‘Candidatus Liberibacter asiaticus’ from mandarin and transmit it from mandarin to mandarin and from mandarin to curry leaf or vice versa, and to study the host preferences of Diaphorina communis;  the molecular and morphological characteristics of the parasitoid of Diaphorina communis, and to determine the phylogenetic relationships between the parasitoids collected from Diaphorina communis and Diaphorina citri;  the effect of altitude, ambient temperature and relative humidity on leaf temperature, and determine the incidences and types of psyllids, and prevalence of ‘CLas’ at different elevations;  the morphological and molecular characteristics of the green psyllids found on mandarin and wild citrus, and other psyllids found on an unidentified Zanthoxylum sp., and to determine the presence of ‘CLas’ within the green psyllids and their host plants; and,  the phylogenetic and morphological relationships of species of Murraya occurring in Bhutan with those proposed by Nguyen (2011), to determine the phylogenetic relationship of the wild citrus species found in Bhutan in relation to other Citrus species and hybrids, and whether the Murraya species and wild citrus found in Bhutan can be hosts for ‘CLas’. 46 Chapter 2: Phylogenetic analysis of Diaphorina communis Mathur and Diaphorina citri Kuwayama ___________________________________________________________________ 2.1 Introduction Diaphorina communis was first recorded by Mathur (1935; 1975) on curry leaf (Bergera koenigii L., cited as Murraya koenigii Spreng.). Mathur (1935) noted that: females could lay 600 eggs in 35 d; nymphal development varied from 11–37 d in summer, 66–79 d in winter and 33–40 d in spring; and males lived for 45 d in midsummer and females for 59 d. Morphologically, adult Diaphorina communis are mostly black (Mathur 1975) and are easily distinguished from adults of Diaphorina citri Kuwayama, which are mostly brown (Figure 2.1). However, the nymphs of the two species are similar with key distinguishing features detectable only in fifth instar nymphs. The fifth instar nymphs of Diaphorina communis are dark grey with a green tinge, black abdomen and antennae, and a margin lined with 45–50 lanceolate setae (Mathur 1935, 1975). In contrast, the fifth instar nymphs of Diaphorina citri are light yellow with an orange tinge, dark antennae, and 53–60 lanceolate setae on the margin of their abdomen (Husain & Nath 1927) (Figure 2.2). Molecular data can supplement morphological characters particularly when challenged with identification of nymphs. Thus, this chapter focuses on molecular differences between Diaphorina communis and Diaphorina citri using the mitochondrial COI and 16S regions. 47 2.2 Material and methods 2.2.1 Specimen collection and DNA extraction Adult specimens of Diaphorina communis were collected by tapping branches of Bergera koenigii L. (curry leaf) onto a white enamel tray, and aspirating the adults falling on the tray into a glass vial. Adults were collected from four sites, at Basochhu (27.3646°N, 89.9124°E, 1036 m ASL) and Basochuu 2 (27.4136°N, 89.9036°E, 1223 m ASL) in Wangdue Phodrang Dzongkhag (district), Sunkosh (Dagana-Tsirang Highway Junction (27.02789°N, 090.07511°E, 391 m ASL), and at Reldri (Rinchending-Pasakha Highway, 26.8400ºN, 89.4045ºE, 400 m ASL) in Chukhha Dzongkhag. Extraction of DNA from psyllids and PCR analysis were performed in the Molecular Laboratory of the School of Science and Health (SSH), Western Sydney University, Hawkesbury Campus. Psyllid genomic DNA was extracted from specimens stored in 100% ethanol. Each specimen was placed in a 1.5 mL tube and washed with 100 µL of 2% bleach plus Triton X-100 for 1 min with gentle vortexing and rinsed three times with Milli Q water. Then, DNA was extracted by crushing the washed specimen with a sterile plastic pestle in a new 1.5 mL tube using the ISOLATE II Genomic DNA Kit (Bioline). The pre-lysis incubation was performed overnight at 56ºC and 300 rpm in a shaking incubator. During the DNA elution step, DNA was eluted in 80 µL of elution buffer and stored at −20°C until further use. 2.2.2 Amplification of Diaphorina communis DNA for phylogenetic analyses The COI region was amplified by conventional PCR (cPCR) using primers DCITRI COI-L (5′-AGG AGG TGG AGA CCC AAT CT) and DCITRI COI-R (5′- TCA ATT GGG GGA GAG TTT TG) (Boykin et al. 2012). Reactions were performed using 2 µL of template DNA in a 20 µL reaction volume following the GoTaq® Flexi DNA polymerase (Promega) protocol with final concentrations of 2.5 mM MgCl2, 0.24 mM dNTP mix (Bioline), 0.4 µM of each primer and 1.25 U of GoTaq 48 Flexi DNA polymerase. The cycling parameters used by Boykin et al. (2012) were applied: initial denaturation at 94°C for 2 min followed by 35 cycles of 30 sec denaturation at 94°C, 30 sec annealing at 53°C, 1 min extension at 72°C followed a final step of extension of 72°C for 10 min. 49 Figure 2.1. Adults (top) and nymphs (bottom) of Diaphorina communis on Bergera koenigii (Photos: N. Om & GAC Beattie). 50 Figure 2.2. Scanning electron micrographs of the abdomens of fifth instar nymphs of Diaphorina communis (A) and Diaphorina citri (B) showing the differences in marginal setae. The 16S region was amplified using the same reaction mixtures as for the COI but using the primers, LR13943F (5’-CAC CTG TTTA TCA AAA ACA T-3’) and LR13392R (5’-CGT CGA TTT GAA CTC AAA TC-3’) (Costa et al. 2003). PCR conditions for the 16S gene were adapted from Costa et al. (2003) with an initial denaturation at 94°C for 5 min, followed by 40 cycles of denaturation at 94°C for 1 min, annealing at 42°C for 90 sec, extension at 64°C for 90 sec followed by a final extension at 64°C for 5 min. 2.2.3 Post PCR and sequencing The PCR products were subjected to electrophoresis in 1% agarose containing GelRed (0.1 L/mL, Biotium). Gel images were visualized under a UV transilluminator and acquired with a GelDoc (BIORAD). Successful amplifications were selected for sequencing. Prior to sequencing, PCR products were cleaned with a mixture of thermosensitive alkaline phosphatase (TSAP (1U/µL, Promega) and Exonuclease I (20 u/µL, New England Biolab). The TSAP mixture was prepared by adding 2.5 µL of Exonuclease I, and 25 µL of TSAP to 172.5 µL of molecular biology grade water. The TSAP mixture was added to PCR products at the rate of 2 µL TSAP mixture per 20 µL PCR product and the mixture incubated at 37°C for 30 51 min followed by a deactivation step at 94°C for 5 min. The cleaned PCR products were sent for sequencing at Macrogen Inc. (Seoul, Korea). Sequencing was performed in both directions with the same primer sets as used for PCR. 2.2.4 Sequence assembly Contiguous sequences of DNA obtained from this study were assembled with DNA Baser Sequence Assembler software (Version 4, Heracle BioSoft) or with Geneious (Version 8, Kearse et al. 2012). Sequences of other accessions were obtained from GenBank. The sequences were aligned using Muscle as enabled in MEGA (Version 6, Tamura et al. 2013). Each alignment was cross checked by eye to verify base calling and for the presence of indels. 2.2.5 Phylogenetic relationships of Diaphorina communis Phylogenetic relationships among the Diaphorina communis accessions from Bhutan and those of Diaphorina citri were determined based on the two mitochondrial DNA regions. Aligned sequence datasets were subjected to phylogenetic analyses by maximum likelihood (ML) using MEGA 6. For COI, the ML analysis was based on the Tamura 3-parameter model (Tamura 1992) with a discrete Gamma distribution (6 categories (+G, parameter = 1.0753)) and, for 16S, the Tamura-Nei model (Tamura & Nei 1993) with a discrete Gamma distribution (6 categories (+G, parameter = 0.4622)). For both analyses, initial trees for the heuristic search were obtained automatically by applying Neighbor-Join and BioNJ algorithms to a matrix of pairwise distances estimated using the maximum composite likelihood approach, and then selecting the topology with the superior log likelihood value. Each analysis was replicated with 1000 bootstraps. GenBank accessions used for the two analyses are shown in Table 2.1. 52 Table 2.1. GenBank accessions used for phylogenetic analyses in this study. Region Accession number Reference COI AY971889 Liu et al. (2006) FJ190289 Boykin et al. (2012) FJ190375 Boykin et al. (2012) FJ190377 Boykin et al. (2012) KC509561 Lashkari et al. (2014) KF702297 Chaitanya et al. (unpublished) KF702299 Chaitanya et al. (unpublished) KF702304 Chaitanya et al. (unpublished) KU647697 Wu et al. (2016) AB721011 Katoh et al. (2013) 16S 53 2.3 Results 2.3.1 Phylogenetic analysis of Diaphorina communis BLAST searches using the COI sequences obtained in this study found that my Diaphorina communis sequences shared 94% identity with Diaphorina citri; for the 16S region, the Diaphorina communis sequences showed 97–98% sequence identity to Diaphorina citri. The phylogenetic relationship of Diaphorina communis with Diaphorina citri based on the COI region is shown in Figure 2.3. The tree was rooted with Bactericera cockerelli (Šulc) (Hemiptera: Triozidae). Accessions of Diaphorina communis formed a separate clade from Diaphorina citri with strong bootstrap support (99%). Variations within the group were observed but were not location specific. The phylogenetic analysis of Diaphorina communis based on the 16S region is given in Figure 2.4. The tree is rooted with one of the accessions of Cacopsylla heterogena Li obtained in this study (see Chapter 6). Two distinct clades with high bootstrap support are obtained, but no variation within the groups was found. 2.4 Discussion The phylogenetic relationships between Diaphorina communis and Diaphorina citri were determined based on COI and 16S regions. In both the analyses, two distinct groupswere formed with strong bootstrap support, with one comprising accessions of Diaphorina communis and the other of Diaphorina citri. Variation within the groups was observed in the COI region but the variation was not related to locations from which specimens were collected. The results indicate that differences in COI and 16S regions may prove useful for differentiating between early instar Diaphorina communis and Diaphorina citri nymphs when fifth instar nymphs and adults are not present on host plants. 54 Figure 2.3. Phylogenetic analysis of Diaphorina communis based on COI using maximum likelihood and the Tamura 3-parameter model (Tamura 1992) with a discrete gamma distribution (6 categories (+G, parameter = 1.0753)) to model evolutionary rate differences among sites. Name of the collection sites are given next to the accession numbers. GenBank accession numbers are given in parentheses. 55 Figure 2.4. Phylogenetic analysis of Diaphorina communis based on the 16S gene using maximum likelihood and the Tamura-Nei model (Tamura & Nei 1993) with a discrete gamma distribution (6 categories (+G, parameter = 0.4622)) to model evolutionary rate differences among sites. The names of the collection sites are given next to the accession numbers. Genbank accession numbers are given in parentheses. The tree is rooted with Cacopsylla heterogena (Chapter 6). 56 Chapter 3: Transmission of ‘Candidatus Liberibacter asiaticus’ (α-Proteobacteria) by Diaphorina communis Mathur (Hemiptera: Sternorrhyncha: Liviidae) ____________________________________________________________________ 3.1 Introduction Many species of psyllids are important pests of agricultural crops (Burckhardt 1985, 1994). Their feeding may cause necroses, galling, and malformations of their host plants (Wallis 1955; Markkula & Laurema 1971; Burckhardt 1994). Certain species are also vectors of serious plant pathogens, including bacteria, phytoplasmas, and viruses (Munyaneza 2010). The Asiatic citrus psyllid, Diaphorina citri, is the main vector of ‘Candidatus Liberibacter asiaticus’ (‘CLas’), the pathogen primarily responsible for devastating impacts on citrus production in Asia, and most recently in the Americas (Bové 2006; Lopes et al. 2013; Hall et al. 2013). Diaphorina citri is also the vector of the less important ‘Candidatus Liberibacter americanus’ (‘CLam’) in Brazil and, under experimental conditions, has transmitted ‘Candidatus Liberibacter africanus’ (‘CLaf’), the pathogen naturally associated with huanglongbing in sub-Saharan Africa (Aubert 1987; Halbert & Manjunath 2004; Bové 2006; Chiyaka et al. 2012; Wang & Trivedi 2013). ‘Candidatus Liberibacter asiaticus’ has also been detected in adults of the black psyllid, Diaphorina communis Mathur, a species collected in Bhutan from ‘CLas’-infected mandarin trees in May 2009 (Donovan et al. 2012a; 2012b). Beside these two species, ‘CLas’ has also been recorded in Cacopsylla citrisuga (Yang & Li) collected from ‘CLas’-infected lemon trees in Yunnan, China (Cen et al. 2012a), and from Cacopsylla heterogena Li collected from infected mandarin trees in Bhutan (Chapter 6). Cacospylla citrisuga has also been reported to transmit ‘CLas’ under laboratory conditions (Cen et al. 2012b). As mentioned in earlier chapters Diaphorina communis was first recorded by Mathur (1935; 1975) on curry leaf. Mathur (1935) noted that wilting and defoliation occurred when numerous nymphs attacked a plant. Mathur (1975) described the 57 insect in greater detail and commented that it was commonly found on curry leaf and ‘Murraya paniculata (L.) Jack’, but rarely on Citrus spp. near Dehra Dun, Uttarakhand, in north-west India. Decades later, Diaphorina communis was reported as a serious pest of Bergera koenigii (cited as Murraya koenigii) in the state of Jammu and Kashmir in India (Tara & Sharma 2010a; 2010b). In Bhutan, it was first identified in 2007 (Yamamoto 2007; Bové 2014) but could have been present much earlier. It is mainly found on curry leaf and occasionally observed on mandarin. Huanglongbing was first recorded, as citrus greening, in south-western Bhutan in the Phuentsholing region in surveys for citrus greening between 1972 and 1990 (Lama & Amtya 1991; Lama & Amatya 1993). Citrus orchards in the west-central region of Bhutan were observed with severe dieback symptoms in the early 1990s. This was attributed to HLB. However, the presence of ‘CLas’ was only confirmed in 2002, mainly in the orchards along the Punakha-Wangdue Valley through which the Punatsangchhu-Sunkosh River flows (Ahlawat & Baranwal 2003; Doe Doe et al. 2003; Bové 2014). Since then, the disease has been detected in other parts of the country, and it is now the most serious impediment to citrus production nationally (Donovan et al. 2016; pers. obs.). Diaphorina citri was also first recorded in Bhutan in the Phuentsholing region in surveys for citrus greening between 1972 and 1990 (Lama & Amtya 1991; Lama & Amatya 1993). Records from Nepal and Sikkim suggest that both the disease and the psyllid may have been present in southern Bhutan since the mid-1960s (Knorr et al. 1970; Catling 1978; Lama & Amtya 1991, 1992; Ohtsu et al. 1997). Diaphorina communis was shown to acquire ‘CLas’ (Donovan et al. 2012a) but the potential of this psyllid to transmit ‘CLas’ has not been determined. Moreover, the status of curry leaf as a host of ‘CLas’ has not been unambiguously determined. At the start of this study, assessments of Bergera spp. as potential hosts of ‘CLas’ was limited to studies by Hung et al. (2000), Damsteegt et al. (2010) and Ramadugu et al. (2016). Hung et al. (2000) attempted graft transmission with Bergera euchrestifolia (Hayata) (cited as Murraya euchrestifolia and mistakenly referred to as curry leaf) from ‘CLas’-infected sweet orange plants in Taiwan, but they did not observe the 58 symptoms commonly observed in Citrus species and hybrids. Moreover, they did not detect ‘CLas’ by dot hybridisation. Here, it should be noted that curry leaf (Bergera koenigii) does not occur in Taiwan (Huang et al. 1997) and the distribution of Bergera euchrestifolia is restricted to Taiwan, Hainan, Yunnan, Guangxi, Guizhou and Guangdong (Swingle & Reece 1967; Zhang et al. 2008). Toorawa (1998) noted that ‘CLas’ was never detected in Murraya paniculata and Bergera koenigii (cited as Murraya koenigii) by both electron microscopy and PCR. Damsteegt et al. (2010) did not detect the pathogen in Bergera koenigii following transmission experiments with Diaphorina citri. Ramadugu et al. (2016) reported a single detection with a ‘CLas’, based on a Ct value of 36 by real-time PCR, during a six-year evaluation program with a range of hosts of the pathogen and Diaphorina citri. However, symptoms were not reported, and DNA of the pathogen was not sequenced. Therefore, the overall aim of this chapter was to evaluate whether Diaphorina communis can transmit ‘CLas’ and whether curry leaf is a host of the pathogen. The evaluations involved several small experiments, particularly preliminary experiments in 2013, and field experiments in 2014 and 2015. For simplicity, general methods relevant to all experiments are described in the Materials and Method section of the chapter. Materials and methods for each experiment is followed by the results of each experiment. The specific objectives of this chapter were to: 1. determine whether Diaphorina communis can acquire ‘Candidatus Liberibacter asiaticus’ from mandarin and transmit it from mandarin to mandarin and from mandarin to curry leaf or vice versa; and 2. study the host preferences of Diaphorina communis. 59 3.2 Materials and Methods 3.2.1 Field site For this study, potted plants infected with ‘CLas’ and pathogen-free populations of Diaphorina communis were not available. Therefore, the experiments were conducted under field conditions in order to assess transmission of ‘CLas’ by Diaphorina communis from naturally-infected mandarin trees to healthy mandarin and curry leaf seedlings. A mandarin orchard at Baychhu (27.2975ºN, 89.9669ºE, 784 m ASL), Wangdue Phodrang Dzongkhag, was selected. It was chosen because it was one of the mandarin orchards where ‘CLas’ was first confirmed as being present in Bhutan in 2002 (Doe Doe et al. 2003) and because of its proximity, ~75 km (3–4 hours by car) to the National Plant Protection Centre (NPPC), Semtokha, Thimphu (27.4411°N, 89.6682°E, 2301 m ASL). It originally comprised ~500 mandarin trees planted in the mid-1980s. When the study commenced, many trees had been recently skeletonised or cut down (but not poisoned). Those that remained had severe dieback, mostly related to ‘CLas’. Both Diaphorina citri and Diaphorina communis were present in the orchard. Temperature and relative humidity in the orchard were recorded using Tinytags (PLUS 2-TGP-4500, Omni Instruments Australia Pty Ltd) set to log records every 30 min. 3.2.2 Preparation of test plants: mandarin and curry leaf seedlings 3.2.2.1 Mandarin seedlings One hundred and thirty, 15-month-old mandarin seedlings were obtained from the nursery of the National Seed Centre (NSC) at Bhur, Gelephu (26.9075°N, 90.4293°E, 381 m ASL) in April 2013. These seedlings are referred to as the April 2013 consignment. They were used for all the experiments conducted in 2013 and 2014. Another consignment of 100 seedlings was obtained from the NSC in April 2014. These seedlings were used for the transmission experiment in 2015. All seedlings were maintained in the greenhouse at the NPPC in Thimphu until they 60 were transported to Baychhu. The plants were maintained in 80–100 mm diameter, 170 mm deep, black, plastic tubes (polytubes). The potting mix was changed prior to transporting to the field. For the plants remaining in a greenhouse, the potting mix was changed once a year. The potting mix comprised a 1:1 mixture of autoclaved garden soil:forest top soil. The seedlings were pruned every 45–60 d to maintain their height at approximately 300–450 mm. Seedlings were watered daily and fertilized with 1 g of urea every 30–45 d. Occasional 0.25% (v/v) sprays of an nC24 agricultural mineral oil (SK EnSpray 99) were applied to suppress infestations of soft scales and spider mites. 3.2.2.2 Curry leaf seedlings Mature curry leaf fruit that had turned dark red were collected on 14 June 2013 from Baychhu and sown within 24 h. Curry leaf usually grows in sandy soils in Bhutan. Therefore, a potting mix was prepared by mixing river sand and forest top soil at a ratio of 1:1. The seedlings were grown in the potting mix in 38-cell, black, plastic seedling trays with 58 mm diameter and 65 mm deep cells (Figure 3.1). Each curry leaf seed was squeezed from the fruit and sown directly into the seedling tray. A B Figure 3.1. Curry leaf fruit (A) and a seedling tray with curry leaf seedlings 30 d after sowing (B). 61 The transplanting of curry leaf seedlings into polytubes (dimensions as above) commenced one month after sowing and continued for another two and half months. All seedlings were transplanted into black polytubes with a slightly modified version of the potting mix used for seeds. The potting mix used for transplanting comprised a 1:2:4 mixture of autoclaved garden soil:river sand:forest top soil, because the 1:1 river sand to forest soil mix was too porous. The seedlings were then kept in the same greenhouse at NPPC as the mandarin seedlings with similar management operations, except that the curry leaf seedlings did not require daily watering. Curry leaf seedlings raised in the greenhouse were used for experiments in 2014 and 2015. 3.2.3 Extraction of DNA of ‘CLas’ from plants Most DNA extractions from plants were performed in the Plant Pathology Laboratory of NPPC in Bhutan unless specified. Samples included both leaves and bark. Samples were washed in tap water and blot dried with tissue paper. For detection of ‘CLas’ from leaf samples, only mid ribs were used by excising the mid ribs with disposable razor blades. Half a gram (0.5 g) of each sample was placed in an extraction pouch with 3.5 mL of CTAB buffer (2% CTAB, 0.2% β–mercapto ethanol, 2% PVP10, 1 M Tris HCl, 0.5 M EDTA, 1.4 M NaCl, pH 8) and ground with a homogenizer (HOMEX 6, Bioreba) at 300 rpm. The extracts were transferred into 2 mL tubes and incubated in water bath at 65ºC for 30 min, shaking the tubes at intervals. The extracts were then centrifuged for 5 min at 8000 × g and 20°C. Then, 1 mL of the supernatant was transferred into another 2 mL tube, and 1 mL of chloroform:isomyl alcohol (24:1) was added and mixed well by inverting the tube. The tubes were centrifuged at 16,100 × g and 20ºC for 5 min. The supernatants were transferred to 1.5 mL tubes, and cold isopropanol was added (540 µL of isopropanol for 900 µL of supernatant) and incubated at −20ºC overnight. After incubation, the tubes were then centrifuged for 20 min at 16100 × g and 4°C to collect the pellets. The pellets were washed twice with 70% ethanol and centrifuged at 16,100 × g for 5 min after each wash. The washed pellets were air- dried for 30 min and dissolved in 100 µL 1 × TE buffer, and stored at –20ºC in NPPC until transportation to Western Sydney University and stored at −20ºC again until further use. 62 3.2.4 DNA extractions from psyllids for ‘CLas’ detection Extractions of DNA from psyllids were performed in the Molecular Laboratory of the School of Science and Health (SSH), Western Sydney University (WSU), Hawkesbury Campus, and the Plant Pathology laboratory at NSW Department of Primary Industries Elizabeth Macarthur Agricultural Institute (EMAI), Menangle, NSW. Psyllids stored in 100% ethanol were placed in 1.5 mL tubes and the tubes left open for 5 min in a laminar hood to remove the ethanol from the samples. DNA was extracted using the Sigma REDExtract-N-Amp™ Plant PCR Kit (Sigma) following the manufacturer’s protocol except for modifications of the volumes of extraction and dilution buffers. For extractions from single adults 10 µL of each buffer was used, for extractions from 2–3 adults (i.e., insects combined to form a composite sample) 15 µL of each buffer was used, and 25 µL of each buffer was used for extractions from five adults. For nymphs, 10 µL and 15 µL of each buffer was used for extractions from 2–3 and five nymphs, respectively. All psyllid samples were crushed after adding the extraction buffer using sterile, 20–200 µL pipette tips made blunt by flaming and pressing on the lid of the sample tube. The blunt pipette tips were more efficient at crushing the psyllids than plastic pestles. The crude DNA extracts were stored at −20ºC till further use. Psyllid samples for phylogenetic studies were extracted from single adults as described in Chapter 2 using an ISOLATE II Genomic DNA Kit (BIOLINE) except the psyllids were not crushed (non-destructive DNA extraction). 3.2.5 Detection of ‘CLas’ by conventional and real-time PCR All work on detection of ‘CLas’ using real-time PCR (qPCR) was performed at EMAI. Detection of ‘CLas’ was performed by multiplexing the TaqMan probe (HLBp) and primer set (HLBas and HLBr) targeting the 16S rDNA of the bacterium in combination with either the probe and primers for the plant cytochrome oxidase (COX) gene (Li et al. 2006) or the insect nuclear gene, wingless (wg) (Manjunath et al. 2008), as internal controls. The TaqMan probe, HLBp, was labelled at its 5’terminal with 6-carboxy-fluorescein (FAM) reporter dye, and the labelling of probes 63 at the 5’- terminals for wg (DCP) and COX (COXp) were both replaced with CAL Fluor 560 Orange (CAL) instead of hexachlorofluorescein (HEX) or tetrachloro-6carboxy-fluorescein (TET) reporter dyes as used by Manjunath et al. (2009) and Li et al. (2006), respectively. All probes were labelled at the 3’-terminals with Black Hole Quencher (BHQ)-1. Real-time PCR reactions were performed using 0.1 mL, four–strip tubes with caps in a Rotor Gene Q cycler (Qiagen) containing final concentration of 1 × PCR buffer, 6.0 mM MgCl2, 0.24 mM dNTPs (Bioline), 240 nM of each primer (Invitrogen/Sigma), 240 nM of each probe (Biosearch), and 1U Taq immolase (Bioline). To each reaction, 1 µL of template DNA was added to prepare a final reaction volume of 12.5 µL. Cycling parameters previously optimized by EMAI were used: pre–incubation at 50°C for 2 min followed by 95°C for 10 min and 40 amplification cycles of 95°C for 30 sec and 58°C for 40 sec. For all assays, positive and non-template controls were included. For plant samples obtained in 2015 onwards, an extraction control (healthy control) made from midribs of peach or apple was included. Samples of citrus plants and Diaphorina citri that were known to be ‘CLas’-positive were used as positive controls for plant and psyllid assays, respectively. Samples were interpreted as ‘CLas’ positive or not-detected based on threshold cycle (Ct) values. The threshold cycle is the number of cycles required for the fluorescent signal within a reaction to cross the threshold, and the Ct value of a particular sample is the point at which sufficient amplicons have accumulated (Adams 2006). Interpretation of results was based on the guidelines set by the United States Department of Agriculture (USDA-APHIS, 2012). For plant assays, samples were considered ‘CLas’-positive if the FAM Ct values were in the range of 0.00 < FAM Ct ≤ 36, and not detected if the FAM Ct was zero. If the samples produced FAM Ct values in the range of 36 < FAM Ct ≤ 40 then the results for the samples were deemed to be inconclusive. For psyllid assays, samples were positive if they produced FAM Ct values in the range of 0.00 < FAM Ct ≤ 32, and ‘CLas’ was not detected if the FAM Ct is equal to zero, and the result is inconclusive if the FAM Ct values were in the range of 32< FAM Ct ≤ 40. Representative samples showing a FAM Ct value > 0.00 were then selected and subjected to conventional 64 PCR (cPCR) using primers A2/J5 (Hocquellet et al. 1999). Reactions were performed using 2 µL of template DNA in a 25 µL reaction volume following the GoTaq® Flexi DNA polymerase (Promega) protocol with final concentrations of 2.5 mM MgCl2, 0.24 mM dNTP mix (Bioline), 0.4 µM of each primer and 1.25 unit of GoTaq Flexi DNA polymerase. Touch-down PCR was used with an initial denaturation at 92°C for 2 min, followed by 45 cycles of denaturation at 92°C for 45 s, and annealing at 69–65°C (decrease 1°C/cycle for 5 cycles) for 45 sec, extension at 72°C for 1 min followed by a final extension step at 72°C for 10 min. Conventional PCR assays were conducted at WSU. Post PCR and sequencing were performed as described in Chapter 2, Section 2.2.3. 3.3 Preliminary Studies in 2013 Five preliminary experiments were conducted at Baychhu. They were undertaken to evaluate survival and development of Diaphorina communis on Citrus reticulata, and the acquisition and transmission of ‘CLas’ by psyllid nymphs and adults. The mandarin trees were about 20 years old and severely affected by the disease. Curry leaf plants used in the experiments were obtained from within the orchard. They are referred to as Baychhu curry leaf plants. 3.3.1 Experiment 1 (2013) The objective was to determine survival of Diaphorina communis nymphs transferred from Baychhu curry leaf plants to soft, fully-expanded, mandarin leaves and the acquisition of ‘CLas’ by the nymphs from the mandarin leaves. The experiment was based on the assumption that ‘CLas’ was not present in the curry leaf plants, and that Diaphorina communis nymphs caged on ‘CLas’-infected mandarin leaves would acquire the pathogen. Materials and Methods. Six mandarin trees were selected on 2 April 2013. One branch on each of the six trees was caged within a BugDorm rearing sleeve (300 × 700 mm) (Australian Entomological Supplies Pty. Ltd.) (Figure 3.2). Each sleeve was labelled. Young Diaphorina communis nymphs were collected by brushing 65 them from infested, immature, Baychhu curry leaf shoots onto white enamel trays with a camel hair brush. Nymphs that fell onto the trays were sorted according to their size. The smallest nymphs (< 0.5 mm) were placed in a glass Petri dish. The nymphs were counted by placing the Petri dish over a ruled notebook page and using a tally counter. Nymphs were then transferred onto the mandarin leaves. Batches of 106 to 130 nymphs were transferred to each branch. Results. All nymphs died within 7 d. Figure 3.2. A BugDorm rearing sleeve on a branch of a ‘CLas’- infected mandarin tree at Baychhu. 3.3.2 Experiment 2 (2013) The objective was to determine survival of Diaphorina communis adults on fullyexpanded immature leaves on ‘CLas’-infected mandarin trees. Materials and Methods. ‘Candidatus Liberibacter asiaticus’-infected, mature mandarin trees used for the previous experiment were also used in this experiment. 66 Adults were collected from Baychhu curry leaf plants by tapping infested branches of the plants over a white enamel tray and collecting adults that fell into the tray with an aspirator or a glass vial. The adults were placed in batches of 20 or 25 in the vials, and groups of 105 adults were released into BugDorm rearing sleeves, one on each of six trees, on 4 April 2013. The presence of eggs and nymphs on immature flush growth was observed after seven days. Surviving adults were collected after 54 d and stored in 100% ethanol to determine if they had acquired ‘CLas’. Results. No psyllid eggs or nymphs were observed on the mandarin leaves. The average number of live adults in the cages at after 54 d was 32. ‘CLas’ titres in adults sampled on day 54 are presented in Table 3.1. Fifty-three samples were tested, 29 prepared from single adults and 24 samples each comprising 5 adults. Twenty of the single adult samples produced FAM Ct values ranging from 20.58 to 39.57. Of these 20 samples, only three had FAM Ct values in the range of 0.00 < FAM Ct ≤ 32, values regarded as ‘CLas’-positive. For the 24 samples, each comprising five adults, 21 samples produced FAM Ct values > 0.00 with a range of 21.53–38, out of which only 11 samples showed FAM Ct values in the range of 0.00 < FAM Ct ≤ 32. Eighteen samples with FAM Ct values > 0.00 were selected for cPCR. Five samples with FAM Ct values ranging from 21.53 to 25.56 showed amplification, and four samples were successfully sequenced. BLAST searches using sequences obtained in this study showed 100% identity and 99% coverage with ‘CLas’ isolates from Bhutan (JF346109), India (KT164840–KT16484045), Indonesia (LCO90231) and China (CP010804). 67 Table 3.1. ‘Candidatus Liberibacter asiaticus’-titres in Diaphorina communis adults caged for 54 d on branches of ‘CLas’-infected mature mandarin trees. Parameters Results Number of samples based on single adults 29 FAM1 Ct range of samples based on single adults 20.58–39.572 Number of single adult with FAM1 Ct values > 0.00 20 Number of single adult with FAM1 Ct values in the range of 0.00 < FAM Ct 3 ≤ 32 Number of samples based on five adults 24 FAM Ct range of samples based on five adults 21.53–38.112 Number of adult composite samples with FAM1 Ct values > 0.00 21 Number of single adult samples with FAM1 Ct values in the range of 0.00 < 11 FAM Ct ≤ 32 1 ‘CLas’ DNA. Eighteen samples with FAM Ct values 21.53–36.39 were selected for cPCR. Five samples with FAM Ct values between 21.53 & 25.56 produced amplicons of which four were successfully sequenced. 2 3.3.3 Experiment 3 (2013) The objective was to determine possible transmission of ‘CLas’ from Baychhu curry leaf plants to mandarin seedlings by Diaphorina communis nymphs transferred from the curry leaf plants to the mandarin seedlings. The experiment was based on the assumption that ‘CLas’ may have been present in the Baychhu curry leaf plants and that late instar Diaphorina communis nymphs developing on the plants would acquire the pathogen, and that adults eclosing from these nymphs would transmit the pathogen to healthy mandarin seedlings. Materials and Methods. Nine mandarin seedlings from the April 2013 consignment from the NSC were planted in 250 mm diameter plastic pots containing potting mix (1:1 sterilised garden soil and forest top soil). Nine 475 × 475 × 475 mm BugDorm insect rearing cages (Australian Entomological Supplies Pty. Ltd.) were placed on a flat area in the orchard (Figure 3.3). One mandarin seedling was placed in each cage. Small stones were placed in the corners of the cages to prevent them from being 68 dislodged by wind. Twenty-five 4−5th instar Diaphorina communis nymphs were transferred from curry leaf plants, as above, to each of the six mandarin seedlings. Three of the mandarin seedlings were retained as controls. In order to confirm that all adults that eclosed were Diaphorina communis some nymphs from the curry leaf plants were held for five days with young curry leaf shoots in plastic containers with perforated lids. Results. All nymphs that were transferred to the mandarin seedlings died within 7 d. All adults that eclosed from nymphs maintained on curry leaf shoots for five days in the plastic containers were Diaphorina communis. Figure 3.3. BugDorm rearing cages with mandarin seedlings used for rearing nymphs of Diaphorina communis. 3.3.4 Experiment 4 (2013). The objective was to determine possible transmission of ‘CLas’ from Diaphorina communis-infested Baychhu curry leaf plants to healthy mandarin seedlings. As for Experiment 3 above, this experiment was based on the assumption that ‘CLas’ may have been present in the Baychhu curry leaf plants and that late instar Diaphorina communis nymphs developing on the plants would acquire the pathogen, and that adults eclosing from these nymphs would transmit the pathogen to healthy mandarin seedlings. 69 Materials and Methods. In this instance, the Diaphorina communis-infested curry leaf plants were caged with healthy mandarin seedlings in May and again in June 2013. In May, nine curry leaf plants with abundant eggs and nymphs were selected from within the orchard. These plants were watered thoroughly and left overnight for easy uprooting on the following day and then planted in 180 mm diameter plastic pots. Soil collected from the sites where curry leaf plants were uprooted was used for planting curry leaf in the pots. Eighteen mandarin seedlings were planted in 180 mm diameter plastic pots containing a potting mix consisting of sterilised garden soil and forest top soil (1:1). The mandarin seedlings were pruned before being placed in the cages. All mandarin seedlings were kept in BugDorm cages during preparation of the experiment. Each curry leaf plant was examined carefully, and all adult Diaphorina communis present were removed before each curry leaf plant was placed in a cage with one mandarin seedling. Nine mandarin seedlings were placed singly in nine other cages. All cages were kept in the orchard for 34 d. Emergence of Diaphorina communis adults in the cages was recorded every 3–6 d for 17 d. The mandarin seedlings were pruned 17 d after planting in order to maintain their height within the cages. After 34 d, all mandarin plants were transported to the NPPC and where they were kept in a rearing room at room temperature for general observations and PCR analysis after one year. In June 2013, for logistical reasons related to moving plants to and from Baychhu to the NPPC, fewer plants were used and, in this instance, four mandarin seedlings were caged with curry leaf plants infested with Diaphorina communis eggs and nymphs and four were kept as controls. Results. In May, adults emerged in all except one cage five days after the Baychhu curry leaf plants were placed in the cages. The lowest and highest numbers of adults that emerged at this time were two and six, respectively. Five days after the first record of adults, all cages contained adults, and the highest number of adults emerging was 23 and the lowest three. Twelve days after the first observation, the highest number of adults increased to over 50 while the lowest was two. However, after 34 d, except for one cage, adults in all cages had died. In June, one week after 70 the Baychhu curry leaf plants were placed in the cages, four and two adults emerged in cages 1 and 4, respectively, and no adults were present in the other cages. One to two adults emerged in other cages but died ~28 d after first being observed. Plant samples, used in both May and June 2013, were tested after one year, showed FAM Ct values between 33.81 and 38.08 but selected samples subjected to cPCR did not produce any amplicons. 3.3.5 Experiment 5 (2013) The objective was to determine development of Diaphorina communis on mandarin flush, in this instance, from budbreak on ‘CLas’-infected mature mandarin trees. Materials and Methods. Development was determined by: (a) caging 30 adults in BugDorm sleeve cages for 14 d in each of five cages with new buds and developing flush on skeletonised branches of ‘CLas’-infected mandarin trees 28 d after mature leaves were removed; and (b) likewise in two cages for 14 d on new buds 30 d after branches were pruned. Results. With the exception of two adults in one cage, all adults died within 11 d of their release. These adults were collected and preserved in 100% ethanol. One nymph was observed. It died within seven days of being observed. 3.4 Studies in 2014 The preliminary studies in 2013 indicated that Diaphorina communis does not develop on Citrus reticulata. Therefore, emphasis shifted to evaluating adult acquisition and transmission of ‘CLas’ from new-growth on stumps of the naturallyinfected, mature mandarin trees at Baychhu in 2014. Greenhouse-raised curry leaf and mandarin seedlings were used for the experiments on transmission of ‘CLas’ from mandarin. The greenhouse-raised mandarin seedlings are referred as NSC mandarin, and the greenhouse raised curry leaf seedlings are referred as 2014-curry leaf seedlings for the studies in 2014. 71 3.4.1 Experiment 1 (2014) The objective was to determine possible acquisition and transmission from flush growth on stumps of ‘CLas’-infected mature mandarin trees to ‘CLas’-free mandarin and curry leaf seedlings. Materials and Methods. This experiment commenced in the orchard at Baychhu on 8 May 2014. Average weather data for 2014 are presented in Figure 3.4. Twenty-two stumps of mature, ‘CLas’-infected trees cut down in early 2013 were selected in March 2014. In order to initiate flush growth, shoots present on the stumps were pruned to a height of 250–300 mm above ground level 45 d prior to the commencement of the experiment. Pruned tissues were collected from the stumps in order to confirm that ‘CLas’ was present. New flush growth on each stump was inspected for Diaphorina citri and Diaphorina communis eggs and nymphs prior to each stump being enclosed within a BugDorm cage modified by cutting a ~ 150 mm diameter hole in its base so as to enable it to be placed over a stump. Soil around the base of each stump was levelled beforehand and stones were placed around the cages in order to prevent them being dislodged by wind. Diaphorina communis adults were collected from wild curry leaf plants at Basochhu (27.3646°N, 89.9124°E, 1036 m ASL), ~10 km from Baychhu, on 7 May 2014. Branches of the plants were tapped onto a white, enamel tray and adults falling on the tray were placed in batches of 30 in glass tubes and released overnight onto greenhouse-raised curry leaf seedlings in BugDorm cages not being used in the experiment. The psyllids were then transferred on 8 May 2014 in batches of 30 to glass vials. Fifty-five adults were then released into each of the 22 BugDorm cages enclosing the mandarin tree stumps and immature flush growth on the stumps. Five psyllids from each vial were used to test for the presence of ‘CLas’. Single, 10-month-old 2014-curry leaf seedlings from the NPPC were placed in each cage on 19 May 2014. They were pruned to heights of approximately 150 mm in 72 order to encourage new growth that was 2–5 mm long when the seedlings were placed in the cages. Figure 3.4. Average monthly minimum and maximum temperatures and relative humidity recorded at Baychhu in 2014 and 2015. Single NSC mandarin seedlings from April 2013 consignment were placed in each cage on the same day. These seedlings were 28-months-old and pruned to heights of approximately 120 mm to encourage new growth that was 2–5 mm long when the seedlings were placed in the cages. The plants were allocated randomly to the BugDorm cages. Further batches of 60–65 adults were released into each cage four and 30 d after the 2014-curry leaf and NSC mandarin seedlings were placed in the cages. Adult psyllids were maintained in the BugDorm cages until 5 July 2014. Thus, Diaphorina communis adults were provided with opportunities to acquire ‘CLas’ from shoots on infected stumps over intervals up to 58 d and to transmit the pathogen 73 to the 2014-curry leaf and NSC mandarin seedlings over an acquisition and transmission interval (ATI), depending on survival after release, of 16–47 d. Numbers of eggs, nymphs and adults on the plants were recorded one and two weeks after the second release of adults on 23 May 2014. Adults within each cage were counted visually through a clear plastic panel at the front of each cage and by examining the plants and internal cage surfaces through the sleeve opening of each cage. Eggs and nymphs were counted using a 10× hand lens by removing the plants temporarily from the cages after shaking adults off the plants inside the cages. At the end of the ATI (5 July 2014), surviving Diaphorina communis adults were collected from each BugDorm cage and stored in 100% ethanol for determining the presence or absence of ‘CLas’ by PCR. Five adults from each cage were tested individually unless specified. The NSC mandarin seedlings were placed in groups of three or four in large, 475 × 475 × 930 mm BudDorm rearing cages under shade cloth within the orchard (Figure 3.5) for 107 d before they were transported to NPPC. The 2014-curry leaf seedlings, all bearing eggs and nymphs of Diaphorina communis, were maintained separately in other cages under shade cloth for use in the following experiment. The midribs of symptomatic leaves were sampled from mandarin stump-shoots on 5 July 2014 to further confirm the presence or absence of ‘CLas’. Periodic sampling for detection of ‘CLas’ in midribs of leaflets from the 2014-curry leaf seedlings and leaves of the NSC mandarin seedlings commenced 44 d after the ATI, and continued at intervals ranging from 72−95 d for 541 d (~18 months) to test for ‘CLas’. Results. Numbers of adults surviving, and numbers of eggs and nymphs on mandarin and 2014-curry leaf seedlings, during the acquisition and transmission experiment after adults were released twice into each of the 22 cages are summarised in Tables 3.2 and 3.3. All adults caged with 2014-curry leaf seedlings in the 11 cages died within 11 d of the first release of 50 adults into each cage. All adults in eight of the 11 cages with mandarin seedlings also died within 11 d of being released. One week after the subsequent release of 60 adults into each cage, an average of seven adults 74 per cage were alive in cages with NSC mandarin seedlings and an average of nine adults were present in the cages containing 2014-curry leaf seedlings. At this point, the cages containing NSC mandarin seedlings had an average of 1 egg per cage compared to the cages housing 2014-curry leaf seedlings that contained 71 eggs per cage (Figure 3.6); no nymphs were recorded at this point. Two weeks after the second release of adults, the cages containing 2014-curry leaf seedlings had higher average numbers of adults (~6), eggs (65), and nymphs (46) compared to the cages with the NSC mandarin seedlings (adults = 2; eggs = 0; nymphs= 0). The average numbers of immature shoots of similar age on the NSC mandarin and 2014-curry leaf seedlings were 8 and 9, respectively at 14 d after the second release of psyllids. Figure 3.5. A mandarin stump used as a source of ‘CLas’ for acquisition and transmission by adult Diaphorina communis (A); BugDorm rearing cages placed over mandarin stumps in the field (B); close up of a BugDorm with a Set A curry leaf seedling and mandarin stump (C); cages while maintained under shade cloth at Baychhu until 20 October 2014, and during transmission studies from Set A 2014 curry leaf to mandarin (D). 75 Table 3.2. Numbers of live Diaphorina communis adults, eggs, and nymphs on NSC mandarin in the experiment cages during the acquisition and transmission experiment in 2014. Seedling and stump/cage number Live adults 11 d after 50 adults were released per cage on 8 May 2014 Live adults, eggs and nymphs 7 and 14 d after 60 adults were released per cage on 23 May 2014 At 7 d (30 May 2014) Number of shoots on 6 June 2014 At 14 d (6 June 2014) Adults Eggs Nymphs Adults Eggs Nymphs Mandarin B1 1 1 0 0 0 0 0 3 Mandarin B2 2 2 0 0 0 0 0 8 Mandarin B9 0 0 0 0 0 0 0 5 Mandarin B10 0 1 0 0 1 0 0 12 Mandarin B11 0 1 2 0 0 0 0 8 Mandarin B12 0 7 4 0 1 2 0 14 Mandarin B13 0 8 0 0 1 0 0 9 Mandarin B14 0 28 0 0 14 0 0 8 Mandarin B16 10 23 0 0 7 0 0 10 Mandarin B18 0 8 0 0 0 0 0 9 Mandarin B19 0 1 0 0 0 0 0 6 7.27 0.55 0 2.18 0.18 0 8.36 Average 76 Table 3.3. Numbers of live Diaphorina communis adults, eggs, and nymphs on 2014-curry leaf seedlings in the cages during acquisition and transmission study by Diaphorina communis adults in 2014 (Experiment 1). Seedling and stump/cage number Live adults 11 d after 50 adults were released per cage on 8 May 2014 Live adults, eggs and nymphs 7 and 14 d after 60 adults were released per cage on 23 May 2014 At 7 d (30 May 2014) Number of shoots on 6 June 2014 At 14 d (6 June 2014) Adults Eggs Nymphs Adults Eggs Nymphs Curry leaf B24 0 8 86 0 3 34 35 10 Curry leaf B3 0 5 30 0 2 33 20 2 Curry leaf B6 0 7 1 0 2 85 0 10 Curry leaf B7 0 7 100 0 0 7 135 14 Curry leaf B8 0 9 80 2 6 153 30 8 Curry leaf B15 0 8 68 0 7 113 32 11 Curry leaf B17 0 23 30 0 15 12 3 5 Curry leaf B20 0 4 11 0 0 0 23 11 Curry leaf B21 0 3 120 0 0 0 88 13 Curry leaf B22 0 10 70 0 9 123 60 9 Curry leaf B23 0 23 186 0 19 155 77 5 9.73 71.09 0.18 5.73 65 45.73 8.91 Average 77 Figure 3.6. Eggs of Diaphorina communis on mandarin (top) and curry leaf (bottom) seedlings (Photos: N. Om). 78 ‘Candidatus Liberibacter asiaticus’ titres in tissues sampled from the mandarin stumps prior to the commencement of the experiment and at the end of the ATI, and the results of periodic testing of test plants (2014-curry leaf and NSC mandarin seedlings) are presented in Tables 3.4 and 3.5. Titres at the beginning and the end of ATI produced FAM Ct values ranging from 14.18 to 25.70 and 15.66 to 22.77, respectively. Four stumps had died by the end of the ATI. Seven of the 11 NSC mandarin seedlings produced FAM Ct values ranging from 34.97 to 39.39 when tested 44 d after the ATI compared to four 2014-curry leaf seedlings. Except for one NSC mandarin seedling (FAM Ct = 39.2), none of the NSC mandarin seedlings and 2014-curry leaf seedlings sampled 125 to 305 d after ATI produced FAM Ct values > 0.00. One of the NSC mandarin seedlings died 305 d after the ATI and two had growth unsuitable for sampling. At 377 and 458 d after ATI, three NSC mandarin and two 2014-curry leaf seedlings produced FAM Ct values between 35.09−37.79 and 37.81−38.38, respectively. All seedlings produced FAM Ct values equal to zero when tested at 541 d. The positive controls showed FAM Ct values ranging from 23.21–34.60, and the internal controls (CAL) showed Ct values ranging from 13.36 to 20.47. Samples with FAM Ct values between 34.62−36.69 did not yield any amplicons when subjected to cPCR with primers A2/J5. ‘Candidatus Liberibacter asiaticus’ titres in psyllids at the beginning of the experiment, when adults were released into the cages, and at the end of the ATI are shown in Table 3.6. All psyllid samples at the time of release into the cages showed FAM Ct values equal to zero, except for one sample that showed a FAM Ct value of 38.9. At the end of the ATI, only seven out of the 22 cages contained live Diaphorina communis adults. Only two adult samples from these cages tested positive by qPCR with the individuals having FAM Ct values of 30.17 and 31.06. 79 Table 3.4. ‘Candidatus Liberibacter asiaticus’ titres in stumps of mature mandarin trees (inoculum source) and NSC mandarin seedlings used in the acquisition and transmission study by Diaphorina communis adults in 2014 (Experiment 1). Seedling stump/cage number1 and FAM Ct values of stumps2 Before2a After 2b FAM Ct values of test plants (days after the ATI)) 44 d 125 d 210 d 305 d 377 d 458 d 39.29 0.00 0.00 0.00 35.09 0.00 541 d Mandarin B1 20.28 21.00 Mandarin B2 16.89 dead 0.00 0.00 0.00 0.00 0.00 37.76 0.00 Mandarin B9 18.85 dead 39.39 0.00 NS 0.00 0.00 0.00 0.00 Mandarin B10 16.05 dead 39.38 0.00 0.00 0.00 0.00 0.00 0.00 Mandarin B11 20.62 17.83 0.00 0.00 0.00 0.00 0.00 0.00 0.00 Mandarin B12 15.75 19.21 0.00 0.00 0.00 0.00 0.00 37.79 0.00 Mandarin B13 20.04 17.67 0.00 0.00 0.00 dead dead dead dead Mandarin B14 19.43 18.25 39.14 0.00 0.00 0.00 0.00 0.00 0.00 Mandarin B16 18.69 15.94 34.97 0.00 0.00 0.00 0.00 0.00 0.00 Mandarin B18 17.90 18.21 35.22 39.24 0.00 0.00 0.00 0.00 0.00 0.00 0.00† Mandarin B19 20.15 dead 35.60 0.00 0.00 80 0.00 NS 0.00 Table 3.5. ‘Candidatus Liberibacter asiaticus’ titres in stumps of mature mandarin trees (inoculum source) and 2014-curry leaf seedlings used in the acquisition and transmission study by Diaphorina communis adults in 2014 (Experiment 1). Seedling stump/cage number1 1 and FAM Ct values of stumps2 Before2a After2b FAM Ct values of test plants (days after the second release of psyllids) 44 d 125 d 210 d 305 d 377 d 458 d 541 d Curry leaf B3 25.70 18.95 38.18 0.00 0.00 0.00 0.00 0.00 0.00 Curry leaf B6 17.77 16.59 0.00 0.00 0.00 0.00 0.00 0.00 dead Curry leaf B7 19.46 19.79 0.00 0.00 0.00 0.00 37.81 * 0.00† Curry leaf B8 18.14 22.77 0.00 0.00 0.00 0.00 0.00 * 0.00 Curry leaf B15 16.93 18.81 0.00 0.00 0.00 0.00 0.00 0.00 0.00 Curry leaf B17 15.50 15.94 36.69 0.00 0.00 0.00 0.00 0.00 0.00 Curry leaf B20 16.78 17.77 34.62 0.00 0.00 0.00 0.00 0.00 0.00 Curry leaf B21 16.10 15.66 35.40 0.00 0.00 0.00 38.38 0.00 0.00 Curry leaf B22 14.18 16.06 0.00 0.00 0.00 0.00 0.00 0.00 0.00 Curry leaf B23 17.06 16.08 0.00 0.00 0.00 0.00 0.00 * 0.00 Curry leaf B24 14.90 16.70 0.00 0.00 0.00 0.00 0.00 * 0.00 Positive controls 25.19 23.93 26.11 33.88 34.60 33.46 33.46 20.03 18.34 2 Common name of test plants followed by the stump/cage number; FAM Ct values for samples obtained from the particular stump number before (2a) and after (2b) the acquisition and inoculation period; CAL (internal control) Ct value range for above samples: 14.13–29.9 except for the two samples marked †both of which produced CAL Ct values of 38.89; * produced zero CAL Ct values due to degraded DNA as indicated by dark colour of the eluted DNA. NS=test plant still alive but hardly any leaves to sample Ct values of the samples subjected to cPCR are emboldened. 81 Table 3.6. Real-time PCR detection of ‘CLas’ in pooled samples of Diaphorina communis adults representative of the population released in the cages, and samples collected at the end of the acquisition and transmission interval (ATI) during Experiment 1 (2014). Five adults from each cage were tested individually unless specified. Seedling and stump/cage number FAM Ct range and number of samples positive for 'CLas' Before release End of ATI ‘CLas' +ve1 FAM Ct range† ‘CLas' +ve1 FAM Ct range† Mandarin B1 0 0 NA NA Mandarin B2 0 0 NA NA Mandarin B9 0 0 NA NA Mandarin B10 0 0 NA NA Mandarin B11 0 0 NA NA Mandarin B12 0 0 NA NA Mandarin B13 0 0 NA NA Mandarin B14 0 0.00 & 38.94 NA NA Mandarin B16 0 0 0 0.00 & 34.54–36.93 Mandarin B18 0 0 NA NA Mandarin B19 0 0 NA NA Curry leaf B3 0 0 0 0.00a Curry leaf B6 0 0 0 0 Curry leaf B7 0 0 0 0 Curry leaf B8 0 0 0 0.00 & 37.20 Curry leaf B15 0 0 0 0 Curry leaf B17 0 0 0 0.00 & 33.77–35.12 Curry leaf B20 0 0 0 0.00 & 35.12–37.76c Curry leaf B21 0 0.00b 0 0 & 38.64 Curry leaf B22 0 0 1 0.00 & 30.17–35.86 Curry leaf B23 0 0 1 0.00 & 31.06–35.71 Curry leaf B24 0 0 0 0 1 Numbers of ‘CLas’ positive samples. † 0.00 indicates all samples had Ct values of zero: 0.00 and a numerical value > 0 indicates at least one sample produced a Ct value > 0; 0.00 and a range of values indicates at least one sample in the group produced a Ct = 0, the rest produced Ct values > 0. a Two, b three, and c four adults tested from for these cages, respectively. NA= no adults in the cage. 82 3.4.2 Experiment 2 (2014) The objective of this experiment was to determine the acquisition and transmission of ‘CLas’ by Diaphorina communis from 2014-curry leaf seedlings to NSC mandarin seedling. It was based on the assumption that ‘CLas’ may have been transmitted to 2014-curry leaf seedlings used in Experiment 1 (2014). Materials and Methods. All eleven 2014-curry leaf seedlings from Experiment 1 (2014) were used. One pathogen-free, NSC mandarin seedling and one 2014-curry leaf seedling infested with Diaphorina communis eggs and nymphs were placed in each of eleven BugDorm cages. The numbers of adult psyllids in each cage were counted five days later and then every 10−14 d for 79 d. Samples of psyllid adults were then removed from the cages and tested for the presence of ‘CLas’. A total of 13 psyllid samples were tested either singly or in groups of five. The 2014-curry leaf seedlings and NSC mandarin seedlings were then maintained, in the absence of psyllids, in larger cages for 107 d (~3.5 months), then transported to NPPC. Sampling of plant tissues from NSC mandarin seedlings in this experiment commenced at 79 d after the eclosion of the first adult psyllid (EFAP), and then continued for 536 d (~18 months). Results. ‘Candidatus Liberibacter asiaticus’ titres in tissue sampled on seven occasions from the mandarin seedlings, and the numbers of Diaphorina communis adults present in each cage when the samples were taken, are presented in Table 3.7. FAM Ct values for samples collected at 79 d after EFAP ranged from 31.72 to 38.73. Most subsequent samples showed FAM Ct values equal to zero and few samples produced FAM Ct values > 36, except for mandarin seedling 5 sampled on day 372 (FAM Ct = 35.73), and mandarin seedlings 6 and 8 (FAM Ct values = 35.95 and 34.25, respectively) sampled on day 536. The FAM Ct values for the positive controls ranged from 20.03 to 34.60, and the CAL Ct values ranged from 14.13 to 32.15 except for one sample that produced a Ct value of 36.34. All cages had at least one or more adults present during ~35-71 d of the 71 d over which adults were present in the cages, with the exception of cages CLB15 and 83 CLB21 housing mandarin seedlings 5 and 8, respectively. The highest numbers of adults were recorded on mandarin seedling 4 (86 adults) in cage CLB8 followed by with mandarin seedling 6 (44 adults) in cage CLB17. Adults collected on day 71 after first eclosion had ‘CLas’ FAM Ct values equal to zero. 84 Table 3.7. Real-time PCR results of the experiment to determine transmission of 'CLas' by Diaphorina communis adults from curry leaf to mandarin seedlings at Baychhu in 2014. Mandarin seedling1 FAM Ct values of test plants (days after the eclosion of first adult psyllid (EFAP) in the cages on 10 July 2014) Number of psyllids2 79 d 120 d 160 d 300 d 372 d 453 d 536 d Mandarin 1 (CLB3) 38.38 0.00 0.00 0.00 0.00 0.00 0.00 1–6 Mandarin 2 (CLB6) 35.99 36.61 0.00 0.00 0.00 0.00 0.00 1–2 Mandarin 3 (CLB7) 38.73 0.00 0.00 0.00 0.00 0.00 0.00 1–3 Mandarin 4 (CLB8) 33.87 0.00 0.00 0.00 0.00 0.00 0.00 4–86 Mandarin 5 (CLB15) 35.24 0.00 0.00 0.00 35.73 37.58 36.09 0.00 Mandarin 6 (CLB17) 35.48 0.00 0.00 0.00 0.00 0.00 35.95 0–44 Mandarin 7 (CLB20) 33.82 0.00 0.00 0.00 0.00 0.00 0.00 2–11 Mandarin 8 (CLB21) 31.72 0.00 0.00 0.00 0.00 0.00 34.25 0.00 Mandarin 9 (CLB22) 34.25 0.00 0.00 0.00 0.00 0.00 36.86 1–13 Mandarin 10 (CLB23) 34.25 0.00 0.00 0.00 0.00 0.00 0.00 5–18 Mandarin 11 (CLB 24) 32.82 0.00 0.00 0.00 0.00 0.00 36.93 0–6 Positive control 24.88 33.88 34.6 33.46 33.46 20.03 21.34 1 Mandarin seedlings caged with 2014- curry leaf seedlings. The 2014-curry leaf seedlings were infested with eggs and nymphs of Diaphorina communis previously caged with stumps of ‘CLas’-infected mature mandarin stumps. 2 Number of psyllids emerging during the ATI of curry leaf to mandarin. The range indicates the minimum number of psyllids one week after the cage was removed from the infected stumps and maximum number of adults present during the ATI. A total of 13 psyllids when tested for’ CLas’ either singly or in groups of 2–5 produced FAM Ct values equal to 0.00. CAL Ct value ranged from: 14.13 to 32.15, plus one sample having a value of 36.34. Samples subjected to cPCR are emboldened. 85 3.4.3 Experiment 3 (2014) The objective of this experiment was to further determine host preferences of Diaphorina communis. The field experiments in 2013 (see Section 3.3.1 to 3.3.5) and 2014 (see Section 3.4.1 Experiment 1 (2014) at Baychhu indicated that Diaphorina communis cannot develop on mandarin. To confirm this, host preferences of the psyllid were assessed under laboratory conditions with NSC mandarin seedlings and NPPC curry leaf seedlings at the NPPC in 2014. Materials and Methods. Diaphorina communis adults were released into BugDorm cages containing: a. Two mandarin seedlings b. One mandarin seedling and one curry leaf seedling c. Two curry leaf seedlings The plants were pruned to 120–150 mm in height at least three weeks before commencing the experiment. All plants had young 1–5 mm buds/flush growth when the experiment commenced. Each plant pair was replicated four times. Fifty Diaphorina communis adults from psyllid cultures maintained in a rearing room at NPPC were released into each cage. All cages were maintained in a rearing room at 21–30°C and 40–60% RH. Adults were removed from the cages 11 d after their release. The plants in the cages were then observed daily for emergence of the next generation of psyllids. The number of second generation adults was recorded for the next eight days. Results: Average numbers of second generation adults developing under laboratory conditions on mandarin and curry leaf seedlings in the choice and no-choice assays with paired mandarin, mandarin and curry leaf, and curry leaf seedlings in cages into which 50 adults were released are shown in Figure 3.7. The average number of second generation adults in the cages was relatively higher in cages containing two curry leaf seedlings followed by the cages with paired mandarin and curry leaf seedlings. The average number of adults in the cages with only paired mandarin 86 seedlings was negligible. On the eighth day average numbers in the cages were 115, 42 and zero, respectively. Figure 3.7. Average (n = 4) number of second generation Diaphorina communis adults following their development on curry leaf and mandarin seedlings in the choice and no-choice test conducted in the laboratory at NPPC in 2014. 3.5 Studies in 2015 For the studies in 2015, similar to studies in 2014, greenhouse-raised curry leaf and mandarin seedlings were used. Curry leaf seedlings used in the 2015 experiments for transmission of ‘CLas’ from mandarin to curry leaf are referred to as 2015-curry leaf seedlings, and the curry leaf seedlings used for transmission of ‘CLas’ from 2015curry leaf seedlings are referred to as 2015B-curry leaf seedlings. seedlings are referred as NSC mandarin seedlings. 87 Mandarin Two experiments were conducted. The first was similar to the experiment with immature flush growth on mandarin stumps, and mandarin or curry leaf seedlings in 2014 (see Section 3.4.1). The aim was to further determine whether Diaphorina communis can transmit ‘CLas’. The second investigated transmission of ‘CLas’ from curry leaf to mandarin or curry leaf by Diaphorina communis. Average ambient temperature and relative humidity at Baychhu in 2014–2015 are shown in Figure 3.4. 3.5.1 Experiment 1 (2015) The objective of this experiment was to further determine whether Diaphorina communis can acquire and transmit ‘CLas’ from ‘CLas’-infected mandarin stumps to mandarin and curry leaf seedlings. Materials and Methods. The field component of the experiment was conducted from 6 May 2015 to 17 June 2015. Fourteen infected stumps, including four used in 2014, were selected from within the orchard. All other methods were similar to Experiment 1 (2014) (see Section 3.4.1) except for the following modifications:  In order to confirm that all plants were pathogen-free, leaf and bark samples were collected from the 2015-curry leaf seedlings from the NPPC and NSC mandarin seedlings and were subjected to PCR before the plants were placed in the field.  Two NSC mandarin and 2015-two curry leaf seedlings were placed in each of 14 BugDorm cages, in contrast to the single seedlings of each plant species in 2014. Forty Diaphorina communis adults were released into each of the cages on 6 May 2015. The placement of both mandarin and curry leaf seedlings in each of the cages was done to enhance survival of the adult psyllids.  Two seedlings of each species were also placed into two other BugDorm cages to serve as control plants (Diaphorina communis adults were not released into these cages) (Table 3.8). 88 Table 3.8. NSC mandarin and 2015-curry leaf seedling allocations in the BugDorm cages used in 2015 for transmission of 'CLas' from infected mandarin stumps by Diaphorina communis. Cage/stump number NSC mandarin seedling identification number 2015-curry leaf seedling identification number L1 M1 & M2 CL1 & CL2 L2 M31 & M32 CL42 & CL43 L3 M5 & M6 CL5 & CL6 L4 M7 & M8 CL7 & CL8 L5 M9 & M10 CL9 & CL10 L6 M11 & M12 CL32 & CL41 L8 M13 & M14 CL13 & CL14 L9 M15 & M16 CL15 & CL16 L10 M17 & M18 CL17 & CL18 U1 M23 & M24 CL23 & CL24 B8 M27 & M28 CL34 & CL38 B16 M21 & M22 CL21 & CL22 B20 M29 & M30 CL29 & CL30 B22 M19 & M20 CL19 & CL20 Control M33 & M44 CL44 & CL45 Diaphorina communis adults were collected from Basochhu, as described in Section 3.3.2, and 40 adults were released into the cages on 6 May 2015. Unlike in Experiment 1 (2014) (see Section 3.4.1), numbers of surviving adults in each cage were counted one day after they were released into the cages, and a second release was made on 8 May 2015 with 55 adults as more than 50% of adults released on 6 May had died. Subsequently, psyllid colonies in the cages were augmented weekly so as to maintain populations of ~50 adults per cage for 39 d. The psyllid release method was slightly modified for this work. The desired number of psyllids were aspirated into 15 mL glass tubes and then released on the same day with the tubes left open in the BugDorm cages. Pooled samples of psyllids representative of the population used in the first three releases (6, 8 and 14 May 2015) were stored in 89 100% ethanol for detection of ‘CLas’, samples tested included adults for the first two release, and 4th–5th instar nymphs for the third release. On the fortieth day, the live adults in the cages were collected using an aspirator and stored in 100% ethanol; psyllid DNA extracts were then prepared from single adults or samples comprising four or five adults and used to test for ‘CLas’. All seedlings were removed and transferred to separate cages and maintained under green shade cloth at Baychhu for 40 d before they were transported to the NPPC. The NSC mandarin seedlings, each labelled, were caged together in groups of four or five. The 2015-curry leaf seedlings were caged separately to be used in Experiment 2 of 2015 (Section 3.4.6). Tissue samples from the mandarin stumps were collected to test for the presence of the pathogen in the stumps. Periodic testing for ‘CLas’ in the NSC mandarin and 2015-curry leaf seedlings commenced 76 d (~ 2.5 months) after the ATI and sampled two more times during the next 217 d. Results. The four stumps that were used in 2014 were not tested prior to the experiment as they were all ‘CLas’-positive in 2014. The FAM Ct ranges before and after commencement of the experiment for the 10 stumps selected in 2015 were 27.89–38.57 and 28.65–36.90. The FAM Ct values for the positive control samples used in the assays were 34.61 and 25.19, and that of the extraction control were zero. The internal control (CAL) Ct values ranged from 16.64 to 25.19 and 15.0 to 34.21 for samples collected before and after ATI respectively (Table 3.9). The average numbers of Diaphorina communis adults alive in the cages over the six weeks from the second release of adults into the cages on 8 May 2015 are shown in Figure 3.8. All cages had at least 20 adults alive on average during the acquisition and transmission interval (ATI). The highest number of adults were alive in cage L4 followed by cage L5 and B8, minimum in cage L10 followed by U1. 90 Table 3.9. Ct values of samples of Baychhu mature mandarin tree stumps before and after ATI of Experiment 1 (2015). Stump Number 1 Ct values Before (19 March 2015) After (17 June 2015) FAM CAL FAM CAL B8 NA NA 31.65 15.49 B16 NA NA 29.35 15.01 B20 NA NA 36.90 20.82 B22 NA NA 29.57 16.75 L4 31.03 20.43 29.56 15.50 L5 34.53 18.13 29.56 15.36 L6 29.79 16.64 31.01 17.62 L7 30.00 20.04 dead dead L8 29.71 19.09 29.76 16.31 L9 34.68 18.10 31.32 16.66 L10 28.71 17.58 29.95 15.62 U1 27.89 16.50 28.65 16.97 Positive control 34.61 25.19 34.23 23.14 Extraction control 0.00 18.35 0.00 34.21 1 Stumps B8, 16, 20, and 22 were stumps used in 2014. NA = all 10 stumps used in 2014 were not tested before the 2014 experiment commenced 91 Figure 3.8. Average numbers of live Diaphorina communis adults in experimental cages (Mean ± SE) for six weeks after 50 adults were released into each cage on May 8 2015. Populations in the cages were augmented weekly to the initial number if less than 25 adults were present. ‘Candidatus Liberibacter asiaticus’ titres for pooled samples of Diaphorina communis adults representative of the populations used for release in the cages housing ‘CLas’ infected-stumps, 2015-curry leaf and NSC mandarin seedlings, are presented in Table 3.10. All samples had FAM Ct values equal to zero and the internal control (wg gene, flurophor = CAL) Ct value range was 25.23–36.01, except for two samples that had CAL Ct values equal to zero. The ‘CLas’ Ct values for Diaphorina communis adults collected at the end of ATI in 2015 are presented in Table 3.11. A total of 109 DNA extracts prepared from single adults or samples comprising four or five adults were tested. Of these, 16 produced FAM Ct values > 0.00 and seven had FAM Ct values < 32. Samples that showed FAM Ct values < 32 were subjected to cPCR, and a sample that showed a FAM Ct value of 17.03 was successfully amplified and sequenced. A BLAST search with the sequence obtained from this sample had a 99% identity with ‘CLas’ isolates from China, India and Japan. 92 Table 3.10. ‘Candidatus Liberibacter asiaticus’ titres in pooled samples of Diaphorina communis adults and nymphs representing the samples released in the cages on the first three occasions. Sample Name NPE1 Date Ct values FAM CAL3 Adults DCO 1 1 6 May 2015 0.00 27.15 DCO 2 1 6 May 2015 0.00 26.83 DCO 3 1 6 May 2015 0.00 26.91 DCO 4 1 6 May 2015 0.00 27.48 DCO 5 1 6 May 2015 0.00 26.89 DCO 6 5 6 May 2015 0.00 26.81 DCO 7 5 6 May 2015 0.00 27.46 DCO 8 5 6 May 2015 0.00 26.35 DCO 8 1 8 May 2015 0.00 0.00 DCO 9 1 8 May 2015 0.00 0.00 DCO 10 1 8 May 2015 0.00 28.87 DCO 11 1 8 May 2015 0.00 29.19 DCO 12 1 8 May 2015 0.00 27.94 DCO 13 3 8 May 2015 0.00 30.89 DCO 14 3 8 May 2015 0.00 36.01 DCN12 5 14 May 2015 0.00 25.94 DCN2 2 5 14 May 2015 0.00 25.23 DCN3 2 5 14 May 2015 0.00 25.30 Nymphs 1 NPE = number per extractions. Nymphs collected during adult collection for third release were used. 3 Wingless gene probe and primer (Manjunath et al. 2008). 2 93 Table 3.11 ‘Candidatus Liberibacter asiaticus’ titres in Diaphorina communis adults collected at the end of ATI for Experiment 1 (2015). FAM Ct values2 ‘CLas' +ve3 CAL 0.00 (8) 0 27-30 20 (8) 0.00 (8) 0 27-29 22 20 (8) 0.00 (7); 38.91 (1) 0 27-30 B22 23 20 (8) 0.00 (7); 37.52 (1) 0 27-30 L1 16 15 (7)a 0.00 (5); 33.10-35.32 (2) 0 26-28 L2 18 15 (7)a 0.00 (7) 0 25-28 L3 25 15 (7)a 0.00 (6); 39.70 (1) 0 26-30 L4 44 20 (8) 17.03-32.78 (8)* 7 23-27 L5 29 20 (8) 0.00 (7); 38.3 (1) 0 25-28 L6 25 20 (8) 0.00 (8) 0 27-30 L8 19 19 (8)b 0.00 (7); 37.24 (1) 0 26-30 L9 32 20 (8) 0.00 (8) 0 27-30 L10 25 20 (8) 0.00 (8) 0 25-29 U1 24 20 (8) 0.00 (7); 36.04 (1) 0 27-30 Cage number Number of adults collected Number of adults tested per cage1 B8 22 20 (8) B16 27 B20 1 Five and three extracts made with one adult and five adults per extraction respectively except: Two extractions with 5 adults: total extraction numbers are given in parentheses. b Two extractions with 5 adults and 1 extraction with 4 adults; 2 FAM Ct values are given without parentheses. Numbers within parentheses indicate the number of the samples showing the respective values. Only 16 samples produced FAM > 0.00. 3 Number of samples that are ‘CLas’ positive * Psyllid sample that produced FAM Ct value of 17.03 (isolate L4-1) was sequenced; the rest of the extracts in the same batch did not yield any amplicon in cPCR. a Titres of ‘CLas’ in 2015-curry leaf seedlings collected before and after the ATI are shown in Table 3.12. All samples collected before the ATI, and the extraction control which consisted of midrib tissue of a peach plant, showed FAM Ct values equal to zero while the positive controls produced a FAM Ct value of 33.81. The highest number of seedlings with FAM Ct values > 0.00 was obtained from plants sampled on the first occasion. Twelve seedlings produced FAM Ct values ranging from 33.14–39.40 and three of these had FAM Ct values ≤ 36. None of these 94 samples yielded any amplicons when subjected to cPCR. Hence, the presence of ‘CLas’ could not be confirmed through sequencing. On the second occasion when seedlings were sampled, the same plants produced FAM Ct values equal to zero or higher than the FAM Ct of the first sampling except for curry leaf seedlings, CL13 and CL17, that both yielded FAM Ct value of 35.27. On the third occasion, 293 d (~10 months) after the ATI, all plants yielded FAM Ct values equal to zero. The internal control Ct values for some of the first samples were zero due to degraded DNA (DNA elutes appeared dark). Titres of ‘CLas’ in the NSC mandarin seedlings before and after the ATI are shown in Table 3.13. As for the curry leaf seedlings above, samples from the mandarin seedlings were collected before being placed in the experimental cages with infected mandarin stumps and adult psyllids. Samples were collected at the same intervals as noted above for the curry leaf seedlings. All mandarin seedling samples collected before the experiment commenced produced FAM Ct values equal to zero and the CAL Ct values ranging from 14.01 to 22.45. The highest number of samples with FAM Ct values > 0.00 was observed for plants, including control plants, sampled on the first occasion. Ten of 17 plants with FAM Ct values > 0.00 were subjected to cPCR but none produced amplicons. The number of samples with FAM Ct values > 0.00 decreased in the subsequent samplings. The FAM Ct values for the positive controls in the assays ranged from 19.66 to 33.80 while those of the extraction controls were 0.00. The CAL Ct values for the positive and extraction controls ranged from 14.34–27.36 and 18.57–33.5, respectively. 95 Table 3.12. 'CLas' titres in samples of 2015-curry leaf seedlings collected before and after the ATI of Experiment 1 (2015). 2015-curry leaf seedling (cage number)1 Ct values before ATI Ct values of samples (days after ATI) 76 d 243 d 293 d FAM CAL FAM CAL FAM CAL FAM CAL CL1 (L1) 0.00 15.95 0.00 0.00 0.00 24.20 0.00 20.71 CL2 (L1) 0.00 16.16 0.00 0.00 0.00 24.33 0.00 21.21 CL5 (L3) 0.00 18.61 0.00 0.00 0.00 24.04 0.00 21.57 CL6 (L3) 0.00 17.33 0.00 0.00 0.00 24.21 0.00 20.52 CL7 (L4) M M 0.00 39.63 0.00 22.61 0.00 20.62 CL8 (L4) 0.00 19.18 0.00 0.00 0.00 25.86 0.00 20.01 CL9 (L5) 0.00 18.41 34.45 27.53 0.00 28.22 0.00 21.32 CL10 (L5) 0.00 17.16 33.14 25.99 39.63 28.37 0.00 21.10 CL13 (L8) 0.00 18.00 39.40 25.72 35.27 27.76 0.00 19.03 CL14 (L8) 0.00 18.05 0.00 24.32 0.00 27.07 0.00 19.84 CL15 (L9) 0.00 17.37 37.67 23.83 0.00 24.85 0.00 31.64 CL16 (L9) 0.00 16.87 0.00 0.00 0.00 26.31 0.00 0.00 CL17 (L10) 0.00 17.06 37.97 24.53 35.27 25.42 0.00 0.00 CL18 (L10) 0.00 17.41 36.00 29.20 0.00 24.55 0.00 34.26 CL19 (B22) 0.00 17.72 37.99 29.84 0.00 25.19 0.00 0.00 CL20 (B22) 0.00 20.22 0.00 27.83 0.00 24.67 0.00 0.00 CL21 (B16 0.00 17.97 37.45 29.18 0.00 24.47 0.00 0.00 96 2015-curry leaf seedling1 Ct values before ATI Ct values of samples (days after ATI) 76 d 243 d 293 d FAM CAL FAM CAL FAM CAL FAM CAL CL22 (B16) 0.00 19.61 0.00 28.11 0.00 25.54 0.00 21.75 CL23 (U1) 0.00 19.45 37.68 25.13 0.00 24.84 0.00 0.00 CL24 (U1) 0.00 17.76 36.90 24.82 0.00 23.62 0.00 0.00 CL29 (B20) 0.00 17.75 0.00 27.99 0.00 25.54 0.00 0.00 CL30 (LB20) 0.00 17.99 0.00 28.27 0.00 23.85 0.00 0.00 CL32 (L6) 0.00 17.96 36.07 27.80 0.00 0.00 0.00 0.00 CL34 (B8) 0.00 15.45 0.00 25.18 0.00 24.82 0.00 0.00 CL38 (B8) 0.00 16.30 36.61 26.51 37.41 24.34 0.00 0.00 CL41 (L6) 0.00 16.46 0.00 31.74 0.00 23.47 0.00 0.00 CL42 (L2) 0.00 17.11 0.00 28.12 38.63 28.22 0.00 0.00 CL43 (L2) 0.00 19.67 M M 0.00 27.57 0.00 0.00 CL44 (C) 0.00 15.79 M M 0.00 38.03 0.00 0.00 CL45(C) 0.00 16.99 M M 0.00 26.70 0.00 0.00 PC 33.81 24.27 19.95 22.72 18.89 21.25 19.66 14.34 EC 0.00 33.50 0.00 27.00 0.00 23.74 0.00 18.57 1 Cage numbers are given in parentheses. ATI = Acquisition and transmission interval. ‘C’ indicates control cage which was set up without psyllids or inoculum source with test plants CL44 & CL45. FAM = ‘CLas’ DNA, CAL = internal control; M = missing samples; PC = positive controls; EC = extraction control (peach midribs). Samples subjected to cPCR are shown with emboldened FAM Ct values. 97 Table 3.13. ‘CLas’ titres in NSC mandarin seedlings before and after the ATI of the Experiment 1 (2015) NSC mandarin seedling1 Ct values before ATI Ct values of samples collected after ATI 76 d 243 d 293 d FAM CAL FAM CAL FAM CAL FAM CAL M1 (L1) 0.00 17.61 0.00 18.77 0.00 21.58 0.00 26.94 M2 (L1) 0.00 16.31 34.15 18.36 0.00 21.59 37.84 25.95 M5 (L3) 0.00 17.21 0.00 18.67 0.00 21.92 0.00 25.19 M6 (L3) 0.00 16.11 0.00 18.84 0.00 24.11 0.00 25.01 M7 (L4) 0.00 16.29 0.00 18.47 0.00 24.34 0.00 25.94 M8 (L4) 0.00 17.84 36.52 18.86 0.00 27.50 39.02 24.74 M9 (L5) 0.00 18.04 0.00 19.40 0.00 23.80 0.00 26.43 M10 (L5) 0.00 21.48 38.32 19.30 0.00 21.62 0.00 24.20 M11 (L6) 0.00 15.21 38.75 19.12 38.87 17.27 0.00 27.34 M12 (L6) 0.00 15.13 37.10 20.24 36.80 18.53 0.00 28.52 M13 (L8) 0.00 16.40 38.82 18.27 0.00 18.40 38.49 23.42 M14 (L8) 0.00 15.32 0.00 21.27 0.00 19.75 0.00 24.92 M15 (L9) 0.00 22.45 0.00 19.33 0.00 17.16 0.00 26.56 M16 (L9) 0.00 15.88 0.00 21.63 0.00 18.03 0.00 27.25 M17 (L10) 0.00 15.39 0.00 24.63 0.00 16.79 0.00 24.79 M18 (L10) 0.00 14.61 36.86 21.17 37.05 15.64 0.00 27.36 M19 (B22) 0.00 14.54 M M 38.56 15.87 0.00 27.43 M20 (B22) 0.00 14.01 36.30 18.65 37.99 17.33 36.55 24.58 M21 (B16) 0.00 14.34 0.00 20.14 0.00 23.23 0.00 27.18 98 NSC mandarin seedling1 Ct values before ATI Ct values of samples collected after ATI 76 d FAM CAL 243 d 293 d FAM CAL FAM CAL FAM CAL M22 (B16) 0.00 15.16 0.00 19.16 0.00 22.81 0.00 25.45 M23 (U1) 0.00 16.06 38.54 20.15 0.00 23.45 0.00 27.58 M24 (U1) 0.00 14.72 38.92 19.20 0.00 22.72 0.00 23.58 M26 (B11) 0.00 14.01 38.05 18.12 0.00 24.79 0.00 23.58 M27 (B8) 0.00 15.58 37.61 18.33 M M 37.00 24.50 M28 (B8) 0.00 14.93 37.09 18.36 0.00 23.59 0.00 25.81 M24 (U1) 0.00 14.72 38.92 19.20 0.00 22.72 0.00 23.58 M29 (B20) 0.00 14.35 0.00 19.80 0.00 24.56 0.00 24.90 M30 (B20) 0.00 15.65 38.36 23.95 0.00 21.51 0.00 24.10 M31 (L2) 0.00 19.54 0.00 21.86 35.67 28.92 dead dead M32 (L2) 0.00 15.88 37.77 18.26 0.00 24.46 0.00 24.50 M33 (C) 0.00 16.45 35.87 19.03 M M 0.00 25.52 M34 (C) 0.00 14.81 36.58 18.42 M M 0.00 23.22 PC 33.80 24.27 26.51 27.36 19.66 14.34 20.62 0.00 EC 0.00 33.50 0.00 21.31 0.00 18.57 0.00 24.10 1 Cage numbers are given in parentheses; ‘C’ indicates control cage that was set up without psyllids or inoculum source with test plants M33 & M44. Sampling commenced ~75d after start of incubation and subsequent sampling conducted at the same interval; FAM = ‘CLas’ DNA; CAL = internal control; M = missing samples; PC = Positive controls; EC = Extraction controls (peach midribs). Ct value of the sample subjected to conventional PCR is emboldened. 2 99 3.5.2 Experiment 2 (2015) The objective of this experiment was to further determine possible transmission of ‘CLas’ by Diaphorina communis adults eclosing from nymph-infested 2015-curry leaf seedlings to initially psyllid-free NSC mandarin seedlings and 2015B-curry leaf seedlings. It was undertaken on the assumption that ‘CLas’ may have been transmitted to the 2015-curry leaf seedlings from the ‘CLas’-infected mandarin stumps. Materials and Methods. Fourteen BugDorm cages were used. Pairs of 2015-curry leaf seedlings infested with eggs and nymphs were placed in each of the 14 cages on 17 June 2015 in which one ‘CLas’-free NSC mandarin seedling and one ‘CLas’-free 2015B-curry leaf seedling were also placed eight days later (25 June 2015) and maintained for 82 d; by this time, Diaphorina communis adults eclosed in some cages. Numbers of Diaphorina communis eggs, nymphs and adults present on 2015curry leaf seedlings were recorded. Titres of ‘CLas’ in the NSC mandarin, 2015B-curry leaf seedlings and psyllids were assessed. The first plant samples were collected at 35 d after the ATI (on 15 October 2015), two subsequent samples were collected at 81–83 d. Representative psyllid samples were collected on 8 July 2015 which corresponded to ~13 d after the eclosion of first adult psyllids (EFAP) and at the end of the acquisition and transmission interval (ATI), which lasted for 82 d (i.e., 90th d after commencement of experiment). Results. Numbers of Diaphorina communis eggs, nymphs and adults present on 2015-curry leaf seedlings when they were removed from the 14 cages with ‘CLas’infected mandarin stumps and Diaphorina communis adults are presented in Table 3.14. Nymphs were present on three of the plants on the day after removal from the cage with infected stumps (17 June 2015). Adults were present in five cages eight days after the cages were removed from the mandarin stumps. Adults were present in seven of the cages 21 d after the cages were removed from the stumps and most adults survived until removal on day 90. 100 Titres of ‘CLas’ in Diaphorina communis adults, and the NSC mandarin and 2015Bcurry leaf seedlings during the experiment are presented in Table 3.15. All samples of psyllid adults collected at 13 d after eclosion of first adult psyllids produced FAM Ct value of zero except for two samples that produced FAM Ct values of 37.23 and 37.44. Psyllid samples collected at the end of ATI produced FAM Ct values of zero. The CAL Ct values for the two sample dates ranged from 24.5–26.66 and 24–28, respectively. Samples of all NSC mandarin and 2015B-curry leaf seedlings before they were placed in cages with the egg-infested 2015-curry leaf seedlings produced FAM Ct values equal to zero. Analysis of samples collected at 35 and 118 d after the ATI resulted in some samples producing FAM Ct values between 34.09 and 39.89 for both the mandarin and curry leaf seedlings used to test transmission. Attempts to amplify samples with FAM Ct values ranging from 34 to 36 with A2/J5 primers did not yield any amplicons. Samples collected at 199 d after the ATI resulted in only one mandarin sample with FAM Ct value > 0.00 (= 38.08) and all curry leaf seedlings produced FAM Ct values equal to zero. 101 Table 3.14. Number of eggs, nymphs and adults present on 2015-curry leaf seedlings when (17 June 2014) they were removed from the cages with ‘CLas’ infected mandarin stumps and Diaphorina communis, used to determine transmission of ‘CLas’ from them by eclosing Diaphorina communis adults to NSC mandarin and 2015Bcurry leaf seedlings from 17 June 2015 to 15 September 2015. Original cage number1 Set A curry leaf seedling number NSC Mandarin Set B curry leaf seedlings Presence of eggs and nymphs on 2015-curry leaf seedlings and number of adults emerged during ATI Day 0 (17 June 2015) Eggs nymphs adults Day 8 (25 June 2015) eggs Day 21 (8 July 2015) Day 37 (24 July 2015) Day 90 (15 Sept 2015) nymphs adults adults2 adults adults2 L1 CL1 & CL2 M8a CL8a ++ -- 0 -- +/- 0 8 1 0 L2 CL42 & CL43 M7a CL7a ++ -- 0 ++* ++* 0 4 0 0 L3 CL5 & CL6 M13a CL13a +/- -/+ 0 -- -- 5 40 13 45 L4 CL7 & CL8 M10a CL10a ++ ++ 0 -- -- 13 30 5 7 L5 CL9 & CL10 M9a CL9a ++ -- 0 -- -- 4 17 2 0 L6 CL32 & CL41 M6a CL6a ++ -- 0 -- +/- 0 1 0 0 L8 CL13 & CL14 M3a CL3a ++ -- 0 -- ++ 0 4 1 0 L9 CL15 & CL16 M14a CL14a ++ -- 0 ++ +/- 1 52 15 22 L10 CL17 & CL18 M11a CL11a ++ -- 0 ++ -- 3 49 17 6 U1 CL23 & CL24 M12a CL12a ++ -- 0 -- -- 0 0 0 0 B8 CL34 & CL38 M2a CL2a ++ -- 0 -- ++ 0 0 0 0 B16 CL21 & CL22 M1a CL1a ++ -- 0 -- ++ 0 16 12 25 B20 CL29 & CL30 M5a CL5a +/- -- 0 -- ++ 0 0 0 0 B22 CL19 & CL20 M4a CL4a ++ -0 -++ 0 11 2 0 1 Cage number refers to the experimental cage with infected stumps for transmission for ‘CLas’ from the mandarin stumps to mandarin and Set A curry leaf seedlings; 2 Representative psyllids collected and tested for ‘CLas’; *dried and dead; ++ or --indicate the presence/absence of eggs/nymphs on both inoculum source plants respectively. +/- indicates presence on one of the source plants but not the other. 102 Table 3.15. ‘CLas’ titres in Diaphorina communis adults, and the NSC mandarin and 2015B-curry leaf seedlings during the experiment to determine transmission of ‘CLas’ by Diaphorina communis adults from 2015-curry leaf seedlings. FAM Ct range of psyllids collected at 13 d after the eclosion of first adult psyllids1 0.00–37.44* CAL Ct range of psyllids collected at 13 d after the eclosion of first adult psyllids1 24.5–26.66 FAM Ct range of psyllids at end of ATI2 0.00 CAL Ct range of psyllids at end of ATI2 24–28 FAM Ct range of the 14 NSC mandarin seedlings before caging with 2015curry leaf seedlings. 0.00 FAM Ct range of 14 2015B-curry seedlings before caging with 2015-curry leaf seedlings. 0.00 Number of NSC mandarin seedlings with FAM Ct values > 0.00 and their Ct range. Samples collected on three occasions: 1. 35 d after ATI 7 & 34.95–38.90** 2. 118 d after ATI 4 & 37.06–39.72 3. 199 d ATI 1 & 38.08 Number of Set B curry leaf seedlings with FAM Ct values > 0.00 and their Ct range: 1. 35 d after ATI 10 & 34.09–39.89** 2. 118 d after ATI 5 & 36.51–39.39 3. 199 d after ATI 0 1 16 samples of adult Diaphorina communis and each sample extracted from composite of two adults; 38 samples comprising of 22 extracts made from single adults and 16 extracts made from composite of five adults per extract; * Only two samples with FAM Ct of 37.23 & 37.44; ** Samples with FAM Ct between 34 and 38 subjected to cPCR with primers A2/J5, but did not yield any amplicon. 2 103 3.6 Discussion 3.6.1 Preliminary studies in 2013 In the preliminary experiments, Diaphorina communis nymphs failed to survive on the NSC mandarin seedlings and no oviposition took place when adults were caged on immature, fully-expanded flush growth that developed on skeletonised branches of ‘CLas’-infested mandarin trees. However, survival of adults was better than nymphs. When adults were placed on branches of mandarin plants with young buds after the leaves had been stripped off, one egg was observed but the nymph that hatched from it did not survive to the second instar. These observations suggest that Diaphorina communis does not develop, or rarely develops, on mandarin and possibly other species of citrus. Therefore, further observations were made with regards to number of eggs, nymphs and adult emergence in cages in the field as well as under laboratory conditions. These observations confirmed that curry leaf is the preferred host of Diaphorina communis, and complete development takes place, possibly exclusively, on curry leaf. In the field cages at Baychhu, curry leaf plants had an average of 71 eggs per plant compared to one egg laid on mandarin. In the following weeks, higher numbers of eggs (65) were found on curry leaf compared to mandarin (0), and many nymphs had emerged on curry leaf by the second week. However, the proportion of surviving adults was comparable between mandarin and curry leaf, i.e., adult psyllids can survive on mandarin but rarely reproduce. A similar trend was observed in the laboratory when adults of Diaphorina communis were provided with curry leaf and mandarin plants in the choice and no choice experiment. No psyllids developed if curry leaf seedlings were not provided (Figure 3.6). This outcome provided further evidence that Diaphorina communis does not develop on mandarin. In the field, adults reared from nymphs collected from curry leaf shrubs were always Diaphorina communis (pers. obs.). However, adults were often observed at Baychhu on mature, seedling mandarin trees, Murraya elongata (see Chapter 7), and a species of Zanthoxylum. Diaphorina communis was originally described from curry leaf (Mathur 1935; 1975), and Tara & Sharma (2010a; 2010b) have more recently reported it as a host plant of the psyllid. 104 My results suggest that Diaphorina communis has a very narrow host range, in contrast to Diaphorina citri, which is known to colonise a wide range of hosts (Aubert 1990; Manjunath & Halbert 2004; Nava et al. 2007; Beattie & Barkley 2009; Westbrooke et al. 2011). The most common theory applied to insect host plant preference is the ‘optimal oviposition’ theory, which takes into account the suitability of the host plant for the development of sessile offspring (Prager et al. 2014). The factors that influence the preference for curry leaf by Diaphorina communis remain to be determined. Insect host preference is influenced by many factors such as stimulant or deterrent host plant metabolites, and involves visual, olfactory, gustory and tactile cues and mechanisms (Nishida 2014). Testing for ‘CLas’ in adult Diaphorina communis caged on infected branches of mature mandarin trees for 54 d in the preliminary experiment (Section 3.3.2) showed FAM Ct values ranging from 20.58 to 39.5 and 21.53 to 38.11 in single and composite samples of adults, respectively. In total, 14 samples produced FAM Ct value between 0.00 and 32, while 41 samples out of the total 53 samples produced FAM Ct values between 0.00 and 40. Selected samples have been successfully sequenced. This result supports an earlier record of acquisition of ‘CLas’ by Diaphorina communis from mandarin (Donovan et al. 2012a; 2012b). 3.6.2 Studies in 2014 and 2015 Studies on acquisition of ‘CLas’ by Diaphorina communis commenced in 2013, and possible transmission was assessed in 2014 and 2015 using greenhouse-grown curry leaf and mandarin seedlings with naturally-infected mandarin stumps as a source of ‘CLas’. Possible acquisition and transmission of ‘CLas’ by Diaphorina communis from curry leaf seedlings held with ‘CLas’-infected mandarin stumps to greenhousegrown mandarin and curry leaf seedlings was also assessed. Although the mandarin stumps used as inoculum sources in 2014 all tested positive for ‘CLas’ (Table 3.5), few psyllids collected at the end of the ATI tested positive for ‘CLas’ (Table 3.6) when the FAM Ct threshold was set at 32. Some samples of psyllids collected at the end of the ATI on 5 July 2014 produced FAM Ct values > 32 105 in contrast to samples tested before their release into the cages with ‘CLas’ infected mandarin stumps that mainly produced FAM Ct value of zero. This questions the reliability of the Ct cut-off value. A value of zero indicates that the bacterium is not detected, whereas the results of samples with FAM Ct values in the range of 32 < FAM Ct ≤ 40 are ambiguous, as these high Ct values can be interpreted as the insects having low titres of the bacterium or due to some nonspecific amplification during the assay. However, non-specific amplifications seem quite unlikely given that all psyllids samples produced FAM Ct value of zero when tested before the psyllids were released in cages with ‘CLas’-infected mandarin infected stumps (Tables 3.6). For NSC mandarin and 2014-curry leaf seedlings used to test transmission of the pathogen by Diaphorina communis in 2014, FAM Ct values in the range of 0.00 < FAM Ct < 36 were recorded in five plant samples collected at 44 d after ATI (Table 3.4 & 3.5). These values indicated that the plant samples contained ‘CLas’ as a result of acquisition and transmission of the pathogen from ‘CLas’-infected mandarin stumps by Diaphorina communis. However, with one exception (mandarin B1 at 377 d), subsequent samples from all seedlings produced FAM Ct values equal to zero or in the range of 36 < FAM Ct < 40. Further assessment with cPCR of extracts from plants with FAM Ct values from 34 to 37 did not yield any amplicons. Similar results were obtained with the attempt to inoculate NSC mandarin seedlings from the 2014curry leaf seedlings (Experiment 2 of 2014, Table 3.7). These samples could not be ‘CLas’ positive. The FAM Ct values in the range of 0.00 < FAM Ct < 36 during the first sampling of both mandarin and curry leaf samples of Experiment 1 and mandarin samples of Experiment 2 of 2014 could have been due to contamination during the extraction process in the laboratory. Some of the samples processed prior to November 2014 were chopped with the same blade. Use of disposable blades and sterile glassware were strictly observed after observation of such PCR results in November 2014. Moreover, a very low number of adults survived in the cages after 50 were released into each cage in the experiment, with most of these adults dying shortly after they were released. Populations in the cages were supplemented by the release of additional adults on two occasions, the last 16 d before ATI. Adult survival was higher in the cages with curry leaf seedlings (Tables 3.2 & 3.3). For Experiment 106 2 of 2014, it is worthy to note that the samples of the NSC mandarin seedlings mandarin 5 and 8 in cages CLB15 and CLB21 collected at 372 and 536 d after ATI produced FAM Ct values ≤ 36 but these cages did not even have any adult eclosed during the entire 71 d period (Table 3.7). The outcome of studies on acquisition and transmission of ‘CLas’ by Diaphorina communis in 2015 (Tables 3.9–3.15) did not differ from the outcomes in 2014. The experiment in 2015 addressed factors overlooked in 2014 by increasing the number of test seedlings; using both curry leaf and mandarin seedlings so as to enhance survival of psyllid adults in the cages; sampling curry leaf and mandarin seedlings for ‘CLas’ before and after psyllid adults fed on them; including curry leaf and mandarin seedlings not exposed to Diaphorina communis and ‘CLas’-infected mandarin stumps as controls; counting and augmenting psyllid populations in cages weekly; and including DNA extraction controls using leaf tissue of either apple or peach to detect any contamination during extraction. However, sampling of mandarin and curry leaf seedlings used in the 2015 experiment was only feasible on three occasions up to 293 d after the ATI. As in 2014, all psyllid samples representing populations released into the cages produced FAM Ct values equal to zero. In contrast, psyllid samples collected from the cages at the end of ATI produced FAM Ct values ranging from 0.00 to 39.7, and seven samples had FAM Ct values ≤ 32 (Table 3.11). Although one psyllid sample with a FAM Ct value of 17.03 produced an amplicon that was successfully sequenced using primers A2/J5, other extracts with FAM Ct values > 0.00 failed to produce amplicons. The current data on the detection of ‘CLas’ in Diaphorina communis indicates a low acquisition rate of ‘CLas. In addition, the experiments in 2014 and 2015 indicate that although Diaphorina communis can acquire ‘CLas’, it does not appear to be able to transmit it, and the pathogen may not multiply within the insect. Although some of the test plants produced FAM Ct values ≤ 36 (Tables 3.4 & 3.5, 3.7, 3.12 & 3.13), these plants cannot be interpreted as ‘CLas’ positive, because no sequencing results could be achieved. Moreover, it is difficult to know where to set the Ct threshold, 107 given that Ct thresholds vary in the literatures and there appears to be an inconclusive region above the threshold. 3.7 Highlights of the study:  Diaphorina communis adults can acquire ‘CLas’ but at a low rate.  Diaphorina communis feeds and develops exclusively on curry leaf when given the choice. However, a low to negligible rate of development of Diaphorina communis is observed on mandarin under no-choice conditions  There is no evidence that curry leaf can harbour ‘CLas’.  No evidence of transmission of ‘CLas’ by Diaphorina communis from infected mandarin to mandarin or curry leaf could be established. 108 Chapter 4: Comparison of parasitoids of Diaphorina citri Kuwayama and Diaphorina communis Mathur (Hemiptera: Sternorrhyncha: Liviidae) ____________________________________________________________________ 4.1 Introduction Tamarixia radiata (Waterson) (Hymenoptera: Eulophidae) is an ectoparasitoid attacking nymphs of the Asiatic citrus psyllid (ACP), Diaphorina citri and was first described as Tetrastichus radiatus by Waterston (1922). The Asiatic citrus psyllid is the primary vector of ‘CLas’, the causal agent of huanglongbing (HLB) (Aubert 1987; Halbert & Manjunath 2004; Bové 2006; Hall et al. 2013). As mentioned in Chapter 1, HLB is a serious disease of citrus for which there is no cure. Disease mitigation requires integrated programs including the suppression of psyllid populations through various methods. Biological control is one approach to limiting psyllid populations, particularly in homegarden, suburban situations or where the use of insecticides is problematic. As such, Tamarixia radiata has been introduced intentionally or unintentionally to Réunion and Mauritius (Aubert et al. 1996), China, including Taiwan (Chiu et al. 1988; Tang 1988; Chien & Chu 1996), the Caribbean and widely within the citrus growing regions of North, Central and South America where Diaphorina citri now occurs (Étienne et al. 2001; Parra et al. 2016). As mentioned in the earlier chapters, the black psyllid, Diaphorina communis, was recorded by Mathur (1935) on curry leaf (Bergera koenigii L.) at Dehradun in northern India, but not described until 1975 (Mathur 1975). Heavy infestations of nymphs cause leaves to wilt and fall, and young growth can be killed and branches deformed (Mathur 1935). Aubert (1987) briefly mentioned that Diaphorina communis and two other psyllids, Diaphorina auberti Hollis and Trioza litseae Bordage, harbour ‘chalcidoid parasite insects identical to those attacking either Trioza erytreae or Diaphorina citri’. ‘Candidatus Liberibacter asiaticus’ was recorded in the adult psyllid by Donovan et al. (2012a;2012b). The pathogen was also recorded in Diaphorina communis in my studies (Chapter 3). 109 In Bhutan, parasitised nymphs of Diaphorina communis were first observed in a small mandarin orchard at Baychhu (27.29749ºN, 89.96691ºE, 784 m ASL), Wangdue Phodrang Dzongkhag, in April 2013 on curry leaf. Although the percent parasitism in the orchard was not determined, parasitised nymphs were common. These nymphs exhibited exit holes on the thorax similar to holes left by emerging Tamarixia radiata adults in mummified Diaphorina citri nymphs. Parasitised nymphs of Diaphorina citri were also observed in another location on Murraya paniculata (L.) Jack (syn. Murraya exotica L.) (see Mabberley 2016). Subsequently, samples were collected to determine the parasitoids associated with the two species of psyllid. Molecular characterisation is necessary to complement morphological descriptions and is crucial if cryptic species are present in a genus. Moreover, the proper identification or characterisation of a parasitoid is important in biocontrol programs to ensure that any introduced agent is a primary parasitoid and not a hyperparasitoid, as hyperparasitism can reduce the effectiveness of biocontrol agents (Aubert 1987). Therefore, in this study, the mitochondrial cytochrome oxidase subunit I (COI) gene and nuclear internal transcribed spacers (ITS1 & ITS2) of the rRNA gene were used to investigate the genetic diversity and phylogenetic relationships between the two parasitoids of Diaphorina citri and Diaphorina communis. All three regions have been extensively used for molecular studies of insects (Lunt et al. 1996; Hebert et al. 2003; Ji et al. 2003). The specific aims of this section of study were to:  describe the molecular and morphological characteristics of the parasitoid of Diaphorina communis; and  to study the phylogenetic relationships between the parasitoids collected from Diaphorina communis and Diaphorina citri. 110 4.2 Materials and methods 4.2.1 Collection of parasitoids Although parasitism was recorded in April 2013, only specimens collected in 2014 were used for molecular studies. In this year, parasitoids emerging from single nymphs were individually collected. A total of 230 parasitoids from Diaphorina communis and 14 parasitoids from Diaphorina citri were collected from April to June 2014 in Bhutan. Parasitised nymphs of Diaphorina communis were collected from curry leaf in Baychhu and nearby Basochhu (27.36463°N, 89.91241°E, 1036 m ASL) while parasitised nymphs of Diaphorina citri were collected from Murraya paniculata (as identified in this study) found in Zangtopelri Park (26.86212°N; 89.38288°E, 221 m ASL) in Phuentsholing, Chukhha Dzongkhag. Each parasitised nymph was excised along with the leaf tissue and placed in a gelatine capsule on the evening of the collection day. The capsules were then placed in plastic containers and kept at room temperature (except during transportation) from the field to the laboratory. Capsules were examined daily for emergence of adult parasitoids. Upon emergence, adults were immobilised by freezing whole capsules at –20°C for > 3 h, preserved in 100% ethanol and then stored at –20°C until further use. 4.2.2 Molecular and phylogenetic analyses 4.2.2.1 Parasitoid DNA extraction DNA was then extracted from whole insects using ISOLATE II Genomic DNA kits (Bioline) following the manufacturer’s instructions but without crushing the samples (non-destructive method). This method allowed the same specimen to be used for microscopy. The pre-lysis step of the protocol was done overnight in a shaking, thermal block at 56°C and 300 rpm (Thermomixer Comfort, Eppendorf). The specimens were taken out before the DNA binding step, and stored in 80% ethanol at −20°C. DNA samples were stored at −20°C till further work. 111 4.2.2.2 Amplification of DNA and sequencing The COI gene and ITS1 and ITS2 regions from the parasitoids were amplified using the polymerase chain reaction (PCR). For the COI gene, the primer pair, CI-J-1718 (5’-GGA GGA TTTG GAA ATT GAT TAG TTC C-3’) and C1-N-2191 (5’-CCC GGT AAA ATT AAA ATA TAA ACT TC-3’) (Simon et al. 1994; Barr et al. 2009), was used. The ITS1 and ITS2 regions were amplified using primers ITS1-F/18sF (5’GTGAACCTGCGAAGGA-3’) with 5.8sR (5’-GTT CAT GTC CTG CAG TTC ACA-3’), and 5.8sF (5’-TGT GAA CTG CAG GAC ACA TGA AC-3’) with 28sR (5’- ATG CTT AAA TTT AGG GGG TA-3’), respectively. Reactions were set up as in Section 2.2.2 (Chapter 2). For all three regions, amplification cycling parameters were taken from Barr et al. (2009). For COI: initial denaturation at 94°C for 3 min followed by 39 cycles of denaturation at 94°C for 20 sec, annealing at 50°C for 20 sec, extension at 72°C for 30 sec and a single cycle of final extension at 72°C for 5 min. For ITS1 region: initial denaturation at 94°C for 3 min and 35 cycles of denaturation at 94°C for 30 sec, annealing at 55°C for 30 sec, and extension at 72°C for 50 sec followed by a single cycle of final extension at 72°C for 7 min. The same conditions were applied to the ITS2 region except the annealing temperature was 50°C. Post PCR procedures were conducted as in Section 2.2.3 (Chapter 2). 4.2.2.3 Sequence analyses Contiguous sequences of DNA were assembled at first with DNA Baser Sequence Assembler software (Version 4, Heracle Biosoft) and later with Geneious (Version 8, Kearse et al. 2012). Homologous sequences in GenBank (Table 4.1) were obtained through BLAST searches (NCBI, Maryland, USA). Only sequences that showed > 70% identity and coverage were selected from the data base. The sequences obtained from this study and from the database were aligned using Muscle as enabled in MEGA (Version 6, Tamura et al. 2013). Each alignment was cross checked to verify base callings and for the presence of indels. 112 For each gene or region, the number of variable sites and genetic distances (p) of the aligned sequences were calculated using MEGA 6. For COI, nucleotide sequences were translated to amino acid sequences using the invertebrate mitochondrial genetic code in MEGA 6 and also with the program ExPASy-translate tool (Gasteiger et al. 2003) to check the open reading frame (ORF). 113 Table 4.1. GenBank sequences used in molecular analyses of sequence data obtained from different populations of parasitoids of Diaphorina communis and Diaphorina citri collected in Bhutan. Gene Species Accession number Reference COI Tamarixia radiata FJ807949 de León & Sétamou (2010) Tamarixia radiata GQ912277 de León & Sétamou (2010)) Tamarixia radiata KT253023 Guzman-Larralde et al. (unpublished) Tamarixia triozae GQ912287 de León & Sétamou (2010) Aprostocetus aethiops HM573652 Kaartinen et al. (2010) Aprostocetus cerrricola JQ416730 Stone et al. (2012) Aprostocetus cerrricola HM573863 Kaartinen et al. (2010) Aprostocetus forsteri KR882328 Hebert et al. (2016) Aprostocetus gala KJ701414 Shylesha & Abraham (unpublished) Aprostocetus meltofei KR805635 Hebert et al. (2016) Aprostocetus meltofei KU374349 Wirta et al. (2016) Tetrastichus schoenobii KJ627790 Reetha et al. (unpublished) Tamarixia radiata FJ807955 de León & Sétamou (2010) Tamarixia radiata GQ401991 Barr et al. (2009) Tamarixia radiata JF924972 Tanner et al. (2011) Tamarixia radiata GQ401789 Barr et al. (2009) Tamarixia radiata JF925003 Tanner et al. (2011) Aprostocetus aethiops HM573653 Kaartinen et al. (2010) Aprostocetus gala KF958278 Reetha et al. (unpublished) ITS1 ITS2 114 4.2.2.4 Phylogenetic relationships Phylogenetic relationships between the parasitoids of Diaphorina communis and Diaphorina citri were inferred based on the COI gene and ITS1 and ITS2 regions using maximum likelihood (ML). Before analysis, the appropriate evolutionary model was determined for each gene. For the COI gene, General Time Reversible model with a discrete gamma distribution (GTR + G) (Nei & Kumar 2000) was used to model the evolutionary rate differences among sites. For the ITS1 and ITS2 regions, the Kimura 2-parameter model (Kimura 1980) was used. For all three genes, initial trees for the heuristic search were obtained automatically by applying Neighbor-Join and BioNJ algorithms to a matrix of pairwise distances estimated using the maximum composite likelihood approach, and then selecting the topology with superior log likelihood value. All analyses were performed with 1000 bootstrap replicates and were conducted in MEGA6 (Tamura et al. 2013). For COI, sequences of Tetrastichus schoenobii Ferrière (Reetha et al. unpublished) was used as an outgroup. Analyses of ITS1 did not include any outgroup sequences from GenBank, as the available sequences were much longer than the sequences of the parasitoids from this study (≈235–451 bp differences), as alignment of sequences that differ this number of nucleotides would give inaccurate results (de León & Sétamou 2010). Details of specimens obtained from the current study are shown in Table 4.2. 115 Table 4.2. Specimens of parasitoids used for molecular analysis and the GenBank accession numbers of the three genetic regions analysed. N/D = no data. Genetic regions ITS1 ITS2 Accession Number Host Location PBT.1 Diaphorina communis Baychhu KX986284 KY047789 KY047810 PBT.2 Diaphorina communis Basochhu KX986285 N/D KY047799 PBT.3 Diaphorina communis Baychhu KX986286 KY047784 KY047800 PBT.4 Diaphorina communis Baychhu KX986287 KY047785 KY047803 PBT.5 Diaphorina communis Baychhu KX986288 KY047786 KY047804 PBT.6 Diaphorina communis Baychhu KX986289 KY047787 KY047812 PBT.7 Diaphorina citri Phuentsholing KY026089 KY047795 KY047813 PBT.8 Diaphorina citri Phuentsholing KY026090 KY047798 KY047814 PBT.9 Diaphorina citri Phuentsholing KY026091 KY047797 KY047816 PBT.10 Diaphorina citri Phuentsholing KY026092 KY047796 KY047815 PBT.11 Diaphorina communis Basochhu KX986290 KY047793 KY047805 PBT.12 Diaphorina communis Basochhu KX986291 KY047794 KY047817 PBT.13 Diaphorina communis Basochhu KX986292 N/D KY047806 PBT.14 Diaphorina communis Basochhu KX986293 KY047792 KY047807 PBT.15 Diaphorina communis Basochhu KX986294 KY047791 KY047808 PBT.16 Diaphorina communis Basochhu KX986295 KY047790 KY047809 PBT.17 Diaphorina communis Basochhu N/D KY047788 KY047811 PBT.18 Diaphorina communis Basochhu KY026088 N/D KY047801 PBT.19 Diaphorina communis Basochhu N/D N/D KY047802 COI 116 4.2.3 Morphology Morphological examinations and descriptions were carried out by Dr Zoya A. Yefremova (Department of Zoology, The Steinhardt Museum of Natural History, Tel Aviv University, Aviv, Israel) and Ekaterina N. Yegorenkova (Department of Geography and Ecology, Ulyanovsk State Pedagogical University, Ulyanovsk, 432700, Russia). The following terminologies and methods were applied in the descriptions:  Morphological terminology follows that of Bouček and Askew (1968), Graham (1991) and Gibson et al. (1997): F1 – first segment of antennal funicle; F2 – second segment; F3 – third segment; F4 – fourth segment; C1 – first segment of clava; C2 – second segment of clava; C3 – third segment of clava; SMV – submarginal vein; MV – marginal vein; PMV – postmarginal vein; SV – stigmal vein; POL – the minimum distance between the posterior ocelli; OOL – the minimum distance between the eye margin and the adjacent posterior ocellus.  Absolute measurements in millimeters (mm) were used for body and forewing length. For all other dimensions, relative measurements were used. Observations and measurements were made using a Leica M80, and the photographs were taken with a Nikon 1V1 mounted on a Leitz Z16 APO macroscope by Zoya A. Yefremova. 117 4.3 Results 4.3.1 Field observation of parasitism No formal survey was made to determine the distribution and percent parasitism in Bhutan. During the course of this study, both nymphs of Diaphorina citri and Diaphorina communis were found to be parasitised. In March 2013, parasitized nymphs of Diaphorina communis were found on Bergera koenigii in Baychhu, Wangdue Phodrang Dzongkhag. Thereafter, parasitism of Diaphorina communis was observed in the Basochhu area (~10 km from Baychhu). Parasitised nymphs of Diaphorina citri were found on Murraya paniculata (as identified in this study) in Zangtopelri Park in Phuenthsoling, Chukhha dzongkhag. The parasitised nymphs were sessile and appeared dark brown. Both types of nymphs exhibited exit holes through the thorax. Figure 4.1 shows the parasitised nymphs of Diaphorina communis and Diaphorina citri. 4.3.2 Molecular and phylogenetic analyses 4.3.2.1 COI region A BLAST search for homologous sequence from GenBank using the sequences of parasitoids of Diaphorina citri from Bhutan showed 99% identity with Tamarixia radiata. Three sequences of Tamarixia radiata from different studies (Table 4.1) were selected from GenBank for comparison with the parasitoid sequences in this study. Searches using the sequences from the parasitoids of Diaphorina communis returned sequences from Tamarixia radiata; however, the sequences only had 91– 93% identity with those from Tamarixia radiata. The unaligned length of the multiple COI nucleotide sequences of the parasitoids of Diaphorina citri and Diaphorina communis collected in Bhutan ranged from 450– 497 bp which, when aligned and trimmed, resulted in 447 bp. Out of the aligned 447 118 Figure 4.1. Parasitised psyllid nymphs and thoraxic exit holes (A-C); Diaphorina communis on Bergera koenigii (A & B); Diaphorina citri nymphs on Murraya paniculata. (C); Adult parasitoid laying eggs on Diaphorina citri nymphs on Murraya paniculata (D) (Photos: N. Om & GAC Beattie). bp, 39 sites were variable with 36 sites being parsimoniously informative (Table 4.3). Variation was also observed between individuals within each group with four and eight variable sites and pairwise sequence divergence of 0–1% and 0–2% within the Diaphorina citri and Diaphorina communis groups, respectively (Table 4.3). The number of nucleotide differences between the two groups was 31–36 giving in 7–8% sequence divergence. Both the Diaphorina citri and Diaphorina communis groups showed ~10% sequence divergence from Tamarixia triozae. The translated COI amino acid sequences did not have any stop codons nor were there any frameshifts. Figure 4.2 shows the phylogenetic analysis of the COI gene from 13 individuals obtained from Diaphorina communis and four individuals obtained from Diaphorina citri. Three different clades are formed with strong bootstrap support (> 90). Parasitoids collected from Diaphorina communis formed a monophyletic clade except for one individual (PBT.12) that grouped with Aprostocetus. PBT.12 was 119 also morphologically different from the rest of the parasitoids collected in Bhutan. The second clade comprised Tamarixia radiata isolates from the GenBank and individuals collected from Diaphorina citri in Bhutan. Tamarixia triozae formed a sister clade to Tamarixia radiata and the parsitoids of Diaphorina communis. Variation among the members of the two Tamarixia clades was observed. However, it was not location-specific; this is more apparent within the parasitoids collected from Diaphorina communis. Sequences for the parasitoids collected from Diaphorina communis were obtained from 12 individuals collected from two sites, Baychhu and nearby Basochhu, and all subclades contained individuals from both of these sites. 120 Table 4.3. Sequence polymorphisms within and between populations of parasitoids of Diaphorina citri and Diaphorina communis. Genetic Region Analysis COI Range of sequence length 450–497 Number of variable sites between and within the accessions of parasitoids from ITS1 496–530 ITS2 462–514 39 (4; 8) 49 (1; 0) 37 (0; 2) 36 (1; 6) 48 (0; 0) 36 (0; 1) Diaphorina citri & Diaphorina communis Number of parsimonious sites between and within the accessions of parasitoids from Diaphorina citri & Diaphorina communis Range of number of nucleotide difference between and within the accessions 31–36 (0–3; 0–7) 48–49 (0–1; 0) 35 (0; 0–2) of parasitoids from Diaphorina citri & Diaphorina communis Percent sequence divergence between and within parasitoids from 7–8 (0–1; 0–2) 10–11 (0; 0) 8 (0; 0–0.2) Diaphorina citri & Diaphorina communis Percent sequence divergence of Diaphorina citri & Diaphorina communis 10–11; 10 * * from Tamarixia triozae Percent sequence divergence of the parasitoids from Diaphorina citri & 0–1; 8 Diaphorina communis from Tamarixia radiata from GenBank Within group differences are shown in parentheses. Values for Dipahorina communis are embolden; *no sequence available 121 0–1; 11–13 0; 8–9 Figure 4.2. Phylogenetic relationships among the parsitoids of Diaphorina communis and Diaphorina citri collected in Bhutan based on COI as inferred by maximum likelihood using the General Time Reversible model with a discrete gamma distribution (GTR + G) (Nei & Kumar 2000). All parasitoids from Diaphorina communis and Diaphorina citri were collected in Bhutan, and the site of collection is given next to the accession code. The sequences from the remaining individuals were obtained from GenBank. The tree with the highest log likelihood is shown. The percentage of trees from 1000 bootstrap replicates in which associated taxa clustered together is shown next to the nodes. The tree is rooted using Tetrastichus schoenobii. 122 4.3.2.2 ITS1 region The length of the ITS1 sequences from the parasitoids of Diaphorina citri and Diaphorina communis ranged from 496 to 530 bp. There were 49 variable sites with 48 parsimony informative sites between the two groups. However, no variation was observed within each group. Sequence divergence between the two groups was 10– 11% while zero divergence was observed within each group. For the Diaphorina citri group, sequence divergence from Tamarixia radiata was 0–1% compared to that of the Diaphorina communis group which showed had 8% divergence (Table 4.3). This observation is further supported by the phylogenetic analysis conducted on the ITS1 region (Figure 4.3) as inferred using maximum likelihood. Similar to the COI analysis, the parasitoids collected from Diaphorina communis formed a clade separate from the parasitoids collected from Diaphorina citri. Individuals collected from Diaphorina citri grouped with Tamarixia radiata isolates taken from GenBank. Sequences obtained from PBT.12 did not fall into either of the groups. 123 Figure 4.3 Molecular analysis of the ITS1 region of parasitoids collected from Diaphorina citri and Diaphorina communis in Bhutan as inferred by maximum likelihood method and using the Kimura 2parameter model of evolution (Kimura 1980). The tree with the highest log likelihood (-1022.5155) is shown. The percentage of trees from 1000 bootstrap replicates in which the associated taxa clustered together is shown next to the nodes. Site of collection is given next to the accession code for sequences obtained in this study. Accession numbers are given in parenthesis for sequences obtained from the GenBank. 124 4.3.2.3 ITS2 region Sequences of the ITS2 region of individuals from Diaphorina citri and Diaphorina communis ranged from 462–514 bp. Sequence analysis showed 37 variable sites with 36 of them being parsimoniously informative (Table 4.3). No variation was observed within the group of individuals from Diaphorina citri collected in Bhutan or with the sequences from the database. Within the Diaphorina communis group, there were two variable sites, of which one was parsimoniously informative. Similar to the ITS1 region, results showed that sequence divergence between the two groups was higher (8%) than within groups (zero). The Diaphorina citri group showed no sequence divergence from Tamarixia radiata while the Diaphorina communis group had 8–9% divergence. The phylogenetic analysis of the ITS2 region is shown in Figure 4.4. All individuals collected from Diaphorina communis formed one clade except for PBT.12 that grouped with Aprostocetus aethiops. Individuals from Diaphorina citri formed a distinct, separate clade from individuals of Diaphorina communis with strong bootstrap support (100%). 125 Figure 4.4. Phylogenetic analysis of the ITS2 region of parasitoids of Diaphorina citri and Diaphorina communis inferred by maximum likelihood using the Kimura 2-parameter model of evolution (Kimura 1980). The tree with the highest log likelihood (-1047.2999) is shown. The percentage of trees from 1000 bootstrap replicates in which the associated taxa clustered together is shown next to the nodes. Site of collection is given next to the accession code for sequences obtained in this study. Accession numbers are given in parenthesis for sequences obtained from the GenBank. 126 4.3.3 Morphological description Name: Tamarixia drukyulensis sp. n. Yefremova & Yegorenkova Etymology: The specific name is derived from the Bhutanese, drukyul, meaning ‘land of the dragon’, i.e., Bhutan, where type materials were collected. Material examined: Holotype: ♀, Bhutan, reared from Diaphorina communis (deposited in TAUI). Paratypes: 32 ♀, 26 ♂ with the same labels (deposited in TAUI); DNA was extracted from two females and two males. The male is almost identical to the female in colour but differs in the structure of the antennae and forewings. Female (Figure 4.5a) Length: 0.9–1.2 mm, forewing 0.90–1.25 mm. Colour: Body mostly brown. Head brown. Eyes dark red. Ocelli red. Antenna dark yellow. Tegulae from dark yellow to brown. Gaster brown with yellow spot in middle of T1 and T2, ventrally yellow. Legs yellow (except brown coxae). Head: 2.2 times as wide as long and 1.1 times as tall. Face smooth. POL 1.3 times as OOL. Malar space 0.66 length of eye. Toruli placed at level of the lower margin of eyes. Antenna with scape 3.3 times as long as broad; pedicel 2.9 times as long as broad; and one discoid anellus, and funicle. F1 2.2 times as long as broad; F2 2.3 times as long as broad and 1.1 shorter than F1; F3 1.8 times as long as broad and 1.05 shorter than F3; clava 3-segmented 3.1 times as long as broad and 2.4 times as long as F3, with apical sensillum. Ratio length of clava to length of funicle = 1.05. Mesosoma: Thorax 1.1 times as long as broad and 1.2 times as long as gaster. Pronotum short. Mesoscutum 1.4 times as long as broad, with median complete line, with 2 short dark pairs adnotaular setae. Scutellum 1.6 times as long as broad, with submedian and sublateral lines. Sculpture of scutellum the same as in mesoscutum. Propodeum 1.6 times as long as dorsellum, smooth, with median carina, spiracle round with paraspiracular carina near metanotum, callus with 1 dark long seta. Fore 127 wings 2.2 times as long as broad. Speculum narrow extending along ⅓MV, closed. MV 1.6 times as long as SMV; MV 4.4 times as long as STV. SMV with 1 seta, MV with 8–9 setae. Hind wing apically acute. Metasoma: Gaster 1.3–1.4 times as long as broad. Figure 4.5. Micrographs of Tamarixia drukyulensis: (a) female; (b) male (Photos: Z. Yefremova). 128 Male (Figure 4.5b). Length: 0.8–0.9 mm. Colour: Body mostly brown. Eyes dark red. Ocelli red. Antenna brownish. Tegulae dark yellow. Legs yellow (except brown coxae), hind legs with a brown 4th tarsomere. Antenna: scape 3.5 times as long as broad with ventral plaque (0.27 length of scape) situated in middle of scape; pedicel 1.5 times as long as broad, one anellus; F1 1.5 as long as broad; F2 1.8 times as long as broad, and 1.1 times longer than F1; F3 2.2 times as long as broad and 1.2 times as long as F2; F4 3.0 times as long as broad and 1.1 times as long as F3; clava 3-segmented with apical sensillum, 5.8 times as long as broad and 2.4 times as long as F4. Funicle with 4 segments with whorled setae; whorled setae of F1 reaching top of C1; whorls of F2 reaching top of C2; whorls of F3 reaching middle of C3; whorls of F4 reaching middle of C3. Forewings: 2.3 times as long as broad. Speculum small, closed, extending along slightly more ⅓ of MV.MV1.5 times as long as SMV and 4.2 times as long as SV. SMV with 1 seta; MV with 7–8 setae. Hind wing apically acute. Genitalia: Gaster 2.0 times as long as broad. Aedeagus ½ of gaster length and 3.6 times as long as digitus; digitus with one spine. Of the 26 male paratypes, seven have digiti parallel with the aedeagus, eight have digiti located at 45°angles to the aedeagus and in five males digiti are recurved from the aedeagus. Host: Diaphorina communis Mathur. Distribution: Bhutan. Comments: The new species is similar to Tamarixia radiata. Females of the two species can be distinguished based on the width to length ratios of the 1st to 3rd flagellomeres, the length to width ratio of the clava, the width to length ratio of the clava to funicle as well as body size (Table 4.4). Males of the two species can be distinguished based on the width to length ratios of the 1st flagellomere, the clava to 4th flagellomere, the 4th flagellomere and of the clava to funicle. Body size and size 129 of the plaque are also differential (Table 4.5). In addition, males of Tamarixia drukyulensis also differ from males of Tamarixia radiata in the following characters: F3 1.2 times as long as F2; clava 5.9 times as long as broad (F3 equal to F2, clava 5.0 times as long as F3 in Tamarixia radiata); whorled setae of F1 reaching top of C1; whorls of F2 reaching top of C2 (whorled setae of F1 reaching top of F4; whorls of F2 reaching middle of C2 in Tamarixia radiata). Table 4.4. Comparative characters of females of Tamarixia drukyulensis sp. n. with females of Tamarixia radiata. Characters/species Tamarixia drukyulensis sp.n. Tamarixia radiata (original description Waterston, 1922) Width to length ratio of 1st flagellomere 2.2 1.7 Width to length ratio of 2nd flagellomere 2.4 1.4 Width to length ratio of 3rd flagellomere 1.8 Subquadrate Length to width ratio of the clava 3.07 2.0 Width to length ratio of clava to 1.05 1.4 1.2 1.3 funicle Body size (mm) Table 4.5. Comparative characters of males of Tamarixia drukyulensis sp. n. with males of Tamarixia radiata. Characters/species Tamarixia drukyulensis sp.n. Tamarixia radiata (original description Waterston, 1922) Width to length ratio of 1st flagellomere 1.5 subquadrate Width to length ratio of clava to 4th flagellomere 2.4 2.0 Width to length ratio of 4th flagellomere 3.1 2.0 Width to length ratio of clava to funicle 1.4 1.8 Size of plaque 0.27 0.11 Body size (mm) 0.8–0.9 1.1 130 4.4 Discussion The COI gene and the ITS regions have been employed in molecular studies on a range of insects. COI has also been used to separate closely related Encarsia spp. (Hymenoptera: Aphelinidae), a genus of minute parasitic wasps with subtle morphological differences (Monti et al. 2005), reduviid bug (Hemitptera: Reduviidae) (Pfeiler et al. 2006) and white fly (Hemiptera: Aleyrodidae) (Hu et al. 2011). The internal transcribed spacers have been used to study phylogenetic relationships and to resolve taxonomic controversies in species of other insects such as Culex (Diptera: Culicidae) and Drosophila (Diptera: Drosophilidae) (Miller et al. 1996; Young & Coleman 2004;). Molecular studies of Tamarixia radiata are mostly related to genetic diversity within the species using COI and ITS1 and 2 (Barr et al. 2009; de León & Sétamou 2010; Peña-Carrillo et al. 2014; Peña-Carrillo et al. 2015). The only sequence data available for other species of Tamarixia is for Tamarixia triozae (de León & Sétamou 2010). In this study, the COI gene and ITS regions were used to determine molecular differences between and within populations of the parasitoids of Diaphorina citri and Diaphorina communis occurring in Bhutan. Sequence analyses of the two groups showed high genetic divergence between the two groups of parasitoids (Table 4.3). The Diaphorina communis group showed 7–8% and 10% sequence divergence to those from Diaphorina citri group and to Tamarixia triozae, respectively. This result is similar to that obtained by de León & Sétamou (2010) with Tamarixia radiata showing 9–10.3% sequence divergence from its sibling species, Tamarixia triozae. These ranges fall within the observations by Hebert et al. (2003) who reported sequence divergence of > 8% in the COI gene between congeneric species in 79% of 13320 animal species pairs. Hebert et al. (2003) also reported that 93% of the Hymenopteran species pairs showed genetic divergences of 8–16%. These results strongly suggest that the parasitoid of Diaphorina communis from Bhutan is a different species of Tamarixia from that found in Diaphorina citri. This is further supported by the phylogenetic relationships inferred from the COI gene and ITS 131 regions. In these phylogenetic studies, the two parasitoids fell into two separate, monophyletic clades with strong bootstrap support (Figures 4.2, 4.3 & 4.4). The morphological examination of the parasitoid of Diaphorina communis shows that it is a previously unrecorded species. The species is closely related to, and resembles, Tamarixia radiata. However, females of Tamarixia drukyulensis are bigger than those of Tamarixia radiata, and the two species can be distinguished from each other based on width to length ratios of the antennal flagellomeres and clava and the relative size of the clava to funicle (Table 4.4). Males of the two species can be distinguished on antennal characteristics, body size and size of the plaque (Table 4.5). Analyses of the three regions (Figures 4.2, 4.3 & 4.4) also separated one insect (PBT.12) collected from Diaphorina communis from all the other individuals. In the analysis of the COI sequences, this insect clustered with Aprostocetus cerricola, Aprostocetus gala, Aprostocetus forsteri, and Aprostocetus aethiops and, using the ITS2 region, with Aprostocetus aethiops and another species of Eulophidae. This insect in the current study clustered most closely with the eulophid hyperparasitoid, Aprostocetus sp., and could be a hyperparsitoid of Diaphorina communis. The presence of hyperparasitoids had been observed for Tamarixia radiata and Tamarixia triozae. Husain & Nath (1924) reported two unidentified hyperparasitoids of Tamarixia radiata (cited as Tetratischus radiatus). Waterhouse (1998) compiled a list of hyperparasitoids belonging to six hymenopteran families occurring in China, Philippines, and Taiwan that attack both Tamarixia radiata and Diaphorencyrtus aligarhensis (Shafee, Alam and Agarwal) (Hymenoptera: Encyrtidae). In addition to Marietta leopardina Motschulsky (Hymenoptera: Aphelinidae) as listed in Waterhouse (1998), Aprostocetus (Aprostocetus) sp., and Psyllaphycus diaphorinae Hayat (Hymenoptera: Encyrtidae) were demonstrated to be hyperparasitoids of Tamarixia radiata and Diaphorencyrtus aligarhensis (Hoddle et al. 2013; Hoddle et al. 2014; Bistline-East & Hoddle 2016). An Encarsia spp. has been reported to attack Tamarixia triozae (Butler & Trumble 2011) in addition to being a 132 hyperparsitoid of Tamarixia radiata and Diaphorencyrtus aligarhensis (Aubert 1987; Waterhouse 1998). 4.5 Highlights of the study  This is the first record of a parasitoid of Diaphorina communis and to assess its genetic variability and phylogenetic relationship with the parasitoid of Diaphorina citri based on COI, ITS1 and ITS2 regions. The molecular analyses suggest that the ectoparasitoid of Diaphorina communis is a new species of Tamarixia.  This study also provides the first morphological descriptions of the parasitoid of Diaphorina communis and complements the results of the molecular study again showing it to be a different species from Tamarixia radiata. The name of the new species has been proposed as Tamarixia drukyulensis sp. n.  The molecular data and the phylogenetic studies also suggest the occurrence of a hyperparasitoid of Diaphorina communis belonging to the genus, Aprostocetus. 133 Chapter 5: Incidence of psyllids and ‘Candidatus Liberibacter asiaticus’ in mandarin orchards at different elevations in Tsirang ___________________________________________________________________ 5.1 Introduction Bhutan is characterised by mountains separated by river valleys. Citrus is grown at different altitudes within this landscape. An altitudinal gradient is characterised by rapid changes in environmental conditions within short horizontal distances, and factors such as temperature, precipitation, UV radiation, partial pressure, and wind speed can interactively affect the distribution of insects along the gradient (Hodkinson 2005). Prior to my studies, Diaphorina citri had been recorded in Bhutan at elevations ranging from 200 m ASL in the south to ~1350 m ASL at Richina (27.6421°N, 89.8624°E) in the west-central region of Punakha (Figure 5.1) and, as nymphs, in an orchard (27.0279°N, 90.1210°E) in Dzamling Zor Gewog (Upper Suntolay) at 1380 m in Tsirang. The latter records were made during an NPPC-ACIAR survey in May 2009 (Donovan et al. 2012b). Elevations of 1350 m in Punakha are known to receive occasional frosts during winter. Mandarins in Tsirang Dzongkhag are grown at elevations ranging from 300 m to ~1550 m ASL. Plantings of seedling trees sourced from unprotected nurseries at elevations below 400 m in India, Sarpang and/or Phuentsholing regions of Bhutan may have commenced in the mid-1960s, as trees sampled for morphological studies by Dorji & Yapwattanaphus (2011) in 2009–2010 were 45 years old. Huanglongbing and Diaphorina citri were known to be present in south-western Bhutan (Phuentsholing), adjacent regions in India (Assam and Sikkim), Bangladesh and Nepal in the 1970s (Catling 1968, 1978; Knorr et al. 1970; Lama & Amtya 1991; Ghosh 1993, Lama & Amatya 1993). Presence of the pathogen was confirmed in 2002 (Garnier & Bové 2002; Ahlawat et al. 2003; Doe Doe et al. 2003; Bové 2014). In 2003, there were some 147,500 trees within Tsirang’s 12 gewogs (NPPC 2003). In 2007, approximately 57% and 87% of the trees were more than 20 years old and 134 10 years old, respectively (NPPC-ACIAR). The first official record of Diaphorina citri in Tsirang was in two of the 12 gewogs, Gosarling and Phutenchhu, in 2003 (NPPC Survey 2003), but the elevations were not recorded. It was subsequently recorded in Gosarling on mature trees in mandarin orchards in Pemathang Chiwog (Lower Suntolay) between 950 m and 1150 m ASL, and, as noted above, in an orchard in Dzamling Zor Chiwog at 1380 m, during an NPPC-ACIAR survey for the psyllid and HLB in May 2009 (Figure 5.2). The trees were 20 or more years old and in rapid decline. Symptoms of HLB were present on all these trees, and many trees in these orchards were dead. However, symptoms of HLB were not common at elevations above 1200 m, and trees above this elevation were bearing fruit despite impacts of powdery mildew, phytophthora and borers. The NPPC-ACIAR observations in 2009 were in stark contrast to those reported by Bové (2004) who found no evidence of HLB in the Damphu/Mendrelgang region of Tsirang, and PCR tests for tissues sampled by him were negative (Bové 2004). Figure 5.1. Symptoms of huanglongbing on a ‘Candidatus Liberibacter asiaticus’-infected seedling mandarin tree at Richina (27.6421N, 89.8624E, 1322–1360 m) (left) and Paul Holford and ‘Citrus’ Dorji (centre, right) inspecting the tree for Diaphorina citri adults and nymphs on 20 May 2009 (Photos: GAC Beattie). 135 Figure 5.2. Dying mature mandarin trees (top left), stumps of dead seedling mandarin trees (top right), lime leaves with symptoms of huanglongbing (lower left) and Diaphorina citri adults on mandarin leaves (lower right) at the Waklay orchard (27.0358N, 90.1093E, 950 m), Pemathang (Lower Suntolay), Gosarling, Tsirang, on 22 May 2009 (Photos: GAC Beattie). During the NPPC-ACIAR survey in 2009, Diaphorina communis was observed on curry leaf plants and mandarin seedlings at Kamichhu (650 m), and in Tsirang at elevations up to ~1050 m, the elevation above which curry leaf does not appear to grow or is uncommon in Tsirang, although it has been recorded up to 2850 m elsewhere in Bhutan (Grierson 1991). Cacopsylla heterogena (as identified in Chapter 6) was first recorded in Bhutan on 19 April 2013 in Tsirang, shortly after my studies commenced: initially in an orchard (27.0082°N, 90.1391°E, 1260 m ASL) in Dekidling Chiwog, Kilkhorthang Gewog, when adults were tapped from a mature mandarin tree into a white enamel tray, and subsequently on the same day at Riserboo ‘A’ (Kamigaon) (26.9532°N, 90.1347°E, 1436 m ASL) in Mendrelgang Gewog when a larger number of adults were tapped 136 from immature and mature seedling mandarin trees on which nymphs were also present. The objectives of the studies reported in this Chapter were to determine relationships between ambient temperatures, relative humidity, rainfall and elevation on the incidence of Diaphorina citri, Diaphorina communis and huanglongbing. I hypothesised that the incidence of the psyllids, particularly Diaphorina citri, and the disease, were primarily influenced by higher leaf temperatures and reduced plant growth at the higher altitudes. The scope of the study was widened to include Cacopsylla heterogena after it was discovered. 5.2 Materials and methods 5.2.1 Site description and experimental plots This study was conducted in Tsirang Dzongkhag to determine the effect of altitude, temperature, rainfall and humidity on leaf temperatures of mandarin on ‘CLas’ levels and psyllid populations. Eight sites ranging from ~800 to 1500 m ASL and separated by approximately 100 m in altitude were selected. The lowest altitude site was at Phuensoomgang in Gosarling Gewog and the highest altitude at Droopchhugang in Tsholingkhar Gewog. The collective name of the sites will be referred as Droopchhugang-Phuensoomgang (‘gang’ is a ridge in Bhutanese). Details of each site are given in Table 5.1 and aerial views are presented in Figures 5.3 and 5.4. Site preparations and planting of mandarin seedlings were completed from 25–29 May, 2013 in these eight sites using two years old mandarin seedlings ‘assumed to be disease-free’ (see discussion) obtained from the National Seed Centre (NSC), Bhur on 26 May 2013. The seedlings were pruned to uniform heights of 500 mm, and then carried to experimental sites in woven plastic bags to prevent any psyllids landing on them during transport. At each elevation, three sets of four mandarin seedlings were planted. Each set of seedlings was planted in 300 mm wide × 400 mm deep holes in a 1 × 1 m plot (Figure 5.5B). The plots were separated by ~30 m. The plots were fenced with bamboo poles and rails to prevent the ingress of cattle, 137 goats, and wild pigs. Plants in these plots were used for the assessment of plant growth, leaf temperatures, psyllid incidence and ‘CLas’ titres. 138 Table 5.1. Locations of experimental sites along Droopchhugang-Phuensoomgang in Tsirang. Farmer Chiwog1 Gewog Altitude (m ASL) GPS coordinates 2 ‘Meme’ Tshering Phuensoomgang (Garigaon A) Gosarling 783 (800) 27.0393°N, 90.1110°E Raj Mal Tamang Phuensoomgang (Garigaon A) Gosarling 883 (900) 27.0364°N, 90.1111°E Lal Bdr. Wakley Pemathang (Lower Suntolay) Gosarling 953 (1000) 27.0359°N, 90.1095°E Mandoge Subba Pemathang (Lower Suntolay) Gosarling 1053 (1100) 27.0333°N, 90.1126°E Renuka Pradhan Pemathang (Lower Suntolay) Gosarling 1175 (1200) 27.0302°N, 90.1155°E Devi Maya Khati Dzamling Zor (Upper Suntolay) Gosarling 1273 (1300) 27.0289°N, 90.1181°E Pema Lham Dzamling Zor (Upper Suntolay) Gosarling 1378 (1400) 27.0242°N, 90.1197°E Dorji Rinchen Droopchhugang (Harpani) Tsholingkhar 1478 (1500) 27.0142°N, 90.1183°E 1 Chiwogs refer to administrative divisions below a gewog, and are equivalent to municipalities comprised of groups of villages. Former names are given in parentheses. 2 Figures in parentheses represent altitude rounded to the nearest hundred/thousand 139 Figure 5.3. Google Earth view of locations of experimental sites along DroopchhugangPhuensoomgang in Tsirang. View facing north from directly above Droopchhugang-Phuensoomgang. Figure 5.4. Google Earth view of locations of experimental sites along DroopchhugangPhuensoomgang in Tsirang. View facing east from directly above Droopchhugang-Phuensoomgang. 140 Figure 5.5. The experimental site at 783 m ASL at ‘Meme’ Tshering’s orchard at Phuensoomgang, Gosarling, Tsirang (A) and a plot with four mandarin seedlings at 1053 m ASL at Mandoge Subba’s orchard in Pemathang, Gosarling, Tsirang (B). (Photos: N. Om). 5.2.2 Plant growth assessment Growth assessments were based on the numbers of leaves produced on four, topmost, young shoots on each plant in each plot giving 48 shoots assessed per elevation. The shoots were tagged. Leaves were counted in May 2014 and April 2015. 5.2.3 Soil sample analysis Soil samples were taken from each plot from 12−14 June 2015. Soil samples from each elevation consisted of six subsamples, two samples collected from next to each plot (not within), at a depth of 150 mm. Subsamples were combined, mixed thoroughly and a 200 g taken from each elevation. Samples were air dried at room temperature, transported to Australia where they were irradiated upon arrival, and then sent to the Department of Science, Information Technology and Innovation (DSITI), EcoSciences Precinct, Dutton Park Queensland, Australia. The following parameters were tested:  Extractable soil cations: calcium, potassium, magnesium and sodium  Soil pH (CaCl2)  Soil pH (water)  Electrical conductivity 141  Total carbon  Total nitrogen  Aluminium saturation percentage  Effective cation exchange capacity  Exchangeable sodium percentage  Exchangeable acidity  Exchangeable aluminium 5.2.4 Leaf temperature measurements Leaf temperatures of mandarin plants in the mini-plots were recorded monthly from May to August 2014 between 1100–1400 hours using a hand-held, infrared thermometer (EXTECH, Instrument Choice, South Australia). Readings were taken within 3 h on the same day by two groups of NPPC staff, each undertaking the measurements at 3–4 sites. At each elevation, four leaves on each of the four plants in each plot were measured (48 readings per elevation). 5.2.5 Incidence of psyllid infestations The incidences of Diaphorina citri and Cacopsylla heterogena at each elevation were recorded from March to August 2014, and in April 2015. For adult psyllids, plants in each plot were initially inspected visually, without disturbance, to observe the number of adults present. Then shoots from each plant were tapped onto a white enamel tray to detect adults falling on the tray that could have been missed during the visual inspections. The incidence of adults of each psyllid species on each plant at each altitude was recorded on a scale of 0 to 5: 0 = no adults 1 = 1 to 5 adults 2 = 6 to 10 adults 3 = 11 to 15 adults 4 = 16 to 20 adults 5 = more than 20 adults 142 The presence or absence of Diaphorina citri eggs and nymphs was assessed nondestructively by examining immature flushes on each of the four plants in each plot at each altitude on each sampling date. For Cacopsylla heterogena, numbers of a ‘pouch galls’ per plant were counted. A similar scale to that used for the assessment of adults was used: 0 = no shoots with eggs or nymphs 1 = 1 to 5 shoots with Diaphorina citri eggs or nymphs Cacopsylla heterogena pouch galls 2 = 6 to 10 shoots 3 = 11 to 15 shoots 4 = 16 to 20 shoots 5 = more than 20 shoots 5.2.6 Recording of weather data Tinytag data loggers (PLUS 2-TGP-4500, Omni Instruments Australia Pty Ltd) set to log every 30 min were used to record ambient temperatures and relative humidity at each site. Polyvinyl chloride (PVC) pipes (110 mm wide and 360 mm long) painted white and with six 20 mm diameter holes below the caps (for air flow) were used to house the data loggers. Thin wire was used to suspend each data logger about half way down each pipe. Each pipe was hung so that the Tinytag was 1.5 m above the ground level within mature tree canopies (Figure 5.6A). Rainfall data at each elevation was recorded using Davis rain gauges equipped with tipping buckets with magnetic reed switch sensors (Davis Instruments, 3465 Diablo Avenue, Hayward, CA 94545 USA) connected to a EasyLog USB data loggers (Lasker Electronis, 4258 West 12th Street, Erie, PA 16505 USA). The gauges were installed according to the manufacturer’s instructions and mounted 0.9 m above ground level on wooden posts (Figure 5.6B) and were set to log every hour measuring 0.2 mm of rain for every bucket tip which was recorded as number of events. 143 Figure 5.6. A PVC pipe containing a Tinytag data-logger (A) and a Davis rain gauge (B). 5.2.7 Prevalence of ‘CLas’ in plant samples at different altitudes Detection of ‘CLas’ was conducted by collecting samples from:  mature mandarin trees along Droopchhugang-Phuensoomgang and also from different elevations at Mendrelgang Gewog; and  young mandarin seedlings planted in the plots at elevations from 800 to 1500 m ASL along Droopchhugang-Phuensoomgang. 5.2.7.1 Sample collection from mature trees In June 2014, bark samples were collected from the eight sites along Droopchhugang-Phuensoomgang. At each site, 10 mature mandarin trees were randomly selected, and bark samples were collected using an 8 mm diameter leather hole punch. At least 10–12 bark plugs were collected from each tree. Subsequent samplings of bark were made in April 2015, and March 2016. Punchers were cleaned either by dipping in 4% bleach or by flaming after each tree. Root samples were also taken on these occasions. The root samples were collected by digging holes on four sides of a tree under the canopy and collecting the fibrous roots (~5 to 10 mm in circumference). During April 2015, bark, root and leaf samples of mature mandarin trees were collected from different elevations in the Mendrelgang Gewog in Tsirang. Samples were stored at 4°C until DNA extraction. 144 5.2.7.2 Sample collection from young plants in the plots Both bark and root samples were collected from all four plants in each plot at each elevation. Bark strips of various lengths were stripped off the shoots and placed in plastic bags. Fibrous roots were dug out as described above. 5.2.7.3 DNA extraction and amplification Extraction of ‘CLas’ from plant tissues was performed in a similar manner to the methods described in Section 3.2.3 (Chapter 3) except that the scaly epidermis on the root and bark was scraped off with disposal razor blades, and any wood and pith removed before washing and chopping the sapwood. All samples were extracted at the NPPC. Samples were tested using real-time PCR (qPCR), selected samples were subjected to cPCR, and successful amplifications were sequenced as described in Section 3.2.5 (Chapter 2). 145 5.3 Results 5.3.1 Plant growth assessment and soil analysis Table 5.2 shows the average number of leaves produced on the four terminal-shoots in May 2014 and April 2015. The results indicate that, one year after planting, seedlings planted at 800–1000 m ASL produced more leaves than seedlings planted at 1100 and 1500 m ASL. A similar trend was observed in April 2015 with plants at 800 and 1000 m ASL producing almost 8–10 times higher numbers of leaves compared to plants at 1100 and 1500 m ASL. Plant at other elevations had intermediate growth. The results of the soil nutrient analysis are given in Figure 5.7. Cation extractable for magnesium, potassium and calcium were lowest at 1500 m followed by 1100 m and 1200 m, and the highest at 1000 m ASL (Figure 5.7A). Extractable sodium was the same (< 0.08 cmol_c/kg) at all sites (data not shown). The soil at all locations was acidic but not saline as indicated by the low electrical conductivity and CaCl2 pH values (Figure 5.7B & 5.7D). The C/N ratio was within the normal range but total carbon (TC) was lowest at 1100 m followed by 1200 m ASL and highest at 1300 m followed by 1400 m and 1000 m ASL (Figure 5.7C). 5.3.2 Ambient temperatures, relative humidity and leaf temperatures Generally, leaf temperatures were lower than ambient temperature by 1−2°C in May, and by 2−7°C in July−August but rarely over 30°C (Figure 5.8). The mean leaf temperatures at ≥ 1200 m were lower than leaf temperatures at 1100 m and below. As for the ambient temperatures, based on the mean minimum temperature, lowest temperatures observed were in December and January with minimum temperatures ranging from 7.3°C to 11.1°C at 800–1100 m, and 5.7°C to 8.1°C at 1200–1500 m ASL. The hottest months were May to September. Maximum temperatures during these months rarely exceeded 30°C at elevations above 1000 m and ranged between 146 30°−32°C at 800–1000 m ASL and 23−30°C at 1100–1500 m ASL (Figure 5.9B). Mean minimum relative humidity was comparatively higher from June to September with a range of 51%−73% for 800–1100 m ASL, and 58%−85% for 1200–1500 m ASL (Figure 5.10). Table 5.2. Average numbers of leaves per terminal shoot of mandarin seedlings planted at different elevations. Altitude (m ASL) Average number of leaves per shoot1 Observations in April 2015 May 2014 April 2015 1500 5.00 3.82 Generally, very poor growth with mostly a single stem. Powdery mildew present. One plant did not have young shoots. 1400 5.72 14.19 All plants still alive but two were damaged by cattle. Soft scales present. 1300 6.74 14.19 One plant had died and three plants damaged by cattle. 1200 6.93 7.62 Three plants did not have young leaves. Soft scales were common. 1100 4.11 2.00 All plants present but with single stem, and almost no leaves. Cattle damage and severe powdery mildew present. 1000 8.38 29.68 One plant had died, and four had sparse shoots. 900 8.29 14.19 Severe cattle damage on four plants. Most shoots on two plants had dried up. 800 10.02 24.84 One plant had died, and 10 other plants did not have young shoots in April 2015 1 Average of four young shoots per plant comprising 48 samples at each elevation. 5.3.3 Rainfall Figure 5.11 shows monthly total rainfall at the eight sites along DroopchugangPhuensoomgang. The records indicate that the monsoon season commences in June and lasts until September. Generally, during the monsoon, the sites at the higher elevations (≥ 1200 m ASL) received more rainfall compared to the sites at lower elevation (˂ 1200 m ASL) in each year except for June 2015. Total rainfall during the months of January, February and May was variable between years but consistently higher from June to September for all locations (Figure 5.11, Tables 5.3 & 5.4). November and December received the least amount of rainfall. 147 Figure 5.7. Results of analysis of soil samples collected from the eight experimental sites in Tsirang in June 2015. 148 34 34 Leaf Ambient 32 30 30 28 28 26 26 24 24 22 22 o 20 18 20 May June 18 34 32 32 30 30 28 28 26 26 24 24 22 22 20 20 o 34 Temperature ( C) Temperature ( C) 32 18 July 800 August 900 1000 1100 1200 1300 1400 1500 800 18 900 1000 1100 1200 1300 1400 1500 Elevation (m ASL) Figure 5.8. Comparison of average leaf temperature and ambient temperature at the experimental sites in Tsirang in May, June, July and August 2014. 149 Figure 5.9. Monthly average minimum and maximum ambient temperatures recorded at the experiment sites along Droopchhugang-Phuensoomgang. 150 Figure 5.10. Monthly average minimum Droopchugang−Phuensoomgang in Tsirang. 151 and maximum relative humidity along Figure 5.11. Monthly total rainfall (mm) recorded from June 2013 to October 2015 at the sites along Droopchugang-Phuensoomgang. 152 Table 5.3. Average monthly rainfall (mm) in June, July, August and September 2014–2015 at elevations ranging from 1500 m to 800 m ASL along Droopchugang-Phuensoomgang in Tsirang. Elevation (m ASL) 2014 2015 Range Average Range Average 1500 143 * 196–303 254 1400 129–379 290 191–353 275 1300 125–326 269 172–309 242 1200 126–392 285 194–289 249** 1100 117–290 220 207–286 235 1000 99–259 207 207–289 243 900 98–324 237 188–268 228 800 113–298 236 214–272 236 * June only for 1500 m. ** June to August 2015 for 1200 m. Table 5.4. Average annual rainfall, minimum and maximum ambient temperatures, and minimum and maximum relative humidity in 2014 at elevations ranging from 800–1500 m ASL along Droopchugang-Phuensoomgang in Tsirang. Elevation ASL) (m Rainfall (mm) Temperature (°C) Relative humidity (%) minimum maximum minimum maximum 800 1118 16.02 28.73 50.59 95.98 900 1128 15.60 29.50 48.80 97.60 1000 1072 15.60 29.20 48.90 96.10 1100 1041 15.53 27.55 53.39 95.55 1200 1461 14.73 24.71 64.18 97.05 1300 1293 13.92 24.15 64.25 98.07 1400 1357 13.47 25.89 55.12 98.10 1500 851* 13.00 24.00 58.60 98.70 * data for July to September 2014 not recorded accurately. 153 5.3.4 Psyllid incidence The incidence of psyllids recorded on young mandarin plants at different elevations is shown in Table 5.5. Adult Diaphorina citri were observed at 800 to 1100 m ASL in different months while adults of Diaphorina communis or Cacopsylla heterogena were never observed on the young plants at any elevation (Table 5.5A). Immature stages of Diaphorina citri were also found at 900 and 1000 m ASL while immature stages of Cacopsylla heterogena within the pouch galls were observed at 1400 m ASL in April 2015 (Table 5.5B). 154 Table 5.5. Incidence of Diaphorina citri (DC), Diaphorina communis (DCO) and Cacopsylla heterogena (Ca) nymphs and adults on mandarin at different altitudes along Droopchhugang-Phuensoomgang, Tsirang. Altitude (m ASL) March 2014 DC DCO April 2014 May 2014 June 2014 July 2014 August 2014 April 2015 Ca DC DCO Ca DC DCO Ca DC DCO Ca DC DCO Ca DC DCO Ca DC DCO Ca A. Adult psyllids 1500 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1400 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1300 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1200 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1100 0 0 0 2 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1000 0 0 0 0 0 0 0 0 0 3 0 0 4 0 0 0 0 0 0 0 0 900 0 0 0 1 0 0 0 0 0 6 0 0 4 0 0 1 0 0 1 0 0 800 0 0 0 0 0 0 0 0 0 6 0 0 5 0 0 5 0 0 5 0 0 B. Psyllid nymphs 1500 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1400 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 1300 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1200 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1100 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1000 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 900 0 0 0 0 0 0 0 0 0 0 0 0 4 0 0 0 0 0 0 0 0 800 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 155 5.3.5 Incidence of ‘CLas’ The incidence of ‘CLas’ was assessed from plant tissues sampled at different elevations from mature mandarin trees from Droopchhugang-Phuensoomgang and Mendrelgang Gewog and from young mandarin trees from DroopchhugangPhuensoomgang. Bark and root tissues were sampled from the plants along Droopchhugang-Phuensoomgang and bark, roots and leaves were collected from Mendrelgang Gewog. 5.3.5.1 Samples from mature trees Table 5.6 shows the detection of ‘CLas’ in the bark samples collected from mature mandarin trees along Droopchhugang-Phuensoomgang. Generally, the majority of the bark samples collected from 800 to 1100 m ASL produced FAM Ct values > 0.00. At these elevations, the FAM Ct values of samples collected in June 2014 and March 2016 ranged from 23.13 to 38.55. However, samples collected in May 2015 had a higher range (35.42 to 39.81) of FAM Ct values. In contrast, few samples collected from 1200 to 1500 m ASL produced FAM Ct > 0.00. The FAM Ct values of samples above 1200 m ASL that were greater than zero ranged from 26.15 to 38.94. The internal control for all samples worked well as indicated by the overall CAL Ct value range of 15.80–31.23. The extraction controls, which consisted either of apple or peach midribs, had FAM Ct values of zero, while the FAM Ct value range for the positive controls was 16.41–30.52. The results of qPCR analysis of root samples collected from mature trees along Droopchhugang-Phuensoomgang are presented in Table 5.7. More than half of the root samples collected in May 2015 from elevations 1200 to 1500 m ASL produced FAM Ct values > 0.00 that ranged from 30.64 to 39.18; however, fewer samples collected at 800 and 900 m ASL had FAM Ct values > 0.00. In contrast, the root samples collected in March 2016 produced results similar to the bark samples with majority of the root samples collected from 800–1100 m ASL producing FAM Ct > 0.00, whilst the majority of samples collected from elevations 1200 m ASL and above had Ct values of zero. The FAM Ct values for the March 2016 samples 156 ranged from 25.12–39.26 and 28.05–39.18 at elevations 800–1100 m and 1200–1500 m ASL, respectively. One root sample from 800 m ASL that had a FAM Ct value of 37.75 produced an amplicon using cPCR. The sequence of this amplicon showed 100% identity with sequences of isolates of ‘CLas’ from Bhutan, China, India, Iran and Japan. The FAM Ct values for the extraction controls were 0.00 and those for the positive control ranged from 19.14–30.52. The internal control CAL Ct values for the root samples ranged from 14.39–34.7. The ‘CLas’ Ct values for bark, root, and leaf samples from mature mandarin trees in Mendrelgang Gewog are presented in Table 5.8. All bark samples produced FAM Ct values of 0.00 except for one sample each at 909 and 1190 m ASL. Similarly, the leaf samples had FAM Ct values of zero except for the two samples from 986 m ASL. In contrast, at least one root sample from all but one elevation produced a FAM Ct value > 0.00. The FAM Ct values ranged from 31.49–39.38. The root sample with a FAM Ct value of 31.49 was successfully sequenced, and its sequence showed 100% identity with ‘CLas’ isolates from Bhutan, China, India, Iran and Japan. The extraction control produced FAM Ct values of zero, and the positive control FAM Ct values ranged from 30.19 to 30.52. The internal control CAL Ct values ranged from 14.31 to 22.61. 157 Table 5.6. FAM Ct values (‘CLas’) for bark samples from 10 mature mandarin trees at each elevation along Droopchhugang-Phuensoomgang. FAM Ct values1 1 2 3 4 5 6 7 8 9 10 EC PC CAL Ct range 1500 June 2014 0.00 0.00 0.00 0.00 35.11 34.73 33.93 0.00 0.00 0.00 NA 22.94 16.40–25.30 May 2015 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 30.14 15.91–19.51 36.68 March 2016 0.00 0.00 33.56 0.00 0.00 26.72 0.00 0.00 0.00 0.00 0.00 19.36 17.69–21.11 1400 June 2014 0.00 35.19 35.78 39.05 0.00 0.00 0.00 0.00 0.00 33.39 NA 22.94 15.48–18.77 May 2015 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 30.14 17.04–19.16 March 2016 0.00 0.00 36.65 0.00 28.93 0.00 0.00 0.00 0.00 0.00 0.00 19.53 19.18–26.34 1300 June 2014 0.00 0.00 0.00 34.38 0.00 0.00 0.00 0.00 0.00 0.00 NA 0.00 16.11–19.61 May 2015 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 30.25 16.02–20.77 35.45 March 2016 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 19.53 22.29–24.23 1200 June 2014 0.00 0.00 37.12 0.00 0.00 0.00 0.00 0.00 0.00 28.37 NA 22.94 15.84–17.27 May 2015 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 29.30 21.49–25.69 36.04 March 2016 0.00 30.12 38.94 37.17 0.00 0.00 26.15 0.00 0.00 0.00 0.00 19.32 16.84–20.55 1100 June 2014 32.49 30.36 33.08 33.34 33.27 34.43 33.65 33.42 29.29 32.41 0.00 22.94 17.89–24.98 May 2015 0.00 0.00 0.00 0.00 0.00 0.00* 0.00 29.30 17.60–31.23 36.85 37.00 39.67 35.08 March 2016 30.94 32.99 30.13 30.85 30.92 31.09 30.59 32.15 28.64 25.92 0.00 19.32 17.96–24.24 1000 June 2014 34.42 32.09 30.58 33.08 29.97 30.34 29.55 37.67 31.34 34.06 NA 22.94 15.80–18.98 May 2015 0.00 0.00 0.00 0.00 0.00 29.81 14.88–18.80 37.26 38.37 35.42 35.95 39.07 0.00 March 2016 26.80 27.54 31.92 27.82 27.33 30.81 31.37 27.44 27.69 29.14 0.00 19.14 18.16–23.29 900 June 2014 30.01 31.70 32.1 29.69 0.00 31.18 0.00 33.56 35.35 29.66 NA 22.94 16.96–22.58 May 2015 0.00 0.00 0.00 29.81 14.66–19.23 36.65 38.59 37.38 35.46 36.44 36.56 39.81 0.00 March 2016 32.28 33.16 34.15 32.77 34.59 34.39 32.73 38.55 33.57 31.49 0.00 20.21 22.27–25.69 800 June 2014 28.09 29.72 24.67 31.11 28.4 23.13 31.18 26.94 32.09 24.83 NA 22.94 17.50–26.47 0.00 30.52 13.56–14.93 May 2015 36.82 35.76 34.77 37.55 36.15 38.10 34.60 37.45 37.37 36.78 March 2016 26.64 25.95 27.31 29.05 29.77 28.78 30.64 31.97 31.86 29.48 0.00 16.41 15.82–25.04 1 FAM Ct = ‘CLas’ DNA; samples subjected to cPCR using primers A2/J5 are emboldened; Italicised FAM Ct values indicate samples that are positive by cPCR; EC = extraction controls (peach or apple midribs); PC = positive control; NA = no analyses; CAL = internal control (plant cytochrome); *the internal control (CAL) for the sample did not work. Altitude (m ASL) Month & Year 158 Table 5.7. qPCR FAM Ct values (‘CLas’) for roots of from 10 mature mandarin trees at each elevation along Droopchhugang-Phuensoomgang May 2015 and March 2016. Altitude (m ASL) 1500 1400 1300 1200 1100 1000 900 800 FAM Ct values1 Month &Year May 2015 March 2016 May 2015 March 2016 May 2015 March 2016 May 2015 March 2016 May 2015 March 2016 May 2015 March 2016 May 2015 March 2016 May 2015 March 2016 1 2 3 4 5 6 7 8 9 10 EC PC CAL Ct range 32.76 0.00 0.00 0.00 34.54 0.00 31.45 0.00 0.00 30.73 0.00 0.00 0.00 35.26 0.00 28.29 39.18 0.00 0.00 30.39 0.00 0.00 0.00 30.92 36.73 36.65 38.79 32.50 37.60 36.70 0.00 31.40 37.49 29.95 0.00 0.00 0.00 0.00 39.13 0.00 0.00 30.90 0.00 31.81 0.00 32.96 38.94 32.04 31.95 0.00 38.94 0.00 36.88 0.00 35.41 0.00 37.94 30.27 0.00 29.68 0.00 32.63 0.00 29.33 31.74 0.00 38.79 29.62 36.27 0.00 31.97 0.00 37.52 38.40 37.88 31.57 0.00 37.11 0.00 30.13 34.76 28.05 0.00 0.00 35.10 0.00 36.07 36.70 0.00 34.53 0.00 31.00 0.00 32.80 0.00 32.53 0.00 0.00 0.00 0.00 37.94 0.00 0.00 29.97 0.00 32.60 39.26 25.12 0.00 0.00 0.00 34.47 30.64 29.77 0.00 0.00 36.02 0.00 0.00 0.00 33.39 0.00 0.00 28.47 0.00* 34.20 0.00 31.71 31.47 0.00 0.00 0.00 37.41 0.00 35.21 0.00 32.45 34.61 0.00 29.31 0.00 38.58 37.75 31.34 36.71 0.00 0.00 0.00 0.00 0.00 34.63 0.00 37.73 31.21 34.97 28.98 0.00 31.87 0.00 28.36 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 30.14 19.36 30.14 19.36 30.25 19.80 29.30 19.32 29.80 19.32 29.81 19.14 30.52 19.67 30.52 20.21 14.79-19.60 16.50-30.94 17.83-21.87 20.48-30.89 17.13-26.12 20.72-24.81 21.11-24.59 20.93-25.51 20.72-26.55 18.75-29.01 16.10-19.19 17.00-27.31 14.47-18.24 18.75-26.52 15.00-34.05** 17.95-20.36 1 FAM Ct = ‘CLas’ DNA; samples subjected to cPCR using primers A2/J5 are embolden; Italicised and underlined FAM Ct values are samples confirmed by sequencing; EC = extraction controls (peach or apple midribs); PC = positive control; CAL = internal control (plant cytochrome oxidase); *the internal control (CAL) for the sample did not work; **only one sample with the highest range value. 159 Table 5.8. qPCR ‘CLas’ FAM Ct values for mandarin tissue samples collected from a range of altitudes in Mendrelgang Gewog, Tsirang Dzongkhag. FAM Ct values for different tissue types1 Altitude (m ASL) Bark root leaves 1434 0.00 (4) 0.00–35.17 (4)a 0.00 (2) 1376 0.00 (4) 0.00–37.62 (4)a 0.00 (2) 1303 0.00 (4) 0.00–35.98 (4)a 0.00 (2) 1251 0.00 (4) 0.00–39.38 (4)a 0.00 (1) 1190 0.00–39.91 (4)a 0.00–38.25 (4)a 0.00 (2) 1100 0.00 (9) 0.00–34.58 (4)b 0.00 (2) 1065 0.00 (4) 0.00–37.82 (4)c 0.00 (2) 1012 0.00 (4) 986 0.00 (4) 909 0.00–37.63 9 (3)a EC 0.00 PC 30.19 CAL Ct value range 14.32–22.61 0.00 (4) 0.00–36.82 (4)a 33.61–34.16 (2) 0.00–38.01 (3)a 0.00 (2) 0.00 0.00 30.52 17.25–22.13 1 0.00 (2) 30.19 14.74–19.34 FAM Ct = ‘CLas’ DNA, FAM Ct for the type of tissues tested and number of sample tested are given in parentheses; aonly one sample with a Ct > 0.00; btwo samples with FAM Ct values of 31.49 & 34.58 (sample with FAM Ct of 31.49 successfully sequenced); ctwo sample with FAM Ct values of 32.91 & 37.82; EC = extraction controls (rose leaf midribs); PC= positive control; CAL Ct values = internal control (plant cytochrome oxidase). 160 5.3.5.2 ‘CLas’ detection in samples from young mandarin trees along Droopchhugang-Phuensoomgang Results of qPCR analysis of bark samples collected from young mandarin seedlings planted along Droopchhugang-Phuensoomgang are presented in Table 5.9. At least four or more seedlings planted at elevations from 800 to 1300 m ASL produced FAM Ct values > 0.00 from extracts from bark samples collected in 2015 and 2016. The FAM Ct values for these samples ranged from 22.69–39.69. At least one sample from 800, 900 and 1000 m ASL was successfully sequenced and shared 100% identity with ‘CLas’ isolates from Bhutan and other countries in the region. In contrast, only two samples from 1400 m ASL produced FAM Ct values > 0.00 while none of the samples from 1500 m ASL produced FAM Ct values > 0.00. The extraction controls produced FAM Ct values of zero. The FAM Ct value range for the positive controls was 19.14–30.52 and the internal control CAL Ct range was 14.51–34.70. The real-time results of the root samples collected from young mandarin trees are shown in Table 5.10. Almost all root samples collected in May 2015 from 1000 to 1500 m ASL produced FAM Ct values > 0.00 with a range of 30.66–38.08. However, only two samples collected at 1000 m ASL were positive as determined by cPCR. Fewer samples from 800 and 900 m ASL collected in May 2015 produced FAM Ct value > 0.00, and these ranged from 33.44–37.46. The samples that produced FAM Ct values of 34.33 and 37.46 from 800 m ASL were successfully sequenced, and the sequences matched 100% identity with ‘CLas’ isolates from Bhutan, China, India, Iran and Japan. In contrast, the March 2016 samples collected from 1100 to 1500 m ASL produced FAM Ct values equal to zero, whereas the majority of the samples collected from 800 to 1000 m ASL produced FAM Ct values ranging from 22.36 to 36.81. The extraction controls produced FAM Ct values of zero. The FAM Ct range for the positive controls was 19.14 to 30.52, and the internal control CAL Ct value ranged from 14.13 to 32.5. 161 Table 5.9. FAM Ct values (‘CLas’) for bark samples collected from 12 young mandarin seedlings at each elevation planted along Droopchhugang-Phuensoomgang. Altitude (m ASL) 1500 1400 1300 1200 1100 1000 900 800 FAM Ct value1 Year & Month 1 2 3 4 5 May 2015 0.00 0.00 0.00 0.00 March 2016 0.00 0.00 0.00 May 2015 0.00 0.00 March-2016 0.00 May 2015 CAL Ct range 6 7 8 9 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 38.79 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 37.09 0.00 39.69 March 2016 0.00 0.00 0.00 0.00 May 2015 35.16 0.00 39.70 March 2016 dead 0.00 10 11 12 EC PC NS 0.00 0.00 0.00 30.14 16.15-21.18 0.00 NS 0.00 0.00 0.00 19.36 16.26-33.90** 0.00 0.00 37.07 0.00 0.00 0.00 30.25 14.51-19.53 0.00 0.00 0.00 0.00 0.00 0.00 0.00 19.36 17.12-34.70** 0.00 35.91 37.32 0.00 0.00 0.00 35.69 0.00 30.25 16.00-21.96 0.00 0.00 0.00 0.00 0.00 39.18 0.00 0.00 0.00 19.80 18.87-25.49 0.00 35.93 38.18 0.00 36.11 0.00 0.00 0.00 0.00 0.00 29.30 20.07-23.31 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 19.32 17.02-26.14 May 2015 38.88 0.00 36.40 0.00 39.22 0.00* 0.00 0.00 0.00* 36.07 33.19 0.00 0.00 28.93 23.16-25.79 March 2016 dead 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 19.32 17.88-29.43 May 2015 0.00 0.00 0.00 0.00 37.81 0.00 0.00 0.00 31.92 29.49 0.00 29.00 0.00 29.81 14.39-17.14 March 2016 38.19 36.11 25.65 0.00 38.22 36.67 36.59 39.47 20.03 19.14 37.61 23.51 0.00 19.14 15.96-21.73 May 2015 32.44 33.67 32.66 34.35 30.58 34.86 32.88 33.84 0.00 0.00 0.00 0.00 0.00 30.52 14.54-18.12 March 2016 33.87 26.73 24.48 dead 25.29 25.08 27.22 28.60 37.83 0.00 0.00 34.93 0.00 19.14 17.23-29.35 May 2015 28.55 0.00 0.00 0.00 31.09 0.00 0.00 31.00 0.00 0.00 0.00 dead 0.00 30.52 14.52-15.87 March 2016 22.69 38.00 0.00 0.00 22.77 26.55 35.86 24.79 0.00 0.00 0.00 dead 0.00 20.21 16.98-23.07 1 FAM Ct = ‘CLas’ DNA; samples subjected to cPCR using primers A2/J5 are emboldend; Italicised FAM Ct values indicate samples that are positive by cPCR; Italicised and underlined FAM Ct values are samples confirmed by sequencing; EC= extraction controls (peach or apple midribs); PC= positive control; CAL = internal control (plant cytochrome); *the internal control (CAL) for the sample did not work; **only one sample with the highest range value; NS= no sample 162 Table 5.10. FAM Ct values (‘CLas’) for root samples collected from 12 young mandarin trees planted along Droopchhugang-Phuensoomgang. Altitude (m ASL) Year Month 1500 May 2015 1 34.90 2 33.37 3 34.61 4 33.93 5 35.93 6 32.54 7 36.27 8 32.93 9 36.44 10 36.48 11 35.01 12 36.77 EC 0.00 PC 30.14 16.74-23.93 March 2016 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 19.36 16.50-30.94 May 2015 34.16 32.95 31.76 30.06 31.51 35.10 30.66 34.83 35.36 34.94 36.08 0.00 0.00 30.25 16.25-19.26 March 2016 0.00 0.00 0.00 0.00 0.00 0.00 38.74 0.00 0.00 0.00 0.00 0.00 0.00 19.36 20.37-30.89 May 2015 34.62 34.53 37.14 39.05 32.79 34.85 33.71 35.03 36.27 33.04 38.08 34.76 0.00 30.25 15.49-23.01 March 2016 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 19.80 20.72-25.19 May 2015 35.10 31.95 32.49 34.02 32.43 33.22 34.24 32.86 32.91 33.79 33.26 33.84 0.00 29.30 20.10-23.07 March 2016 Dead 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 19.80 20.93-25.86 May 2015 34.92 34.40 33.79 33.82 38.56 33.77 36.13 35.32 33.70 32.85 36.59 32.78 0.00 28.93 22.39-27.18 March 2016 Dead 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 19.32 18.75-29.01 May 2015 35.30 32.09 35.65 34.27 34.91 37.61 0.00 35.55 34.70 30.85 0.00 32.84 0.00 29.81 15.74-18.23 March 2016 0.00 35.50 27.55 36.91 0.00 22.36 24.64 0.00 28.59 28.79 0.00 26.18 0.00 19.14 17-27.31 May 2015 0.00 0.00 0.00 36.06 0.00 0.00 0.00 0.00 0.00 35.25 0.00 33.44 0.00 30.52 16.59-32.5** March 2016 27.21 30.69 30.20 dead 29.11 27.64 29.09 25.88 0.00 36.81 0.00 0.00 0.00 19.14 18.75-26.38 May 2015 34.33 35.70 36.45 0.00 37.46 0.00 0.00 35.57 0.00 0.00 0.00 dead 0.00 30.52 14.13-19.67 March 2016 27.73 0.00 0.00 0.00 23.41 24.16 0.00 29.27 0.00 0.00 0.00 dead 0.00 20.21 17.95-21.6 1400 1300 1200 1100 1000 900 800 & FAM Ct value 1 CAL values Ct FAM Ct = ‘CLas’ DNA; samples subjected to cPCR using primers A2/J5 are emboldened; Italicised FAM Ct values indicate samples that are positive by cPCR; Italicised and underlined FAM Ct values are samples confirmed by sequencing; EC= extraction controls (peach or apple midribs); PC= positive control; CAL = internal control (plant cytochrome); *the internal control (CAL) for the sample did not work; **only one sample with the highest range value. 163 5.4 Discussion 5.4.1 Growth of mandarin seedlings. In my study, mandarin seedlings planted, in 2013, in existing orchards along Droopchhugang-Phuensoomgang at 100 m intervals from 800 to 1000 m ASL grew better than the seedlings planted at 100 m intervals from 1100 m and 1500 m ASL. This was in contrast to my hypothesis that rapid transmission of ‘CLas’ from ‘CLas’infected mature trees in the orchards to the seedlings at the lower altitudes would impede their growth in contrast to plants at the higher elevations where the risk of infection would be less. More seedlings became infected at the lower altitudes, but, despite this the plants grew better. Populations of Diaphorina citri at these altitudes were also noticeably lower than anticipated due to rapid decline and loss of mature trees, and low incidence of flush growth on mature trees that were still alive. Thus, factors other than ‘CLas’ influenced the growth of the seedlings. Severe infections with powdery mildew occurred at 1100 and 1500 m, soil quality varied and was poor at 1100, 1200 and 1500 m ASL, and damage caused by cattle, goats and wild boars was frequently observed (Table 5.2 & Figure 5.7). 5.4.2 Relationships between ambient temperatures, relative humidity, rainfall, elevation, and incidence of psyllids Prior to my studies, as noted in the introduction to this chapter, Diaphorina citri has been recorded in Bhutan at elevations ranging from 200 m ASL in the south to ~1350 m ASL at Richina in the west-central region of Punakha and, as nymphs, at 1380 m in Dzamling Zor Gewog, Tsirang. In the current study, Diaphorina citri adults were observed on the young mandarin plants at 800, 900 and 1100 m ASL. High populations were also observed on young mandarin trees in a nursery at 1100 m, and ‘CLas’ was detected in the nursery plants and in psyllids collected from them. With one exception on 19 April 2013 at Riserboo ‘A’ at 1438 m when four adults were tapped from a mature tree, the psyllid was never observed in Tsirang at elevations ≥ 1200 m ASL during the study despite 164 ambient temperatures and relative humidity at all elevations in citrus orchards in Tsirang being favourable (see Liu & Tsai 2000) for its development and survival. Annual minimum temperature at ≥ 1200 m ASL ranged from 13°C to 14.73°C, and annual rainfall from 1293 to 1461 mm averaged in 2014 (Table 5.4). It is thus possible that the adults recorded at Riserboo ‘A’ may have been from breeding populations in the orchard. It is also possible that they may have flown or were dispersed by wind from lower elevations, or were introduced on infested plants from nurseries at lower elevations shortly before they were recorded. Bové (2014) stated, in reference to HLB in Bhutan, that the psyllid cannot survive at elevations above 1400 m. Aubert (1987; 1990) commented that Diaphorina citri is a ‘surprisingly enduring insect’, surviving temperatures of 45°C in arid areas to −7°C in wet subtropical areas. Lakra et al. (1983) reported that in Hissar, Haryana, India (29.14464°N, 75.7188°E, 215 m ASL), the daily minimum temperatures of below 5°C and daily maximum of > 45°C, with a relative humidity lower than 40% are lethal to the psyllid. Aubert (1987) reported that Diaphorina citri is commonly found from sea level to 1500 m in south-western Arabia. Maximum summer temperatures at 1500 m ranged from 32–34°C and minimum temperatures in winter were as low as 2.5°C. The psyllid was absent in orchards above 1700–1800 m where occasional frosts occur (Aubert 1987). Subsequently, ‘CLas’ and Diaphorina citri were recorded at 1700 m in Taif (21.2622°N, 40.4090°E) in Saudi Arabia (Bové & Garnier 1984; Bové 2014). However, Aubert (1987), Bové and Garnier (1984) and Bové (2014) did not cite the latitudes and longitudes of the locations where the surveys were undertaken, and orchards viewed in Google Earth suggest that the observations in Taif were at elevations less than 1500 m ASL, possibly ~1450 m. Diaphorina citri infestations were not recorded by Aubert (1990) on Réunion Island (21.12°S, 55.53°E) at elevations of 700–800 m where minimum temperatures were 165 7°C. In peninsular Malaysia, between 3–5°N and 101–103.5°E, the psyllid was recorded up to 1200 m where minimum temperatures of 14°C occur (Aubert 1990). In China, the greatest infestations of the psyllid and the greatest incidence of huanglongbing occurs in the southeast in Guangxi, Guangdong, Fujian, and Taiwan, with the boundary separating high from low incidence running from 29°N in Zhejiang to 25°N in Yunnan in a sea-facing arc running slightly inland from the mountain ranges that separate inland Sichuan, Guizhou, Hunan and Jiangxi from coastal Guangxi, Guangdong, Fujian and Zhejiang (Yang et al. 2006). The elevations of localities between 26.00°N and 29.00°N where Diaphorina citri occurs in these provinces range from ~500–1200 m (Yang et al. 2006). Beattie et al. (2010) assessed populations of Diaphorina citri in orchards at Purworejo (7.7145°S, 110.0096°E, 60 m ASL), Grabag (7.3667°S, 110.3000°E, 640 m ASL) and Ngablak (7.3963°S, 110.3893°E, 1300 m ASL) in Central Java, Indonesia, over 2–3 years. The insect was common at Purworejo, uncommon at Grabag and never observed at Ngablak. Online records and unpublished records from the study (Rachmad Gunadi, Universitas Gadjah Mada) indicate that average temperatures and annual rainfall at the three elevations are ~26.5°C and 2447 mm, 22.1°C and 3068 mm, and 17.4°C and 2908 mm, respectively, with peak monthly rainfall of ~470 mm at Purworejo, ~580 mm at Grabag, and ~630 mm at Ngablak in December and January. The presence of Diaphorina citri at elevations ranging from 10 m to 880 m ASL in Puerto Rico (18.2208°N, 066.5901°W) was determined by Jenkins et al. (2015). It was not recorded at elevations above 600 m ASL. This was attributed to lower ambient temperatures at higher elevations limiting flush growth on trees and generations of the psyllid at the higher elevations, and to differences in air pressure, oxygen levels and short wave radiation, partial pressure and precipitation. They also hypothesised that slower development of the psyllid at the higher elevations may have prolonged the risk of attack by predators and parasites (Jenkins et al. 2015). They did not record ambient temperatures or rainfall, but weather information 166 accessible online indicates that average rainfall ranges from 700–1400 mm near sea level to 2300–2500 mm from 600–800 m ASL where surveys were undertaken. Average minimum and maximum temperatures differ by ~3°C and ~4°C repectively. (http://pr.water.usgs.gov/drought/climate.html; http//www.topuertorico.org/reference /tempera.shtml). Populations of Diaphorina citri decline after heavy rainfall. Aubert (1987) mentioned 150 mm, and Chavan & Shummanvar (1993) recorded the lowest population densities near Pune in Maharashtra, India, after monsoon rains that occur from June to October. Average monthly rainfall recorded from June to September in Pune by Tinmaker et al. (2010) over four years was 145 mm, ranging from 115 mm to 187 mm per month. Average rainfall cited by World Weather Online for the same interval in Pune was 165 mm, ranging from 126 mm to 207 mm per month (https://www.worldweatheronline.com/pune-weather-averages/maharashtra/in.aspx). Bové (2014) summarised records for ‘CLas’ and Diaphorina citri in Nepal, noting that the pathogen and the vector had been recorded in orchards that occur at similar latitudes (~26° to 27°N) to orchards in Bhutan, at elevations ranging from ~450 m to ~1350 m. ‘Candidatus Liberibacter asiaticus’ titres and the extent of psyllid infestations were not mentioned. Garnier & Bové (2002) surveyed orchards in Bhutan from 28 to 29 August 2002. Most of the trees in the orchards visited were 10–30 years old. The altitude of the orchards was determined with an altimeter, but the elevations appear, based on my knowledge and surveys, and cross-checking with Google Earth, in most instances, to have been overestimated by 70–100 m. ‘Candidatus Liberibacter asiaticus’ was detected at Rimchhu (27.6675°N, 89.7753°E, 1380 m ASL, cited as 1450 m), Botakha (27.6401°N, 89.7948°E, 1287–1325 m ASL, cited as 1400 m), Serigang (27.6399°N, 89.7925°E, 1318 m ASL, cited as 1400 m), Phuntshopelri (27.6128°N, 89.8406°E, 1264 m ASL, cited as 1350 m), Upper Sonagasa (27.6110°N, 89.8467°E, 1239 m ASL, cited as 1350 m ASL) and Lower Sonagasa (27.6093°N, 89.8499°E, 1232 m ASL, cited as 1350 m ASL), and the Renewable Natural Resources Research 167 Center (RNRRC) at Bajo, Wangdue Phodrang (27.4906°N, 89.8999°E, 1225 m, cited as 1300 m). The presence of Diaphorina citri eggs, nymphs and adults was not recorded. At Chhuzomsa (27.5053°N, 89.9634°E, 1362 m ASL, cited as 1300 m), to the east of Wangdue Phodrang, no symptoms of HLB were recorded and Diaphorina citri was not mentioned. The surveys continued southwards along the right bank of the Punatsangchhu. At Rurechhu (27.3537°N, 89.9144°E, 1000 m ASL, cited as 1100 m) no evidence of HLB was found and Diaphorina citri was not mentioned: the orchard is now an electricity substation. At Baychhu (27.2984°N, 89.9674°E, 776 m ASL, cited as 850 m), ‘CLas’ was detected but Diaphorina citri was not mentioned. At Kamichhu (27.2706°N, 90.0381°E, 640 m ASL, cited as 700 m) ‘CLas’ and Diaphorina citri were present. Bové (2004) reported the outcome of surveys undertaken in Bhutan from 9 to 24 October 2004. These surveys were undertaken in the Damphu and Tashipang (Mendrelgang) regions of Tsirang and on the Thimphu (spelt as Timphu) and Pasakha roads near Phuentsholing. No evidence for HLB was found. Diaphorina communis was never observed in the seedling mandarin plots along Droopchhugang-Phuensoomgang during the study. Some adults were observed on Bergera koenigii in the vicinity of the plots at 800, 900 and 1000 m. Cacopsylla heterogena was observed on mature trees at 1500 m ASL and on young trees in an orchard between 1300 m and 1400 m ASL along DroopchhugangPhuensoomgang in 2013. A few pouch galls with nymphs and aged honeydew were found on mature mandarin trees at 1300 m ASL in 2015. The psyllid was recorded once in the seedling mandarin plots at 1400 m ASL in 2015. Eggs, nymphs and adults were observed in a nursery near these plots in 2014. In areas, other than Droopchhugang-Phuensoomgang, the psyllid was found at elevations ranging from 983–2444 m ASL (Chapter 6). No parasitoids were recorded despite the large number of nymphs observed during the study. 168 My results and the observations reported by Aubert (1987; 1990), Chavan & Shummanvar (1983), Beattie et al. (2010) and Jenkins et al. (2015) suggest that monsoon rains have significant impacts on populations of Diaphorina citri in Tsirang and that these impacts are likely to be greater as prevailing ambient temperatures decline with increasing elevation. However, the differences in ambient temperatures (Figure 5.9, Table 5.4) may not be the sole reason for the abrupt change in the incidence of the psyllid between 1100 and 1200 m. The fall in the incidence of Cacopsylla heterogena with declining elevations, particularly the abrupt change in incidence below 1200 m, is most probably related to increasing ambient temperatures and falling relative humidity (Figures 5.10 & 5.11, Table 5.4) with the decline in elevation and increasing risk of egg and nymph mortality despite protection afforded to these immature stages by the pouch galls in which they develop. 5.4.3 Prevalence of ‘CLas’ at different elevations Few mandarin seedlings (up to three plants) representing each seedling consignment received from the NSC in 2013 and 2014 were maintained in the green house in NPPC for observations. Pooled samples of these seedlings were tested for ‘CLas’ and one sample (out of three) produced FAM Ct of 34.27 by qPCR in 2014 but did not yield any amplicons in cPCR. This result, however, cast doubt over the health status of the seedlings at the NSC. Therefore, more sampling and testing were conducted on the same plants as well as sampling from the plants at NSC. Subsequent testing of samples from the same plants maintained at NPPC did not yield any FAM Ct values. Further, the PCR results obtained from the young mandarin seedlings planted along Droopchhugang-Phuensoomgang also indicate that the plant used in the current study could not have been infected. If seedlings were infected before planting, then ‘CLas’-positive results would also be obtained from seedlings planted at the higher elevations as the seedlings planted at each altitude were selected randomly from the same group of plants. If the seedlings were infected before planting, then ‘CLas’ would have been detected in seedlings planted at all elevations, which was not the case. 169 I hypothesised that leaf temperatures detrimental to ‘CLas’ may influence the incidence of ‘CLas’ and severity of huanglongbing at higher altitudes in Tsirang, due to lower evaporative cooling of leaves in relation to higher relative humidity at the prevailing ambient temperatures. However, the leaf temperatures recorded were ~8 to 19°C below temperatures required in heat treatments to kill ‘CLas’ in plant tissues (e.g., 40 to 51°C for 30 minutes to 48 hours) (Lin & Lo 1965; Martinez et al. 1971; Raychaudhuri et al. 1974; Su & Chang 1976; Huang 1978; Lo et al. 1981; Cheema et al. 1982; Lo 1983; Hoffman et al. 2013). Therefore, leaf temperatures could not have been the factor limiting the titres of ‘CLas’ and severity of huanglongbing at the higher altitudes. Results of qPCR analysis of the root and bark samples collected for two and three years, respectively, from mature mandarin trees (> 30 years) along DroopchhugangPhuensoomgang showed that ‘CLas’ was more prevalent in plants at the lower elevations (800–1100 m) than in plants at 1200 m or above (Table 5.6, & 5.7). This is more evident in the analysis using bark samples (Table 5.6). The low incidence of ‘CLas’ at higher elevations could be due to the absence of Diaphorina citri in these areas restricting spread of the disease. ‘Candidatus Liberibacter asiaticus’ could have been introduced in these areas by infected planting material. Most citrus orchards in Bhutan were established with material produced without any appropriate phytosanitary measures. Planting materials used to establish orchards in the 1960s80s were sourced from lower elevations where both the pathogen and Diaphorina citri were prevalent. Although the presence of ‘CLas’ in Bhutan was only confirmed in 2002 (Ahlawat 2003; Doe Doe et al. 2003), the disease was present at the lower elevations much earlier as reported in Lama & Amtya (1991) and Lama & Amatya (1993). Records indicate that the pathogen was confirmed in neighbouring states of India and Nepal in the 1960s (Fraser 1966; Nariani & Raychaudhuri 1968; Knorr et al. 1970; Regmi & Lama 1988), and in Bangladesh in the late 1970s (Catling et al. 1978). Leaf and bark samples from elevations above 1200 m in Mendrelgang Gewog did not yield any FAM Ct values, whereas at least one or more root samples produced FAM 170 Ct value > 0.00 with most of them close to 36. A root sample from 1100 m with FAM Ct value of 31.49 was confirmed by sequencing. The observation of many root samples from higher elevations producing FAM Ct values > 0.00 compared to bark (or leaf) both along Droopchhugang-Phuensoomgang as well as in the Mendrelgang Gewog seem to indicate that ‘CLas’ may be present but is not readily detected in aerial plant tissues at such elevations. However, there is no evidence to confirm this, since not a single root sample from the higher elevation could be amplified using cPCR and sequenced. It is also possible that the root samples may have produced non-specific amplification. Kunta et al. (2014) obtained ‘CLas’-positive Ct values ranging from 22.90 to 31.78 in root samples from asymptomatic trees using the 16S primer-probe of Li et al. (2006) whereas the leaf samples from the same trees did not produce any positive real time test results. Kunta et al. (2014) concluded that the 16S primer-probe of Li et al. (2006) was not suitable for detection of ‘CLas’ in root samples based on further evaluations using the LJ900fpr primer-probe on root and soil samples. Kunta et al. (2014) found that the PCR products that the 16S primerprobe amplified from root and soil samples matched with beta-glucosidase belonging to several proteobacteria. The primers-probe set used in the current study was also that of Li et al. (2006). However, further work is required to assess the results of the root samples in the current study. Real-time PCR analysis of samples taken from young mandarin seedlings planted at 100 m intervals from 800 m to 1500 m showed a similar trend with a greater proportion of plants at lower elevations producing FAM Ct values > 0.00 compared to plants at higher elevations, especially in the bark and root samples collected in March 2016. Bark samples collected in May 2015 showed a higher number of plants at lower elevations producing FAM Ct value > 0.00 than the corresponding root samples. The overall results indicate that few plants at higher elevations produced FAM Ct values in the range of 0.00 < FAM Ct < 36 which are deemed as ‘CLas’ positive. Many samples that produced FAM Ct values between 30 and 40 did not yield any amplicons when subjected to cPCR with primers A2/J5, although two samples with 171 FAM Ct values of 37.46 and 37.75 from young and mature trees respectively, both collected from 800 m, were successfully amplified and sequenced. 5.5 Conclusions My results suggest that factors other than ambient temperature, RH and rainfall limit the occurrence of Diaphorina citri and, directly or indirectly, the presence of ‘CLas’ at ≥ 1200 m in Tsirang. UV radiation may be a possible factor limiting the distribution of Diaphorina citri at or above 1200 m. For UV radiation to have impacts on tissues, radiation must enter and be absorbed in the tissues, and many animals and plants are thought to have developed UV shielding mechanisms (Caldwell et al. 1998). This possibility is supported by occurrence of eggs and nymphs of Cacopsylla heterogena inside pouch galls in contrast to opposed to the exposed eggs and nymphs of Diaphorina citri and Diaphorina communis. It is also supported by the occurrence of an unidentified leaf gall midge (Diptera: Cecidomyiidae) at elevations ranging from 800 to 1400 m observed during my study (Figure 5.12) that develops within wart-like, tubular leaf galls formed by adaxial leaf surfaces rolled inwards along midribs. The formation of pouch and tubular leaf galls would provide shielding mechanisms against the effects of UV light, high rainfall and desiccation. Moreover, Bhutan lies within a region of the Earth’s surface where high UV radiation occurs (Figure 5.13) (Liley & McKenzie 2006), and higher UV radiation than in Arabia where, as noted above, Diaphorina citri occurs in the absence of monsoon rains, at slightly higher elevations than in Bhutan. Unidentified spider mites (Acari: Tetranychidae) were also observed during the study, on abaxial leaf surfaces (Figure 5.14) of Zanthoxylum sp. leaflets, 27.0610°N, 89.5642°E, 1607 m, near the Chhukha Bridge on the Phuentsholing-Thimphu Highway on 24 April 2013 and mandarin trees at Kamichhu (650 m) on 16 April 1014. Some spider mites are known to stay on abaxial leaf surfaces in order to avoid UV (Ben-Yakir & Fereres 2016). UV radiation (UVA & UVB) has been reported to affect herbivores directly, e.g., by causing high mortality of immature stages of a chrysomelid species, and reduced the egg laying capacity of the two spotted spider mite (Tetranychus urticae Koch: Acari: Tetranychidae) (Kuhlmann & Müller 2011). Indirect effects of 172 UV radiation on herbivores is associated with changes in plant morphology, physiology and photochemistry (Kuhlmann & Müller 2011). Under enhanced UVB radiation, probing behaviour as well as the nymphal development period, reproductive and post-reproductive period, and difference in weight after moulting of the grain aphid (Sitobion avenae: Hemiptera: Aphididae) were negatively affected (Hu et al. 2013a & b). Hu et al. (2013b) noted differences in response to UV radiation among the brown and green morphs of the grain aphid. Further, UV radiation causes changes in plant secondary metabolites—which are known to contribute to protection against pathogens and insects (Katerova et al. 2012). Salt et al. (1998) observed progressively low populations of the psyllid, Strophingia ericae (Curtis) (Hemiptera: Liviidae), and reduced level of the amino acid, isoleucine, in the heather plants (Calluna vulgaris (L.) Hull) (Ericales: Ericaceae) compared to the controls over a 27 month period. Solar radiation is said to increase with increase in altitude. Comparing the total irradiance and UVA irradiance between Jungfraujoch at 3576 m ASL in Switzerland and Innsbruck at 577 m ASL in Austria, Blumthaler et al. (1997) noted that under clear sky condition of summer, total irradiance increased by 8% per 1000 m while UVA irradiance increased by 9%. Figure 5.12. Wart-like tubular leaf gall of an unidentified cecidomyiid observed between 800 m and 1400 m ASL during the study, and larvae within a gall (Photos: GAC Beattie). 173 Figure 5.13. Map of peak UV indexes using a modified scale to highlight the absolute peaks (Liley & McKenzie 2006). The location of Bhutan is circled in red and indicated with an arrow. Figure 5.14. Spider mites on abaxial leaf surfaces of Zanthoxylum sp. (1600 m ASL) and mandarin (650 m ASL). (Photos: GAC Beattie) 174 5.6  Highlights of the study: Altitude, ambient temperature and relative humidity did not lead to leaf temperatures detrimental to ‘CLas’ titres.  Diaphorina citri was more commonly found below 1200 m while Cacopsylla heterogena was found quite abundantly at higher altitudes.  The distribution of Diaphorina citri in Tsirang at higher altitudes seems to be limited, possibly due to combination of UV radiation and rainfall, since the ambient temperatures obtained during the two years of the study period are within the favourable conditions for Diaphorina citri.  Diaphorina communis was not observed in the experimental plots or on mature mandarin trees in the study area, although it was observed nearby on Bergera koenigii.  ‘Candidatus Liberibacter asiaticus’ is more prevalent at elevations up to 1100 m. At elevations above 1200 m, ‘CLas’ may have been introduced in planting materials but remained localised due to absence of Diaphorina citri at these altitudes. In the absence of a vector, it is possible to grow mandarins and other Citrus species and hybrids above 1200 m using pathogen-free planting material. 175 Chapter 6: Preliminary investigation into the role of Cacopsylla heterogena Li in huanglongbing __________________________________________________________________ 6.1 Introduction As detailed in the literature review, besides Diaphorina citri and Diaphorina communis, about eight other species of psyllids are reported to feed on rutaceous plants in Asia (Table 6.1). In Bhutan, four adults of a species of green psyllid were first recorded in April 2013 in Tsirang, initially in an orchard (27.0082°N, 90.1391°E, 1260 m ASL) in Dekidling Chiwog, Kilkhorthang Gewog, and then on the same day at Riserboo ‘A’ (Kamigaon) (26.9532°N, 90.1347°E, 1436 m ASL) in Mendrelgang Gewog when a larger number of adults were tapped from immature and mature seedling mandarin trees on which nymphs were also present. Adult females of the green psyllid lay their eggs on young leaves that rapidly fold inwards longitudinally at 90° along midribs so forming a pouch gall that protects the nymphs as they develop. High populations of the psyllid cause significant deformation of flush growth, which is manifested as a twisting and bending of leaves as they grow in length before hardening (pers. obs.). Since these initial observations, damage caused by this psyllid has been observed in mandarin orchards in the Dagana, Mongar, Punakha, and Thimphu Dzongkhags (Beattie, pers. comm.). This psyllid species was also observed infesting an undescribed wild citrus species (see Chapter 7) growing near Wengkhar and Korilla in the Mongar Dzongkhag and at Basochhu in the Wangdue Phrodrang Dzongkhag (Beattie, pers. comm.). Two other species of psyllids have subsequently been found causing similar foliage damage on an undescribed species of Zanthoxylum in various parts of the Tsirang Dzongkhag and at Baychhu in the Wangdue Phodrang Dzongkhag. Until recently, the only species of green psyllid on citrus known to acquire and transmit ‘CLas’ is Cacopsylla citrisuga (Yang & Li) (Cen et al. 2012 a; 2012b). The high incidence of the psyllids found in Bhutan on mandarin and other citrus relatives and their possible role in the epidemiology of ‘CLas’ necessitated an investigation of these species to determine any role they may play in relation to the aetiology of 176 ‘CLas’. Additionally, molecular characterisation of the psyllids is important to inform the morphological identification of the currently known psyllids on Rutaceae. Thus, this chapter focuses on the molecular characterisation of the psyllids found on citrus (mandarin, lime, lemon, orange and wild citrus) and Zanthoxylum in Bhutan, and the detection of ‘CLas’ within the psyllids and the host plants on which they were found. For insects, the mitochondrial 16S region and the COI gene (Simon et al. 1994; Lunt et al. 1996; Shouche & Patole 2000; Costa et al. 2003) are widely used in phylogenetic studies and were using in this study. In addition, the nuclear ITS region has also been employed to infer phylogenetic relationships in closely related groups of insects (Miller et al. 1996) and was also used in this study. The specific objectives of this chapter were to:  study the morphological and molecular characteristics of the green psyllids found on mandarin and wild citrus, and other psyllids found on an unidentified Zanthoxylum sp., and,  determine the presence of ‘CLas’ within the green psyllids and their host plants. 177 Table 6.1. Summary of species of psyllids feeding on Rutaceae in Asia1 Species Host plant Places Reference Cacopsylla (Psylla) citricola (Yang & Li) Citrus maxima (Burm.) Merr. China Yang & Li (1984) Citrus medica L. China; India Yang & Li (1984) Citrus maxima L. China Yang & Li (1984) Citrus medica L. India Beattie (pers. comm.) Murraya paniculata L. Japan Inoue et al. (2006) Cacopsylla (Psylla) citrisuga (Yang & Li) Cacopsylla (Psylla) evodiae (Miyataki)) Tetradium glabrifolium (Champ. ex Benth.) T. G. Hartley Zanthoxylum beecheyanum var. alatum (Nakai) Hara Inoue (2010) Toddalia asiatica (L.) Cacopsylla heterogena Li Citrus sp. China Li (2011) Cacopsylla (Psylla) murrayi (Mathur) Bergera koenigii L. Northern India Mathur (1975) Citrus maxima L. Cacopsylla toddaliae (Yang) Lahiri & Biswas (1979, 1980) Citrus × limon (L.) Osbeck Malaysia Osman & Lim (1992) Citrus × aurantium L. Japan; Taiwan Inoue 2010 Toddalia asiatica (L.) Lam. Diaphorina murrayi Kandasamy Bergera koenigii (L.) India Kandasamy (1986) Trioza citroimpura Yang & Li Citrus reticulata Blanco China Yang & Li (1984) 1 For complete descriptions, refer to the literature review in Chapter 1. 178 6.2 Materials and methods 6.2.1 Psyllid samples for phylogenetic analyses and morphological identification Specimens of green psyllids on citrus occurring at altitudes ranging from 983 to 2444 m ASL and on the Zanthoxylum sp. from altitudes from 1175 to 1264 m ASL were collected as described in Chapter 2 for phylogenetic analysis (Table 6.2). Nymphs were included to confirm that the adults and nymphs collected from each host were of the same species. Specimens were stored in 100% ethanol until DNA extraction. Representative psyllid specimens were sent to Dr Susan Halbert (Taxonomic Entomologist, Division of Plant Industry, Florida Department of Agriculture and Consumer Services) and Luo Xinyu (Department of Entomology, China Agricultural University) for morphological identification. Three specimens of Cacopsylla citrisuga from Yunnan, China were received from Dr Cen Yijing, South China Agricultural University, Guangzhou, Guangdong, China to compare with the psyllids collected in Bhutan; two specimens were adults collected in Yunnan, China, and preserved in 100% ethanol, and one specimen was received as DNA. 6.2.2 Psyllid DNA extraction for phylogenetic studies Genomic DNA from single psyllid was extracted from specimens stored in 100% ethanol in the Molecular Laboratory of the School of Science and Health (SSH), Western Sydney University, Hawkesbury Campus. The extraction method using the ISOLATE II Genomic DNA Kit (Bioline) was employed but without crushing the samples Section 4.2.2 (Chapter 4). Subsequent extractions were made using the REDExtract-N-Amp™ Plant PCR Kit (Sigma-Aldrich) as in Section 3.2.4 (Chapter 3). For specimens from China, DNA was extracted from the two psyllid specimens using the ISOLATE II Genomic DNA Kit (Bioline). The third specimen from China was received as a DNA extract. 179 Table 6.2. Host plants and locations where psyllid specimens were collected. Abbreviations used: Bhutan (BT); nymph with round and not black abdomen (RNBA); nymph with round and black abdomen (RBA); slender nymph (SN). Authorities of plant species are as in Chapter 7. Sample Name of samples based on Location Host plant Life stage GPS coordinates Elevation number results of this study CHBT.1 Cacopsylla heterogena Droobchhugang, Tsholingkhar Gewog, Tsirang, BT Citrus reticulata adult 27.0189°N, 90.1275°E 1478 CHBT.2 Cacopsylla heterogena Droobchhugang, Tsholingkhar Gewog, Tsirang, BT Citrus reticulata adult 27.0189°N, 90.1275°E 1478 CHBT.3 Cacopsylla heterogena Droobchhugang, Tsholingkhar Gewog, Tsirang, BT Citrus reticulata adult 27.0189°N, 90.1275°E 1478 CHBT.4 Cacopsylla heterogena Riserboo ‘A’, Mendregang Gewog, Tsirang, BT Citrus reticulata adult 26.9532°N, 90.1347°E 1436 CHBT.6 Cacopsylla heterogena Riserboo ‘A’, Mendregang Gewog, Tsirang, BT Citrus reticulata adult 26.9532°N, 90.1347°E 1436 CHBT.9 Cacopsylla heterogena Riserboo ‘A’, Mendregang Gewog, Tsirang, BT Citrus reticulata nymph 26.9532°N, 90.1347°E 1436 CHBT.10 Cacopsylla heterogena Riserboo ‘A’, Mendregang Gewog, Tsirang, BT Citrus reticulata adult 26.9532°N, 90.1347°E 1436 CHBT.11 Cacopsylla heterogena Riserboo ‘A’, Mendregang Gewog, Tsirang, BT Citrus reticulata adult 26.9532°N, 90.1347°E 1436 CHBT.12 Cacopsylla heterogena Riserboo ‘A’, Mendregang Gewog, Tsirang, BT Citrus reticulata adult 26.9532°N, 90.1347°E 1436 CHBT.14 Cacopsylla heterogena Riserboo ‘A’, Mendregang Gewog, Tsirang, BT Citrus reticulata nymph 26.9532°N, 90.1347°E 1436 (m ASL) 180 Sample Name of samples based on number CHBT.17 results of this study Cacopsylla heterogena CHBT.18 Location Host plant Life stage GPS coordinates Elevation RDC, Maenchhana, Kilkhorthang Gewog, Tsirang, BT Citrus × aurantium (sweet orange) nymph 26.9977°N, 90.1250°E (m ASL) 1531 Cacopsylla heterogena RDC, Maenchhana, Kilkhorthang Gewog, Tsirang, BT Citrus × aurantium (sweet orange) nymph 26.9977°N, 90.1250°E 1531 CHBT.20 Cacopsylla heterogena Patala, Drujegang Gewog, Dagana, BT Citrus reticulata adult 26.9847°N, 90 0180°E 1496 CHBT.21 Cacopsylla heterogena Patala, Drujegang Gewog, Dagana, BT Citrus reticulata nymph 26.9847°N, 90 0180°E 1496 CHBT.22 Cacopsylla heterogena Patala, Drujegang Gewog, Dagana, BT Citrus reticulata nymph 26.9847°N, 90 0180°E 1496 CHBT.23 Cacopsylla heterogena Patala, Drujegang Gewog, Dagana, BT Citrus reticulata nymph 26.9802°N, 90.0129°E 1493 CHBT.24 Cacopsylla heterogena Patala, Drujegang Gewog, Dagana, BT Citrus reticulata nymph 26.9802°N, 90.0129°E 1493 CHBT.25 Cacopsylla heterogena Patala, Drujegang Gewog, Dagana, BT Citrus reticulata adult 26.9802°N, 90.0129°E 1493 CHBT.26 Cacopsylla heterogena Patala, Drujegang Gewog, Dagana, BT Citrus reticulata adult 26.9802°N, 90.0129°E 1493 CHBT.27 Cacopsylla heterogena Thangna, Drujegang Gewog, Dagana, BT Citrus reticulata nymph 26.9870°N, 90.0326°E 1164 CHBT.28 Cacopsylla heterogena Thangna, Drujegang Gewog, Dagana, BT Citrus reticulata nymph 26.9870°N, 90.0326°E 1164 CHBT.29 Cacopsylla heterogena Thangna, Drujegang Gewog, Dagana, BT Citrus reticulata adult 26.9870°N, 90.0326°E 1164 181 Sample Name of samples based on Location Host plant Life stage GPS coordinates Elevation number results of this study CHBT.30 Cacopsylla heterogena Thangna, Drujegang Gewog, Dagana, BT Citrus reticulata adult 26.9870°N, 90.0326°E 1164 CHBT.31 Cacopsylla heterogena Thangna, Drujegang Gewog, Dagana, BT Citrus reticulata adult 26.9870°N, 90.0326°E 1164 CHBT.31 Cacopsylla heterogena Thangna, Drujegang Gewog, Dagana, BT Citrus reticulata adult 26.9870°N, 90.0326°E 1164 CHBT.32 Cacopsylla heterogena Citrus reticulata nymph 26.9826°N, 90.0533°E 1035 CHBT.33 Cacopsylla heterogena Citrus reticulata nymph 26.9748°N, 90.0550°E 983 CHBT.34 Cacopsylla heterogena Pangna, Drujegang Gewog, Dagana, BT Below Pangna, Drujegang Gewong, Dagana, BT Talo, Punakha, BT Citrus reticulata nymph 27.5516°N, 89.8238°E 2444 CHBT.35 Cacopsylla heterogena Talo, Punakha, BT Citrus reticulata adult 27.5516°N, 89.8238°E 2444 CHBT.37 Cacopsylla heterogena Talo-Walakha Road 1, Punakha, BT Citrus reticulata adult 27.5403°N, 89.8521°E 1791 CHBT.39 Cacopsylla heterogena Mendrelgang - Thimphu-Punakha Road, BT Citrus reticulata nymph 27.5248°N, 89.8323°E 1604 CHBT.41 Cacopsylla heterogena Mendrelgang - Thimphu-Punakha Road, BT Citrus reticulata nymph 27.5248°N, 89.8323°E 1604 CHBT.42 Cacopsylla heterogena Khuengkha, Dungna Gewog, Chukkha, BT Citrus reticulata nymph 26.9335°N, 89.4322°E 1090 CHBT.45 Cacopsylla heterogena Khuengkha, Dungna Gewog, Chukkha, BT Citrus × aurantiifolia nymph 26.9335°N, 89.4322°E 1090 (m ASL) 182 Sample Name of samples based on number CHBT.46 results of this study Cacopsylla heterogena CHBT.47 Location Host plant Life stage GPS coordinates Elevation Khuengkha, Dungna Gewog, Chukkha, BT Citrus × aurantiifolia nymph 26.9335°N, 89.4322°E (m ASL) 1090 Cacopsylla heterogena Khuengkha, Dungna Gewog, Chukkha, BT Citrus × aurantiifolia adult 26.9335°N, 89.4322°E 1090 CHBT.48 Cacopsylla heterogena Khuengkha, Dungna Gewog, Chukkha, BT Citrus × aurantiifolia adult 26.9335°N, 89.4322°E 1090 CHBT.49 Cacopsylla heterogena Khuengkha, Dungna Gewog, Chukkha, BT Citrus × aurantiifolia adult 26.9335°N, 89.4322°E 1090 CHBT.50 Cacopsylla heterogena Near Wengkhar, Mongar, BT wild native citrus nymph 27.2515°N, 91.2597°E 2018 CHBT.51 Cacopsylla heterogena Near Wengkhar, Mongar, BT wild native citrus nymph 27.2515°N, 91.2597°E 2018 CCN.1 Cacopsylla citrisuga Yunnan, China (received as DNA) lemon adult 24.0712°N, 97.7999°E, 1200 CCN.2 Cacopsylla citrisuga Yunnan, China lemon adult 24.0712°N, 97.7999°E, 1200 PCOBT.1 Cornopsylla rotundiconis Pemathang, Gosarling Gewog, Zanthoxylum sp. adult 27.2414°N, 90.3581°E 1175 Zanthoxylum sp. adult 27.2414°N, 90.3581°E 1175 Zanthoxylum sp. adult 27.2414°N, 90.3581°E 1175 Zanthoxylum sp. adult 27.2414°N, 90.3581°E 1175 Tsirang, BT PCOBT.2 Cacopsylla sp. Pemathang, Gosarling Gewog, Tsirang, BT PCOBT.4 Cornopsylla rotundiconis Pemathang, Gosarling Gewog, Tsirang, BT PCOBT.5 Cornopsylla rotundiconis Pemathang, Gosarling Gewog, Tsirang, BT 183 Sample Name of samples based on number PCOBT.6 results of this study Cornopsylla rotundiconis Location Host plant Pemathang, Gosarling Gewog, Life stage GPS coordinates Elevation Zanthoxylum sp. adult 27.2414°N, 90.3581°E (m ASL) 1175 Zanthoxylum sp. adult 27.2414°N, 90.3581°E 1175 Zanthoxylum sp. adult 27.2414°N, 90.3581°E 1175 Zanthoxylum sp. adult 27.2414°N, 90.3581°E 1175 Zanthoxylum sp. RNBA 27.0120°N, 90.1579°E 1264 Zanthoxylum sp. RNBA 27.0120°N, 90.1579°E 1264 Zanthoxylum sp. SN 27.0120°N, 90.1579°E 1264 Zanthoxylum sp. RBA 27.0120°N, 90.1579°E 1264 Zanthoxylum sp. RBA 27.0120°N, 90.1579°E 1264 Tsirang, BT PCOBT.7 Cacopsylla sp. Pemathang, Gosarling Gewog, Tsirang, BT PCOBT.8 Cacopsylla sp. Pemathang, Gosarling Gewog, Tsirang, BT PCOBT.9 Cacopsylla sp. Pemathang, Gosarling Gewog, Tsirang, BT PCOBT.10 Cacopsylla sp. Dangreyboog, Dunglagang Gewog, Tsirang, BT PCOBT.11 Cacopsylla sp. Dangreyboog, Dunglagang Gewog, Tsirang, BT PCOBT.15 Cornopsylla rotundiconis Dangreyboog, Dunglagang Gewog, Tsirang, BT PCOBT.16 Cacopsylla sp. Dangreyboog, Dunglagang Gewog, Tsirang, BT PCOBT.17 Cacopsylla sp. Dangreyboog, Dunglagang Gewog, Tsirang, BT 184 Sample Name of samples based on number results of this study PCOBT.18 Cacopsylla sp. Location Host plant Life stage GPS coordinates Elevation (m ASL) Dangreyboog, Dunglagang Gewog, Zanthoxylum sp. RBA 27.0120°N, 90.1579°E 1264 Zanthoxylum sp. adult 27.0120°N, 90.1579°E 1264 Zanthoxylum sp. adult 27.0120°N, 90.1579°E 1264 Zanthoxylum sp. adult 27.0120°N, 90.1579°E 1264 Zanthoxylum sp. adult 27.0120°N, 90.1579°E 1264 Tsirang, BT PCOBT.19 Cacopsylla sp. Dangreyboog, Dunglagang Gewog, Tsirang, BT PCOBT.20 Cacopsylla sp. Dangreyboog, Dunglagang Gewog, Tsirang, BT PCOBT.21 Cacopsylla sp. Dangreyboog, Dunglagang Gewog, Tsirang, BT PCOBT.22 Cornopsylla rotundiconis Dangreyboog, Dunglagang Gewog, Tsirang, BT PCOBT.24 Cornopsylla rotundiconis Dangreyboog, Dunglagang Gewog, Tsirang, BT Zanthoxylum sp. adult 27.0120°N, 90.1579°E 1264 PCOBT.25 Cacopsylla sp. Dangreyboog, Dunglagang Gewog, Zanthoxylum sp. RNBA 27.0120°N, 90.1579°E 1264 Zanthoxylum sp. RBA 27.0120°N, 90.1579°E 1264 Tsirang, BT PCOBT.27 Cacopsylla sp. Dangreyboog, Dunglagang Gewog, Tsirang, BT 185 Sample Name of samples based on number PCOBT.28 results of this study Cornopsylla rotundiconis Location Host plant Dangreyboog, Dunglagang Gewog, Life stage GPS coordinates Elevation Zanthoxylum sp. SN 27.0120°N, 90.1579°E (m ASL) 1264 Zanthoxylum sp. SN 27.0120°N, 90.1579°E 1264 Zanthoxylum sp. adult 27.0120°N, 90.1579°E 1264 Zanthoxylum sp. adult 27.0120°N, 90.1579°E 1264 Zanthoxylum sp. adult 27.0120°N, 90.1579°E 1264 Zanthoxylum sp. adult 27.0120°N, 90.1579°E 1264 Zanthoxylum sp. adult 27.0120°N, 90.1579°E 1264 Tsirang, BT PCOBT.29 Cornopsylla rotundiconis Dangreyboog, Dunglagang Gewog, Tsirang, BT PCOBT.31 Cornopsylla rotundiconis Dangreyboog, Dunglagang Gewog, Tsirang, BT PCOBT.33 Cornopsylla rotundiconis Dangreyboog, Dunglagang Gewog, Tsirang, BT PCOBT.34 Cacopsylla sp. Dangreyboog, Dunglagang Gewog, Tsirang, BT PCOBT.35 Cacopsylla sp. Dangreyboog, Dunglagang Gewog, Tsirang, BT PCOBT.36 Cacopsylla sp. Dangreyboog, Dunglagang Gewog, Tsirang, BT 186 6.2.3 Psyllid DNA amplifications and sequencing The COI region was amplified similar to methods described in Section 4.2.2 (Chapter 4) using primers, CI-J-1718 (5’-GGA GGA TTT GGA AAT TGA TTA GTT CC-3’) and C1-N-2191 (5’-CCC GGT AAA ATT AAA ATA TAA ACT TC3’) (Simon et al. 1994), with PCR conditions adapted from Boykin et al. (2012) as in Section 2.2.2 (Chapter 2). The ITS region was amplified with the universal primers, ITS1 and ITS4, using a protocol adapted from White et al. (1990). The PCR cycling parameters were performed with an initial denaturation at 94°C for 90 sec, followed by 30 cycles of denaturation at 95°C for 50 sec, annealing at 55°C for 70 sec and extension at 72°C for 90 sec, and a final elongation step at 72°C for 3 min. For the mitochondrial 16S region, amplification was performed as described in Section 2.2.2 (Chapter 2). Sequencing was performed in both directions using the same primers sets as described in Section 2.2.3 (Chapter 2). 6.2.4 Phylogenetic relationships of green psyllids on citrus and Zanthoxylum sp. For the green psyllids, phylogenetic relationships were inferred through maximum likelihood (ML) analyses of the mitochondrial 16S and COI genes and the nuclear ITS region. Bactericera cockerelli (Šulc) (Hemiptera: Sternorrhyncha: Triozidae) was used as the outgroup in all analyses. Sequences were aligned using Muscle as enabled in MEGA (Version 6, Tamura et al. 2013). For the COI region, sequences were translated using the invertebrate mitochondrial code and the resulting protein alignment checked for stop codons within the sequences. Evolutionary analyses were conducted in MEGA with 1000 bootstrap replicates. Prior to each analysis, the appropriate evolutionary model was determined. For the COI gene, the General Time Reversible model (Nei & Kumar 2000) with a discrete gamma distribution ((6 categories (+G, parameter 0.5542)) and invariable sites was used to model the evolutionary rate among the sites. For 16S region, the ML tree was obtained using the Hasegawa-Kishino-Yano model (Hasegawa et al. 1985) with a discrete gamma distribution (6 categories (+G, parameter 0.4105)). The best evolutionary model was determined based on the lowest Bayesian Information Criterion (BIC) score 187 determined using MEGA6. For the ITS region, the ML analysis used the Tamura 3parameter model (Tamura 1992) with a discrete gamma distribution (6 categories (+G, parameter 1.1435)) to model evolutionary rate differences among sites. 6.2.5 Detection of ‘CLas’ in green psyllids and their host plants 6.2.5.1 Development of primers for the wingless gene of the green psyllids The primers and probe of Manjunath et al. (2008), designed against the wg gene of Diaphorina citri, failed to amplify this gene from the Cornopsylla and Cacopsylla species. Therefore, a pair of primers, CaF and CaR, was designed based on the primers (DCF and DCR) of Manjunath et al. (2008) for Diaphorina citri. A second set of primers, WGCaF and WGCaR (Figure 6.1), was designed based on the primers (WGf and WGr) of Li et al. (2008). In both instances, primer design was informed by an alignment of the sequences of the wg gene of Cacopsylla brunneipennis (Edwards), Cacopsylla peregrina (Förster), and Cacopsylla pyri (Förster) (Thao et al. 2000). The new primers were checked by conventional PCR using DNA templates from Cacopsylla heterogena, the undescribed Cacopsylla sp. and Cornopsylla rotundiconis. The primer pair, WGCaF and WGCaR, which amplified the wg gene of the Cacopsylla species, was selected for use in real-time PCR. For real-time PCR, the new primer pair was multiplexed with the primers for ‘CLas’ and with the TaqMan probes for wg (Li et al. 2008) and for ‘CLas’ (Li et al. 2006). The Taqman probe for wg was labelled at the 5’ terminal with tetrachlorofluorescein (TET) reporter dye and the 3’ terminal labelled with Black Hole Quencher (BHQ-1) (Biosearch technologies). The ‘CLas’ probe was labelled with 6-carboxy-fluorescein (FAM) and BHQ-1. Primers, WGCaF, and WGCaR, do not amplify the wg gene from Diaphorina spp.; therefore, when DNA from Diaphorina spp. was amplified, the primers and probe of Manjunath et al. (2008) were used. 188 Figure 6.1. Sequences of primers and probes used for the amplification of the wingless (wg) gene of the citrus green psyllids based on the primers (WGf and WGr) designed by Li et al. (2008) and the sequences from Cacopsylla spp. Primer (WGf & WGr; WGCaF & WGCaR) and probe (WGp) regions are underlined, and the direction of amplification is indicated using arrows. Bases identical to Diaphorina citri in the Cacopsylla sequences are represented by dots. 6.2.5.2 Collection of psyllid and plant samples for detection of ‘CLas’ and detection procedures The Cacopsylla and Cornopsylla spp. were collected from different altitudes in five dzongkhags (Table 6.3). Although all three species of green psyllids were observed in 2013, only samples collected in 2015 and 2016 were used for the detection of ‘CLas’. Samples of Cornopsylla rotundiconis Lou, Li, Li & Cai (Hemiptera: Sternorrhyncha: Psyllidae) and the undescribed Cacopsylla sp. were included in this analysis even though the WGp probe does not bind with DNA from Cornopsylla rotunidiconis; hence, there is no internal amplification control for this psyllid. Psyllid DNA was extracted using REDExtract-N-Amp™ Plant PCR Kit (SigmaAldrich) as described in Section 3.2.4 (Chapter 3). Detection of ‘CLas’ was also performed for host plants collected from locations where psyllid specimens were collected, especially where the plants appeared symptomatic. The plant samples included mandarin, sweet orange, lemon, lime and an unidentified Zanthoxylum sp. Midribs and petioles of leaves were excised and preserved in 100% ethanol within 1–2 d of collection, transported to Western Sydney 189 University and stored at −20°C until further use. Before DNA extraction, samples were placed on autoclaved paper towel and air dried for 5 min. Then ~0.20 g aliquots of tissue were chopped into small pieces (1–2 mm) with disposable blades and placed in bead beating-tough, 2 mL tubes (MO BIO Laboratories Inc. supplied by Genworks) each containing a 6.35 mm chrome steel beating bead (Daintree Scientific). The tubes with the samples and the beating beads were then placed in liquid nitrogen for 30 sec before placing in a tissue lyser (FastPrep). Leaf tissues were ground at 4 m/sec for 20 sec. DNA from plant samples were then extracted using ISOLATE II Plant DNA kit (BIOLINE) following the manufacturer’s instructions with slight modifications. The pre-lysis incubation was performed at 65°C for 30 min instead of 10 min. The lysis buffer, PA2, was used for all extractions. Procedures for ‘CLas’ detection and result interpretation were performed in the same manner as described in Section 3.2.5 (Chapter 3) except for the primers and probes used for amplification. For the psyllid assays, the psyllid sample is deemed to be ‘CLas’ positive if the FAM Ct value is within the range of 0.00 < FAM Ct ≤ 32, ‘CLas’ is not detected in the sample if the FAM Ct is zero, and the result for the sample is inconclusive if the FAM Ct value is in the range of 32 < FAM Ct ≤ 40. All assays included non-template (NTC) and positive controls. For the psyllid assays, samples of Diaphorina citri previously determined to be ‘CLas’-positive were used as positive controls using the primers and probes for the wg gene designed by Manjunath et al. (2008) multiplexed with primers and probes for ‘CLas’ designed by Li et al. (2006). Similarly for plants, the positive controls comprised samples previously confirmed as positive. Additionally, for the plant sample assays, extraction controls consisting of DNA extracted from apple or peach leaf midribs were included. For plant assays, the sample is ‘CLas’ positive if the FAM Ct value is greater than zero but less than or equal to 36. Samples that showed Ct values greater than zero were further subjected to conventional PCR using primers, A2 & J5 (Hocquellet et al. 1999). Successful amplifications were sequenced in both directions at Macrogen using the same primer set. 190 Table 6.3. Locations where Cacopsylla heterogena was collected in 2015 and 2016 for detection of 'CLas'. Locations* GPS coordinates Altitude Host (m ASL) Chhukha Khuengkha, Dagana Menchuna, Drujegang Patala, Drujegang Thangna, Drujegang Punakha Nobgang Talo-Walakha Road 1 Talo-Walakha Road 2 Thimphu Mendrelgang, Thimphu-Punakha Road Tsirang Drupchigang Mendrelgang RDC, Maenchhana Riserboo 'A' Riserboo Dzamling Zor 26.9335°N, 89.4322°E 1090 mandarin & lime 26.9802°N, 90.0129°E 26.9847°N, 90.0180°E 26.9870°N, 90.0326°E 1493 1496 1164 mandarin mandarin mandarin 27.5647°N, 89.8438°E 27.5403°N, 89.8521°E 27.5327°N, 89.8673°E 1985 1791 1419 mandarin mandarin mandarin 27.5248° N, 89.8323°E 1604 mandarin 27.0189°N, 90.1275°E 26.9517°N, 90.1041°E 26.9977°N, 90.1250°E 26.9532°N, 90.1347°E 26.9572°N, 89.1380°E 27.0243°N, 90.1198°E 1478 1182 1531 1436 1553 1386 mandarin mandarin mandarin, orange, lemon mandarin mandarin mandarin * Dzongkhag names are emboldened 191 6.3 Results 6.3.1 Morphological descriptions of green psyllids on citrus A species of green psyllid (Figure 6.2) was recorded on mandarin for the first time in Bhutan in April 2013 at Riserboo ‘A’, Mendrelgang Gewog, Tsirang Dzongkhag (26.9532°N, 90.1347°E, 1436 m ASL). The psyllid on the mandarins was identified as Cacopsylla heterogena Li (Li 1976) by Dr Susan Halbert (Division of Plant Industry, Florida Department of Agriculture and Consumer Services) and confirmed by Luo Xinyu (Department of Entomology, China Agricultural University). Later, psyllids identical to the one on mandarin were observed on lemons, limes, sweet oranges and wild citrus at altitudes ranging from 983–2444 m ASL (Table 6.2). 6.3.2 Psyllids on Zanthoxylum sp. Two further species of psyllids were observed on the species of Zanthoxylum (Figure 6.3) around the same time as the green psyllid was found on mandarin. The wings of the two species on Zanthoxylum appear more orange–yellow compared to the green psyllid on mandarin. In the field, the sizes of two species on Zanthoxylum appeared differed: one was observed to be larger than the other, and possessed exceptionally long antennae. The larger psyllid with long antennae was identified as Cornopsylla rotundiconis (Luo et al. 2012) (Figure 6.4) and the smaller one is an undescribed Cacopsylla sp. (Figure 6.5). 192 Figure 6.2. Cacopsylla heterogena: ovipositing female (A); eggs (B); nymphs (C); adult (D). (Photos: GAC Beattie). Figure 6.3. Leaves and fruits of the Zanthoxylum sp. from where Cornopsylla rotundiconis and the undescribed Cacopsylla sp. were collected. (Photos: N. Om). 193 Figure 6.4. Cornopsylla rotundiconis: adult male (A); slender nymph with honeydew (B) (Photos: N. Om). Figure 6.5. Unidentified Cacopsylla sp. from Zanthoxylum: young nymph with round and black abdomen (A); young nymph with round but not black abdomen (B); fifth instar nymph (C); adult female (D). (Photos: N. Om). 194 6.3.3 Phylogenetic analyses 6.3.3.1 Psyllid sequence analysis A BLAST search using the COI sequences obtained from Cornopsylla rotundiconis and the Cacopsylla spp. from the Zanthoxylum sp. showed that they have 84–88% identity with Cacopsylla fraudatrix Labina & Kuznetsova, Cacopsylla citrisuga, Cacopsylla myrtilli (Wagner) and Cacopsylla ledi (Flor), while the sequences of Cacopsylla heterogena have 99% identity with Cacopsylla citrisuga, 85% with Cacopsylla myrtilli and Cacopsylla ledi and 82–84% with Cacopsylla coccinea (Kuwayama), Cacopsylla pruni (Scopoli), Cacopsylla picta (Förster), and Cacopsylla pyricola (Förster). The 16S sequences obtained for the psyllids in the current study have 90–93% identity with Cacopsylla chinensis (Yang & Li), Cacopsylla qianli (Yang & Li), Cacopsylla pyrisuga (Förster) and Psylla lanceolata Yang. Only a few ITS sequences were obtained from the Bhutanese psyllids on mandarin and Zanthoxylum. Some of the ITS sequences obtained were found to be ~98% identical to strains of Cladosporium and Davidiella (Cladosporiaceae: Capnodiales) but with only ~30% sequence coverage. Attempts at sequencing the ITS region of psyllids using DNA extracted via a destructive method did not improve the sequencing results. A BLAST search using data from successful sequencing of the ITS regions of Cacopsylla heterogena, Cacopsylla citrisuga and the undescribed Cacopsylla sp. only had similarity to the ITS2 region of Cacopsylla pyricola with 74–76% identity and 50–71% sequence coverage, and ITS2 and 28S of Cacopsylla fulguralis (Kuwayama) with 73–76% identity and 62–64% sequence coverage. The ITS sequence from Cornopsyla rotundiconis showed 69–70% identity and 56% sequence coverage to the ITS2 and 28S region of Cacopsylla pyricola. For the Cacopsylla citrisuga accessions, one of the extracts made in this study and the DNA extracted in China produced amplicons for all three regions. For all three regions of all three psyllid species, the sequences obtained were compared with appropriate sequences in GenBank (Table 6.4). 195 Table 6.4. List of GenBank accessions of psyllids used for molecular phylogeny. Species Genetic regions COI Bactericera cockerelli 16S Beard & Bulman (unpublished) KF623528 Swisher & Crosslin (2014) AY971914 Bactericera cockerelli KM206147 Liu et al. (2006) Oettl & Schlink (2015) AB363711 Cacopsylla chinensis Cacopsylla citrisuga ITS KC008074 Bactericera cockerelli Cacopsylla affinis References Lee et al. (2007) KJ850285 Wang et al. (2015) Cacopsylla citrisuga KJ850304 Wang et al. (2015) Cacopsylla coccinea KP245955 Que et al. (2016) Cacopsylla fraudatrix JX987969 Kuznetsova et al. (2012) KF305121 Cacopsylla fulguralis Peccoud et al. (2013) Cacopsylla ledi JX987974 Kuznetsova et al. (2012) Cacopsylla melanoneura FJ648818 Malagnini et al. (unpublished) Cacopsylla myrtilli KR044343 Gwiazdowski et al. (2015) Cacopsylla myrtilli JX987981 Kuznetsova et al. (2012). Cacopsylla myrtilli KF494331 Nokkala et al. (2013) Cacopsylla picta KM206184 Oettl & Schlink (2015) 196 Genetic regions Species COI Cacopsylla pruni KM206191 Cacopsylla pyricola JF327670 Cacopsylla pyricola KP843860 16S Referemce ITS Oettl & Schlink (2015) JF327721 Kang et al. (2012) Zohdi & Hossini (unpublished) Cacopsylla pyrisuga AB721003 Katoh et al. (2013) Cacopsylla qianli AB363717 Lee et al. (2007) Psylla lanceolata AB363700 Lee et al. (2007) 197 Table 6.5 shows the sequence analysis for the different genetic regions of the psyllids. The range of sequence lengths obtained were 447–514, 413–514, and 889– 1079 bp for COI, 16S rDNA and the ITS regions, respectively. Greatest sequence divergence between the ingroup and the outgroup was obtained for the ITS region (21.79–37.22%). Within the Cacopsylla heterogena accessions, the 16S region showed greater sequence divergence (0.00–1.40) than in the COI (0.00–0.60) and ITS (0.00–1.00) regions. The sequence divergence between Cacopsylla heterogena and Cacopsylla citrisuga was higher in the 16S and COI regions than in the ITS region. For Cacopsylla heterogena, the intraspecific sequence divergence overlaps that of the interspecific sequence divergence between Cacopsylla heterogena and Cacopsylla citrisuga for all three genes. As for Cacopsylla citrisuga, the intraspecific sequence divergence is lower than the interspecific divergence for the 16S and ITS regions, but overlaps with the interspecific sequence divergence for COI. For all three genetic regions, the highest sequence divergence was obtained between Cacopsylla heterogena and Cornopsylla rotundiconis, and the lowest divergence between Cacopsylla heterogena and Cacopsylla citrisuga. Alignment of translated sequences of COI region did not show any stop codons within the sequences. The number of amino acid differences between Cacopsylla heterogena and Cacopsylla citrisuga for COI was between 0.00–1.00, between Cacopsylla heterogena and the undescribed Cacopsylla sp. was 2.00–3.00, with nine amino acid differences occurring between Cornopsylla rotundiconis and Cacopsylla heterogena (Table 6.5). 198 Table 6.5. Sequence analysis of psyllids. Analysis Genetic regions COI 16S ITS Range of sequence length 447–514 413–514 889–1079 Number of variable sites 201 160 426 Number of parsimonious informative sites 163 84 194 18.58–21.94 15.34–19.11 21.79–37.22 Range of sequence divergence within Cacopsylla heterogena (%) 0.00–0.60 0.00–1.40 0.00–1.00 Range of sequence divergence within Cacopsylla citrisuga (%) 0.00–0.66 0.22 0.10 Range of sequence divergence between Cacopsylla heterogena & Cacopsylla citrisuga (%) 0.24–0.88 0.63–1.32 0.20–0.80 Range of sequence divergence between Cacopsylla heterogena &Cacopsylla sp. from Zanthoxylum (%) 10.74–11.98 5.30–5.70 7.33–10.07 Range of sequence divergence between Cacopsylla heterogena & Cornopsylla rotundiconis (%) 16.50–17.84 9.62–10.83 10.52–12.85 0.00 N/A N/A Number of amino acid difference within Cacopsylla citrisuga 0.00–1.00 N/A N/A Number of amino acid difference between Cacopsylla heterogena & Cacopsylla citrisuga 0.00–1.00 N/A N/A Number of amino acid difference between Cacopsylla heterogena & Cacopsylla sp. from Zanthoxylum 2.00–3.00 N/A N/A 9.00 N/A N/A Range of sequence divergence between in-group & Bactericera cockerelli (%) Number of amino acid difference within Cacopsylla heterogena Number of amino acid difference between Cacopsylla heterogena & Cacopsylla rotundiconis N/A = no analysis 199 6.3.3.2 Phylogenetic relationships of psyllids derived from the mitochondrial COI gene Figure 6.6 shows the phylogenetic relationships of green psyllids based on the COI gene. The analysis resulted in the following clades.  A clade comprising the Cornopsylla rotundiconis adults and the slender nymphs (Figure 6.4 & Table 6.1) from the Zanthoxylum sp. (Figure 6.3) that forms a sister clade to the other clades that comprise the Cacopsylla species.  The Cacopsylla species form the following clades: o A weakly supported clade containing Cacopsylla pyricola. o A second clade consisting of Cacopsylla affinis (Low), Cacopsylla melanoneura (Förster), Cacopsylla pruni, Cacopsylla picta, Cacopsylla coccinea, Cacopsylla fraudatrix, Cacopsylla myrtilli and Cacopsylla ledi. o A third clade further separating into three subclades. The first contains nymphs that had black (RBA) and non-black abdomens (RNBA) and the adults of the undescribed Cacopsylla sp. (Figure 6.5 & Table 6.2) collected from Zanthoxylum. The second subclade comprising the adults and nymphs of Cacopsylla heterogena (Figure 6.2 & Table 6.2) collected from mandarin and wild citrus. The final subclade contains Cacopsylla citrisuga from Yunnan, China and two GenBank accessions of the same species corresponding to the haplotypes, C1 and C2, of Wang et al. (2015). 6.3.3.3 Phylogenetic relationships of psyllids derived from the 16S gene Figure 6.7 shows the phylogenetic relationships of psyllids based on the 16S region. The followings clades are formed:  A basal clade consisting of Cacopsylla chinensis.  A clade consisting of Psylla lanceolata and Cacopsylla pyrisuga.  A clade comprising accessions Cornopsylla rotundiconis collected from Zanthoxylum sp. with Cacopsylla qianli as a sister member to the clade.  A clade that formed three subclades with the first consisting of accessions of the Cacopsylla sp. collected from the Zanthoxylum sp. The other two subclades were closely related with one consisting of the Cacopsylla heterogena 200 accessions from Bhutan and the other comprising the accessions of Cacopsylla citrisuga from China. The nymphs of each species of psyllid grouped within the same clade as that of the adults. 6.3.3.4 Psyllids phylogeny based on the ITS region The phylogenetic analysis of the psyllids based on the ITS region is shown in Figure 6.8. The analysis resulted in a basal clade (A) comprising the accessions of Cornopsylla rotundiconis and a second clade that further divides into three subclades (B–D): B comprising Cacopsylla fulguralis and Cacopylla pyricola; C containing the unidentified Cacopsylla species from the Zanthoxylum sp. from Bhutan; and D a poorly resolved clade containing Cacopsylla citrisuga and Cacopsylla heterogena. The analysis was repeated with a reduced data set comprising only the accessions of Cacopsylla citrisuga and Cacopsylla heterogena (Figure 6.9) with an accession of the undescribed Cacopsylla sp. used as the outgroup. In this analysis, the sequences from Cacopsylla citrisuga grouped within the sequences from Cacopsylla heterogena. 201 Figure 6.6. Phylogenetic analysis based on the COI gene of psyllids derived using maximum likelihood based on the General Time Reversible model (Nei & Kumar 2000). A discrete gamma distribution was used to model evolutionary rate differences among sites (6 categories (+G, parameter = 0.5479)). The rate variation model allowed for some sites to be evolutionarily invariable ([+I], 55.5942% sites). The tree with the highest log likelihood (-3047.7307) is shown. The percentage of trees in which the associated taxa clustered together is shown next to the branches. Accession numbers are in parentheses following each taxon. 202 Figure 6.7. Phylogenetic analysis of the 16S rDNA region derived using maximum likelihood based on the Hasegawa-Kishino-Yano model of evolution (Hasegawa et al. 1985). A discrete gamma distribution was used to model evolutionary rate differences among sites (6 categories (+G, parameter 0.4105)). The tree with the highest log likelihood (-1859.4981) is shown. The percentage of trees in which the associated taxa clustered together is shown next to the branches. Accessions obtained from GenBank are shown with their accession numbers in parentheses. 203 Figure 6.8. Phylogenetic analysis based on the ITS region of psyllids inferred by maximum likelihood based on the Tamura 3-parameter model (Tamura 1992). A discrete gamma distribution was used to model evolutionary rate differences among sites (6 categories (+G, parameter 1.1435)). The tree with the highest log likelihood (-4233.2235) is shown. The percentage of trees in which the associated taxa clustered together is shown next to the branches. GenBank accession numbers are given in parentheses after the taxon. Figure 6.9. Phylogenetic analysis of a reduced data set of the ITS region of the Cacopsylla species using the unidentified Cacopsylla species as the outgroup. The analysis used ML based on the Tamura 3-parameter model of evolution (Tamura 1992). The tree with the highest log likelihood (2042.2051) is shown. The percentage of trees in which the associated taxa clustered together is shown next to the branches. 204 6.3.4 Detection of ‘CLas’ in green psyllids and host plants 6.3.4.1 Primer development The wingless (wg) gene primers (DCF & DCR) and TaqMan probe designed by Manjunath et al. (2008) for Diaphorina citri failed to amplify the wg gene of the green psyllids from mandarin. The new primers, CaF and CaR, based on this region by aligning the sequences of wg genes of Cacopsylla brunneipennis, Cacopsylla peregrina, and Cacopsylla pyri (Thao et al. 2000) also failed to produce an amplicon for Cacopsylla heterogena and Cacopsylla sp. from Zanthoxylum. Another set of primers (WGCaF & WGCaR) based on different positions within the wingless gene of Diaphorina citri used by Li et al. (2008) were then designed. This primer set amplified DNA from both Cacopsylla heterogena and Cacopsylla sp. but not Cornopsylla rotunidconis by conventional PCR. Similarly, when used in conjunction with the TaqMan probe designed by Li et al. (2008), the wg gene was also amplified by real-time PCR using DNA from the Cacopsylla species but not from Cornopsylla rotunidconis. 6.3.4.2 Detection of ‘CLas’ in Cacopsylla heterogena and host plants A total of 66 and 141 psyllid DNA extracts comprising of 262 and 447 psyllids collected in 2015 and 2016, respectively, were tested for ‘CLas’ (Table 6.6). Of the extracts made from individuals collected in 2015, only two samples of adults showed a FAM (the fluorophore for ‘CLas’) Ct value in the range of 0.00 < FAM Ct ≤ 32; the remainder were HLB negative. For insects collected in 2016, only four samples of adults had FAM Ct values within the range of 0.00 < FAM Ct ≤ 32. The lowest Ct values obtained were 32.98 and 30.13 for collections made in 2015 and 2016, respectively. The Ct range for ‘CLas’ (FAM) positive controls was 19.82–20.30 for 2015 and 17.43–21.34 for the 2016 samples. The Ct range for the internal control of the psyllid gene (TET) was 20.53–23.91 and 20.66–22.72 for 2015 and 2016 samples, respectively. Among the samples that showed FAM Ct values in the range of 0.00 < FAM Ct ≤ 32, one sample from a composite of five adults collected in 2016 (FAM Ct = 30.13) was amplified and successfully sequenced with the primers A2/J5. 205 A BLAST search using this sequence showed 99% identity and sequence coverage with ‘CLas’ isolates from China, India and Iran among others. Table 6.7 shows the results of PCR tests for ‘CLas’ detection in plant species and varieties on which Cacopsylla heterogena was collected. The host plants tested included mandarin, sweet orange, lemon and lime. Seventeen of the 24 plant samples tested showed FAM Ct values in the range of 0.00 < FAM Ct ≤ 36, i.e., they were HLB positive. The FAM Ct range for the 17 samples was 17.45–35.06. The lowest FAM Ct (17.45) was obtained from a mandarin sample collected at 933 m ASL in the Samtse Dzongkhag. The highest FAM Ct value was obtained from one of samples collected from Talo at 2444 m ASL, and is the only sample that showed a FAM Ct value above 36. The positive controls showed a FAM Ct range of 18.89– 21.55 while all extraction controls had FAM Ct values equal to zero. The CAL Ct value (plant internal control) ranged between 19.70−32.76. 6.2.1.1 Detection of ‘CLas’ in Zanthoxylum sp. and its psyllids A total of 30 extracts made from either single individuals or composites (5 individuals) of the undescribed Cacopsylla sp. and 20 extracts from either 1 or 5 adults were used. Extracts of nymphs of Cornopsylla rotundiconis were also included that consisted of composites of five nymphs per extract. Results of samples obtained from a Zanthoxylum sp. that exhibited blotchy mottled symptoms and its psyllids tested for ‘CLas’ are shown in Table 6.8. The Zanthoxylum sp. samples show a FAM Ct range of 20.98–23.18 with a corresponding CAL Ct range of 16.76– 21.83. These same samples were subjected to cPCR similar to other samples with FAM Ct ≤ 36 but did not produce an amplicon. All samples of the undescribed Cacopsylla sp. and Cornopsylla rotundiconis adults and nymphs resulted in FAM Ct values equal to zero. The wg primer and probe sets designed for Cacopsylla species do not amplify the DNA of Cornopsylla rotundiconis; hence, internal control Ct values are not available. 206 Table 6.6. Screening of Cacopsylla heterogena collected in 2015 and 2016 in Bhutan for the presence of ‘CLas’ by real-time PCR. Parameters Year of collection 2015 2016 Total number of nymphs included in the test1 123 262 Total number of adults included in the test2 139 185 Total number of psyllids tested 262 447 3 32.98–38.47 30.13–39.84* 0 0 2† 4* 19.82–20.30 17.43–21.34 Range of TET Ct for all samples 20.22–26.25 20.16–34.48** Range of TET5 Ct for positive control4 20.53–23.91 20.66–22.72 0 1 Range of FAM Ct > 0 Number of nymph samples with FAM3 Ct values in the range of 0.00 < FAM Ct ≤ 32 3 Number of adult samples with FAM Ct values in the range of 0.00 < FAM Ct ≤ 32 Range of FAM3 Ct for positive control4 5 Confirmation through sequencing6 1 21 extractions made with five nymphs per extractions, two extractions made with 6 and 12 nymphs per extraction, and 7 extracts with three nymphs in 2015. For 2016, five nymphs per extraction were used. All nymphs were mostly 4–5th instars; 2 Eighteen extracts with single adults per extraction; 28 extracts with 5 psyllids per extraction in 2015. In 2016, forty five extracts with 5 adults per extract & 55 extracts with single adults were made; 3 'CLas' DNA ; 4 Range taken from different test runs; 5 Psyllid DNA (internal control); 6 Samples with FAM Ct values in the range of 30 ≤ FAM Ct ≤ 36 were subjected to conventional PCR with A2/J5 primers (Hocquellet et al. 1997) and successful amplifications sequenced; † Ct values obtained for extracts made from 5 adults per extraction; * Samples from Talo-Walakha Road 2 (Table 6.3); ** 1 nymph sample (composite of five 4-5th instar nymphs), from RDC Maenchhana, Tsirang, with a ‘CLas’ Ct value of 34.48. 207 Table 6.7. Detection of 'CLas' in host plants of Cacopsylla heterogena. Locations1, 2 GPS coordinates Altitude Host plant3 Ct value range (m ASL) FAM CAL Chhukha Khuengkha 26.9335°N, 89.4322°E 1090 mandarin (1) 33.53 27.74 26.9335°N, 89.4322°E 1090 lime (1) 22.01 26.16 Menchhuna, Drujegang 26.9802°N, 90.0129°E 1493 mandarin (2) 32.37–33.87 22.72–23.34 Patala, Drujegang 26.9847°N, 90.0180°E 1496 mandarin (2) 0.00–35.06 24.72–28.48 below Pangna, Drujegang 26.9748°N, 90.0550°E 983 mandarin (1) 20.26 26.18 27.5516°N, 89.8238°E 2444 mandarin (5)4 31.56–37.87 21.31–32.76 27.5327°N, 89.8673°E 1419 mandarin (5) 4 17.54–23.96 20.50–24.26 26.9032°N, 89.2911°E 933 mandarin (1) 17.45 23.04 RDC, Maenchhana 26.9977°N, 90.1250°E 1531 lemon (5)5 0.00–25.10 23.32–26.33 RDC, Maenchhana 26.9977°N, 90.1250°E 1531 sweet orange (1) 0.00 23.66 Positive controls 18.89–21.55 19.70–22.72 Extraction controls (peach) 0.00 24.84–27.11 Dagana Punakha Talo Talo-Walakha Road 2 Samste Tsirang 1 District names are emboldened: 2 Cacopsylla heterogena nymphs/adults from Pangna, Talo and Samste were not evaluated for ‘CLas’: they were too few or, for nymphs, too small (first and second instars). Adults from Talo-Walakha Road 2 were ‘CLas’ +ve. Nymphs/adults from the other locations were ‘CLas’ –ve; 3 Number of samples (petioles or midribs) tested are given in parentheses; 4 All samples showed Ct values > 0.00; 5 One out of five samples showed a Ct value > 0.00 208 Table 6.8. Detection of 'CLas' in Zanthoxylum sp., Cacopsylla sp. and Cornopsylla rotundiconis. Sample type1 Ct value FAM CAL 20.98 & 23.18 16.76 & 21.83 25.77 21.49 Plant 1. Zanthoxylum sp. Positive control Psyllids Number of extracts based on: single adults 5 adults 5 nymphs Ct value FAM TET2 15 15 0 0.00 N/A 11 9 5 0.00 N/A Positive control3 21.86 N/A Positive control4 30.19 22.32 2. Cacopsylla sp. 3. Cornopsylla rotundiconis 1 Zanthoxylum mid-rib samples were collected from Dangreyboog, Dunglagang Gewog, Tsirang in July 2014, and psyllid samples were collected in May 2014 and July 2015; 2 WGCaF and WGCaR primers with WGp TaqMan probe of Li et al. (2008); 3 Diaphorina citri sequenced extract; 4 Cacopsylla heterogena extract that was sequenced (Table 6.7). N/A = not applicable 209 6.4 Discussion 6.4.1 Phylogeny of psyllids The mitochondrial COI and the 16S rDNA genes and the ITS region of the nuclear DNA were used to determine the phylogenetic relationships of species of green psyllids recorded on Rutaceae in Bhutan. In the molecular phylogeny of closely related individuals, it is important to have a lower sequence divergence within species compared to that between species to delimit the species (Meyer & Paulay 2005; Roe & Sperling 2007), and many studies have shown this (Tang et al. 1996). In the current study, pairwise sequence divergence comparisons (Table 6.5) show that the sequence divergence in the 16S and ITS regions within Cacopsylla citrisuga is lower than the sequence divergences between Cacopsylla heterogena and Cacopsylla citrisuga. However, for the COI gene, the intra-specific sequence divergence overlaps that of the inter-specific divergence between Cacopsylla citrisuga and Cacopsylla heterogena. Similarly, the intra-specific sequence divergences of Cacopsylla heterogena overlap the range of inter-specific sequence divergences between Cacopsylla citrisuga and Cacopsylla heterogena in all three of the genetic regions examined. Intra-specific variation is said to vary from species to species ranging from no variation in some species to significant variation in others (Tang et al. 1996). The overlap of intra- and interspecific sequence divergence has been observed in the ITS region of the species complex of the black fly Simulium damnosum Theobold (Diptera: Simuliidae) (Tang et al. 1996), in mitochondrial and nuclear genes in the families of Coleoptera, Diptera, Hemiptera, Hymenotera, Isoptera, Lepidotera and Phthiraptera (Cognato 2006), in the COI gene of the whitefly Bemisia tabaci (Gennadius) (Hemiptera: Sternorrhyncha: Aleyrodidae) (Boykin et al. 2007) and in the COI-COII region of 23 species of Lepidoptera and Diptera (Roe & Sperling 2007). Therefore, such an observation in the current data is not unusual. The results of the phylogenetic analyses show that the green psyllids collected from different locations in Bhutan (Table 6.2) could be placed in one of three taxa. In the analyses of all three genetic regions, Cornopsylla rotundiconis from the species of 210 Zanthoxylum always formed a clade that was sister to the clades containing the undescribed Cacopsylla sp. also from Zanthoxylum and Cacopsylla heterogena found on Citrus spp. In addition, all Bhutanese accessions of Cacopsylla grouped separately from all other Cacopsylla spp. whose sequence data have been placed in GenBank. Analyses of the two mitochondrial genes seem to indicate that Cacopsylla citrisuga and Cacopsylla heterogena are separate species, as separate clades containing these two species were obtained. However, in the analysis of the ITS region (Figures 6.8 & 6.9), Cacopsylla citrisuga grouped together with Cacopsylla heterogena within one clade. Hence, it is possible that these two taxa represent closely related species. However, both the genetic distances and the phylogenetic analysis of the ITS region call into question the separation of these two species. The incongruence in the analyses of the mitochondrial and the nuclear genes may be due to at least two possibilities. Firstly, it is possible that Cacopsylla citrisuga and Cacopsylla heterogena may either belong to one species or to a species complex. A species complex is a group of ‘closely related isolates whose individual members may represent more than one species’ (Fegan & Prior 2005). Species complexes are known to exist in several insect species including true fruit fly (Diptera: Tephritidae) species such as Bactrocera dorsalis (Hendel) (Augustinos et al. 2014). Augustinos et al. (2014) raised uncertainties about the actual number of species recognised in this species complex. Similarly, Schutze et al. (2015) argued that three Bactrocera species namely, Bactrocera dorsalis, Bactrocera invadens Drew, Tsuruta & White and Bactrocera papayae Drew & Hancock are the same species. Species complex problems are reported in the hermit beetles wherein the species, Osmoderma eremita (Scopoli) (Cleoptera: Scarabaeidae), includes at least two or more species (Audisio et al. 2009). Both Cacopsylla citrisuga and Cacopsylla heterogena are described from Yunnan Province in China. Cacopsylla citrisuga (syn. Psylla citrisuga) was first recorded in 1981 from Baoshan (25.1138°N, 99.1618°E, 1680 m ASL), Tengchong (25.0219°N, 98.4911°E, 1650 m ASL) and Ruili (24.0138°N, 97.8519°E, 750 m ASL) in western Yunnan (Yang & Li 1984). Cacopsylla heterogena was recorded in 1990 and described in 2011 from Wulongxiang (24.6119°N, 104.2921°E, 952 m ASL) in eastern Yunnan (Li 2011). Cacopsylla citrisuga is reported on pumelo 211 (cited as Citrus grandis) and citron (Citrus medica) (Yang & Li 1984), while Li (2011) found Cacopsylla heterogena on the same host plants (cited as ‘Citrus sp. (Rutaceae). In Bhutan, Cacopsylla heterogena was first observed in 2013 at 1260 m ASL and, since then, has been observed at altitudes ranging from 983–2444 m ASL (Table 6.2) in five dzongkhags. The other dzongkhags have not been surveyed yet, but it will not be surprising if this insect has a wider distribution. Cacopsylla heterogena in Bhutan is found on mandarin, lemon, lime, and sweet orange (pers. observation), and wild citrus (Beattie, pers. comm.), nominally a hybrid of Citrus cavaleriei (see Chapter 7). Hence, both in Bhutan and Yunnan, the two species are found in the same regions and on the same range of host plants. In addition to occurring in similar locations, according to Li (2011) Cacopsylla heterogena is also morphologically similar to Cacopsylla citrisuga except that Cacopsylla heterogena has shorter antennae. Molecular study of Cacopsylla citrisuga is limited to that of Wang et al. (2015) who reported the existence of two haplotypes of this species in Yunnan, one from Ruili in the west and the other from near Shiping (23.7073°N, 102.4944°E, 1444 m ASL) to the east. The two haplotypes are separated with moderate bootstrap support (63%) in an analysis of the COI region (Wang et al. 2015). Data from both haplotypes are shown in Figure 6.6 of my study, and show that there is at least a third haplotype in Yunnan. Hence, there is genetic variation within the COI gene from Cacopsylla citrisuga, and it is possible that the variation found in Cacopsylla heterogena forms part of this variation. As for Cacopsylla heterogena, there is no other record of molecular work, and my study is the first study to determine its relationship with Cacopsylla citrisuga and other psyllid species. A second explanation for the observed difference in the present data could be introgressive hybridisation. Introgression through hybridisation is defined as the introduction of genes from one species into another resulting in hybrid offspring that interbreed with one of the parental species (Baum & Smith 2013). Introgression of genes (either in mtDNA or nuclear genome) has been observed in many animal species ranging from salamanders (Amphibia: Salamandridae) (Canestrelli et al. 212 2014) and cichlid fishes (Perciformes: Cichlidae) (Nevado et al. 2011) to Drosophila species (Diptera: Drosophilidae) (Herrig et al. 2014) and mosquitoes (Diptera: Culicidae) (Crawford et al. 2015). Therefore, it is possible that if Cacopsylla citrisuga and Cacopsylla heterogena are, indeed, different species, the incongruence in the analysis of the nuclear and mitochondrial genes could be due to hybridisation between the species. As mentioned earlier, both Cacopsylla heterogena and Cacopsylla citrisuga occur in Yunnan. Therefore, it is possible that the place where the Cacopsylla citrisuga accessions used in the current study were obtained come from a contact zone where hybridisation between the two species could occur. Genes of Cacopsylla heterogena could have introgressed into Cacopsylla citrisuga leading to individuals with shared similarity in their nuclear genomes but with differing mitochondrial genes. Mixed populations of different psyllid species are known. Cacopsylla citricola often occurs as mixed populations with Cacopsylla citrisuga on pumelo and citron in China (Yang & Li 1984). This apparently occurs despite competition for the same ecological niche for oviposition and development of nymphs. Hence, mixed populations of Cacopsylla heterogena and Cacopsylla citrisuga could also occur. Therefore, based on the results of the current study, the status of whether Cacopsylla heterogena and Cacopyslla citrisuga are the same species, part of a species complex or different species cannot be established. There is limited sequence data available for Cacopsylla citrisuga and no sequences of the 16S and ITS regions of Cacopsylla citrisuga are available in GenBank. Further morphological work combined with molecular analyses using additional mitochondrial and nuclear markers and including samples of both Cacopsylla heterogena and Cacopsylla citrisuga from China and elsewhere are needed to compare with the Bhutanese accessions of Cacopsylla heterogena to elucidate the relationship between the two psyllids. 213 6.4.2 Detection of ‘CLas’ in Cacopsylla heterogena and host plants A total of 207 psyllid DNA samples sourced from 709 psyllids collected in 2015– 2016 were tested for the presence of ‘CLas’. None of the DNA samples from 123 nymphs and 139 adults collected in 2015 showed FAM Ct values in the range of 0.00 < FAM Ct ≤ 32. Thus, ‘CLas’ was not detected in these psyllids. In 2016, the pathogen was not in DNA samples from 262 nymphs but four samples out of 185 adults produced FAM Ct values in the range of 0.00 < FAM Ct ≤ 32. One of these samples, with a FAM Ct value of 30.13, was able to produce an amplicon by cPCR using the primers, A2 and J5 (Hocquellet et al. 1999). This amplicon was successfully sequenced and the data matched that from ‘CLas’ isolates from Bhutan, China, India and Iran with 99% identity and sequence coverage. The DNA was from five Cacopsylla heterogena adults collected on a seedling mandarin tree at 1419 m ASL on the Talo-Walakha Road 2 (Table 6.2) in the Punakha Dzongkhag. These results indicate that Cacopsylla heterogena nymphs cannot acquire ‘CLas’ but Cacopsylla heterogena adults may occasionally acquire the pathogen under some field conditions. Of the 24 plant samples tested, 20 showed FAM Ct values in the range of 0.00 < FAM Ct ≤ 36. The lowest values were obtained from mandarin collected from a location at 933 m ASL (Table 6.6), and the extracts from leaf midribs and petioles produced FAM Ct values ranging from 17.54 to 23.96 (Table 6.6). These positive samples were from trees (Table 6.2) representative of mandarin trees at all of the locations from which Cacopsylla heterogena was recorded and collected during the study. This suggests that ‘CLas’ may be present in most mature mandarin trees irrespective of their elevation above sea level. However, titres of the pathogen may be low, as trees with symptoms of the disease are uncommon above 1200 m. Nevertheless, my results suggest very low acquisition rates of ‘CLas’ by Cacopsylla heterogena, zero for nymphs and negligible for adults (~2%). This suggests that Cacopsylla heterogena may not transmit ‘CLas’. In contrast to my results for Cacopsylla heterogena, Cen et al. (2012a) detected ‘CLas’ in 41% of the late instar nymphs of Cacopsylla citrisuga using nested PCR. The trees where nymphs were 214 collected were also ‘CLas’ positive (Cen et al. 2012a). In 1992 in India, less than 1% of the Diaphorina citri tested were positive for ‘CLas’ (Bové et al. 1993); however, this may be a reflection of the assay method used. More recently, 8.6% and 9.7% of field-collected Diaphorina citri tested were positive for ‘CLas’ (Manjunath et al. 2008; Halbert et al. 2012). However, infection rates for this insect are usually higher with 38–100% of psyllids being HLB-positive in surveys in Florida (Coy & Stelinski 2015). In addition, ‘CLas’ was detected in about 40–75% of a psyllid population confined to infected plants for five to 12 weeks under laboratory conditions (Hung et al. 2004; Pelz-Stelinski et al. 2010). The figures given above for Diaphorina citri are based on much larger sample sizes, and titres of ‘CLas’ in mandarin trees in relation to titres within Cacopsylla heterogena needs to be examined more thoroughly. Razi et al. (2014) assayed single individuals of Diaphorina citri in Pakistan and found substantial seasonal variation in HLB-positive psyllids with infection rates varying from 0–25% in different months. Therefore, in addition to larger sample sizes, seasonal effects need to be taken into account in future surveys. Further studies are needed to determine whether Cacopsylla heterogena can transmit ‘CLas’, although my results indicate that the psyllid does not play a major role in the spread of HLB in Bhutan. 6.4.3 Detection of ‘CLas’ in Zanthoxylum sp., Cacopsylla sp. and Cornopsylla rotundiconis The Zanthoxylum sp. from which most of the samples of the undescribed Cacopsylla sp. and Cornopsylla rotundiconis were collected exhibited strong mottling symptom on the leaflets of one branch. The two samples of Zanthoxylum sp. examined did not produce any amplicon when subjected to conventional PCR although the FAM Ct values were lower than the ‘CLas’ positive control (Table 6.8). This suggests that the FAM Ct value obtained may be a false positive. 215 6.5  Highlights of the study: Three species of green psyllids occur in Bhutan, one on citrus and two on Zanthoxylum sp.  The green psyllids occurring on mandarin, wild citrus (Chapter 7), lemons, limes and oranges in Bhutan belong to one species, Cacopsylla heterogena.  The two psyllids collected from the Zanthoxylum sp. are confirmed as Cornopsylla rotundiconis, and the other is an undescribed species of Cacopsylla.  The taxonomic separation of the Cacopsylla citrisuga accessions from Yunnan, China and Cacopsylla heterogena from Bhutan needs to be confirmed to determine whether they are the same or distinct species.  Cacopsylla heterogena can acquire ‘CLas’ under field conditions.  There was no evidence of ‘CLas’ in Cornopsylla rotundiconis and Cacopsylla sp., the green psyllid species recorded on Zanthoxylum sp. 216 Chapter 7: Molecular and morphological characterisation of Murraya species and wild citrus taxa from Bhutan and their relevance to huanglongbing ____________________________________________________________________ 7.1 Introduction As described in the comprehensive list given in Chapter 1 of this thesis, a range of rutaceous plants has been reported to be hosts of ‘Candidatus Liberbacter asiaticus’ (‘CLas’). All Citrus species and cultivars are regarded as being susceptible to the pathogen although the severity of infections and manifestations of symptoms vary (Halbert & Manjunath 2004; Gottwald et al. 2007; Beattie & Barkley 2009; Ramadugu et al. 2016). Among citrus relatives, species of Murraya (sensu stricto) and curry leaf, Bergera koenigii (L.), are of particular concern as potential alternative hosts of the bacterium. Murraya paniculata (syn. Murraya exotica sensu Mabberley 2016) is a common and widely grown ornamental in temperate, subtropical and tropical regions of the world (the taxonomy of Murraya species is discussed below and in the discussion), and curry leaf occurs naturally in South Asia and is commonly cultivated in Asia and elsewhere for the culinary use of its leaves. Both species may be found in proximity to citrus and are hosts of Diaphorina citri, the principal, and most widely distributed, vector of ‘CLas’ (Aubert 2009; Hall et al. 2013). Early studies of Diaphorina citri reported the psyllid on Bergera koenigii (cited as Murraya koenigii) and Citrus species and hybrids in India (Lal 1917; 1918; Fletcher 1917; 1919; Husain & Nath 1924, 1927; Mathur 1975) and on Citrus (Kuwayama 1908) and Murraya paniculata in Taiwan (Maki 1915; Kuwayama 1931). Husain & Nath (1927) were the first to describe the serious impact of the psyllid on citrus production. They attributed impacts of the psyllid (small dry, insipid fruit, twig and branch dieback, and death of trees) to ‘some poison’ injected by the psyllid during feeding. The symptoms they described are now regarded as the first description of symptoms of huanglongbing (Beattie et al. 2009). The black psyllid, Diaphorina communis, has commonly been reported on Bergera koenigii and also on Murraya paniculata (Mathur 1975). Past studies have demonstrated that Murraya paniculata 217 can harbour ‘CLas’ and serve as an inoculum reservoir (Deng et al. 2007; Zhou et al. 2007; Lopes et al. 2010; Walter et al. 2012b; Ramadugu et al. 2016). Zhou et al. (2007) detected ‘CLas’ in Murraya paniculata transmitted through dodder (Cuscuta pentagona Engelm. (Solanales: Convolvulaceae), while Deng et al. (2007), Walter (2012a; 2012b), and Ramadugu et al. (2016) detected low-titres ‘CLas’ in Murraya paniculata as a result of field transmission by Diaphorina citri. Lopes et al. (2010) detected ‘CLas’ and ‘Candidatus Liberibacter americanus’ (‘CLam’) in Murraya paniculata growing in urban areas (Lopes et al. 2010). Walter et al. (2012a & b) hypothesised that low titres of ‘CLas’ in Murraya paniculata and in Diaphorina citri reared from Murraya paniculata could be due to a resistance trait in Murraya paniculata against the bacterium. Ramadugu et al. (2016) also considered Murraya paniculata to be resistant to ‘CLas’ with infections not persisting. Thus, infections in Murraya paniculata are transient. The systematics of Murraya exotica and Murraya paniculata has been debated since Linnaeus with the plants being described as Chalcas paniculata in 1767 and Murraya exotica in 1771 (Linnaeus 1767; 1771). They have been regarded as separate species by some authors (e.g., Stone 1985; Jones 1995; Huang 1997) and as synonyms by others (e.g., Tanaka 1929; Swingle & Reece 1967; Mabberley 1998). Recent morphological and molecular evidence (Nguyen 2011) suggests that plants classified as Murraya paniculata by Swingle & Reece (1967) belong to four distinct species: Murraya paniculata (syn. Murraya exotica), the widely cultivated form known as orange jasmine, orange jessamine and mock orange; Murraya elongata A. DC. ex Hook. f. (Hooker 1875), a taxon found on mainland Asia in India, across Indochina to the southern provinces of China, and on the Andaman Islands and the island of Langkawi in the Indian Ocean; Murraya sumatrana Roxburgh (Roxburgh 1832), with a west Malesian distribution; and Murraya heptaphylla Spanoghe (Spanoghe 1841) found in eastern Malesia and Australasia. Another species, Murraya gleniei Thwaites ex Oliv. (Oliver 1861), occurs in Sri Lanka (Swingle & Reece 1967; Mabberley 2016) and one other, Murraya alata Drake, with winged rachises occurs in southern China (Guangdong, Guangxi and Hainan) and Indochina (Drake 1892; Swingle & Reece 1967; Zhang et al. 2008). Nguyen (2011) included 218 six Murraya accessions from Brazil, three from California and two from Florida in his study. All of these accessions were Murraya paniculata (orange jasmine) which, despite studies reported by Damsteegt et al. (2010) and Lee et al. (2011) appears to be the only species of Murraya in the Americas aside from a University of California, Riverside accession of ‘Murraya ovatifoliolata var. ovatifoliolata’ from Woongarra (24.9016°S, 152.4232°E, 20 m ASL), Queensland, Australia In the early 1990s, Grierson (1991) recorded Murraya paniculata and Bergera koenigii (as Murraya koenigii) in the southern and eastern regions of Bhutan; no other records of Murraya species in Bhutan exist. However, in April 2014, during the course of this study, plants resembling Murraya elongata, a species described from Myanmar, were found in a citrus orchard at Baychhu (27.2975°N, 89.9669°E, 784 m ASL) and on the roadside of the Rinchending–Pasakha Highway at Reldri (26.8400°N, 89.4045°E, 400 m ASL) in Chukhha Dzongkhag. Adults of both Diaphorina citri and Diaphorina communis were observed on the Murraya plants in Baychhu. In April 2015, eggs and young nymphs of one or both psyllid species were observed on the plants in Baychhu. Sleeve cages were placed over the infested branches. All adult psyllids that emerged from nymphs after about 21 d were Diaphorina citri males and females. This represents the first record of Diaphorina citri on a species of Murraya native to the region where the psyllid evolved. Murraya paniculata (orange jasmine), on which Diaphorina citri was recorded in India in 1975 (Cheema & Kapur 1975), was introduced to the Indian Subcontinent from China before the 1800s (Edwards & Lindley 1819–1820; Roxburgh 1832). In October 2015, a wild citrus taxon growing near Wengkhar (27.2515°N, 91.2597°E, 2018 m ASL) in the Mongar Dzongkhag was observed to be infested with what was assumed to be nymphs of Cacopsylla heterogena (Beattie, pers. comm.) (Figure 7.1). Leaf damage resembling that caused by Cacopsylla heterogena on mandarins in Tsirang was also evident (Figure 7.1). Wild plants identical to that at Wengkhar were also observed in Basochhu in April 2016. The plants at Basochhu 219 had foliar damage caused by Cacopsylla heterogena (Beattie, pers. comm.) (Figure 7.2). Morphologically, the foliage and the fruit of the wild citrus appeared to be similar to Ichang papeda (Citrus cavaleriei H. Léveillé ex Cavalerie syn. Citrus ichangensis Swingle), but its foliage can be confused with foliage of Citrus latipes (Swingle) Tanaka as both species have large petioles. Swingle and Reece (1967) described the leaves of ‘Citrus ichangensis’ as narrow, 4–6 times longer than wide with large, broadly-winged petioles and those of Citrus latipes as ‘leaf blades more variable in size and shape and with the tips subacute or even bluntly rounded, not apiculate or subcaudate with blunt points as in Citrus ichangensis’. Striking differences between ‘Citrus ichangensis’ and Citrus latipes are observed in the flowers and the fruits. The flowers are borne singly in the leaf axils in ‘Citrus ichangensis’ while in Citrus latipes, flowers are borne in ‘small axillary racemes with 5–7 flowers’. The fruit peel of Citrus latipes is much thicker (5–6 mm) than that of ‘Citrus ichangensis’ (2–4 mm) (Swingle & Reece 1967). Grierson (1991) recorded Citrus latipes being present in Trongsa Dzongkhag in Bhutan. They described the leaves as ovate, 40–70 × 15–25 mm, acuminate, base rounded, margin minutely crenate-serrate, glabrous; petiole obovate, often larger than the lamina, 35– 70 × 20–30 mm, the flowers as solitary or in short racemes, 4-merous, and the fruit as subglobose, ca. 50 mm diameter, peel somewhat thick, segments ca. 9, seeds numerous. Penjor et al. (2014) reported that a wild citrus accession from Mongar was identical to Citrus latipes based on the matK gene but referred to the accession as an ‘Ichang relative’ based on the similar morphological characters between the wild citrus and ‘Citrus ichangensis’. In Bhutan, no information on the Murraya plants mentioned above existed at the start of this study other than the records by Grierson (1991). Grierson recorded one species of Murraya (sensu stricto) referring to it as Murraya paniculata (syn. Murraya exotica sensu Mabberley (2016)) and describing it as an evergreen shrub or tree to 6 m, leaves 120–150 mm, 3–7-foliolate; leaflets ovate, 50–100 × 20–50 mm, bluntly acuminate, base ± asymmetrically cuneate, margin entire, glabrous, inflorescence up to 20-flowered, berry ovate, ca. 8 × 5 mm. 220 Figure 7.1 Nymph of Cacopsylla heterogena on wild citrus at Wengkhar (top); leaf distortion caused by Cacopsylla heterogena on wild citrus at Wengkhar (bottom) (Photos: GAC Beattie). 221 Figure 7.2. Foliage of wild citrus at Basochhu (Photos: GAC Beattie). 222 In order to confirm the presence of Murraya elongata in Bhutan and to resolve the identity of the wild citrus plant, the first part of this chapter focuses on the molecular and morphological identification of the Murraya and wild citrus taxa found in Bhutan. Moreover, as outlined above, as Murraya paniculata is a transient host of ‘CLas’ and the host status of the other putative species of Murraya or wild citrus is unknown, the latter part of this chapter focuses on detection of ‘CLas’ in these accessions. Many molecular markers have been developed for phylogenetic studies. More commonly, the chloroplast genome (cpDNA) (Clegg & Zurawski 1992; Morton et al. 2003; Shaw et al. 2005; Bayer et al. 2009; Lu et al. 2011; Carbonell-Caballero et al. 2015) and the nuclear ITS regions (Sang et al. 1995; Kyndt et al. 2010; Li et al. 2010; Kumar et al. 2013; Yamaji et al. 2013; Hynniewta et al. 2014; Sun et al. 2015) of plants have been used. For the current study, five and four cpDNA markers for Murraya and the wild citrus, respectively, together with the nuclear ITS region were used to investigate the phylogenetic relationships among Murraya accessions and wild citrus accessions. The specific objectives of this chapter were to:  determine the phylogenetic relationships of species of Murraya occurring in Bhutan with those proposed by Nguyen (2011), and assess their morphological differences;  determine the phylogenetic relationships of the wild citrus species; and  test the Murraya species and wild citrus for ‘CLas’. 223 7.2 Materials and methods 7.2.1 Collection of Murraya accessions The plant samples used in the current study included nine accessions of Murraya from Bhutan and six from Yingde, Guangdong, China. The samples of Murraya from Bhutan were collected from: (1) a citrus orchard at Baychhu, Wangdue Phodrang Dzongkhag; (2) from the roadside of the Rinchending–Pasakha Highway at Reldri near Phuentsholing, Chukhha Dzongkhag; and (3) from Zangtopelri Park in Phuentsholing, Chukhha Dzongkhag. GPS coordinates of the localities are given in Table 7.1. Voucher specimens of all plants were collected, pressed and mounted on herbarium sheets. Fresh leaflets of plants corresponding to the pressed specimens were used for DNA extractions. DNA extractions were performed within 3−5 d of collection. Specimens from Yingde, China, were obtained as DNA for molecular analysis (Table 7.1). 7.2.1 Collection of the wild citrus Young leaves of the wild citrus species were collected for molecular studies from near Wengkhar, Mongar Dzongkhag in October 2015 by George Beattie, and then in April 2016 from Korilla also in the Mongar Dzongkhag by Tshering Penjor of the Research and Development Centre (RDC), Wengkhar. Leaves of seedlings cultivated from wild plants at Basochhu were obtained from RDC Maenchhana, Tsirang, in April 2016. Leaf samples were collected and preserved in 100% ethanol until being used for DNA extraction. GPS coordinates of the localities are given in Table 7.1. 7.2.2 DNA extractions from Murraya DNA extractions from plants were made at the Plant Pathology Laboratory of the National Plant Protection Centre (NPPC) in Bhutan. Extraction methods similar to Section 3.2.3 of Chapter 3 were used except whole leaf samples were used for the extraction of plant genomic DNA. For detection of ‘CLas’ from leaf samples, only mid ribs were used by excising the mid ribs with disposable razor blades. 224 Table 7.1. A list of Murraya samples collected from Bhutan and China and citrus samples from Bhutan used for molecular analysis in the current study. Abbreviations used: Bhutan (BT); Murraya (M); Phuentsholing (P/ling); RDC (Research & Development Centre); Wangdue (Wangdue Phodrang). Sample name Location GPS coordinates Elevation (m ASL) Species (based on the results of this study) MBT.1 Baychhu, Wangdue, BT 27.2975ºN, 89.9669ºE 784 Murraya elongata MBT.2 Baychhu, Wangdue, BT 27.2975ºN, 89.9669ºE 784 Murraya elongata MBT.3 Baychhu, Wangdue, BT 27.2975ºN, 89.9669ºE 784 Murraya elongata MBT.4 Baychhu, Wangdue, BT 27.2975ºN, 89.9669ºE 784 Murraya elongata MBT.5 Baychhu, Wangdue, BT 27.2975ºN, 89.9669ºE 784 Murraya elongata MBT.6 Reldri, P/ling, BT 26.8400ºN, 89.4045ºE 400 Murraya elongata MBT.7 Reldri, P/ling, BT 26.8400ºN, 89.4045ºE 400 Murraya elongata MBT.8 Reldri, P/ling, BT 26.8400ºN, 89.4045ºE 400 Murraya elongata MBT.9 Zangtopelri Park, P/ling, BT 26.8619ºN, 89.3827ºE 200 Murraya paniculata MCN.1 Yingde, China 24.2922°N, 113.3452°E 62 Murraya elongata MCN.2 Yingde, China 24.2922°N, 113.3452°E 62 Murraya elongata MCN.3 Yingde, China 24.2922°N, 113.3452°E 62 Murraya elongata MCN.4 Yingde, China 24.2922°N, 113.3452°E 62 Murraya elongata MCN.5 Yingde, China 24.2922°N, 113.3452°E 62 Murraya elongata MCN.6 Yingde, China 24.2922°N, 113.3452°E 62 Murraya elongata NCBT.1 near Wengkhar, Mongar, BT 27.2516°N, 91.2597°E 2018 unresolved NCBT.3 Rimchu, Punakha, BT 27.6677°N, 89.7667°E 1520 unresolved NCBT.5 Korilla, Mongar, BT 27.3108°N, 91.2961°E 2100 unresolved NCBT.7 RDC, Maenchhana, Tsirang, BT 26.9964°N, 90.1224°E 1502 unresolved NCBT.9 Basochhu, Wangdue, BT 27.3556°N, 89.8871°E 1929 unresolved 225 7.2.3 DNA extraction from the wild citrus For the wild citrus specimens, DNA was extracted from specimens preserved in 100% ethanol in the Postharvest Molecular Laboratory, Hawkesbury Campus, Western Sydney University. For extraction of plant genomic DNA, leaf tissue (~0.02 g) was washed in 2% bleach with Triton X-100 (five drops of Triton X-100 per 5 mL of 2% bleach) for 1 min with gentle vortexing, and rinsed three times with Milli Q water. For detection of ‘CLas’ only midribs (~0.20 g) were used. Leaf samples were cut into small pieces (1–2 mm) and placed in bead beating-tough, 2 mL tubes (MO BIO Laboratories Inc. supplied by Genworks) each containing a 6.35 mm chrome steel beating bead (Daintree Scientific). The tubes with the samples and the beating beads were then placed in liquid nitrogen for 30 secs before placing in a tissue lyser (FastPrep). Leaf tissues were ground using the tissue lyser at 4 m/sec for 20 sec. DNA was then extracted using either the DNeasy Plant Mini Kit (Qiagen) or the ISOLATE II Plant DNA Kit (Bioline). 7.2.4 Plant genomic DNA amplification Table 7.2 shows the primers used for amplification of the five chloroplast DNA (cpDNA) regions and the internal transcribed (ITS) region of the nuclear ribosomal DNA. For all regions, PCR reactions were performed using 2 µL of template DNA in 20–25 µL reaction volumes following the GoTaq® Flexi DNA polymerase (Promega) protocol, with final concentrations of 2.5 mM MgCl2, 0.24 mM dNTP mix (Bioline), 0.2 µg/µL BSA, 0.4 µM of each primer and 1.25 U of GoTaq Flexi DNA polymerase. For amplification of regions of Murraya and wild citrus specimens, the same primer sets were used except for the ITS regions. conditions for each genetic region were as follows. 226 PCR Table 7.2. List of primers used for the molecular analysis of Murraya and wild Citrus specimens from Bhutan. Target region Primer name (forward & reverse) Primer sequence (5’- 3’) Reference ITS ITS1 ITS4 TCC GTA GGT GAA CCT GCG G TCC TCC GCT TAT TGA TAT GC White et al. (1990) White et al. (1990) ITS AB101 AB102 ACGAATTCATGGTCCGGTGAAGTGTTC G TAGAATTCCCCGGTTCGCTCGCCGTTA C Robinson et al. (2001) Robinson et al. (2001) matK-5’trnK spacer trnK-3914F* matk5’R TGG GTT GCT AAC TCA ATG G GCA TAA ATA TAY TCC YGA AAR ATA AGT GG Johnson & Soltis (1994) Shaw et al. (2005) psbM-trnDGUCspacer trnDGUCR GGG ATT GTA GYT CAA TTG GT Shaw et al. (2005) psbMF AGC AAT AAA TGC RAG AAT ATT TAC TTC CAT Shaw et al. (2005) trnTUGUR AGG TTA GAG CAT CGC ATT TG Shaw et al. (2005) rps4R2 CTG TNA GWC CRT AAT GAA AAC G Shaw et al. (2005) ycf6R GCC CAA GCR AGA CTT ACT ATA TCC AT Shaw et al. (2015) CCA GTT CRA ATC YGG GTG Shaw et al. (2005) CGA AAT CGG TAG ACG CTA CG ATT TGA ACT GGT GAC ACG AG Taberlet et al. (1991) Taberlet et al. (1991) rpS4-trnT spacer trnCGCA-ycf6 GCA trnC F C F *renamed as matK6 in Shaw et al. (2005). trnL-trnL-trnF 227 7.2.4.1 ITS region For the Murraya specimens, this region was amplified with primers ITS1 and ITS4 using a protocol adapted from White et al. (1990). The PCR cycling parameters were performed with an initial denaturation at 94°C for 90 sec, followed by 30 cycles of denaturation at 95°C for 50 sec, annealing at 55°C for 70 sec and extension at 72°C for 90 sec, and a final elongation step at 72°C for 3 min. For the wild citrus specimens, the ITS region was amplified using primers AB101 and AB102 (Robinson et al. 2001; Li et al. 2010). PCR conditions for this primer pair were performed with an initial denaturation at 96°C for 2 min, followed by 30 cycles of denaturation at 96°C for 1 min, annealing at 60°C for 1 min and extension at 72°C for 2 min, and a final elongation at 72°C for 10 min (Li et al. 2010). 7.2.4.2 matK-5’trnK spacer This non-coding intron was amplified using primers, trnK-3914F (Johnson & Soltis 1994) (also referred to as matK6 by Shaw et al. (2005)) and matK5’R (Shaw et al. 2005). Reactions were performed following the protocol of Shaw et al. (2005): 80°C for 5 min, and 35 cycles of 95°C for 3 min, 50°C for 1 min, 72°C for 2 min followed by a final extension step at 72°C for 5 min. 7.2.4.3 psbM-trnDGUC spacer Primers psbMF and trnDGUCR (Shaw et al. 2005) were used to amplify this region. Amplification parameters were: 94°C for 5 min followed by 35 cycles of 94°C at 1 min, 55°C for 1 min, 72°C for 3.5 min, and a final step of 72°C for 5 min (Nguyen 2011). 7.2.4.4 rpS4-trnT spacer This region was amplified with primers trnTUGU and rpS4 (Shaw et al. 2005) with PCR conditions of 92°C for 3 min, followed by 30 cycles of 92°C for 1 min, 55°C for 1 min, 72°C for 3 min, and a final elongation at 72°C for 7 min (Nguyen 2011). 228 7.2.4.5 trnCGCA-ycf6 region PCR conditions were set with an initial denaturation step at 80°C for 5 min, then 35 cycles of 94°C for 1 min, 55°C for 1 min, 72°C for 3.5 min, and a final elongation at 72°C for 5 min using primers ycf6R and trnCGCA (Shaw et al. 2005). 7.2.4.6 trnL-trnL-trnF region This region comprises the trnL intron and the trnL-trnF spacer (Figure 7.3) and will be referred as trnL-trnL-trnF following Shaw et al. (2005). The region was amplified using primers c and f (Taberlet et al. 1991) with PCR conditions as in Taberlet et al. (1991) and Nguyen (2011): initial denaturation at 94°C for 5 min, then 30 cycles of 94°C for 1 min, 55°C for 1 min, 72°C for 2 min, followed by elongation step of 72°C for 5 min. Figure 7.3. The trnL-trnL-trnF region showing the positions and directions of primers (Taberlet et al. 1991). 229 7.2.5 ‘CLas’ detection, gel electrophoresis and sequencing Detection of ‘CLas’ from both Murraya and wild citrus accessions were performed as described in Chapter 3 using both real-time PCR (qPCR) and conventional PCR (cPCR). Post PCR processing of samples (gel electrophoresis and sequencing) used the same methods detailed in Section 2.2.3 (Chapter 2). 7.2.6 Phylogenetic nomenclature for Murraya Since the study of Murraya by Nguyen (2011), further analysis of the literature has suggested names for the taxa identified that should take precedence over those used by Nguyen (2011). These names will be used in further publications of the data derived in Nguyen’s study and will be used in this thesis; the two sets of names are given in Table 7.3. Table 7.3. Proposed names for various taxa of Murraya. Nguyen (2011) Current study Murraya exotica Murraya paniculata Murraya paniculata Murraya sumatrana Murraya asiatica Murraya elongata Murraya × omphalocarpa Murraya × omphalocarpa Murraya ovatifoliolata Murraya heptaphylla var. ovatifoliolata Murraya ovatifoliolata var. zollingeri Murraya heptaphylla var. heptaphylla 230 7.2.7 Phylogenetic relationships of Murraya spp. Sequence assembly was performed as described in Section 2.2.4 of Chapter 2. Sequences of other accessions were obtained either from previous studies and/or from GenBank and are presented in Table 7.4 for Murraya accessions and Tables 7.5 & 7.6 for the chloroplastal and ITS regions of the citrus accessions. Phylogenetic relationships among the Murraya accessions from Bhutan and of those from other parts of the world were determined based on five cpDNA regions and the ITS region. Aligned sequence datasets were subjected to phylogenetic analyse by maximum likelihood (ML) in MEGA6. Then ML analyses were performed separately on each cpDNA sequence set and the ITS region, and then for combination of all cpDNA and ITS region with 1000 bootstrap replicates. Before analysis, the appropriate evolutionary model was determined for each gene using MEGA 6 with the best model being determined based on the lowest Bayesian Information Criterion (BIC) score. For each of the cpDNA, the Tamura 3-parameter model (Tamura 1992) was used. For the ITS region and the combined cpDNA data sets, the Tamura 3-parameter model with a discrete gamma distribution (5 categories (+G, parameter = 0.2202) for ITS and (5 categories (+G, parameter = 0.1000) for the combined cpDNA were used to model the evolutionary rate differences among sites. For each gene, initial tree(s) for the heuristic search were obtained by applying the Neighbor-Joining method to a matrix of pairwise distances estimated using the maximum composite likelihood approach, and then selecting the topology with superior log likelihood value. The combined cpDNA set was also subjected to maximum parsimony (MP) analysis using MEGA6. The MP tree was obtained using the subtree-pruning-regrafting algorithm (Nei & Kumar 2000) with search level 1 in which the initial trees were obtained by the random addition of sequences (10 replicates). 231 Table 7.4. Sequences of Murraya and Bergera accessions used for molecular analyses in this study. Accession Location Species Reference 2Mu.p. ANSW Richmond, NSW, Australia Murraya paniculata Nguyen (2011) 4Mu.p. ANSW Richmond, NSW, Australia Murraya paniculata Nguyen (2011) 8–ANSW Royal Botanic Garden, Sydney, NSW, Australia Murraya paniculata Nguyen (2011) 13Mu.p. AQ Brisbane, QLD, Australia Murraya paniculata Nguyen (2011) 22Mu.p.IWJ, Bogor Botanic Garden, WJ, Indonesia Murraya sumatrana Nguyen (2011) 23Me.c. IWJ Bogor Botanic Garden, WJ, Indonesia Merrillia caloxylon (Ridl.) Swingle Nguyen (2011) 24Mu.p. IP Bogor Botanic Garden (from Pegunungan Cycloop, Papua), Indonesia Murraya × cycloopensis Nguyen (2011) 25Mu.p.IWJ Bogor Botanic Garden, WJ, Indonesia (from Merubetiri Murraya sumatrana Nguyen (2011) National Park, EJ) 28Mu.e.IWJ Bogor Botanic Garden, WJ, Indonesia Murraya paniculata Nguyen (2011) 30Mu.p. IL Bogor Botanic Garden, WJ, Indonesia Murraya sumatrana Nguyen (2011) 34Mu.p.IEJ Purwodadi Botanic Garden, EJ, Indonesia Murraya sumatrana Nguyen (2011) 38Mu.p.IEJ Purwodadi Botanic Gardens, EJ, Indonesia Murraya sumatrana Nguyen (2011) 42–IUCR Bayan, Purworejo, CJ (from UCR), Indonesia Murraya paniculata Nguyen (2011) 44Mu.e.ICJ Bayan, Purworejo, CJ, Indonesis Murraya paniculata Nguyen (2011) 45Mu.p. ICJ Bayan, Purworejo, CJ, Indonesia Murraya sumatrana Nguyen (2011) 46Mu.p. ICJ Yogyakata, CJ, Indonesia Murraya sumatrana Nguyen (2011) 48Mu.p. ICJ Universitas Gadjah Mada, Yogyakata, CJ, Indonesia Murraya sumatrana Nguyen (2011) 232 Accession Location Species Reference 54Mu.ov.AQ Bundaberg, QLD, Australia Murraya heptaphylla var. ovatifoliolata Nguyen (2011) 58Mu.p.VTG Chau Than, Tien Giang, Việt Nam Murraya paniculata Nguyen (2011) 61–VCP Cuc Phuong National Park, Ninh Binh, Việt Nam Murraya elongata Nguyen (2011) 65–UCR University of California, Riverside, USA Murraya paniculata Nguyen (2011) 66–Mu.sp.AQ Woongarra, QLD (ex University of California, Riverside), Australia Haddon Head Beach, Blue Mud Bay, NT, Australia Murraya heptaphylla var. ovatifoliolata Nguyen (2011) Murraya heptaphylla var. ovatifoliolata Nguyen (2011) 71Mu.ov. ANT Gove, NT, Australia Murraya heptaphylla var. ovatifoliolata Nguyen (2011) 72Mu.p. AQ Mt Carbine, QLD, Australia Murraya heptaphylla var. ovatifoliolata Nguyen (2011) 73Mu.p. AQ Cooktown-Mt Webb National Park, QLD, Australia Murraya heptaphylla var. ovatifoliolata Nguyen (2011) 74Mu.ov.AQ Battle Camp, QLD, Australia Murraya heptaphylla var. ovatifoliolata Nguyen (2011) 75Mu.p.AQ Cairns, QLD, Australia Murraya heptaphylla var. ovatifoliolata Nguyen (2011) 76Mu.p.PI Guangxi via South China Botanical Gardens, China Murraya elongata Nguyen (2011) 77Mu.p.VTG Cai Lay, Tien Giang, Việt Nam Murraya paniculata Nguyen (2011) 84VDL Buon Ma Thuot, Dac Lac, Việt Nam Murraya paniculata Nguyen (2011) 86Mu.p.VTH Dong Ve, Thanh Hoa, Việt Nam Murraya paniculata Nguyen (2011) 88Mu.p.VCP Cuc Phuong National Park, Ninh Binh, Việt Nam Murraya elongata Nguyen (2011) 91Mu.om.T Orchid Island, Taiwan Murraya × omphalocarpa (Hayata) Nguyen (2011) 92Mu.omT Orchid Island, Taiwan Murraya × omphalocarpa Nguyen (2011) 93Mu.omT Orchid Island, Taiwan Murraya × omphalocarpa Nguyen (2011) 94Mu.p.CYD Pipashan, Yingde County, GD, China Murraya elongata Nguyen (2011 95Mu.p.CYD Pipashan, Yingde County, GD, China Murraya elongata Nguyen (2011) 69Mu.p.ANT 233 Accession Location Species Reference 96Mu.p.CYD Pipashan, Yingde County, GD, China Murraya elongata Nguyen (2011) 97CYD Hengshitang, Yingde County, GD, China Murraya paniculata Nguyen (2011) 98Be.kw. CGX Guangxi via South China Botanical, Gardens in Bergera kwangsiensis (C.C. Huang) Nguyen (2011) Bergera microphylla (Merr. & Chun) Nguyen (2011) Murraya paniculata Nguyen (2011) Guangzhou, GD, China 99Be.mic. CH Bawangling, Hainan, via South China Botanical Gardens in Guangzhou, GD, China 100M.sp. CH Bawangling, Hainan, via South China Botanical Gardens in Guangzhou, GD, China 101Mu.p.CGD South China Agricultural University, GD, China Murraya paniculata Nguyen (2011) 102Mu.p.BSP Capão Bonito, SP Brazil Murraya paniculata Nguyen (2011) 106M.p.BSP Araraquara, SP, Brazil Murraya paniculata Nguyen (2011) 108M.p. ANSW Richmond, NSW, Australia Murraya paniculata Nguyen (2011) 111UFBG Fairchild Botanic Garden, Florida, USA Murraya paniculata Nguyen (2011) 113Mu.z.INTT Kupang, NTT, Indonesia Murraya heptaphylla var. heptaphylla Spanoghe Nguyen (2011) 114Mu.z.INTT Kupang, NTT, Indonesia Murraya heptaphylla var. heptaphylla Nguyen (2011) 115Mu.p.AQ Tondoon Botanic Gardens, QLD, Australia Murraya heptaphylla var. ovatifoliolata Nguyen (2011) EF126637 – Bergera koenigii (Murraya koenigii) Bayer et al. (2009) EF138843 – Bergera koenigii (Murraya koenigii) Bayer et al. (2009) JX144255 – Murraya alata Drake Mou et al. (unpublished) JX144256 – Murraya paniculata Mou et al. (unpublished) 234 Table 7.5. GenBank accessions of citrus and hybrids used for molecular analyses of chloroplast regions. Taxa cited in GenBank Names based on Mabberley (1997, 1998, 2004, 2008) and Zhang et al. (2008) Accession numbers for the specific genetic region trnL-trnL-trnF rpS4-trnT Matk-5’trnK psbM-trnD References Atalantia monophylla Atalantia monophylla (Roxb.) A. DC. EF126636 EF134633 EF138841 EF164813 Bayer et al. (2009) Citrus aurantiifolia Citrus × aurantiifolia (Christm.) Swingle EF126645 EF134643 EF138851 EF164823 Bayer et al. (2009) Citrus aurantiifolia Citrus × aurantiifolia (Christm.) Swingle KJ865401 KJ865401 KJ865401 KJ865401 Su et al. (2014) Citrus aurantium Citrus × aurantium L. EF126647 EF134644 EF138853 EF164824 Bayer et al. (2009) Citrus bergamia Citrus × limon (L.) Osbeck EF126648 EF134646 EF138854 EF164826 Bayer et al. (2009) Citrus celebica Citrus hystrix DC. EF126649 EF134647 EF138855 EF164827 Bayer et al. (2009) Citrus gracilis Citrus wintersii Mabb. EF126650 EF134648 EF138856 EF164828 Bayer et al. (2009) Citrus halimii Citrus halimii Stone EF126651 EF134649 EF138857 EF164829 Bayer et al. (2009) Citrus hindsii Citrus japonica Thunb. JX144237 – – – Mou et al. (unpublished) Citrus hystrix DC. Citrus hystrix DC. EF126652 EF134650 EF138858 EF164830 Bayer et al. (2009) Citrus ichangensis Citrus cavaleriei H. Léveillé ex Cavalerie EF126653 EF134651 EF138859 EF164831 Bayer et al. (2009) Citrus indica Tanaka Citrus indica Tanaka EF126654 EF134652 EF138860 EF164832 Bayer et al. (2009) Citrus jambhiri Citrus × taitensis Risso EF126655 EF134653 EF138861 EF164833 Bayer et al. (2009) Citrus junos Citrus × junos Siebold ex Tanaka EF126656 EF134654 EF138862 EF164834 Bayer et al. (2009) Citrus latifolia Citrus × latifolia (Tanaka ex Yu. Tanaka) EF126657 EF134655 EF138863 EF164835 Bayer et al. (2009) Tanaka 235 Taxa cited in GenBank Names based on Mabberley (1997, 1998, 2004, 2008) and Zhang et al. (2008) Accession numbers for the specific genetic region trnL-trnL-trnF rpS4-trnT Matk-5’trnK psbM-trnD References Citrus latipes Citrus latipes (Swingle) Tanaka EF126658 EF134656 EF138864 EF164836 Bayer et al. (2009) Citrus × limonia Citrus × limon (L.) Osbeck – – EF138866 – Bayer et al. (2009) Citrus limon Citrus limon (L.) Osbeck EF126659 – EF138865 EF164837 Bayer et al. (2009) Citrus macroptera Citrus hystrix DC. EF126661 EF134659 EF138867 EF164839 Bayer et al. (2009) Citrus maxima Citrus maxima (Burm.) Merr. EF126664 EF134661 EF138869 EF164842 Bayer et al. (2009) Citrus medica Citrus medica L. EF126665 EF134663 EF138871 EF164843 Bayer et al. (2009) Citrus medica Citrus medica L. – – – EU369571 Li et al. (2007b) Citrus myrtifolia EF126666 EF134664 EF138872 EF164844 Bayer et al. (2009) Citrus obovoidea Yu. Tanaka Citrus × aurantium var. myrtifolia Ker Gawler Citrus maxima (Burm.) Merr. EF126667 EF134665 EF138873 EF164845 Bayer et al. (2009) Citrus platymamma Citrus reticulata Blanco KR259987 KR259987 KR259987 KR259987 Lee et al. (2015) Citrus reticulata Citrus reticulata Blanco EF126671 EF134669 EF138877 EF164850 Bayer et al. (2009) Citrus reticulata Citrus reticulata Blanco – EF134670 – – Bayer et al. (2009) Citrus reticulata Citrus reticulata Blanco EU369542 – – – Li et al. (2007b) Citrus sinensis Citrus × aurantium L. ‘Sweet orange’ DQ864733 DQ864733 DQ864733 DQ864733 Bausher et al. (2006) Citrus sinensis Citrus × aurantium L. – EF134671 – EF164851 Bayer et al. (2009) Citrus sp. amboinensis Citrus 'amboinensis' – EF134642 – – Bayer et al. (2009) Citrus tachibana Citrus reticulata Blanco EF126673 EF134672 EF138880 EF164852 Bayer et al. (2009) Citrus × paradisi Citrus × aurantium L. “Grapefruit’ EF126668 EF134668 EF138876 EF164847 Bayer et al. (2009) 236 Taxa cited in GenBank Names based on Mabberley (1997, 1998, 2004, 2008) and Zhang et al. (2008) Accession numbers for the specific genetic region trnL-trnL-trnF rpS4-trnT Matk-5’trnK psbM-trnD References Citrus × paradisi Citrus × aurantium L. “Grapefruit’ EF126668 EF134668 EF138876 EF164847 Bayer et al. (2009) Clymenia polyandra Citrus polyandra Tanaka AY295281 – – – Morton et al. (2003) Fortunella hindsii Citrus japonica Thunb. EU369558 – – – Li et al (2007b) Fortunella japonica Citrus japonica Thunb. EF126679 EF134680 EF138888 EF164860 Bayer et al. (2009) Fortunella margarita Citrus japonica Thunb. – – – EF164861 Bayer et al. (2009) Fortunella polyandra Citrus japonica – EF134682 EF138890 EF164862 Bayer et al. (2009) Microcitrus australasica Citrus australasica F. Mueller EF126686 EF134690 EF138898 EF164870 Bayer et al. (2009) Microcitrus australasica Citrus australasica F. Mueller EU369567 – – – Li et al. (2007b) Microcitrus australis Citrus australis (Mudie) EF126687 EF134691 EF138899 EF164871 Bayer et al. (2009) Microcitrus inodora Citrus indora F.M. Bailey EF126688 – – – Bayer et al. (2009) Microcitrus papuana Citrus wintersii Mabb. EF126689 EF134694 EF138902 EF164874 Bayer et al. (2009) Poncirus trifoliata Citrus trifoliata L. – EF134706 EF138914 EF164886 Bayer et al. (2009) Poncirus trifoliata Citrus trifoliata L. EU369562 – – – Li et al (2007b) × Citrofortunella mitis Citrus × microcarpa Bunge – – EF138868 – Bayer et al. (2009) × Citrofortunella sp. – EF126641 EF134639 – EF164819 Bayer et al. (2009) 237 Table 7.6. GenBank accessions of citrus and hybrids used for molecular phylogeny based on the ITS region. Taxa cited in GenBank Names based on Mabberley (1997, 1998, 2004, 2008) and Zhang et al. (2008) Accession number References Atalantia monophylla Atalantia monophylla (Roxb.) A. DC. GQ225867 Kumar et al. (2013) Citrus clementina Citrus × aurantium L. XM 006423861 Jenkins et al. (unpublished) Citrus deliciosa Citrus × aurantium L. AB456093 Yamaji et al. (2013) Citrus hindsii Citrus japonica Thunb. JN681163 Amar et al. (unpublished) Citrus hindsii Citrus japonica Thunb. KP093211 Liu et al. (2015) Citrus hindsii Citrus japonica Thunb. KP093210 Liu et al. (2015) Citrus hindsii Citrus japonica Thunb. JX144194 Mou et al. (unpublished) Citrus hystrix Citrus hystrix DC. FJ641961 Kyndt et al. (2010) Citrus ichangensis Citrus cavaleriei H. Léveillé ex Cavalerie JQ990182 Sun et al. (2015) Citrus indica Citrus indica Tanaka GQ225847 Kumar et al. (2013) Citrus japonica Citrus japonica Thunb. JX144195 Mou et al. (unpublished) Citrus japonica Citrus japonica Thunb. HQ893878 Wang et al. (2012). Citrus japonica Citrus japonica Thunb. FJ641924 Kyndt et al. (2010). Citrus junos Citrus × junos Siebold Tanaka AB456114 Yamaji et al. (2013) Citrus junos Citrus × junos Siebold Tanaka AB456113 Yamaji et al. (2013) Citrus kinokuni Citrus japonica Thunb. AB456098 Yamaji et al. (2013) Citrus latipes Citrus latipes (Swingle) Tanaka GQ225851 Kumar et al. (2013) Citrus macroptera Citrus hystrix DC. GQ225852 Kumar et al. (2013) 238 Taxa cited in GenBank Names based on Mabberley (1997, 1998, 2004, 2008) and Zhang et al. (2008) Accession number References Citrus maxima Citrus maxima (Burm.) Merr. JQ990179 Sun et al. (2015) Citrus maxima Citrus maxima (Burm.) Merr. FJ641949 Kyndt et al. 2010 Citrus maxima Citrus maxima (Burm.) Merr. JN681155 Amar et al. (unpublished) Citrus madurensis Citrus japonica Thunb. KP093204 Liu et al. (2015) Citrus medica Citrus medica L JQ990164 Sun et al. (2015) Citrus medica Citrus medica L. JQ990164 Sun et al. (2015) Citrus reticulata Citrus reticulata Blanco FJ641934 Kyndt et al. (2010) Citrus reticulata Citrus reticulata Blanco FJ641939 Kyndt et al. (2010 Citrus reticulata Citrus reticulata Blanco GQ225853 Kumar et al. (2013) Citrus reticulata Citrus reticulata Blanco HQ893877 Wang et al. (2012) Citrus sinensis Citrus × aurantium L. JN681150 Amar et al. (unpublished) Citrus tachibana Citrus reticulata Blanco JQ990178 Sun et al. (2015) Citrus trifoliata Citrus trifoliata L. HQ893876 Wang et al. (2012) Citrus × tangelo Citrus × aurantium L JN661211 Amar et al. (unpublished) Fortunella polyandra Citrus japonica FJ434160 Kyndt et al. 2010 Eremocitrus glauca Citrus glauca (Lindley) Burkill AB456049 Yamaji et al. (2013) Eremocitrus glauca Citrus glauca (Lindley) Burkill FJ434161 Kyndt et al. (2010) Fortunella japonica Citrus japonica Thunb. AB456108 Yamaji et al. (2013) Fortunella japonica Citrus japonica Thunb. AB456110 Yamaji et al. (2013) 239 Taxa cited in GenBank Names based on Mabberley (1997, 1998, 2004, 2008) and Zhang et al. (2008) Accession number References Fortunella japonica Citrus japonica Thunb. AB456051 Yamaji et al. (2013) Microcitrus australasica Citrus australasica F. Mueller AB457061 Yamaji et al. (2013) Poncirus trifoliata Citrus trifoliata L. AB456050 Yamaji et al. (2013) Poncirus trifoliata Citrus trifoliata L. FJ606752 Daniel & Knoess (unpublished) 240 7.2.8 Morphology of Murraya Two data sets were used for analysis of the morphology of accessions of Murraya: (A) a set containing accessions of Murraya elongata; and (B) data for Murraya elongata, Murraya sumatrana, Murraya heptaphylla and Murraya paniculata. The data for these analyses were obtained from this study and from the data set taken from the study of Ngyuen (2011). Data Set A comprises 71 leaves from 8 plants of Murraya elongata. Data set B consists of the data from Set A plus 155 leaves from 19 plants of Murraya paniculata, 41 leaves from 5 plants of Murraya sumatrana, 39 leaves of Murraya heptaphylla var. ovatifoliolata and 15 leaves from Murraya heptaphylla var. heptaphylla. For the Bhutanese accessions, leaf assessments were based on a maximum of ten basal and terminal leaflets per plant. Pressed specimens of three plants from each location were used. The following morphological features of the leaves were measured:  BL: length basal leaflet;  BW: width of basal leaflet;  BACU: length of acuminate portion of basal leaflet;  BAN: angle of base of basal leaflet;  BRLW: ratio of the length and width of basal leaflets;  BRACU: ratio of the length of the acuminate tip to the length of basal leaflets;  TL: length of terminal leaflet;  TW: width of terminal leaflet;  TACU: length of acuminate portion of terminal leaflet;  TAN: angle of base of terminal leaflet;  TRLW: ratio of the length and width of terminal leaflets; and  TRACU: ratio of the length of the acuminate tip to the length of terminal leaflets. Variation among the accessions of Murraya was examined using ANOVA and principal components analysis (PCA). For Data Set A, before being subjected to ANOVA, the data relating to the variables above were checked for homogeneity of the variances using Levene’s test; heteroscedasticity data were transformed to 241 logarithms. The transformed data were also used for PCA; however, the derived variables (BRACU, TRACU, BRLW & TRLW) were excluded from this analysis. For Data Set B, the data were again checked for homogeneity of variances with respect to the taxon to which they were assigned (e.g., Murraya elongata or Murraya paniculata) before being subjected to PCA; all data were transformed to logarithms. ANOVA and PCA were performed using Statistica (V12, StatSoft Inc.). Fruits of the Murraya accessions from Bhutan were also included in the morphological description but not assessed statistically. 7.2.9 Phylogenetic relationships of wild citrus Phylogenetic relationships of wild citrus accessions collected in Bhutan were analysed in similar manner as described for the Murraya accessions; ML analyses were conducted on each cpDNA and the ITS region. Sequences of the cpDNA were concatenated using Geneious, and ML analysis was performed on the concatenated sequences to infer the phylogenetic relationships. Before performing the ML analysis, the evolutionary model for each gene was performed. For the combined cpDNA, the Tamura 3-parameter model (Tamura 1992) was determined with a discrete gamma distribution (6 categories (+G, parameter 0.1000) with invariable (I) sites, and for the ITS region, the Tamura 3-parameter model (6 categories (+G, parameter 0.1908) was used to model the evolutionary rates among the sites. The cpDNA was also analysed through MP. The MP analysis was obtained by the subtree-pruning regrafting algorithm (Nei & Kumar 2000) with search level 1 in which the initial trees were obtained by the random addition of sequences (10 replicates). All analyses were performed with 1000 bootstrap replicates in MEGA6. Atalantia monophylla was used as outgroup for all phylogenetic analyses. Names of taxa in all phylogenetic analyses are based on Mabberley (1997; 1998; 2004; 2008) and Zhang et al. (2008) as detailed in Tables 7.5 and 7.6. 242 7.3 Results 7.3.1 Sequence analysis of the Murraya accessions Table 7.7 shows the sequence analyses of the individual genes. The longest sequence length obtained in this study was for the psbM-trnDGUC region (1142–1166 bp). However, the length was trimmed to match the length of sequences from Nguyen (2011) which provided many of the other sequences used for comparison with those obtained in the current study. Among the cpDNA regions, psbM-trnDGUC had the highest number of variable sites (54), but the trnL-trnL-trnF region had the highest number of parsimoniously informative sites (29). The rpS4-trnT region of the cpDNA showed the least number of variable (20) and parsimoniously informative sites (8). Compared to any of the cpDNA regions, the ITS region, with a sequence length range of 608–686 bp, provided the highest number of variable (93) and parsimoniously informative sites (36). 7.3.2 Phylogenetic relationships of Murraya Phylogenetic analysis of different cpDNA regions yielded congruous results but with some genetic regions providing better resolution than others. To illustrate this, the phylogenetic trees from three of the cpDNA regions that gave a high (trnL-trnLtrnF), medium (matK) and poor (trnT) resolution of the taxa are presented together with the results from the ITS region and an analysis based on the combination of all five cpDNA regions with the ITS region. 7.3.2.1 trnL-trnL-trnF region Phylogenetic analysis of the trnL-trnL-trnF region provided a better resolved tree than the other regions of the cpDNA (Figure 7.4). Six distinct clades were formed including two separate clades of Murraya elongata: one clade of Murraya elongata comprising accessions from Yingde, China, and the other clade including accessions from Bhutan and Guangxi, China. All Murraya paniculata accessions clustered into one clade together with accession MBT.9 from Bhutan. Accessions of Murraya heptaphylla var. heptaphylla, Murraya heptaphylla var. ovatifoliolata and the hybrid 243 Murraya × ompalocarpa formed one clade with the two latter taxa forming distinct subclades. Murraya alata formed a single member clade and Merrillia caloxylon was a sister taxon to all Murraya accessions. 244 Table 7.7. Sequence analysis of the cpDNA and the ITS region of the Murraya accessions. Genetic regions Analysis ITS matK-5'trnK psbM-trnDGUC rpS4-trnT trnCGCA-ycf6 trnL-trnL-trnF Combined chloroplast Range of length of sequences from the current study 608– 686 793–819 1142–1166* 546–567 723–760 947–1001 3956–4165** Number of variable sites of the aligned sequences 93 42 54 20 38 42 241 Number of parsimony informative sites 36 20 17 8 19 29 114 0–10 0–4 0–4 0–2 0–3 0–3 0–4 Range of pairwise sequence divergence among all taxa * trimmed to the length of sequences obtained by Nguyen (2011) ** for accessions with sequences for all 5 cpDNA. 245 Figure 7.4. Phylogenetic analysis of the trnL-trnL-trnF region using maximum likelihood and the Tamura 3-parameter model of evolution (Tamura 1992). The tree with the highest log likelihood (1596.8238) is shown, and the percentage of trees in which associated taxa cluster together is shown next to the branches. Accessions obtained from the current study are shown within boxes. Abbreviations used: MBT accessions from Bhutan; MCN, accessions from China. 246 7.3.2.2 matK-5' trnK region The analysis of the matK-5' trnK region produced a tree (Figure 7.5) that shows little resolution with many accessions forming a large polytomy comprising accessions of: Murraya heptaphylla var. ovatifoliolata, Murraya heptaphylla var. heptaphylla, and Murraya × omphalocarpa along with the accession of Merrillia caloxylon and Murraya elongata accessions from Yingde, China. Accessions of Murraya elongata from Bhutan and Guangxi group together in a single clade as do the accessions of Murraya sumatrana and Murraya paniculata. 7.3.2.3 rpS4-trnT region Results obtained from the analysis of the rpS4-trnT region are shown in Figure 7.6. This region shows low resolution with the accessions of Murraya elongata and Merrillia caloxylon forming a large, basal polytomy. Only two distinct clades are formed. One clade comprises Murraya accessions of Murraya paniculata that split into two subclades. The other clade comprises accessions of Murraya sumatrana, Murraya heptaphylla var. ovatifoliolata, Murraya heptaphylla var. heptaphylla, Murraya × omphalocarpa and Murraya × cycloopensis. 7.3.2.4 ITS region Phylogenetic analysis of the ITS region of the Murraya species using Merrillia caloxylon and Bergera microphylla as outgroups resulted in five clades (Figure 7.7). One clade consists of all Murraya elongata accessions from Bhutan and from China. Accessions from Yingde form a subclade nested within this main Murraya elongata clade. Accessions of Murraya sumatrana form a second clade. A third clade comprising of all accessions of Murraya paniculata with the accession from Bhutan (MBT.9) and the accession from Buon Ma Thuot, Việt Nam (80Mu.p.VDL) being sister to the rest. Murraya alata forms fourth, single member clade. The last clade consists of accessions of Murraya heptaphylla var. ovatifoliolata and Murraya heptaphylla var. heptaphylla. 247 Figure 7.5. Evolutionary history inferred by using the maximum likelihood method based on the Tamura 3-parameter model (Tamura 1992) for the matK-5' trnK region. The tree with the highest log likelihood (-1408.8929) is shown. Accessions obtained from this study are shown in boxes. Accessions obtained from GenBank are shown with accession numbers in parentheses. Abbreviation used: MBT Murraya accessions from Bhutan; MCN Murraya accessions from China. 248 Figure 7.6. Molecular phylogenetic analysis inferred by using maximum likelihood based on the Tamura 3-parameter model (Tamura 1992) for the rps4-trnT region. The tree with the highest log likelihood (-907.8983) is shown. The percentage of trees in which associated taxa cluster together is shown next to the branches. Accessions obtained in this study are shown within boxes. Abbreviations used: MBT accessions from Bhutan; MCN Accessions from China. 249 Figure 7.7. Phylogenetic relationships of the ITS region inferred using the maximum likelihood method based on the Tamura 3-parameter with a discrete gamma distribution evolutionary model of rate differences among sites (5 categories (+G, parameter 0.2202)) (Tamura 1992). The tree with the highest log likelihood (-1479.1368) is shown. The percentage of trees in which the associated taxa cluster together is shown next to the branches. Accessions obtained from this study are shown within boxes. Abbreviations used: MBT accessions from Bhutan; MCN Accessions from China. 250 7.3.2.5 Phylogenetic relationships of Murraya inferred from combination of five cpDNA and ITS region Figure 7.8 shows the results of the phylogenetic analysis from the combination of five cpDNA and the ITS region. The analysis of the concatenated sequences resulted in better resolution than any analysis of the single genes and the results are summarised below:  All accessions of Murraya elongata from Bhutan and China form one clade with strong bootstrap support. Two subclades are found within this clade: one comprising the accessions from Yingde, China, and the other of the accessions from Guangxi, China together with the accessions from Bhutan. Accession 88 Mu.p VCP from Cuc Phuong does not group within the Murraya elongata clade.  All accessions of Murraya paniculata form one clade and the accession from Bhutan is sister to the rest.  All Murraya sumatrana accessions cluster together.  Murraya heptaphylla var. ovatifoliolata and Murraya heptaphylla var. heptaphylla form one clade with each variety forming a distinct subclade.  Merrillia caloxylon is sister to all Murraya accessions. This same data set was analysed using maximum parsimony (Figure 7.9). This method produced similar tree as with the maximum likelihood. However, accession 88 Mu. p VCP from Cuc Phuong forms a sister clade to the Murraya elongata clade. 251 Figure 7.8. Phylogenetic relationships inferred from the combination of five cpDNA regions and the ITS region of Murraya accessions from Bhutan using the maximum likelihood based on the Tamura 3-parameter model of evolution (Tamura 1992) with a discrete gamma distribution (5 categories (+G, parameter 0.1000)). The tree with the highest log likelihood (-8468.8153) is shown. The percentage of trees in which the associated taxa cluster together is shown next to the branches. Accessions obtained from this study are shown within boxes. Abbreviation used: MBT accessions from Bhutan; MCN accessions from China. 252 Figure 7.9. Phylogenetic relationships inferred from the combination of five cpDNA regions and the ITS region of Murraya accessions from Bhutan using maximum parsimony (Felsenstein 1985). Tree #1 out of 5 most parsimonious trees (length = 248) is shown. The percentage of replicate trees in which the associated taxa clustered together in the bootstrap test (1000 replicates) is shown next to the branches. The MP tree was obtained using the Subtree-Pruning-Regrafting (SPR) algorithm (Nei & Kumar 2000) with search level 1 in which the initial trees were obtained by the random addition of sequences (10 replicates). Branches with bootstrap values less than 50% were collapsed together. 253 7.3.3 Morphology of Murraya accessions from Bhutan In Baychhu, Murraya elongata was observed on rocky and dry areas mostly on the edge of orchards. A few plants were observed within the orchard but were usually cut back at least three to four times a year along with weeds. The weeds grew back more quickly taking over the whole ground and hiding any plants underneath. In Reldri, Murraya elongata was observed on sloping area beside the road; this location was not as dry as that at Baychhu. The flowers on the plants both at Reldri and Baychhu were borne terminally with 5 white petals. The leaves of these plants had five to seven leaflets most of which had acuminate tips; the petioles and petiolules were often glabrous (Figures 7.10). Mature fruits observed at Baychhu were reddish orange in colour, ~10 mm long and 8 mm wide and almost globular. The fruit (previously undescribed) contained two seeds that were hairy (Figure 7.11). ANOVA of the leaves of accessions of Murraya elongata from Bhutan (Data Set A, Figure 7.12), China and Việt Nam showed significant variation in the parameters measured (Table 7.8). More variation was found in the basal leaflets as opposed to the terminal leaflets with the length and width of the leaflets and their ratio being more variable than the other characteristics assessed. PCA of this data resulted in the first two factors only having eigenvalues greater than 1.0; hence, these two factors only were used to examine any grouping of the data (Kaiser 1960). The plot of the factor coordinates (Figure 7.12) shows that the widths and lengths of both the basal and terminal leaflets are strongly correlated with Factor 1 whereas the basal angles of the basal and terminal leaflets were strongly correlated with Factor 2. However, despite the variation in leaf morphology among the plants from the different locations being found by ANOVA, no obvious separation of the plants was observed in the PCA analysis (Figure 7.13). The data for the proposed four species of Murraya (Ngyuen 2011) (Data Set B) are shown in Figures 7.14 and 7.15. In this analysis, the correlations of the variables with the factors were similar to those for Data Set A. The logarithms of the lengths 254 and widths of the basal and terminal leaflets were again strongly correlated with Factor 1 and the basal angles of the terminal and basal leaflets with Factor 2; again only two factors had eigenvalues greater than 1.0 and were used to examine the variation among leaves from the four species. The plots of the case variables show three distinct groups of plants although with some overlap between each group. Firstly, a group consisting of accessions of Murraya paniculata including the accession of this species from Bhutan (upper right). Secondly, a group containing accessions of the two varieties of Murraya heptaphylla (lower right). Lastly, a group containing accessions of Murraya elongata from Bhutan and China, together with accessions of Murraya sumatrana from Indonesia (centre left). Figure 7.10. Leaves, leaflets and flowers of Bhutanese accessions of Murraya elongata from Baychhu (A & B) and leaves, leaflets and an inflorescence of Murraya elongata from Reldri, Phuentsholing (C & D) (Photos: N. Om & GAC Beattie). 255 Figure 7.11. Fruit (A & B) and seeds (C) of Murraya elongata from Baychhu (Photo: GAC Beattie). 256 Figure 7.12. Plot of factor coordinates for Data Set A for the first two principal components. As the analysis is based on correlation, the largest variable-factor correlation is equal to 1.0; therefore, the coordinates are shown within a unit circle. BL: length basal leaflet; BW: width of basal leaflet; BACU: length of acuminate portion of basal leaflet; BAN: angle of base of basal leaflet; TL: length terminal leaflet; TW: width of terminal leaflet; TACU: length of acuminate portion of terminal leaflet; TAN: angle of base of terminal leaflet. 257 Table 7.8. ANOVA of the morphology of leaves taken from accessions of Murraya elongata from Bhutan, China and Việt Nam. BL: length basal leaflet; BW: width of basal leaflet; BACU: length of acuminate portion of basal leaflet; BAN: angle of base of basal leaflet; BRLW: ratio of the length and width of basal leaflets; BRACU: ratio of the length of the acuminate tip to the length of basal leaflets; TL: length terminal leaflet; TW: width of terminal leaflet; TACU: length of acuminate portion of terminal leaflet; TAN: angle of base of terminal leaflet; TRLW: ratio of the length and width of terminal leaflets; and TRACU: ratio of the length of the acuminate tip to the length of terminal leaflets. Feature Origin n mean Se Fisher's LSD ANOVA F BL BW BRLW BACU Cuc Phuong Yingde Baychhu Reldri Cuc Phuong Yingde Baychhu Reldri Cuc Phuong Yingde Baychhu Reldri Cuc Phuong Yingde Baychhu Reldri 9 6 28 28 9 6 28 28 9 6 28 28 9 6 28 28 61.12 34.97 40.93 33.27 28.76 18.58 21.78 19.21 2.13 1.93 1.9 1.72 4.93 2.35 4.92 3.84 2.71 1.95 1.64 1.75 1.02 1.7 0.92 0.72 0.06 0.12 0.06 0.05 0.54 0.42 0.36 0.49 a bc b c a bc b c a abc b c a b a ab 258 P Levene's test F P 24.4 < 0.001 0.97 0.41 12.66 < 0.001 1.64 0.19 6.35 < 0.001 0.91 0.44 3.16 0.03 2.15 0.1 Feature Origin n Mean se Fisher's LSD ANOVA F BRACU Cuc Phuong Yingde Baychhu Reldri LogBAN Cuc Phuong Yingde Baychu Reldri TL Cuc Phuong Yingde Baychhu Reldri TW Cuc Phuong Yingde Baychhu Reldri TRLW Cuc Phuong Yingde Baychhu Reldri 9 6 28 28 9 6 28 28 9 6 28 28 9 6 28 28 9 6 28 28 0.08 0.07 0.12 0.11 77.33 88 102.57 103.04 82.55 53.31 65.45 58.25 31.86 24.8 29.53 24.71 2.6 2.18 2.27 2.39 0.01 0.01 0.01 0.01 2.46 2.77 2.78 2.17 3.69 1.89 2.44 2.07 1.47 1.86 1.65 0.97 0.08 0.1 0.05 0.06 bc c a ab c b a a a c b a a bc ab c a b b b 259 P Levene's test F P 3.69 0.016 2.74 0.5 15.41 < 0.001 1.51 0.22 12.04 < 0.001 1.84 0.15 4.24 0.008 1.66 0.18 3.96 0.012 1.32 0.28 Feature Origin TACU Cuc Phuong Yingde Baychhu Reldri TRACU Cuc Phuong Yingde Baychhu Reldri TAN Cuc Phuong Yingde Baychhu Reldri n Mean 9 6 28 28 9 6 28 28 9 6 28 28 8.1 6.06 7.87 6.7 0.1 0.11 0.12 0.11 64.33 67.83 82.32 72.86 se Fisher's LSD 0.87 0.73 0.5 0.63 0.01 0.01 0.01 0.01 3.32 0.83 1.79 1.79 c bc a b 260 ANOVA F P Levene's test F P 1.35 0.27 1.72 0.17 0.86 0.46 2.35 0.08 11.68 < 0.001 2.33 0.082 Figure 7.13. Plot of the coordinates for each observation (case) using the first two factors from principal components analysis of leaves from accessions of Murraya elongata from four locations. 261 Figure 7.14. Plot of factor coordinates for Data Set B for the first two principal components. As the analysis is based on correlation, the largest variable-factor correlation is equal to 1.0; therefore, the coordinates are shown within a unit circle. BL: length basal leaflet; BW: width of basal leaflet; BACU: length of acuminate portion of basal leaflet; BAN: angle of base of basal leaflet; TL: length terminal leaflet; TW: width of terminal leaflet; TACU: length of acuminate portion of terminal leaflet; TAN: angle of base of terminal leaflet. 262 Figure 7.15. Plot of the coordinates for each observation (case) using the first two factors from principal components for all observations (leaves) from accessions of Murraya elongata, Murraya paniculata, Murraya sumatrana and Murraya heptaphylla. 263 7.3.4 Morphological description of wild citrus accessions The wild citrus accessions have two distinct morphologies. Firstly, the leaves and fruits of the wild citrus accessions, NCBT.1, NCBT.5, NCBT.7 and NCBT.9, resemble the description of Citrus cavaleriei (Citrus ichangensis) given by Swingle & Reece (1967) in that they have large, winged petioles with apiculate leaf tips (Figures 7.16A & 7.17A). The fruits (Figure 7.16B) have large, thick seeds as in Citrus cavaleriei. However, based on the observations of accession NCBT.9, the flowers are different from either of Citrus latipes or Citrus cavaleriei in that they are mostly borne singly (Figure 7.17B) between the nodes and not in the leaf axils. Secondly, the morphology of NCBT.3 was different from the accessions above with respect to leaf and fruit shapes. The leaves are ovate and do not have large, winged petioles. The fruit have a mammillated apex (Figure 7.18). 7.3.5 Sequence analysis of wild citrus Longest sequence length was found for the psbM–trnDGUC region (935–1163 bp) while the rpS4–trnT region had the shortest length (517–562 bp) (Table 7.9). Among the four cpDNA regions, the psbM–trnDGUC region had the highest number of variable and parsimoniously informative sites (106 & 20). The rpS4–trnT region had the least number of variable and informative sites. Compared to the combined sequence of the chloroplast regions, the ITS region provided a higher number of parsimoniously informative sites (50) (Table 7.9). Pairwise sequence divergence showed that the within in-group sequence divergence was highest in the ITS regions (0.00–5.58%) followed by psbM–trnD and matK– 5’trnK. The ITS region also showed high sequence divergence between the ingroups and the outgroup (Atalantia monophylla). Five chloroplast genes and one nuclear gene were amplified from the wild citrus samples collected from Bhutan. A BLAST search using sequences of different cpDNA of the Bhutanese wild citrus accessions resulted in 99–100% identity to citrus hybrids such as Citrus reticulata (‘platymamma’), sweet orange (Citrus × 264 aurantium) (‘sinensis’) (DQ864733) and Citrus × aurantiifolia (KJ865401). A BLAST search using the ITS sequence resulted in 99% identity to Citrus reticulata, Citrus × aurantium (‘clementina’), varieties of Citrus japonica (‘hindsii’, ‘japonica’, and ‘madurensis’), and others. For the trnCGCA–ycf6 region, a BLAST search yielded only three similar sequences, these belonging to Citrus × aurantium (‘platymamma’), sweet orange (Citrus × aurantium), and Citrus × aurantiifolia and, hence, this region was excluded from any further analysis. Figure 7.16. Accession NCBT.1 showing leaves with large winged petioles (A), whole and crosssectioned fruit (B) and leaf distortion caused by Cacopsylla heterogena (C). (Photos: GAC Beattie). 265 Figure 7.17. Accession NCBT.9 showing leaves with large winged petioles (A), flowers that are mostly borne singly (B) and Cacopsylla heterogena damage on leaves (C). (Photo: GAC Beattie). 266 Figure 7.18. Accession NCBT.3 showing leaves without large petioles (A), a cross section of a fruit (B); side view of a fruit (C) and the top view of a fruit (D). (Photos: T. Penjor) 267 Table 7.9. Sequence analysis of wild citrus accessions. Analysis matK-5'trnK psbM-trnDGUC trnL-trnL-trnF rpS4-trnT Combined cpDNA ITS Range of sequence length of NCBTs 774 – 822 935 – 1163 941 – 1014 517 – 562 3159 – 3167 658 – 808 Range of sequence length of GenBank accessions 772 – 871 1176 –1256 937 – 1063 526 – 616 3159 – 3223 564 –740 Number of variable sites 45 106 50 30 235 146 Number of informative sites 19 20 19 5 48 50 Range of sequence divergence within ingroups (%) 0.00 – 2.23 0.00 – 2.64 0.00 – 1.43 0.00 – 1.36 0.00 – 1.99 0.00 – 5.58 Range of sequence divergence between ingroups and Atalantia monophylla (%) 2.46 – 3.69 1.91 – 3.20 1.10 – 2.09 1.55 – 2.33 1.77 – 2.97 4.11 – 7.18 268 7.3.6 Phylogenetic relationships of wild citrus based on four cpDNA regions The phylogenetic analysis of the wild citrus sequences used a data set comprising: the Bhutanese accessions; accessions taken from GenBank that share 99% similarity (the highest similarity in the BLAST search) with the Bhutanese accessions; and other accessions that the BLAST search and other sources suggested may be related to the Bhutanese accessions. Phylogenetic analysis of the individual chloroplast genes resulted in trees with low resolution in which the wild citrus accessions from Bhutan always grouped with Citrus latipes and hybrids of Citrus reticulata but not to Citrus reticulata itself. A similar result was obtained when the four cpDNA were combined. Figure 7.19 shows the phylogenetic analysis based on combinations of the four chloroplast genes with the tree produced by ML. The tree consists of the eight clades listed below with species names being taken from GenBank: 1. Citrus reticulata together with Citrus taitensis (‘jhambiri’) and Citrus × junos; 2. accessions found in Clade ‘R’ of Bayer et al. (2009)—Australasian species together with Citrus medica and Citrus indica, the latter both native to India; 3-5. Citrus cavalieri (‘ichangensis’), Citrus (Poncirus) trifoliata and Citrus hystrix (‘macroptera’) each forming single member clades; 6. two species of Citrus japonica (Fortunella) together with Citrus halimii; 7. two accessions of Citrus hystrix, two accessions of Citrus aurantiifolia, and × Citrofortunella sp. – corresponding to the ‘lime clade’ of Bayer et al. (2009); and 8. a large, poorly resolved polytomy containing the Bhutanese wild citrus accessions (NCBT.1, NCBT.3, NCBT.5, NCBT.7, and NCBT.9), Citrus latipes and hybrids of Citrus reticulata with Citrus maxima and Citrus × aurantium as sister clade. This data set was also subjected to parsimony analysis (Figure 7.20). The tree produced using this method showed more resolution, and the accessions in Clade 8 again grouped together. However, the Bhutanese accessions again formed part of a basal polytomy. 269 Figure 7.19. Phylogenetic relationships of wild citrus from Bhutan based on combinations of four chloroplast genes (matK-5’trnK, psbM-trnDGUC, trnL-trnL-trnF, rpS4-trnT) inferred using maximum likelihood based on the Tamura 3-parameter model of evolution (Tamura 1992) with discrete a gamma distribution among sites (6 categories (+G, parameter 0.1000)) with invariable sites (([+I], 66% sites). The tree with the highest log likelihood (-6901.6987) is shown. The percentage of trees in which the associated taxa clustered together is shown next to the branches and branches with bootstrap values of less than 50% were collapsed together. Most GenBank sequences were obtained from Bayer et al. (2009). Sequences obtained from different studies are shown by letters in parentheses. Sequences obtained from this study are: NCBT.1, NCBT.3, NCBT.5, NCBT.7, and NCBT.9. 270 Figure 7.20. Phylogenetic relationships of wild citrus from Bhutan based on combinations of four chloroplast genes (matK-5’trnK, psbM-trnDGUC, trnL-trnL-trnF, rpS4-trnT) inferred using parsimony. Tree #1 out of the 2 most parsimonious trees (length = 319) is shown. The percentage of replicate trees in which the associated taxa clustered together in the bootstrap test (1000 replicates) (Felsenstein 1985) are shown next to the branches. The MP tree was obtained using the Subtree-PruningRegrafting algorithm (Nei & Kumar 2000) with search level 1 in which the initial trees were obtained by the random addition of sequences (10 replicates). Branches with bootstrap values of less than 50% were collapsed together. Most GenBank sequences were obtained from Bayer et al. (2009). Sequences obtained from different studies are shown by letters in parentheses. Sequences obtained from this study are: NCBT.1, NCBT.3, NCBT.5, NCBT.7 and NCBT.9. 271 7.3.7 Phylogenetic relationships of wild citrus based on the nuclear ITS regions Figure 7.21 shows the phylogenetic relationships of the citrus accessions based on the ITS region, with the data set again based on accessions closely related to the Bhutanese accessions identified through a BLAST search. The analysis yielded a poorly resolved tree consisting of a large polytomy in which the following groups can be found and to which the Australasian accessions were sister: Clade 1: Citrus maxima, Citrus reticulata and hybrids of Citrus reticulata; Clade 2: accessions of Citrus trifoliata; Clade 3: the Bhutanese accessions, NCBT.1, NCBT. 5, NCBT.7 and NCBT.9; and Clade 4: the Bhutanese wild citrus accession NCBT.3 grouped together with Citrus hystrix (including ‘macroptera’), Citrus latipes, Citrus indica, and further accessions of Citrus maxima. 272 Figure 7.21. Phylogenetic analysis of citrus accessions based on the ITS region using maximum likelihood based on the Tamura 3-parameter model (Tamura 1992). A discrete gamma distribution was used to model evolutionary rate differences among sites (6 categories (+G, parameter 0.1908)). The tree with the highest log likelihood (-2390.5207) is shown. Accession numbers are given in parentheses next to the taxon. Accessions obtained in this study: NCBT.1, NCBT.3, NCBT.5, NCBT.7, and NCBT.9. Branches with bootstrap values of less than 50% were collapsed together. 273 7.3.8 Detection of ‘CLas’ in Murraya and wild citrus Table 7.10 shows the results of real-time PCR conducted to test the Murraya elongata and Murraya paniculata and wild citrus accessions for infection by ‘CLas’. The Murraya elongata accessions produced FAM Ct values ranging from 32.15– 36.17 while the Murraya paniculata accession, MBT. 9, collected in Bhutan produced a FAM Ct value of 0.00. The internal control (CAL) Ct values for all the test samples ranged from 13.22 to 22.06. The positive control FAM Ct was 19.26−25.77 with CAL Ct value range of 19.78−21.49. The extraction control which is a mandarin sample obtained from the horticulture block in Hawkesbury Campus produced a FAM Ct value of 37.55 with CAL Ct value of 20.20. Selected samples of Murraya elongata and wild citrus were subjected to cPCR but did not result in the production of amplicons. 274 Table 7.10. Detection of 'CLas' in the accessions of Murraya species and wild citrus accession NCBT.9. Sample name Species Ct values FAM CAL MBT.1 Murraya elongata 32.75 13.98 MBT.2 Murraya elongata 36.17 15.87 MBT.3 Murraya elongata 34.69 14.94 MBT.4 Murraya elongata 32.15 13.22 MBT.5 Murraya elongata 33.16 13.96 MBT.6 Murraya elongata 34.96 20.92 MBT.7 Murraya elongata 34.71 20.02 MBT.8 Murraya elongata 35.69 22.06 MBT.9 Murraya paniculata 0.00 20.35 NCBT. 9a wild citrus 34.96 20.47 NCBT. 9b wild citrus 35.85 20.38 NCBT. 9c wild citrus 34.55 19.70 NCBT. 9d wild citrus 35.95 20.19 NCBT. 9e wild citrus 35.63 20.32 Positive control* Citrus reticulata 19.26-25.77 19.78-21.49 Extraction control** Citrus reticulata 37.55 20.20 NCBT 9a to 9e= samples taken from the same plant in Bhutan but DNA extracted in WSU. *Positive control Ct values from two assays. **included during extraction of NCBT.9 samples and collected from horticulture block in Hawkesbury campus, Western Sydney University. Samples subjected to cPCR are emboldened . 275 7.4 Discussion 7.4.1 Phylogenetic relationships and morphology of Murraya from Bhutan In inferring plant systematics, non-coding regions of the cpDNA have been used to study phylogenetic relationships below the family level due to their fast evolving nature and fewer functional constraints as compared to coding regions (Gielly & Taberlet 1994; Shaw et al. 2005). Similarly, ITS regions are well suited for the study of species and closely related genera (Baldwin et al. 1995; Soltis & Soltis 1998). In the current study, five cpDNA and the ITS region of the rDNA were used to assess the phylogenetic relationships species of Murraya occurring in Bhutan. Variable results were obtained from the phylogenetic analysis of the cpDNA with some taxa better resolved with some genetic regions than others. In this study, the trnL-trnL-trnF region provided a better resolution of taxa than the other regions of the cpDNA used (Figure 7.4), as it contained the highest number of parsimoniously informative sites among the cpDNA (Table 7.7). All cpDNA regions except the rps4-trnT region resolved Murraya elongata into two clades with the accessions from Bhutan and Guangxi, China in one clade and the accessions from Yingde, China into another clade (Figure 7.6). The rpS4-trnT region failed to resolve Murraya elongata accessions in any groups. In contrast, the ITS region showed better resolution, with all Murraya elongata accessions falling within one clade (Figure 7.7). Further, the remaining accessions of Murraya sumatrana, Murraya paniculata, and Murraya heptaphylla accessions grouped into separate distinct clades. For the combination of the cpDNA and the ITS region analysed using ML, all accessions of Murraya paniculata, Murraya sumatrana, Murraya heptaphylla and Murraya elongata were resolved except for the placement of Murraya elongata accession 88Mu.p.VCP from Cuc Phoung, Việt Nam (Figure 7.8). Better resolution was achieved when the same data set was analysed using MP with the Cuc Phoung accession being sister to the rest of the Murraya elongata accessions (Figure 7.9). 276 Morphological data analyses show that in spite of variation in leaf morphology among the Murraya elongata plants from different locations as shown by ANOVA (Table 7.8), no actual separation between the accessions were obtained with the PCA (Figure 7.13). In particular, there appears to be no morphological separation of accessions from the two clades of Murraya elongata identified in the phylogenetic analysis, and the variation in leaf shape within a plant appears to be as great as the variation between plants; this suggests that they form a single group. However, the sampling is only from 71 leaflets from 5 plants and needs to be extended. The comparison of leaf morphology between Murraya paniculata, Murraya heptaphylla, Murraya elongata, and Murraya sumatrana resulted in three separate groups: one group containing Murraya paniculata, the second containing Murraya heptaphylla and the third group comprising of Murraya elongata and Murraya sumatrana (Figure 7.15). This indicates that leaves of Murraya elongata and Murraya sumatrana are morphologically similar. Duminil & Di Michele (2009), in their review of comparing molecular and morphological markers for plant species delimitation, noted certain incongruence of species identification based on the two methods. They (2009) concluded that higher species delimitation associated with molecular markers mostly corresponded to cryptic species wherein morphologically similar individuals were separated as different species molecularly. In contrast, higher species delimitations based on morphology corresponded to species varying morphologically due to their adaptation to local environment (phenotypic plasticity) (Duminil & Di Michele 2009). Cryptic species have been reported in liverworts (Marchantiophyta: Conocephalaceae), cellular slime moulds (paraplyletic Prostista: Dictyosteliidae), ferns (Pteridophyta: Pteridaceae) (Odrzykoski & Szweykowski 1991), Drapa species (Brassicaeae) in the artic (Grundt et al. 2006), Mitella (Saxifragaceae) (Okuyama & Kato 2009), and in orchids (Orchidaceae) (Efimov 2013). Shneyer and Kotseruba (2015) noted that cryptic species are rarely described or named after their discovery, as it is complicated to do so according to all rules. Based on a comparison of leaf shape and molecular phylogenetics, Murraya sumatrana and Murraya elongata may represent cryptic species. This similarity in leaf shape also poses a problem if taxa can only be 277 sampled when in their vegetative phase. However, the shape of the fruit of the two taxa appear different with plants of Murraya elongata from Bhutan and China having globose fruit and seeds (Figures 7.11 & 7.22) and Murraya sumatrana producing long, ellipsoid fruit with mammiform apex and spindle-shaped seeds (Figure 7.23). The formation of globose fruit by Murraya elongata needs to be confirmed, but both fruit shape and place of origin appear to separate the two taxa. Results of the current studies also provide support for the findings of Nguyen (2011) wherein both molecular and morphological studies showed distinct separation between accessions that appear to originate from mainland Asia (Murraya elongata (Bhutan, Việt Nam and China), from southeast China (Murraya paniculata) and those that have a Malesian or Australasian origin (Murraya sumatrana and Murraya heptaphylla). Therefore, using both morphology and molecular phylogenetics, the accessions of Murraya from Bhutan could be placed within the taxa proposed by Nguyen (2011). The current study provides further evidence to support the argument for the division of taxa regarded as orange jasmine (Murraya paniculata, sensu Mabberley (2016) into four species. Two of the four species occur in Bhutan: Murraya paniculata and Murraya elongata. Murraya paniculata is a widely grown ornamental known as ‘orange jasmine’, and its occurrence in Bhutan is not surprising especially in towns near Bhutan–Indian border. Murraya paniculata was recorded as being introduced to India from China and grown in gardens (Edwards & Lindley 1819-1820; Roxburgh 1832). Roxburgh (1832) also observed its occurrence in the wild in the mountains of the Cicars (present day northeast coast of Andhra Pradesh) (Edwards & Lindley 1819–1920). Hooker (1875) described Murraya elongata A. DC. (Figure 7.24) (from Taong–dong, Myanmar (Burma) but noted it was very different to the forms of ‘Murraya exotica’ also occurring in the region. Murraya elongata appears to be associated with hilly, mountainous, seasonally-dry woodlands associated with limestone and granite areas (Kong et al. 1986; Huang 1997) from Pakistan through India, Myanmar, Thailand, peninsular Malaysia, Laos, Việt Nam to southern China (Hooker 1875; Kong et al. 1986; Huang 1997; Nguyen 2011). Therefore, its discovery at Baychhu and Reldri in Bhutan is not surprising. The discovery adds to our knowledge of biodiversity in Bhutan and Asia. 278 Figure 7.22. Fruit of Murraya elongata from Yingde, China (Photo: GAC Beattie). Coin =28.65 mm diameter. Figure 7.23. Fruit and seeds of Murraya sumatrana from Bogor Botanic Garden, Indonesia (Photo: Nguyen Huy Chung). 279 . Figure 7.24. Murraya elongata A. DC. ex Hook. Wallich Herbarium type specimen. 280 7.4.2 Phylogenetic relationships of wild citrus from Bhutan In angiosperms, the cpDNA is maternally inherited and the nuclear ITS region is biparently inherited. This provides the possibility of examining relationships due to hybridization (Doebley 1992; Olmstead & Palmer 1994). Baldwin et al. (1995) stated that lineages of hybrid populations do not form monophyletic groups, but such individuals will group with non-hybrid parents possessing the orthologous nuclear ribosomal DNA. In the current study, wild citrus accessions from Bhutan were evaluated to determine their phylogenetic relationships based on a combination of four cpDNA genes and their ITS region. In the cpDNA analysis, the Bhutanese wild citrus accessions clustered with Citrus latipes, Citrus maxima and hybrid accessions and appears to be more distantly related to Citrus cavaleriei, Citrus medica and Citrus reticulata. The presence of Citrus latipes and Citrus maxima in the same cluster as the wild citrus accessions from Bhutan seem to indicate a possible maternal relationship of these two species with the wild citrus accessions. This is further supported by the clustering of hybrid accessions that have Citrus maxima as one of the ancestral parents: Citrus × aurantium (Citrus maxima and Citrus reticulata); Citrus × aurantium (‘paradisi’) (backcross between Citrus maxima and Citrus × aurantium); C.× aurantium (‘sinensis’) (Citrus reticulata and Citrus maxima), Citrus maxima (‘obovoidea’) (a probable hybrid between Citrus maxima and Citrus reticulata (Hodgson 1967)), and Citrus × limon [(Citrus medica (citron) × Citrus × aurantium)]. Based on the cpDNA analysis of hybrids involving either Citrus medica or Citrus maxima, Citrus maxima has always been proposed as the maternal parent, while Citrus medica has been proposed as the paternal parent (Nicolosi et al. 2000; Barkley et al. 2006; Li et al. 2010; Carbonell-Caballero et al. 2015). Citrus × aurantium (‘platymamma’) and Citrus × aurantium (‘sinensis’) clustered together indicating their close relatedness. Lee et al. (2015) characterised the whole chloroplast genome of Citrus × aurantium (‘platymamma’) and found it closest to Citrus × aurantium (‘sinensis’) (Bausher et al. 2006). Penjor et al. (2014), based on the coding region of matK, showed that the wild citrus accession that they collected from Mongar, Bhutan is closer to Khasi 281 papeda which is Citrus latipes. This is consistent with the cpDNA results obtained in the current study, where the wild citrus accessions grouped in same cluster as Citrus latipes. The current study used four cpDNA (matK-5’trnK intron, psbM-trnD, trnLtrnL-trnF, rpS4-trnT). The ITS analysis resulted in a poorly resolved tree. One accession of Citrus maxima taken from GenBank (JQ990179) clustered with the mandarins in this analysis. This could be a misidentification or a hybrid of Citrus reticulata, as other accessions of Citrus maxima are in the cluster that contains Citrus medica, Citrus indica, Citrus hystrix, and Citrus latipes together with NCBT.3 (Clade 4). Kumar et al (2012) also found Citrus latipes grouping with Citrus hystrix using ITS sequences. With the exception of accession NCBT.3, the wild citrus accessions cluster together with weak bootstrap support and appeared to be equally related to Citrus reticulata and its hybrids, as to Citrus cavaleriei, Citrus latipes, Citrus maxima and others. In contrast, accession NCBT.3 clustered in a subgroup with accessions of Citrus latipes, Citrus hystrix, Citrus indica, Citrus medica and Citrus maxima indicating its closer relationship to these accessions than to the other Bhutanese accessions. The exact nature of the Bhutanese accessions is problematic. Based on their morphology and molecular biology, these accessions clearly separate into two paternal groups: Clade 3 in Figure 7.21 comprising accessions NCBT.1, 5, 7 and 9, and Clade 4 in Figure 7.21 comprising accession NCBT.3. The sequencing results suggest that the accessions from the two groups have the same maternal parent. With respect to the chloroplast sequences (Figures 7.19 & 7.20), the clade to which all Bhutanese accessions belong contains two true species, Citrus latipes and Citrus maxima, and all accessions are closer to these two species than to Citrus cavaleriei. With respect to their nuclear genomes, the results from sequencing the ITS region suggest that the accessions in Clade 3 in Figure 7.21 are closer to Citrus cavaleriei and a number of other types than to Citrus latipes and Citrus maxima. In contrast, the ITS regions of NCBT.3 is more similar to Citrus latipes and other members of Clade 4 in Figure 7.21 than to Citrus cavaleriei. Therefore, NCBT.3 has a different paternal parent from the rest. These results also suggest that Bhutan accessions in 282 either group are not true Citrus species, with the molecular data suggesting that accessions NCBT 1, 5, 7 and 9 in Clade 3 in Figure 7.21 represent a hybrid taxon and that NCBT.3 could be Citrus latipes. However, the morphology of accession NCBT.3 strongly suggests that it is not Citrus latipes. Firstly, the leaves of Citrus latipes have winged petioles whereas the petioles NCBT.3 are not winged. Secondly, the fruit of Citrus latipes are not mammillate whereas those borne by NCBT.3 are mammillate. There is some resemblance with Citrus hystrix (‘macroptera’), as the petioles of certain accessions are not winged and the fruit are mammillate. It also resembles Citrus medica in terms of both having wingless petioles and fruits with mammillated apex. Concerning the other species in Clade 4 in Figure 7.21, the leaves do not resemble Citrus maxima, as the petioles of this species have small wings and the fruit are large and not mammillate. The leaves of Citrus hystrix have winged petioles and the fruit colliculate. Citrus indica has leaves without winged petioles but the fruit are not smooth and round in shape. In addition, the fruit and leaves of NCBT.3 do not resemble those of Citrus cavaleriei, as the leaves of the latter have winged petioles and the fruit are ellipsoid with a surface that is colliculate. The morphology of NCBT.3, together with its molecular biology, suggests that it is a hybrid with possibly Citrus latipes as the maternal parent and Citrus hystrix (‘macroptera’) or Citrus medica as the male parent. Citrus medica is reported to be growing in the same location from where accession NCBT.3 was obtained (Penjor, pers. comm.). My NCBT.1, 5, 7 and 9 accessions had winged petioles and the ellipsoid fruit with colliculate surfaces resembling leaves and fruit of Citrus cavaleriei as illustrated by Penjor et al. (2014) and Swingle & Reece (1967). The leaves, but not the fruit, of my NCBT.1, NCBT.5, NCBT.7 and NCBT.9 accessions also resembled description of Citrus latipes (Swingle & Reece 1967; Grierson 1991). The flowers of plants at Basochhu were mostly borne singly (Figure 7.17B) between nodes and not in the leaf axils. Swingle & Reece (1967) noted that the flowers of ‘Citrus ichangensis’ are borne singly in the axils of the leaves and those of Citrus latipes are, at least sometimes, borne in small axillary racemes with 5–7 flowers. Grierson (1991) 283 described the flowers of Citrus latipes as solitary or in short racemes, and Zhang et al. (2009) described the flowers of Citrus cavaleriei as flowers solitary or to 9 in fascicles (Zhang et al. 2009). These descriptions are not consistent. Based on morphology and results for matK, Penjor et al. (2014) concluded that their accession B07001 from near Wengkhar, Mongar, was a Citrus cavaleriei-relative. However, the matK results also grouped the accession with Citrus latipes. My NCBT.1, NCBT.5, NCBT. 7 and NCBT.9 accessions from Wengkhar and Basochhu, and accession B07001 of the Citrus cavaleriei-relative studied by Penjor et al. (2014), were all collected at elevations ranging from 1900 to 2100 m ASL. At these elevations temperatures in winter drop below freezing and snowfalls can occur (Penjor et al. 2014). Swingle & Reece (1967) regarded Citrus cavaleriei as the most cold-tolerant species of Citrus. Grierson (1991) in Grierson & Long (1991) ‘Flora of Bhutan’ mentions Citrus latipes occurring between 1920 m and 2100 m ASL in Bhutan. He did not mention Citrus cavaleriei (Citrus ichangensis). Swingle & Reece (1967) noted that Citrus latipes occurs in the Khasi Hills in north-eastern India, and in northern Myanmar, between 500–1830 m ASL. Thus, my NCBT.1, NCBT.5 and NCBT.9 accessions appear to represent a hybrid of cross between Citrus latipes as the maternal parent and Citrus cavaleriei as the paternal parent. My results, and those of Penjor et al. (2014), suggest that one or more hybrids may be included in descriptions of Citrus cavaleriei by Swingle & Reece (1967) and Zhang et al. (2009). At the moment, the taxonomy of the wild citrus accessions in the current study must remain unresolved. Citrus taxonomy and phylogeny has always been complicated and confusing due to high rate of hybridisation and apomixis coupled with long history of cultivation (Mabberley 1997; Nicolosi et al. 2000; Barkley et al. 2006). Although, the ITS region has been used for phylogenetic studies at lower taxonomic levels, sometimes they have reduced utility due to high sequence divergence, wide variation in sequence length, paralogy problems or lack of resolving power (Li et al. 2007b). However, such observations with the ITS region could rather be due to the nature and number of samples used. There is a need to sequence a greater number of 284 genes from a greater range of possible parents and for further molecular techniques to be employed to deduce their lineage. 7.4.3 Detection of ‘CLas’ in Murraya and wild citrus All samples of Murraya elongata produced FAM Ct values ranging from 32.15 to 36.17 except for one that produced FAM Ct value equal to zero. Samples of the wild citrus produced FAM Ct values of 34.55 to 35. 95. The FAM Ct values of both Murraya elongata and wild citrus accession NCBT.9 that produced FAM Ct > 0.00 were within the FAM Ct value cut off for ‘CLas’ positive. However, no amplicons could be obtained with the selected samples of both Murraya elongata and wild citrus samples when subjected to cPCR with primers A2/J5. Based on the Ct values, the samples of Murraya elongata and wild citrus can be interpreted as ‘CLas’ positive especially for those samples with FAM Ct values in the range of 0.00 < FAM Ct < 36. Walter et al. (2012a) did not detect ‘CLas’ using the 16S r DNA primers-probe set of Li et al. (2006) in samples of Murraya paniculata regarded as ‘CLas’ negative using the LJ900 primers targeting the tandem repeats of the hyvI/hyvII of the bacterium. Walter et al. (2012a), however, noted that the bacterial titre was generally lower in Murraya paniculata samples than in citrus, and mentioned that one of the ‘LJ900-positive’ samples was amplified with a Ct value of 38.2 using the 16S primers. Similar results were obtained in another study by Walter et al. (2012b), where only three of the 19 samples of Murraya paniculata produced ‘CLas’ Ct values of 37.43–40.58 using the 16S primers compared to all 19 samples producing ‘CLas’ Ct values that ranged from 26.55-37.50 using the LJ900 primers. Walter et al. (2012b) commented that the discrepancies in the results between the two primers could be due to higher sensitivity of the LJ900 primers method resulting from generating higher copies of the hyvI/hyvII compared to the 16S gene. Lopes et al. (2010) also observed lower titres of ‘CLas’ in Murraya paniculata (syn. Murraya exotica) than in citrus. Therefore, it is possible that the Murraya elongata samples in the current study may have been infected with ‘CLas’ but titres of the pathogen may have been too low to be detected by cPCR as shown by the FAM Ct range of 32.15 to 36.17. This suggests that Murraya elongata may be a poor and transient host of 285 ‘CLas’ and, therefore, of inconsequential importance in the spread of HLB. If it is the original host of Diaphorina citri it is unlikely to have been plant species from which the psyllid acquired ‘Candidatus Liberibacter asiaticus’. 7.5 Highlights of the study:  Murraya elongata from Bhutan, and Guangdong and Guangxi in China, form a monophyletic group based on the combination of five cpDNA and the ITS region. Both morphological and molecular data show that Murraya elongata accessions from mainland Asia including the Bhutanese accessions are different from Murraya sumatrana and Murraya heptaphylla of Malesian or Australasian origin.  Murraya paniculata from Bhutan grouped with other accessions of this taxon from other parts of the world.  The phylogeny of the wild citrus based on the four cpDNA and ITS analysis is not resolved. The current molecular results and the morphologies of the citrus accessions indicate that accessions NCBT.1, NCBT.5, NCBT.7 and NCBT.9 represent a hybrid of Citrus latipes and Citrus cavaleriei while accession NCBT.3, which is morphologically different from the other accessions may be a hybrid of Citrus latipes on the maternal side and Citrus hystrix or Citrus medica on the paternal side.  Murraya elongata is of inconsequential importance in the spread of HLB. 286 Chapter 8: General Discussion ____________________________________________________________________ The specific objectives of my research were to determine:  the phylogenetic relationships between Diaphorina communis and Diaphorina citri;  whether Diaphorina communis can acquire ‘Candidatus Liberibacter asiaticus’ from mandarin and transmit it from mandarin to mandarin and from mandarin to curry leaf or vice versa, and to study the host preferences of Diaphorina communis;  the molecular and morphological characteristics of the parasitoid of Diaphorina communis, and to determine the phylogenetic relationships between the parasitoids collected from Diaphorina communis and Diaphorina citri;  the effect of altitude, ambient temperature and relative humidity (RH) on leaf temperature, and determine the incidences and types of psyllids, and prevalence of ‘CLas’ at different elevations;  the morphological and molecular characteristics of the green psyllids found on mandarin and wild citrus, and other psyllids found on an unidentified Zanthoxylum sp., and to determine the presence of ‘CLas’ within the green psyllids and their host plants; and,  the phylogenetic and morphological relationships of species of Murraya occurring in Bhutan with those proposed by Nguyen (2011), to determine the phylogenetic relationship of the wild citrus species found in Bhutan in relation to other Citrus species and hybrids, and whether the Murraya species and wild citrus found in Bhutan can be hosts for ‘CLas’; 287 8.1 Key findings and their significance 8.1.1 Phylogenetic relationships of Diaphorina communis and Diaphorina citri I studied the phylogenetic relationship between Diaphorina communis and Diaphorina citri based on the COI and 16S regions. My results showed two distinct clades, one comprising of Diaphorina communis and the other of Diaphorina citri; variation within each clade exists. This was the first molecular study characterising Diaphorina communis. My molecular data indicate that the COI and the 16S regions can be used to distinguish Diaphorina citri from Diaphorina communis. This knowledge is useful for making decisions on psyllid management, particularly if dealing with immature psyllid stages where morphological identification is difficult. 8.1.2 ‘Candidatus Liberibacter asiaticus’ and Diaphorina communis Diaphorina communis adults can acquire ‘CLas’ from infected mandarin but at a low rate as evidenced by the low numbers of adults becoming infected at the end of the acquisition and transmission interval. There is no evidence of curry leaf being a host of ‘CLas’, and there is no evidence for transmission of ‘CLas’ by Diaphorina communis from mandarin to curry leaf or mandarin and vice versa. This conclusion is based on the results of a combination of qPCR and sequencing. Even though the results of some of the qPCR analyses showed the Ct values for ‘CLas’ to be within the range of > 0 ≤ 36, a range in plant assays that is deemed as positive for ‘CLas’, these results could not be confirmed by sequencing and were deemed inconclusive. I observed adult Diaphorina communis on mandarin, Murraya elongata, curry leaf and Zanthoxylum sp., and the psyllid could possibly be feeding on these plants in the field. However, I found that, given the choice, Diaphorina communis prefers to feed on curry leaf and exclusively develops on this species. Diaphorina communis was first observed on curry leaf and described in India (Mathur 1935; 1975), and the results of my studies appear to indicate that curry leaf is the original host of Diaphorina communis. 288 It has been shown that ‘CLas’ multiplies faster in Diaphorina citri that fed on ‘CLas’-infected plants as nymphs than in psyllids that fed as adults, and successful transmission of ‘CLas’ to healthy host plants occurred only from those psyllids that had acquired the pathogen as nymphs (Inoue et al. 2009; Pelz-Stelinski et al. 2010; Ammar et al. 2016). Considering that nymphs of Diaphorina communis cannot survive on mandarin, and adults may require longer acquisition and multiplication periods, the role of Diaphorina communis as vector of ‘CLas’ is concluded to be negligible. 8.1.3 Comparison of parasitoids of Diaphorina citri and Diaphorina communis When I started my studies, the only information available on Diaphorina communis were the biological descriptions by Mathur (1935; 1975), and that the psyllid harboured the HLB pathogen (Donovan et al. 2012a; 2012b); knowledge on its role in the epidemiology of HLB was non-existent. Assuming that the psyllid could transmit ‘CLas’ and assuming that there would be a need to manage the psyllid, part of my studies was to investigate the existence of natural enemies of the psyllid. The parasitoid that I reared from nymphs of Diaphorina communis collected from Bergera koenigii is a new species of Tamarixia based on molecular phylogenetic analyses that I conducted and on the morphological descriptions by Zoya Yefremova (Department of Zoology, The Steinhardt Museum of Natural History) and Ekaterina Yegorenkova (Department of Geography and Ecology, Ulyanovsk State Pedagogical University). The new species is named as Tamarixia drukyulensis sp. n. 8.1.4 Incidence of psyllids and ‘CLas’ at different elevations Prior to my studies, citrus plants grown at altitudes of 1200 m and above in Tsirang grow well compared to citrus grown in areas below 1200 m, and Diaphorina citri was generally not observed above this elevation, with the exception of Diaphorina citri nymphs recorded in the Dzamling Zor Gewog (1380 m ASL) of Tsirang Dzongkhag by NPPC-ACIAR team in 2009. I hypothesised that the low incidence and severity of ‘CLas’ and Diaphorina citri contributed to better growth of citrus at 289 higher altitudes, and that rapid transmission of ‘CLas’ would impede their growth at the lower altitudes. I also hypothesised that the low incidence and severity of both the pathogen and the psyllid was due to higher leaf temperatures as a result of higher relative humidity and prevailing ambient temperatures at these elevations. My investigations involving eight sites ranging from 800 m to 1500 m ASL along Droopchhugang-Phuensoomgang in Tsirang revealed that:  mandarin seedlings planted along Droopchhugang-Phuensoomgang grew better at 800–1000 m ASL than seedlings planted at 1100 and 1500 m ASL based on the number of leaves on terminal shoots  leaf temperatures were lower than the mean maximum ambient temperatures at all locations.  ambient temperatures and relative humidities at all elevations were within the the favourable range for development and survival of Diaphorina citri.  in Tsirang, Diaphorina citri was found from 800 to 1100 m ASL on mandarin (the result does not imply that Diaphorina citri did not occur below 800 m because this was not assessed during the study).  more plants (both mandarin seedlings and mature trees) at the lower altitude were infected with ‘CLas’ compared to plants at higher elevations. Based on the results of bark samples, ~40–80% infection occurred in the mandarin seedlings planted at the beginning of the study in 2013 at lower elevations of 800 to 1000 m ASL compared to 0% infection at ≥ 1100 m ASL; 100% infection in mature mandarin trees at 800–1100 m compared to 0–20% ≥ 1200 m ASL. These findings indicate that leaf temperature is not a limiting factor for both Diaphorina citri and ‘CLas’ incidences in Tsirang. The results of my studies and the observations reported in earlier studies (Aubert 1987 & 1990; Chavan & Shummanvar 1983; Beattie et al. 2010; Jenkins et al. 2015) regarding the effect of temperature, humidity and elevation on Diaphorina citri suggest that interactions between monsoon rainfalls and temperature are more likely to impact Diaphorina citri and may limit the distribution at higher altitude as the ambient temperature decreases with increasing elevations. However, the results obtained in the current 290 study revealing an abrupt change in the incidence of Diaphorina citri between sites at 1100 m and 1200 m suggest that ambient temperature may not be solely responsible for this. The annual average ambient temperatures at 1200 m are higher than at 1100 m by ~1°C and 3°C for the annual minimum and maximum temperatures respectively (Table 5.4 of Chapter 5). My investigations also looked at the incidence of Diaphorina communis and Cacopsylla heterogena along the study sites. The results showed that Diaphorina communis never occurred on mandarin at the observed elevations, although adults and nymphs of Diaphorina communis were observed on Bergera koenigii at 800, 900 and 1000 m. This observation of Diaphorina communis on Bergera koenigii corroborates the findings of the host preference test in Chapter 3, and seems to suggest that the distribution of Diaphorina communis may be restricted by the distribution of Bergera koenigii. Cacopsylla heterogena, as identified in Chapter 6, was found from 1300 m to 1500 m ASL in the experimental plots in Tsirang. Although the current study assessed only the incidence of the psyllids, the population sizes and the foliar damage due to Cacopsylla heterogena appeared to decrease with decreasing altitude. The higher incidence of ‘CLas’ at the lower altitudes of 800 m to 1100 m ASL compared to at 1200 m and above could be related to the presence of the vector, Diaphorina citri, in these low areas. The occurrence of ‘CLas’ at the higher elevations was probably due to introduction of infected plants during orchard establishment. Therefore, in the absence of the vector and with appropriate agronomic practices, it is possible to grow citrus in Bhutan above 1200 m, although different varietiel selections would need to be grown to suit the conditions at the higher elevation (Susanto et al. 2013; Rokaya et al. 2016). Based on these results, factors other than ambient temperature, relative humidity and rainfall limit the occurrence of Diaphorina citri and ‘CLas’ at ≥ 1200 m in Tsirang. It is likely that UV radiation, could be a possible limiting factor. 291 8.1.5 Cacopsylla heterogena and ‘CLas’ I observed Cacospylla heterogena, (a species originally described from China), infesting mandarin in Tsirang in 2013 and, subsequently, this species was found also on lime, lemons and orange trees in Tsirang, and on wild citrus in Wengkhar, Mongar and in Basochhu, Wangdue Phodrang (Chapter 7). Around the same time, I also observed two species of green psyllids on an unidentified Zanthoxylum sp. in various places in Tsirang and in Baychhu, Wangdue Phodrang. Morphological identification of Cacopsylla heterogena was conducted by Susan Halbert (Taxonomic Entomologist, Division of Plant Industry, Florida Department of Agriculture and Consumer Services) and Luo Xinyu (Department of Entomology, China Agricultural University). One of the two species on Zanthoxylum was identified as Cornopsylla rotundiconis (Luo et al. 2012) and the other is an undescribed Cacopsylla sp. (Luo Xinyu, pers. comm.). I investigated the phylogenetic relationships among the species of the green psyllids, and investigated if these psyllids could harbour the HLB pathogen using qPCR. I also obtained three specimens of Cacopsylla citrisuga from Yunnan, China through Dr Cen Yijing, South China Agricultural University to compare with the other psyllids in the molecular analyses. Cacospylla citrisuga is another green psyllid described from China and is similar to Cacopsylla heterogena morphologically (Li 2011), and has been reported to harbour and transmit ‘CLas’ in China (Cen et al. 2012a; 2012b) but not formally published. The molecular phylogenetic analyses based on two mitochondrial genes (COI & 16S), and one nuclear gene (ITS) revealed that three distinct species of green psyllids occur in Bhutan: the green psyllid infesting citrus in Bhutan belonged to one species, Cacopsylla heterogena; and two species on Zanthoxylum sp. (Cornopsylla rotundiconis and an unidentified Cacopsylla sp). Both Cornopsylla rotundiconis and the unidentified Cacopsylla sp. are morphologically and molecularly distinct from Cacopsylla heterogena and Cacopsylla citrisuga. However, the phylogenetic relationship of Cacopsylla heterogena to Cacopsylla citrisuga could not be resolved based on the current molecular analyses. Data based on the mitochondrial genes 292 suggest that Cacopsylla heterogena is a separate species from Cacopsylla citrisuga but analysis of the ITS region showed otherwise. I tested DNA samples from adults and nymphs of Cacopsylla heterogena collected from various locations for ‘CLas’ using qPCR. I also tested samples of the host plants on which Cacopsylla heterogena was collected. In most locations, the host plants of Cacopsylla heterogena tested positive for ‘CLas’. However, my investigation showed that none of the psyllid samples collected in 2015 were positive for ‘CLas’, even though some insects were collected from an area where some of the host plants were ‘CLas’-positive (e.g., some of the lemon trees in the RDC, Tsirang). From the samples collected in 2016, only 2% of the adults sampled (total adults = 185) were positive for ‘CLas’. The host plants sampled from the same location as the positive psyllids also tested positive for ‘CLas’. This indicates a low acquisition rate by Cacopsylla heterogena. However, I did not obtain any positive results from DNA extracts made from nymphs. Further, I could not obtain any evidence of ‘CLas’ in Cornospylla rotundiconis and the undescribed Cacopsylla sp. and their host plant, Zanthoxylum sp., even though the plant sampled exhibited strong mottling symptoms (Figure 8.1) and low FAM Ct values. Unlike Diaphorina communis, Cacopsylla heterogena feeds and develops on citrus, which means that the nymphs have the opportunity to acquire the pathogen. However, this does not seem to be the case based on the current results—no detection or low detection in nymphs and adults, respectively. Thus, the results of my studies indicate that Cacopsylla heterogena poses little or no threat to citrus production in the higher elevations where it usually occurs. This complements the results of my studies on the distribution of Diaphorina citri in Tsirang (Chapter 5) suggesting that it may be feasible to grow citrus at higher elevations (1200 m and above) due to the absence of Diaphorina citri. My results also indicate that the psyllids on Zanthoxylum sp. are not a threat to citrus. My work on the phylogenetics of Cacopsylla heterogena, Cornopsylla rotundiconis, and the undescribed Cacopsylla sp. is the first of its kind. There is limited molecular data on psyllids, and my results contribute to the information within molecular 293 databases that can be used in studies of psyllid phylogenetics. Molecular data support morphological identification and support psyllid identification especially when dealing with species complexes and cryptic species. During my work on the detection of ‘CLas’ in the green psyllids, I also designed a set of primers, WGCaF and WGCaR (based on the primers (WGf and WGr) of Li et al. (2008)) to amplify the wg gene of the Cacopsylla species. This primer pair can be multiplexed with TaqMan probes for wg (Li et al. 2008) and TaqMan probes for ‘CLas’ with the primers for ‘CLas’ (Li et al. 2006) for the detection of ‘CLas’. This knowledge is of use in diagnostic testing. Figure 8.1. Leaflets of Zanthoxylum sp. with mottling symptoms. 8.1.6 Murraya species and ‘CLas’ My phylogenetic studies confirmed that the Murraya plants occurring in Baychhu, Wangdue Phodrang and in Reldri along Rinchending-Pasakha at Phuentsholing were Murraya elongata. Further, the analyses (using five cpDNA and the ITS region) established that the accessions of Murraya elongata from Bhutan grouped with the accessions from Yingde and Guangxi in China. The analyses also differentiated Murraya elongata accessions from mainland Asia including the Bhutanese accessions from accessions of Murraya sumatrana and Murraya heptaphylla that are of Malesian or Australasian origin. Comparisons of leaf morphology differentiated Murraya paniculata and Murraya heptaphylla from Murraya elongata and Murraya sumatrana but indicated that leaves of the latter two species are morphologically 294 similar. This similarity in leaf morphology emphasises the importance of sampling flowers and fruits for morphological descriptions. The morphological differentiation between Murraya sumatrana and Murraya elongata in my study was, therefore, based on the shape of the fruit as plants of Murraya elongata from Bhutan and China have globose fruit and seed whereas Murraya sumatrana produces long, ellipsoid fruit with mammiform apex and spindle-shaped seeds as shown in Nguyen (2011). The accession of Murraya that I collected from Zantopelri Park in Phuentsholing is Murraya paniculata based on both molecular and morphological analyses; this plant, commonly known as orange jasmine is grown as an ornamental around the world. My study identified two species of Murraya (elongata and paniculata) occurring in Bhutan, and provides the first description of fruits of Murraya elongata in addition to molecular data available for future phylogenetic studies. I observed adults of both Diaphorina citri and Diaphorina communis on Murraya elongata during sample collection in Baychhu in 2014. I also found that the eggs and young nymphs on Murraya elongata observed in April 2015 belonged to Diaphorina citri based on the adults eclosed in the caged branches. This is the first record of development of Diaphorina citri on Murraya elongata. Previous reports have indicated that Murraya paniculata, the widely cultivated form, is a reservoir of ‘CLas’ when evaluated under laboratory conditions (Deng et al. 2007; Zhou et al. 2007), in field experiments (Walter 2012a.) and in field-collected samples (Lopes et al. 2010; Walter 2012b). Therefore, I tested the Murraya species for ‘CLas’ using qPCR, followed by cPCR in an attempt to amplify and sequence some of the samples deemed as positive by qPCR. However, the cPCR using primers A2/J5 (Hocquellet et al. 1991) did not yield any amplicons from any of the Murraya elongata samples; thus, no sequence data was obtained. Based on these results, it can only be stated that Murraya elongata is a putative host of ‘CLas’ and unlikely to be important in the spread of HLB. Populations of the psyllid I observed on Murraya elongata were always low, suggesting that if it is the original host of Diaphorina citri, populations of the psyllid in natural environments (in understories 295 of forests) may also be low in contrast to populations that occur on Murraya exotica, a plant introduced to the subcontinent. 8.1.7 Identity of wild citrus and testing of accessions for ‘CLas’ During the course of my research, a wild citrus taxon, having leaves with large, winged petioles and infested with Cacopsylla heterogena was observed at near Wengkhar in eastern Bhutan and at Basochhu in Wangdue Phodrang. Four accessions of this wild citrus (NCBT.1, 5, 7 & 9) together with a further wild citrus accession that had ovate leaves and petioles that are not winged (NCBT. 3, sourced from Rimchhu) were molecularly and morphologically characterised. However, I could not obtain sufficient evidence to resolve the identity of these wild citrus accessions. The molecular data showed that NCBT.1, 5, 7, & 9 share the same maternal parent with NCBT.3 but have a different paternal parent. The results of my study also suggested that these accessions may not be true Citrus species but rather hybrids: NCBT. 1, 5, 7 & 9 are possibly hybrids of Citrus latipes and Citrus cavaleriei, and NCBT.3, may be a hybrid of Citrus latipes on the maternal side and Citrus hystrix or Citrus medica on the paternal side. I have no evidence of the presence of ‘CLas’ in any of the wild citrus accessions that I tested. However, this could be because the wild citrus plants were located in wild areas where ‘CLas’ may not be present, and does not rule out the potential of these plants to harbour the pathogen. 8.2 Future research 8.2.1 Diaphorina communis and ‘CLas’ Many factors influence vector-pathogen relationships and vector competence such as variation in environmental factors, genetic variation associated with the pathogen or the vector, pathogen dose, and age of the vector (Tabachnick 2015). For Diaphorina citri, higher acquisition and transmission rates are associated with acquisition by the psyllid in its nymphal stages (Inuoe et al. 2009; Pelz-Stelinski et al. 2010; Ammar et al. 2016) and with longer acquisition periods experienced by adults (Pelz-Stelinski et al. 2010; Ammar et al. 2016). These observations seem to explain the low 296 acquisition of ‘CLas’ by Diaphorina communis in the current study; however, it would be interesting to explore the:  gut flora of Diaphorina communis in comparison with that of Diaphorina citri to determine whether it could have a role in ‘CLas’ suppression; and,  the mechanism of resistance to ‘CLas’, if any, in Diaphorina communis that can be exploited in Diaphorina citri. 8.2.2 ‘Candidatus Liberibacter asiaticus’ and Ct values The most widely used diagnostic method for detection of ‘CLas’ uses real-time PCR (qPCR) and the primers, probes and conditions developed by Li et al. (2006); this method was used in the current studies. In my studies, I interpreted all results based on Ct values set out in the guideline by USDA-APHIS (2012) as being ‘CLas’ positive for plant assay if the FAM Ct values (flurophore for ‘CLas’ DNA) were in the range of 0.00 < FAM Ct ≤ 36 or 0.00 < FAM Ct < 32 for psyllid assays. For plant assays, Ct = 36 is said to achieve greater sensitivity (the probability of detection in a truly infected plant material) with minimal loss of specificity, the probability of non-detection in a healthy plant (Turechek et al. 2012). Values between 36–40 or 32–40 for plants and psyllids, respectively, are said to be inconclusive which requires further evaluation. In the current studies, regardless of the Ct value threshold cut-off, I further evaluated samples that produced FAM Ct values > 0.00 through sequencing with primers A2/J5 (Hocquellet et al. 1999). I obtained sequencing data in few instances where the FAM Ct values for plant samples were above the Ct threshold (e.g., 37.46 and 37.75) but failed to obtain amplification for samples with FAM Ct values of ~34 to 35 (Chapter 5). This reaffirms the interpretation that samples producing Ct values between 36 and 40 are inconclusive but casts doubt over those that produce Ct values < 36, yet fail to yield amplicons when subjected to cPCR; are these false positives or do these values mean that the bacterial titres are below detection level by cPCR? If so, then what about the samples that produce Ct values greater than 36 and, yet, give amplicons. The instance where the samples of the mottled Zanthoxylum sp. produced FAM Ct values of 20.98 and 23.18 (Chapter 6), is another case where the samples did not yield any amplicons when subjected to cPCR 297 and, therefore, were classified as false positives. These findings make the interpretation of results problematic whether it is for diagnostic or research purposes. Recent studies on ‘CLas’ transmission and detections are based on qPCR Ct value thresholds ranging from 32 to ≥ 40 as being positive for ‘CLas’ (Li et al. 2007; PelzStelinski et al. 2010; Walter et al. 2012a; Ramadugu et al. 2015; Ammar et al. 2016) and, additionally, establishing a standard curve with a known quantity of ‘CLas’ DNA as a reference DNA sample (Li et a. 2006; Li et al. 2008; Manjunath et al. 2008; Lopes et al 2013). Studies by Kunta et al. (2014) conducted comparative assays using different primer sets for both conventional and real-time PCR for detection of ‘CLas’ in leaf and root samples of ‘Valencia’ sweet orange grafted on sour orange. Their studies showed the root samples that yielded ‘CLas’ positive Ct values (22.90 to 31.78) with the 16S primers-probe set of Li et al. (2006) were false positives, and the 16S primers-probe produced non-specific amplification due to shared similarity with the -glucosidase gene of several Proteobacteria. Kunta et al. (2014) noted that the primer sets Las606/LSS and A2/J5 for cPCR, and LJ900fpr and CQULA for qPCR are more reliable for root samples. Coy et al. (2014) indicated that the ‘CLas’ 16S primer-probe set is not consistent in its performance compared to the wg gene in psyllid DNA. For instance, the Ct values for 16S were about 24.5 for all four components of a ten-fold dilution series of a psyllid sample, whereas the serial dilution for the wg gene from the same sample was normal, and overall found no correlation in the efficiencies for most psyllid samples between the 16S and wg genes. Coy et al. (2014) hypothesised that some contaminants that are co-extracted with the target DNA along with other factors caused this problem. While the contribution of the current diagnostic methods developed by many studies, especially that of Li et al. (2006), is indisputable, it is vital to examine and evaluate the results obtained in this study more closely. It is possible that there are some compounds in the samples that interfere with the amplification of the target gene, and it is also possible that there are differences in the isolates of the pathogen in Bhutan that is not detected by the A2/J5 primers. Therefore, it is pertinent to determine whether the current observations are due to the techniques used or variation in the pathogen by analysing the current samples using other primer-probe sets for qPCR, and other primers for cPCR. 298 8.2.3 Incidence of ‘CLas’ and Diaphorina citri at higher elevations Different studies have attributed different factors to the distribution of insects along altitude gradients such as low temperature affecting psyllid development, disruption of synchrony between insect and its host plant due to changes in temperature, increased parasitism, and changes in plant biochemistry due to UV-B (Hill & Hodkinson 1992; Hodkinson 2005; Jenkins et al. 2015). I found that incidences of ‘CLas’ was low at 1200 m and above while Diaphorina citri rarely occurred at 1200 m and above in Tsirang. What is interesting is comparing the results obtained at 1100 m, where both ‘CLas and high population of Diaphorina citri exist, with those from 1200 m where the psyllid rarely occurs. Different elevation delimitation for Diaphorina citri had been observed in different places. As discussed in Chapter 5, Diaphorina citri has been reported as high as 1700 m in Taif in Saudi Arabia (Bové 2014), though elevation in Google Earth suggest that the observations in Taif were at elevations possibly ~1450 m. In Puerto Rico, Jenkins et al. (2015) did not observe the psyllid above 600 m, but observed few psyllids at Adjuntas which is about 580 m ASL where Diaphorina citri was first detected in 2001 by Philip Stansly and Robert Rouse (Halbert & Núñez 2004). Flores et al. (2009) also observed the psyllid at Adjuntas in contrast to Pluke et al (2008) who did not detect the psyllid during surveys conducted in 2004–2005. Based on the results of my studies in Tsirang, and the early records of Diaphorina citri, ambient temperatures, RH, and rainfall, it would be useful to evaluate the differences in UV index at these different elevations and to test samples of plants from different elevations for differences in phenolic compounds (e.g., flavonoids, tannins and coumarins). The phenolic compounds are said to play important roles in UV protection and have anti-microbial and antiherbivore effects (Kuhlmann & Müller 2011; Katerova et al. 2012). Identification of genes responsible for such changes, and potential manipulation of those genes in either plants or psyllids, would be another avenue to explore for management of HLB. 299 8.2.4 Phylogeny of Cacopsylla heterogena Although, the green psyllid on citrus was identified as Cacopsylla heterogena based on morphological descriptions, I could not obtain sufficient evidence to separate Cacopsylla heterogena from Cacopsylla citrisuga. Therefore, future work should include more samples of Cacospylla citrisuga and of Cacopsylla heterogena from Yunnan, and other locations. Additional molecular markers, especially those derived from nuclear genes, should be used to compare and resolve the taxonomic status of Cacopsylla heterogena and Cacopsylla citrisuga. 8.2.5 Cacopsylla heterogena and ‘CLas’ Although the results of my study indicate that Cacopsylla heterogena poses minimum threat as a vector of ‘CLas’, there are certain questions that I did not have the opportunity to explore. Therefore, it would be useful to examine and evaluate these further:  Firstly, a larger number of psyllid samples and the corresponding host plant samples must be collected and tested for the presence of ‘CLas’. Psyllid samples should consist of 4th–5th instar nymphs and adults. This will be helpful to determine whether the nymphs can acquire ‘CLas’. In my studies, I collected both nymphs and adults from areas where some of the host plants tested positive for ‘CLas’, but I was not able to sample nymphs from plants known to be infected.  Secondly, it should be determined whether Cacopsylla heterogena can transmit ‘CLas’. This may be achieved by releasing adults on ‘CLas’-infected plants and monitoring for ‘CLas’ infection in both nymphs and eclosing adults. In the field, Cacopsylla heterogena is found on mandarin, lime, lemon and oranges so development on citrus is not a limitation as was found for Diaphorina communis (Chapter 3). Subsequently, if found to be able to acquire ‘CLas’, the resulting populations (preferably second generation adults that have fed on ‘CLas’infected plants as nymphs) should be placed in cages with healthy plants to determine whether Cacopsylla heterogena can transmit the pathogen. Determination of whether Cacopsylla heterogena can transmit ‘CLas’ is 300 important, because ‘CLas’ is present at higher elevations where Cacopsylla heterogena is found. I suspect these ‘CLas’-infection may have resulted from the planting of infected material when the orchards were established. This has implications if the focus of citrus production moves to higher altitudes in Bhutan, and is relevant to other countries with similar conditions. 8.2.6 Murraya species Although Murraya elongata and Murraya sumatrana can be separated based on their molecular biology, the failure to differentiate between Murraya elongata and Murraya sumatrana based on leaflet morphology emphasises the need to include the flowers and fruits in morphological descriptions. My studies found the fruits of Murraya elongata to be globose based on the pictures of fruits of Murraya elongata from Bhutan and China, and compared with the picture of fruits of Murraya sumatrana in Nguyen (2011). Therefore, more plant samples collected from different parts in Asia need to be assessed to confirm the formation of globose fruit by Murraya elongata. Although I found that the eggs and young nymphs of Diaphorina citri on the plants of Murraya elongata that I observed in April 2015, there was no opportunity to determine the presence of ‘CLas’ in the adults that laid these eggs, as the adults were not present. The few nymphs that were present were young instars and were unlikely to harbour the pathogen. Therefore, further work must also determine whether M. elongata can be a host of the pathogen and whether Diaphorina citri can acquire the pathogen. This is important in the context of management of HLB and psyllids. 8.2.7 Wild citrus My studies on the wild citrus species found in Bhutan included four cpDNA and one nuclear gene; however, to resolve the status of wild citrus, a larger number of genes from a wide range of possible parents should be assessed. Additionally, both flowers and fruits of the true citrus species that are possible parents of these accessions should be examined and described, as the current descriptions of the flowers and 301 fruits of both Citrus cavaleriei (syn. Citrus ichangensis) and Citrus latipes made by different authors (Swingle & Reece 1967; Grierson 1991; Zhang et al. 2008) vary (Tables 8.1 and 8.2). From these descriptions, it appears that the flowers of Citrus cavaleriei can be single or in racemes and the fruit globose or pyriform, and the flowers of Citrus latipes may be solitary or in racemes. These descriptions suggest that each may be referring to more than one taxon. 302 Table 8.1. A comparison of the descriptions of the flowers of Citrus cavaleriei and Citrus latipes. Authority Citrus cavaleriei Citrus latipes Swingle & Reece (1967) Flowers borne singly in the leaf axils; 2.5-3 cm diameter, white, 5-numerous Flowers borne in small axillary racemes with 5–7 flowers, 4numerous Zhang et al. (2008) Flowers solitary or to 9 in fascicles, 3–3.5 cm in diameter; Petals 4 or 5, – Grierson (1991) – Flowers solitary or in short racemes, 4-numerous, Table 8.2. A comparison of the descriptions of the fruit of Citrus cavaleriei and Citrus latipes. Authority Citrus cavaleriei Citrus latipes Swingle & Reece (1967) Fruits small (3–4 diameter in dried state, 3.5-5cm when fresh), with 7–9 locules,; pulp– vesicles very few; seeds few, large, very thick, Fruit almost globular with compressed ends, oil cells moderately small, fruit peel much thicker (5–6 mm) than that of Citrus cavaleriei (2–4 mm); seeds are smaller and more numerous than Citrus cavaleriei and arranged in 5–7 in each segment. Zhang et al. (2008) Fruit oblate, globose, or pyriform, usually 3–5 × 4–6 cm but when pyriform to 9–10 × 7– 8(–12) cm, with narrow longitudinal grooves, oil dots large and conspicuously prominent, base rounded, apex rounded, dimpled, and with or without a papilla; pericarp to 2 cm thick but usually much less; sarcocarp in 7–13 segments; seeds 30 or more, subglobose to irregularly pyramidal, – Grierson (1991) – Fruit subglobose, c 5cm diameter, peel somewhat thick, segment c 9, seed numerous 303 8.3 Implications for citriculture in Bhutan Based on the findings of my studies and observations made during the study period, the following recommendations are made:  It is essential that pathogen-free planting materials are produced under conditions protected from Diaphorina citri. Moreover, production facilities should not be located in areas where the psyllid occurs e.g., Bhur in Gelephu, Sarpang, or Bajo in Wangdue Phodrang. The current situation of HLB in Bhutan resulted from establishment of orchards with plants infected with HLB and infested with Diaphorina citri. Records indicate the presence of Diaphorina citri and HLB in orchards at Phuentsholing as early as the 1970s although the presence of ‘CLas’ was not confirmed until 2002 after orchards in Punakha Dzongkhag (~1200 m ASL) started to exhibit severe HLB-like symptoms in the mid-1990s. The disease though more prevalent at lower altitude still prevails in places where Diaphorina citri does not occur reaffirming the use of infected materials.  Citrus production based on suitable varieties should be viable from 1200 m to 1700 m in the absence of Diaphorina citri and HLB, or where Diaphorina citri rarely occurs, and with effective management of powdery mildew. Therefore, importance should be given to plant breeders and plant protection personnel collaborating to improve citrus varieties suitable for higher elevations.  Production below 1200 m is also feasible if all citrus below 1200 m in Bhutan is progressively removed (most trees are already dead or dying) and replanted at high densities with certified pathogen-free trees under strict quarantine.  Likewise all Bergera koenigii and Murraya paniculata plants within and in close proximity to production regions below 1200 m must be removed before pathogen free trees are planted.  Insecticides can be used to slow the spread of HLB but will not prevent spread. Area-wide management is essential in places where many orchards are present close to each other. However, spraying in most orchards in Bhutan is difficult due to tall trees, rugged terrains, low availability of water and difficulties with accessing suitable spray equipment. 304 Nevertheless, mineral oils should be evaluated for suppression of Cacopsylla heterogena populations in higher elevations as high populations of this psyllid cause severe foliage damage. Control of Diaphorina citri will also be required on immature trees planted below 1200 m and application of mineral oils and other chemicals during flush growth cycles should be evaluated for this purpose.  Impacts of Cacopsylla heterogena damage on the growth of immature trees should be assessed and studies undertaken to identify its natural enemies (no parasitoids were observed in my study, possibly because the galls are so tightly closed that oviposition by parasitoids is severely impeded) and impacts of these natural enemies on populations of the psyllid. 305 References Achor DS, Chung KR, Exteberria E, Wang N, Albrigo LG. 2008. Anatomical evolution of symptoms from infection with the HLB bacterium. Proceedings of the International Conference on Huanglongbing, Orlando, Florida, 2–5 December 2008. Abstract 5.3. Adams PS. 2006. Data analysis and reporting. In: Dorak M (ed), Real-time PCR. New York: Taylor & Francis Group. pp. 39–61. Ahlawat YS, Baranwal VK, Thinlay, Doe Doe, Majumder S. 2003. First report of citrus greening disease and associated bacterium “Candidatus Liberibacter asiaticus” from Bhutan. Plant Disease 87: 488. Akarapisan A. 2012. The current status of huanglongbing (HLB) epidemic in Thailand. Proceedings of the International Symposium on Epidemiology and Disease Management of Citrus Huanglongbing Disease for Sustaninable Citrus Production in the ASPAC Region, 5–10 November 2012, National Taiwan University, Taipei, Taiwan. Altamirano DM, Gonzales CI, Viñas RC. 1976. Analysis of the devastation of leaf-mottling (greening) disease of citrus and its control program in the Philippines. In Calavan EC (ed), Proceedings of the Seveth Conference of the International Organization of Citrus Virologists, Athen, Greece, 29 September ‒ 4 October 1975. Riverside: International Organization of Citrus Virologists, University of California: Riverside. pp. 22‒26. Álvarez I, Wendel JF. 2003. Ribosomal ITS sequences and plant phylogenetic inference. Molecular Phylogenetics and Evolution 29: 417‒434. Amar M, Sablok, G., Biswas M, Dulloo E, Guo W. Unpublished. Molecular phylogeny in Citrus L. (Rutaceae) inferred through ITS. https//www.ncbi.nlm.nih.gov/nuccore/ JN681155. Aubert B, Garnier M, Guillaumin D, Herbagyandono B, Setiobudi L, Nurhadi F, 1985. Greening, a serious threat for the citrus productions of the Indonesian Archipelago. Future prospects of integrated control. Fruits 40: 549–563. 306 Aubert B, Grisoni M, Villemin M, Rossolin G. 1996. A case study of huanglongbing (greening) control in Réunion. In: da Graca JV, Morena p, Yokomi RK (eds), Proceedings of the Thirteen Conference of the International Organization of Citrus Virologists, University of California, Riverside. pp. 276–278. Aubert B, Quilici S. 1988. Monitoring adult psyllas on yellow traps in Reunion Island. In: Garnsey SM, Timmer LW, Dodds JA (eds), Proceedings of the Tenth Conference of International Organization of Citrus Virologists, Valencia, Spain, 17–21 November 1986. Riverside: International Organization of Citrus Virologists, University of California: Riverside. pp. 249–254. Aubert B. 1987. Trioza erytreae del Guercio and Diaphorina citri Kuwayama (Homoptera: Psylloidea), the two vectors of citrus greening disease: Biological aspects and possible control strategies. Fruits 42: 149–162. Aubert B. 1990. High density planting (HDP) of Jiaogan mandarin in the lowland area of Shantou (Guangdong China) and implications for greening control. In: Aubert A, Tontyaporn S, Buangsuwon D (eds.), Proceedings of the Fourth International Asia Pacific Conference on Citrus Rehabilitation, Chiang Mai, Thailand, 4–10 February 1990. Rome: FAO UNDP. pp. 149–157. Aubert B. 1990. Integrated activities for the control of huanglongbing-greening and its vector Diaphorina citri Kuwayama in Asia. In: Aubert B, Tontyaporn S, Buangsuwon D (eds), Proceedings of the Fourth International Asia Pacific Conference on Citrus Rehabilitation, Chiang Mai, Thailand, 4–10 February 1990. Rome: FAO UNDP. pp. 133–144. Aubert B. 1992. Citrus greening disease, a serious limiting factor for citriculture in Asia and Africa. In: Tribulato E, Gentile A, Refergiato G (eds), Proceedings of the Seventh International Society of Citriculture Congress, Acireale, Italy, 8–9 March 1992. 2: 817–820. Aubert B. 2008. Huanglongbing (HLB) a graft-transmissible psyllid borne citrus disease: diagnosis and strategies for control in Reunion Island. Proceedings of the International Research Conference on Huanglongbing, Orlando, Florida, 2–5 December 2008. Addenda. 34 pp. 307 Aubert B. 2009. A new threat to Mediterranean citrus. Huanglongbing (HLB) in 16 questions and answers. FruiTrop 168: 2−7. Audisio P, Brustel H, Carpaneto GM, Coletti G, Mancini E, Trizzino M, Antonini G, De Biase A. 2009. Data on molecular taxonomy and genetic diversification of the European hermit beetles, a species complex of endangered insects (Coleoptera: Scarabaeidae, Cetoniinae, Osmoderma). Journal of Zoological Systematics and Evolutionary Research 47: 88–95. Augustinos AA, Drosopoulou E, Gariou-Papalexiou A, Bourtzis K, Mavragani-Tsipidou P, Zacharopoulou A. 2014. The Bactrocera dorsalis species complex: comparative cytogenetic analysis in support of sterile insect. Technical Applications. BMC Genetics 15: S16. Baldwin BG, Sanderson MJ, Porter JM, Wojciechowski MF, Campbell CS, Donoghue MJ. 1995. The ITS region of nuclear ribosomal DNA: a valuable source of evidence on angiosperm phylogeny. Annals of the Missouri Botanical Garden 82: 247–277. Baldwin BG. 1992. Phylogenetic utility of the internal transcribed spacers of nuclear ribosomal DNA in plants: an example from the Compositae. Molecular Phylogenetics and Evolution 1: 3–16. Barkley NA, Roose ML, Krueger RR, Federici CT. 2006. Assessing genetic diversity and population structure in a citrus germplasm collection utilizing simple sequence repeat markers (SSRs). Theoretical and Applied Genetics 112: 1519–1531. Barr N, Hall D, Weathersbee A, Nguyen R, Stansly P, Qureshi J, Flores D. 2009. Comparison of laboratory colonies and field populations of Tamarixia radiata, an ectoparasitoid of the Asian citrus psyllid, using internal transcribed spacer and cytochrome oxidase subunit I DNA sequences. Journal of Economic Entomology 102: 2325–2332. Bassanezi RB, Bassanezi RC. 2008. An approach to model the impact of huanglongbing on citrus yield. Proceedings of the International Conference on Huanglongbing, Orlando Florida 2–5 December, 2008. pp. 301–304. 308 Bassanezi RB, Montesino LH, Stuchi ES. 2009. Effects of huanglongbing on fruit quality of sweet orange cultivars in Brazil. European Journal of Plant Pathology 125: 565– 572. Bassanezi RB, MontesinoLH, Gasparoto MCG, Filho AB, Amorium L. 2011. Yield loss caused by huanglongbing in different sweet orange cultivars in São Paulo, Brazil. European Journal of Plant Pathology 130: 577–586. Baum DA, Smith SD. 2013. Tree thinking: an introduction to phylogenetic biology. Roberts and Company Publishers, Inc. Colorada, USA. Bausher MG, Singh ND, Lee S-B, Jansen RK, Daniell H. 2006. The complete chloroplast genome sequence of Citrus sinensis (L.) Osbeck var 'Ridge Pineapple': organization and phylogenetic relationships to other angiosperms. BMC Plant Biology 6: 1–11. Bayer RJ, Mabberley DJ, Morton C, Miller CH, Sharma IK, Pfeil BE, Rich S, Hitchcock R, Sykes S. 2009. A molecular phylogeny of the orange subfamily (Rutaceae: Aurantioideae) using nine cpDNA sequences. American Journal of Botany 96: 668– 685. Beard S, Bulman S. Unpublished. NGS for identification of trapped insects. https://www.ncbi.nlm.nih.gov/nuccore/KC008074 Beattie GAC, Barkley P. 2009. Huanglongbing and its vectors: A pest–specific contingency plan for the citrus and nursery and garden industries (Version 2), February 2009. Horticulture Australia Ltd., Sydney. 272 pp. Beattie GAC, Holford P, Haigh AM, Nguyen HC, Mabberley DJ, Weston PH, Broadbent P, Spooner–Hart RN. 2012. Huanglongbing: research & insights from collaborative research in Southeast Asia. Proceedings of the International Symposium on Epidemiology and Disease Management of Citrus Huanglongbing Disease for Sustainable Citrus Production in the ASPAC Region, 5–10 November 2012, National Taiwan University, Taipei, Taiwan (In press). Beattie GAC, Holford P, Haigh T. 2010. Huanglongbing management for Indonesia, Vietnam and Australia. Final Report HORT/2000/043. Australian Centre for International Agricultural Research, Canberra. 309 Beattie GAC, Holford P, Mabberley DJ, Haigh AM, Broadbent P. 2008. Australia and huanglongbing. In: Ku TY, Pham THH (eds), Proceedings of FFTC-PPRI-NIFTS Joint Workshop on Management of Citrus Greening and Virus Diseases for the Rehabilitation of Citrus Industry in the ASPAC, Plant Protection Research Institute, Hà Nội, Việt Nam, 8–12 September 2008. pp. 75–100. Beattie GAC, Holford P, Mabberley DJ, Haigh AM, Broadbent P. 2009. On the origins of Citrus, huanglongbing, Diaphorina citri and Trioza erytreae. In: Gottwald TR, Graham JH (eds), Proceedings of the International Conference on Huanglongbing, Orlando, Florida 2–5 December 2008. pp. 23–56. Ben-Yakir D, Fereres A. 2016. The effects of UV radiation on arthropods: a review of recent publications (2010–2015). Acta Horticulturae 1134: 335–342. Beveridge TJ. 1981. Ultrastructure, chemistry, and function of the bacterial cell wall. International Review of Cytology 72: 5225–5232. Bhagabati KN. 1993. Survey of greening disease of mandarin orange in the Northeastern states of India. In: Moreno P, da Graca JV, Timmer LW (eds), Proceedings of the Twelfth Conference of the International Organization of Citrus Virologists, New Delhi India, 23‒27 November 1992. Riverside: Internaitonal Organization of Citrus Virologists, University of California: Riverside. pp. 441‒442. Bistline-East A, Hoddle MS. 2016. Biology of Psyllaphycus diaphorinae (Hymenoptera: Encyrtidae), a Hyperparasitoid of Diaphorencyrtus aligarhensis (Hymenoptera: Encyrtidae) and Tamarixia radiata (Hymenoptera: Eulophidae). Annals of the Entomological Society of America. 109: 22–28. Blumthaler M, Ambach W, Ellinger R. 1997. Increase in solar UV radiation with altitude. Journal of Photochemistry and Photobiology B: Biology 39: 130–134. Bouček Z, Askew RR. 1968. Index of paleartic eulophidae (Index of entomophogous insects). Le François. Bové J. 2014. Heat-tolerant Asian HLB meets heat-sensitive African HLB in the Arabian Peninsula! Why? Journal of Citrus Pathology 1: 1–78. 310 Bové JM, Dwiastuti ME, Trivatna A, Supriyanto A, Nasli E, Becu P, Garnier M. 2000. Incidence of huanlongbing and citrus rehabilitation in North Bali, Indonesia. In: da Graça JV, Lee RF, Yokomi RK (eds.), Proceedings of the Fourteen Conference of the International Organization of Citrus Virologists, Campinas, Sáo Paulo, Brazil, 13–18 September 1998. Riverside: International Organization of Citrus Virologists, University of California: Riverside. pp. 200–206. Bové JM, Garnier M. 1984 Citrus greening and psylla vectors of the disease in the Arabian Peninsula. In: Garnsey SM, Timmer LW, Dodds JA (eds), Proceedings of the Ninth Conference of the International Organization of Citrus Virologists, Puerto Iguacu, Misiones, Argentina, 9–13 May 1983. Riverside: International Organization of Citrus Virologists, University of California, Riverside. pp. 109–114. Bové JM. 2004. Control of citrus huanglongbing (ex-greening) and citrus tristeza virus. Report of First Mission, October 9 to 24, 2004. Bhutan, FAO Technical Cooperation program/BHU/3001 (A). TR: NPPC / ADM-25. Technical report 1. Bové JM. 2006. Huanglongbing: a destructive, newly emerging, century-old disease of citrus. Journal of Plant Pathology 88: 7–37. Bové JM. 2014. Heat-tolerant Asian HLB meets heat-sensitive African HLB in the Arabian Peninsula! Why? Journal of Citrus Pathology 1: 1–78. Bové, JM, Garnier M, Ahlawat YS, Chakraborty NK, Varma A. 1993. Detection of the Asian strains of the greening BLO by DNA-DNA hybridization in Indian orchard trees and Malaysian Diaphorina citri psyllids. In: Moreno P, da Graça, JV, Timmer LW (eds), Proceedings of the Twelfth Conference of the International Organization of Citrus Virologists, New Delhi, India 23–27 November 1992. Riverside: International Organization of Citrus Virologists, University of California, Riverside. pp. 258–263. Boykin LM, De Barro P, Hall DG, Hunter WB, McKenzie CL, Powell CA, Shatters, RG. 2012. Overview of worldwide diversity of Diaphorina citri Kuwayama mitochondrial cytochrome oxidase 1 haplotypes: two Old World lineages and a New World invasion. Bulletin of Entomological Research 102: 573–582. 311 Boykin LM, Shatters RG, Rosell RC, McKenzie CL, Bagnall RA, De Barro P, Frohlich DR. 2007. Global relationships of Bemisia tabaci (Hemiptera: Aleyrodidae) revealed using Bayesian analysis of mitochondrial COI DNA sequences. Molecular Phylogenetics and Evolution 44: 1306–1319. Broadbent P, Fraser LR. 1979. Winter yellows of citrus. Agricultural Gazette of New South Wales 90: 41. Brown SE, Oberheim AP, Barret A, McLaughlin WA. 2011. First report of ‘Candidatus Liberibacer asiaticus’ associated with huanglongbing in the weeds Cleome rutidosperma, Pisonia aculeate and Trichostigma octandrum in Jamaica. New Disease Reports 24: 25. Buitendag CH, von Broembsen LA. 1993. Living with citrus greening in South Africa. In: Moreno P, da Graca JV, Timmer LW (eds), Proceedings of the Twelfth Conference of the International Organization of Citrus Virologists, New Delhi, India, 23–27 November 1992. Riverside: International Organization of Citrus Virologists, University of California: Riverside. pp. 269–273. Burckhardt D. 1985. Taxonomy and host plant relationships of the Trioza apicalis Förster complex (Hemiptera: Triozidae). Insect Systematics & Evolution 16: 415–432. Burckhardt D. 1994. Psylloid pests of temperate and subtropical crop and ornamental plants (Hemiptera, Psylloidea): A review. Trends Agricultural Science Entomology 2: 173– 186. Butler CD, Trumble JT. 2011. New records of hyperparasitism of Tamarixia triozae (Burks) (Hymenoptera: Eulophidae) by Encarsia spp. (Hymenoptera: Aphelinidae) in California. The Pan-Pacific Entomologist 87: 130–133. Caldwell MM, Björn LO, Bornman JF, Flint SD, Kulandaivelu G. 1998. Effects of increased solar ultraviolet radiation on terrestrial ecosystem. Journal of Photochemistry and Photobiology B, Biology 46: 40−52. Cameron SL. 2014. Insect mitochondrial genomics: implications for evolution and phylogeny. Annual Review of Entomology 59: 95–117. 312 Canestrelli D, Bisconti R, Nascetti G. 2014. Extensive unidirectional introgression between two salamander lineages of ancient divergence and its evolutionary implications. Scientific Reports 4: 1–7. Capoor SP, Rao DG, Viswanath SM. 1967. Greening disease of citrus in the Deccan Trap country and its relationship with the vector Diaphorina citri Kuwayama. In: weathers LG, Cohen M (eds), Proceedings of the Sixth Conference of eh International Organization of Citrus Virologists, Mbabane, Swaziland, 21–28 August 1972. Richmond: University of California, Division of Agricultural Sciences. pp. 43–49. Capoor SP, Rao DG, Viswanath SM. 1974. Greening disease of citrus in the Deccan Trap country and its relationship with the vector Diaphorina citri Kuwayama. In: Weathers LG, Cohen M (eds), Proceedings of the Sixth Conference of the International Organization of Citrus Virologists, Mbabane, Swaziland, 21–28 August 1972. Richmond: University of California, Division of Agricultural Sciences. pp. 43– 49. Capoor SP. 1963. Decline of citrus trees in India. Bulletin of the National Institute of Science of India 24: 48–64, Carbonell-Caballero J, Alonso R, Ibañez V, Terol J, Talon M, Dopazo J. 2015. A phylogenetic analysis of 34 chloroplast genomes elucidates the relationships between wild and domestic species within the genus Citrus. Molecular Biology and Evolution 32: 2015–2035. Caterino MS, Cho S, Sperling FA. 2000. The current state of insect molecular systematics: a thriving Tower of Babel. Annual Review of Entomology 45: 1–54. Catling HD, Garnier M, Bové JM. 1978. Presence of citrus greening disease in Bangladesh and a new method for rapid diagnosis. FAO Plant Protection Bulletin 26: 16–18. Catling HD. 1968a. Report on a visit to Nepal. FAO report PL. T/67/2. (mimeograph) Catling HD. 1968b. Report to the Government of the Philipines on the distribution and biology of Diaphorina citri, the vector of leaf mottling (greening) disease of citrus. United Nations Development Programme TA 2589. Rome: FAO. 14 pp. plus figures. 313 Catling HD. 1970. Distribution of the psyllid vectors of citrus greening disease, with notes on the biology and bionomics of Diaphorina citri. FAO Plant Protection Bulletin 18: 8–15. Celino CS, Salibe AA, Cortez RE. 1966. Diaphorina citri Kuway, the insect vector for the leap mottling virus of citrus in the Philippines. Manila, Bureau of Plant Industry. 3 pp. Cen Y, Gao J, Deng X, Xia Y, Chen J, Zhang L, Guo J, Gao W, Zhou W, Wang Z. 2012b. A new insect vector of ‘Candidatus Liberibacter asiaticus’ Cacopsylla (Psylla) citrisuga (Hemiptera: Psyllidae). Abstracts of the Twelfth International Citriculture Congress, Valencia, Spain 18–23. November 2012. pp. 194. Cen YJ, Zhang LN, Xia YL, Guo J, Deng XL, Zhou WJ, Sequeira GJ, Gao JY, Wang ZR, Yue JQ, Gao YQ. 2012a. Detection of 'Candidatus Liberibacter asiaticus' in Cacopsylla (Psylla) citrisuga (Hemiptera: Psyllidae). Florida Entomologist 95: 304– 311. Chaitanya BN, Asokan R, Rebijith KB, Ranjitha Hande H, Krishna Kumar NK. Unpublished. https://www.ncbi.nlm.nih.gov/nuccore/KF702297, KF702299, KF702304 Chavan VM. 2004. Investigations on citrus psylla, Diaphorina citri Ku., a vector of citrus greening disease in Maharashtra. Journal of Maharashtra Agricultural University 29: 290–293. ChavanVM, Summanwar AS. 1993. Population dynamics and aspects of the biology of citrus psylla, Diaphorina citri Kuw., in Maharashtra. In: Moreno P, da Graça JV, Timmer LW (eds), Proceedings of the Twelfth Conference of the International Organization of Citrus Virologists, New Delhi, India, 23–27 November 1992. Riverside: International Organization of Citrus Virologists, University of California: Riverside. pp. 286−290. Cheema SS, Chohan JS, Kapur SP. 1982. Effect of moist hot air on citrus greening infected budwood. Journal of Research, India 19: 97–99. 314 Cheema SS, Kapur SP. 1975. Murraya paniculata Linn. ―A new host for Diaphorina citri Kuwayama. Current Science 44: 249. Chien CC, Chiu SH, Ku SC. 1989. Biological control of Diaphorina citri in Taiwan. Fruits 44: 401–407. Chien CC, Chu YI, Ku SC. 1991. Biological control of citrus psyllid, Diaphorina citri in Taiwan. II. Evaluation of Tamarixia radiata and Diaphorencyrtus diaphorinae for control of Diaphorina citri. Chinese Journal of Entomology 11: 25–38. Chien CC, Chu YI. 1996. Biological control of citrus psyllid, Diaphorina citri in Taiwan. International Journal of Pest Management 34: 93–105. Chiu SC, Aubert B, Chien CC. 1988. Attempts to establish Tetrastichus radiatus Waterston (Hymensptera, Chalchidoidea), a primary parasite of Diaphorina citri Kuwayama in Taiwan. In: Garnsey SM, Timmer LW, Dodds JA (eds), Proceedings of the Tenth Conference of International Organization of Citrus Virologists, Valencia, Spain, 17– 21 November 1986. Riverside: International Organization of Citrus Virologists, University of California: Riverside. pp. 265–268. Chiyaka C, Singer BH, Halbert SE, Morris JG (Jr), van Bruggen AHC. 2012. Modeling huanglongbing transmission within a citrus tree. Proceedings of the National Academy of Sciences 109: 12213–12218. Chomnunti P, Schoch CL, Aguirre-Hudson B, Ko-Ko TW, Hongsanan S, Gareth Jones EB, Kodsueb R, Phookamsak R, Chukeatirote E, Bahkali AH, Hyde KD. 2011. Capnodiaceae. Fungal Diversity 51: 103. doi:10.1007/s13225-011-0145-6 Clausen CP. 1933. The citrus insects of tropical Asia. Lingnan Science Journal 15: 127– 132. Clegg MT, Zurawski G. 1992. Chloroplast DNA and the study of plant phylogeny: present status and future prospects. In: Soltis PS, Soltis DE, Doyle JJ (eds), Molecular Systematics of Plants. Chapman and Hall. New York. pp. 1–13. Cognato AI. 2006. Standard percent DNA sequence difference for insects does not predict species boundaries. Journal of Economic Entomology 99: 1037–45. 315 Conant P, Hirayama C, Kumashiro BR, Hew RA, Young CL. 2006. Asian citrus psyllid Diaphorina citri Kuwayama (Hemiptera: Psyllidae). State of Hawaii Department of Agriculture, New Pest Advisory, Updated February 2009. http://hawaii.gov/hdoa/pi/ppc/npa-1/npa06-01-ACP.pdf Costa M, del Lama MA, Melo G, Sheppard W. 2003. Molecular phylogeny of the stingless bees (Apidae, Apinae, Meliponini) inferred from mitochondrial 16S rDNA sequences. Apidologie 34: 73–84. Coy MR, Stelinski LL. 2015. Great variability in the infection rate of 'Candidatus Liberibacter asiaticus' in field populations of Diaphorina citri (Hemiptera: Liviidae) in Florida. Florida Entomologist 98: 356–7. Crawford DL. 1912. Indian Psyllidae. Records of the Indian Museum 7: 419–435. Euphalerus citri Crawford, pp. 424–425, Plate XXXIII, Figs N, O, P and Plate XXXV, Fig.D. Crawford DL. 1913. New genera and species of Psyllidae from the Philippine Islands. The Philippine Journal of Science 8: 293–310, Plate I. Crawford DL. 1917. Philippine and Asiatic Psyllidae. The Philippine Journal of Science 12: 163–175. 1 plate. Crawford DL. 1919. The jumping plant lice of the Palaeotropics and the South Pacific Islands. Philippine Journal of Science 15: 139–207, Plates I–III. Crawford DL. 1924. New Indian Psyllidae. Records of the Indian Museum 26: 615–621. Crawford JE, Riehle MM, Guelbeogo WM, Gneme A, Sagnon NF, Vernick KD, Nielsen R, Lazzaro BP. 2015. Reticulate speciation and barriers to introgression in the Anopheles gambiae species complex. Genome Biology and Evolution 7: 3116–3131. da Graça JV. 1991. Citrus greening diseases. Annual Review of Phytopathology 29: 109– 136. da Graca JV. 2008. Biology, history and world status of huanglongbing. Proceedings of an International Workshop on Citrus Huanglongbing (‘Candidatus Liberibacter asiaticus’) and the Asian citrus psyllid (Diaphorina citri), Hermosillo Sonoro, 316 Mexico 7–9 May 2008. North American Plant Protection Organisation: Ottawa, Ontario, Canada. Damsteegt V, Postnikova E, Stone A, Kuhlmann M, Wilson C, Sechler A, Schaad N, Brlansky R, Schneider W. 2010. Murraya paniculata and related species as potential hosts and inoculum reservoirs of ‘Candidatus Liberibacter asiaticus’, causal agent of huanglongbing. Plant Disease 94: 528–533. Danforth BN, Lin CP, Fang J. 2005. How do insect nuclear ribosomal genes compare to protein‐coding genes in phylogenetic utility and nucleotide substitution patterns? Systematic Entomology 30: 549–562. Daniel C, Knoess W. Unpublished. https://www.ncbi.nlm.nih.gov/nuccore/FJ606752 Davis RI, Gunua TG, Kame MF, Tenakanai D, Ruabete TK. 2005. Spread of citrus huanglongbing (greening disease) following incursion into Papua New Guinea. Australasian Plant Pathology 34: 517‒524. De Bac G, Saponari M, Loconsole G, Martelli G, Yokomi R K, Catalano L, Breithaup J. 2010. First report of ‘Candidatus Liberibacter asiaticus’ associated with huanglongbing in Ethiopia. Plant Disease 94: 482. de León JH, Sétamou M. 2010. Molecular evidence suggests that populations of the Asian citrus psyllid parasitoid Tamarixia radiata (Hymenoptera: Eulophidae) from Texas, Florida, and Mexico represent a single species. Annals of the Entomological Society of America 103:100–110. Deng X, Lou Z, Feng Z, Li H, Chen J, Civerolo EL. 2008. First Report of ‘Candidatus Liberibacter asiaticus’ from Atalantia buxifolia in Guangdong, China. Plant Disease 92: 314. Deng XL, Zhou G, Li H, Chen JC, Civerolo EL. 2007. Nested-PCR detection and sequence confirmation of 'Candidatus Liberibacter asiaticus' from Murraya paniculata in Guangdong, China. Disease Notes. Plant Disease 91: 1051. Ding F, Wang G, Yi G, Zhong Y, Zeng j, Zhou B. 2005. Infection of wampee and lemon by the citrus huanglongbing pathogen (Candidatus Liberibacter asiaticus) in China. Journal of Plant Pathology 87: 207–212. 317 DNA Sequence Assembler v4 (2013), Heracle BioSoft, www.DnaBaser.co Doe Doe, Om N, Chencho D, Thinlay, Garnier M, Jagoueix S, Bové JM. 2003. First report of ‘Candidatus Liberibacter asiaticus’, the agent of citrus huanglongbing (Exgreening) in Bhutan. Plant Disease 87: 448. Doebley J. 1992. Molecular systematics and crop evolution In: Soltis PS, Soltis DE, Doyle JJ (eds) Molecular Systematics of Plants. Chapman and Hall. New York. pp. 202– 222. Dong W, Liu J, Yu J, Wang L, Zhou S. 2012. Highly variable chloroplast markers for evaluating plant phylogeny at low taxonomic levels and for DNA barcoding. PLoS 7: e35071. Donovan NJ, Beattie GAC, Chambers GA, Holford P, Englezou A, Hardy S, Dorjee, Wangdi P, Thinlay, Om N. 2012a. First report of ‘Candidatus Liberibacter asisaticus’ in Diaphorina communis. Australasian Plant Disease Notes 7: 1–4. Donovan NJ, Dorji K, Wangdi L, Sanderson G. 2016. A supply of healthy germplasm is the key to survival of the Bhutanese citrus industry. Food, Agriculture and Environment 14: 23−28. Donovan NJ, Holford P, Beattie GAC, Hardy S. 2012b. HORT 2005/142 Improving mandarin production in Bhutan and Australia through the implementation of on-farm best management practices: disease survey. Report submitted to ACIAR. Dorji K, Yapwattanaphun C. 2011. Morphological Identification of Mandarin (Citrus reticulata Blanco) in Bhutan. Kasetsart Journal-Natural Science 45: 793–802. Drake del Castillo E. 1892. Journal de Botanique (Morot). 6 (15–16): 276. Duan Y, Zhou L, Gottwald TR, Gabriel D. 2008. First report of dodder transmission of Candidatus Liberibacter asiaticus in Florida to tomato (Lycopersicon esculentum). Plant Disease 91: 227. Duminil J, Di Michele M. 2009. Plant species delimitation: A comparison of morphological and molecular markers. Plant Biosystems 143: 528−542. 318 Edwards ST, Lindley J. 1819–1920. The Botanical register: consisting of coloured figures of exotic plants cultivated in British gardens with their history and mode of treatment. Vol V. London: James Ridgeway. [Murraya exotica 434]. Efimov P. 2013. Sibling species of fragrant orchids (Gymnadenia: Orchidaceae, Magnoliophyta) in Russia. Russian Journal of Genetics 49: 299–309. Eng L. 2007. A presumptive field test for huanglongbing (citrus greening disease). Senior Officers’ Conference, Sawarak, Malaysia, 11–14 December 2007, Department of Agriculture, Sarawak. Étienne J, Quilici S, Marival D, Franck A. 2001. Biological control of Diaphorina citri (Hemiptera: Psyllidae) in Guadeloupe by imported Tamarixia radiata (hymenoptera: Eulophidae). Fruits 56: 307–315. Etxeberria E, Gonzalez P, Achor D, Albrigo D. 2009. Anatomical distribution of abnormally high levels of starch in HLB-affected Valencia orange trees. Physiological and Molecular Plant Pathology 74: 76–83. Fan GC, Cai ZJ, Weng QY, Ke C, Liu B, Zhou LJ, Duan Y-P. 2011. First report of a new host (Pithecellobium lucidum Benth) of the citrus huanglongbing bacterium, Candidatus Liberibacter asiaticus. In: Burns JK, Graham JH, Gottwald TR (eds), Proceedings of the Second International Research Conference on Huanglongbing, Orlando, Florida, USA, 10–14 January 2011. p. 137. Fan J, Chen CX, Yu QB, Khalaf A, Achor DS, Brlansky RH, Moore GA, Li ZG, Gmitter G Jr. 2012. Comparative transcriptional and anatomical anlyses of tolerant rough lemon and susceptible sweet orange in response to ‘Candidatus Liberibacter asiaticus’ infection. Molecular Plant Microbe Interactions 25: 1396–1407. Fegan M, Prior P. 2005. How complex is the ‘Ralstonia solanecearum species complex’? In: Allen C, Prior P, Hayward AC (eds), Bacterial wilt disease and the Ralstonia solanearum species complex. St. Paul Minnesota, APS Press. pp. 449–461 Felsenstein J. 1985. Confidence limits on phylogenies: an approach using the bootstrap. Evolution 39: 783–791. 319 Fletcher TB (ed.). 1917. Report of the Proceedings of the Second Entomological Meeting, Pusa, India, 5–12 February 1917. Calcutta: Superintendent Government Printing. pp. 213, 215–216. Fletcher TB (ed.). 1919. Report of the Proceedings of the Third Entomological Meeting, Pusa, India, 3–15 February 1919. Calcutta: Superintendent Government Printing.1: 276. Folimonova SY, Robertson CJ, Garnsey SM, Gowda S, Dawson WO. 2009. Examination of the response of different genotypes of citrus to huanglongbing (citrus greening) under different conditions. Phytopathology 99: 1346–1354. Fraser L. 1966. Citrus dieback in India. Report to the Department of External Affairs, Canberra, Australia. 95 pp. 15 figs. Fraser LR, Singh D, Capoor SP, Nariani TK. 1966. Greening virus, the likely cause of citrus dieback in India. FAO Plant Protection Bulletin 14: 127–130. Fraser LR, Singh D. 1966. Citrus greening virus: a new threat to citrus industry. Punjab Horticulture Journal 6: 104–107. Fraser LR, Singh D. 1969. Reaction of Indian citrus varieties to greening virus. In: Chapman HD (ed.), Proceedings of the First International Symposium, University of California, Riverside, 16–26 March 1968. California: Publications Department of the University of California. 1: 365–366. French PA, Brown GK, Bayly MJ. 2016. Incongruent patterns of nuclear and chloroplast variation in Correa (Rutaceae): introgression and biogeography in south-eastern Australia. Plant Systematics and Evolution 302: 447–468. Garnier M, Bové JM. 1983. Transmission of the organism associated with citrus greening disease from sweet orange. Phytopathology 73: 1358–1363. Garnier M, Bové JM. 1993. Citrus greening disease and the greening bacterium. In: Moreno P, da Graça JV, Timmer LW (eds), Proceedings of the Twelfth Conference of the International Organization of Citrus Virologists, New Delhi, India, 23–27 November 1992. Riverside: International Organization of Citrus Virologists, University of California, Riverside. pp. 212–219. 320 Garnier M, Bové JM. 1996. Distribution of the huanglongbing (greening) Liberobacter species in fifteen African and Asian countries. In: da Graca JV, Moreno P, Yokomi RK (eds), Proceedings of the Thirteenth Conference of the International Organization of Citrus Virologists, Fuzhou, Fujian, China, 16–23 November 1995. Riverside: International Organization of Citrus Virologists, University of California: Riverside. pp. 388–391. Garnier M, Bové JM. 2002. Survey for citrus HLB in Bhutan. Report to Government of Bhutan, 2002. 10 pp. Garnier M, Danel N, Bové JM. 1984a. The greening organism is a gram negative bacterium. In: Garnsey SM, Timmer LW, Dodds JA (eds), Proceedings of the Ninth Conference of the International Organization of Citrus Virologist, Puerto Iguacu, Misiones, Argentina, 9–13 May 1983. International Organization of Citrus Virologist, University of California: Riverside. pp. 115–124. Garnier M, Danel N, Bové JM. 1984b. Aetiology of citrus greening disease. Annals of Microbiology (Institute Pasteur) 135A: 169–179. Garnier M, Jagoueix-Eveillard S, Cronje PR, Le Roux HF, Bové JM. 2000. Genomic characterization of a liberibacter present in an ornamental rutaceous tree, Calodendrum capense, in the Western Cape Province of South Africa. Proposal of ‘Candidatus Liberibacter africanus subsp. capensis’. International Journal of Systematic and Evolutionary Microbiology 50: 2119–2125. Gasparoto MCG, Bassanezi RB, Amorim L, Montesino LH, Lourenco SA, Wulff NA, Teixeira DC, Mariano AG, Martins EG, Leite AP, Bergamin Filho A. 2010. First report of 'Candidatus Liberibacter americanus' transmission from Murraya paniculata to sweet orange by Diaphorina citri. Journal of Plant Pathology 92: 543– 546. Gasparoto MCG, Coletta-Filho HD, Bassanezi RB, Lopes SA, Lourenco SA, Amorim L. 2012. Influence of temperature on infection and establishment of ‘Candidatus Liberibacter asiaticus’ in citrus plants. Plant Pathology 61: 658–664. 321 Gasteiger E, Gattiker A, Hoogland C, Ivanyi I, Appel RD, and Bairoch A. 2003. ExPASy: the proteomics server for in-depth protein knowledge and analysis. Nucleic acids research 31: 3784–3788. Gavarra MR, Mercado BG, Gonzales CI. 1990. Progress report: Diaphorina citri trapping, identification of parasite and possible field establishment of the imported parasite, Tamarixia radiata in the Philippines. In: Aubert B, Tontyaporn S, Buangsuwon D (eds), Proceedings of the Fourth International Asia Pacific Conference on Citrus Rehabilation, Chian Mai, Thailand, 4–10 Febraury 1990. Rome: FAO UNDP. pp. 246–250. Ghosh SK, Giannotti J, Louis C. 1977. Multiplication intense des prokaryotes associés aux maladies de type «Greening» des Agrumes dans les cellules criblées de cuscutes. Annals of Phytopathology 9: 525–530. Ghosh SP. 1993. Mandarin production in the sub-Himalayan tracts of India, Nepal and Bhutan, and the prevalence of citrus greening disease. In: Moreno P, da Graça JV, Timmer LW (eds), Proceedings of the Twelfth Conference of the International Organization of Citrus Virologists, New Delhi, India, 23–27 November 1992. Riverside: International Organization of Citrus Virologists, University of California, Riverside. pp. 447–448. Gibson GAP, Huber JT, Woolley JB (eds). 1997. Annotated keys to the genera of Nearctic Chalcidoidea (Hymenoptera). NRC Research Press, Ottawa. Gielly L, Taberlet P. 1994. The use of chloroplast DNA to resolve plant phylogenies: noncoding versus rbcL sequences. Molecular biology and evolution 11: 769–777. Gonzales CI, Viñas RC, Vergara LA. 1972. Observations on 110 citrus cultivars in an area severely infested by leaf mottling. In: Price WC (ed.), Proceedings of the Fifth Conference of the International Organization of Citrus Virologists, Tokyo, Japan, 30 October 8–November 1969. Gainesville: University of Florida Press. pp. 38–40. Gonzales CI, Viñas RC. 1981. Field performance of citrus varieties and cultivars grown under control measures adopted against leaf mottling (greening) disease in the Philippines, In: Matsumoto K (ed.), Proceedings of the Fourth International Society 322 of Citriculture Congress, Tokyo, Japan, 9–12 November 1981. Riverside: International Society of Citriculture. 1: 463–464. Gonzalez P, Reyes-De-Corcuera J, Etxeberria E. 2012. Characterization of leaf starch from HLB-affected and unaffected-girdled citrus trees. Physiological and Molecular Plant Pathology 79: 71–8. Gottwald T, Parnell S, Taylor E, Poole K, Hodge J, Ford A, Therrien L, Mayo S, Irey M. 2008. Within-tree distribution of ‘Candidatus Liberibacter asiaticus’. In: Gottwald TR, Graham JH (eds), Proceedings of the Meeting, International Research Conference on HLB, Orlando, Florida, United States of America, 8 December 2008. pp. 310–313. Gottwald TR, da Graça JV, Bassanezi RB. 2007. Citrus huanglongbing: The pathogen and its impact. Plant Health Progress doi:10.1094/PHP-2007-0906-01-RV. Gottwald TR. 2010. Current epidemiological understanding of citrus huanglongbing. Annual Review of Phytopathology 48: 119–139. Graham MWR de V. 1991. A reclassification of the European Tetrastichinae (Hymenoptera: Eulophidae): revision of the remaining genera. Memoirs of the American Entomological Institute 49: 1–322. Grech NM, Samways MJ. 1985. Assessment of the fungus Cladosporium sp. near oxysporum (Berk. and Curt.) as a biocontrol agent for certain Homoptera. Proceedings of the Citrus and Subtropical Fruit Research Institute Greening Symposium, CSFRJ, Nelspruit, South Africa, 26–28 November 1984. 30 pp. Grenzebach E. 1994. Integrated pest management in selected fruit trees. Report No. 42 on a short-term consultancy mission: 27 February to 12 March 1994, on behalf of Deutche Gesellschaft Für Technische Zusammenarbeit (GTZ). Grierson AJC. 1991. Rutaceae. In: Grierson AJC, Long DG. Flora of Bhutan. Volume 2, Part 1. Edinburgh, Royal Botanic Garden. pp. 6–22. Grundt HH, Kjølner S, Borgen L, Rieseberg LH, Brochmann C. 2006. High biological species diversity in the Arctic flora. Proceedings of the National Academy of Sciences of the United States of America 103: 972–5. 323 Guzman-Larralde AJ, Suaste-Duzul A, Rugman-Jones P, Pena-Carrillo K, Gonzalez-Garcia F, Gonzalez-Hernandez, Unpublished. https://www.ncbi.nlm.nih.gov/nuccore/ KT253023. Gwiazdowski RA, Foottit RG, Maw HEL, Hebert PD. 2015. The Hemiptera (Insecta) of Canada: constructing a reference library of DNA barcodes. PLOS One 10 (4): e0125635. Halbert SE, Manjunath K, Ramadugu C, Lee RF. 2012. Incidence of huanglongbingassociated ‘Candidatus Liberibacter asiaticus’ in Diaphorina citri (Hemiptera: Psyllidae) collected from plants for sale in Florida. Florida Entomologist 95: 617– 624. Halbert SE, Manjunath KL, Ramadugu C, Brodie MW, Webb SE, Lee RF. 2010. Trailers transporting oranges to processing plants move Asian citrus psyllid. Florida Entomologist 93: 33–38. Halbert SE, Manjunath KL. 2004. Asian citrus psyllids (Sternorrhyncha: Psyllidae) and greening disease of citrus: a literature review and assessment of risk in Florida. Florida Entomologist 87: 330–353. Halbert SE, Núñez CA. 2004. Distribution of the Asian citrus psyllid, Diaphorina citri Kuwayama (Rhynchota: Psyllidae) in the Carribean basin. Florida Entomologist 87: 401–402. Hall DG, Hentz MG, Meyer JM, Kriss AB, Gottwald TR, Boucias DG. 2012. Observations on the entomopathogenic fungus Hirsutella citriformis attacking adult Diaphorina citri (Hemiptera: Psyllidae) in a managed citrus grove. Journal of the International Organization for Biological Control 57: 663–675. Hall DG, Nguyen R. 2010. Toxicity of pesticides to Tamarixia radiata, a parasitoid of the Asian citrus psyllid. Journal of the International Organization for Biological Control 55: 601–611. Hall DG, Richardson ML, Ammar ED, Halbert SE. 2013. Asian citrus psyllid, Diaphorina citri, vector of citrus huanglongbing disease. Entomologia Experimentalis et Applicata 146: 207−23. 324 Hall DG. 2008. Biological control of Diaphorina citri. Proceedings of the International Workshop on Huanglongbing of Citrus (Candidatus Liberibacter) and the Asian Citrus Psyllid (Diaphorina citri). Hermosillo, Sonoro, Mexico 7–9 May 2008. pp. 1– 7. Hansen AK, Trumble JT, Stouthamer R, Paine TD. 2008. A new huanglongbing species, ‘Candidatus Liberibacter psyllaurous’, found to infect tomato and potato, is vectored by the psyllid Bactericera cockerelli (Sulc). Applied and Environmental Microbiology 74: 5862–5865. Hasegawa M, Kishino H, Yano TA. 1985. Dating of the human-ape splitting by a molecular clock of mitochondrial DNA. Journal of Molecular Evolution 22: 160−174. Hebert PD, Ratnasingham S, and de Waard JR. 2003. Barcoding animal life: cytochrome c oxidase subunit 1 divergences among closely related species. Proceedings of the Royal Society of London B: Biological Sciences 270: S96–S99. Herrig DK, Modrick AJ, Brud E, Llopart A. 2014. Introgression in the Drosophila subobscura—D. madeirensis sister species: evidence of gene flow in nuclear genes despite mitochondrial differentiation. Evolution 68: 705–719. Hocquellet A, Toorawa P, Bove JM, Garnier M. 1999. Detection and identification of the two Candidatus Liberobacter species associated with citrus huanglongbing by PCR amplification of ribosomal protein genes of the β operon. Molecular and Cellular Probes 13: 373–379. Hoddle CD, Hoddle MS, Triapitsyn SV. 2013. Marietta leopardina (Hymenoptera: Aphelinidae) and Aprostocetus (Aprostocetus) sp. (Hymenoptera: Eulophidae) are obligate hyperparasitoids of Tamarixia radiata (Eulophidae) and Diaphorencyrtus aligarhensis (Hymenoptera: Encyrtidae). Florida Entomologist 96: 643–646. Hoddle MS, Hoddle CD, Triapitsyn SV, Khan SZ, Arif MJ. 2014. How many primary parasitoid species attack nymphs of Diaphorina citri (Hemiptera: Liviidae) in Punjab, Pakistan? Florida Entomologist 97: 1825–1828. Hoddle MS. 2012. Foreign exploration for natural enemies of Asian citrus psyllid, Diaphorina citri (Hemiptera: Psyllidae), in the Punjab of Pakistan for use in a 325 classical biological control program in California USA. Pakistan Entomologist 34: 1– 5. Hodges AW, Spreen TH. 2012. Economic impacts of citrus greening (HLB) in Florida, 2006/07–2010/11. FE903 a publication of the Food and Resource Economics Department, Florida Cooperative Extension Service, Institute of Food and Agriculture Sciences, University of Florida, Gainesville. http://edis.ifas.ufl.edu. Hodgson RW. 1967. Horticultural varieties of Citrus. In: Reuther W, Webber HJ, Batchelor LD (eds), The Citrus Industry, Volume 1. Berkeley: University of California. pp. 431–591. Hodkinson ID. 1986. The psyllids (Homoptera: Psylloidea) of the Oriental zoogeographical regions: an annotated check-list. Journal of Natural History 20: 299–357. Hodkinson ID. 2005. Terrestrial insects along elevation gradients: species and community response to altitude. Biological Reviews 80: 489–513. Hoffman MT. Doud MS, Williams L, Zhang MQ, Ding F, Stover E, Hall D, Zhang S, Jones L, Gooch M, Fleites L, Dixon W, Gabreil D, Duan YP. 2013. Heat treatment eliminates ‘Candidatus Liberibacter asiaticus’ from infected citrus trees under controlled conditions. Phytopathology 103: 15–22. Hoffmann JH, Moran VC, Webb JW. 1975. The influence of the host plant and saturation deficit on the temperature tolerance of a psyllid (Homoptera). Entomologia Experimentalis et Applicata 18: 55−67. Hoffmann WE. 1936. Diaphorina citri Kuw. (Homoptera: Chermidae), a citrus pest in Kwangtung. Lingnan Science Journal 15: 127–132. Hollis D. 1984. Afrotropical jumping lice of the family Triozidae (Homoptera: Psylloidea). Bulletin of the British Museum of Natural History (Entomology) 49: 1–102. Hooker J. 1875. The Flora of British India. Volume 1. London: L Reeve. pp. 502–503. Hooker ME. 1993. Reliability of gentisic acid, a fluorescent marker, for diagnosis of greening disease. Plant Disease 77: 174–180. 326 Hu H, Roy A, Brlansky RH. 2014. Live population dynamics of ‘Candidatus Liberibacter asiaticus’, the bacterial agent associated with citrus huanglongbing, in citrus and noncitrus hosts. Plant Disease 98: 876–884. Hu H. 2012. Quantitative determination of selective alternative hosts of ‘Candidatus Liberibacter asiaticus’ and potential for transmission to citrus. PhD Thesis. University of Florida. Gainesville, Florida, USA. Hu J, de Barro P, Zhao H, Wang J, Nardi F, and Liu SS. 2011. An extensive field survey combined with a phylogenetic analysis reveals rapid and widespread invasion of two alien whiteflies in China. PLoS One 6:e16061. Hu ZQ, Zhao HY, Thieme T. 2013a. Probing behaviors of Sitobion avenae (Hemiptera: Aphididae) on enhanced UV-B irradiated plants. Archives of Biological Science 65: 247–254. Hu ZQ, Zhao HY, Thieme T. 2013b. The effects of enhanced ultraviolet-B radiation on the biology of green and brown morphs of Sitobion avenae (Hemiptera: Aphididae). Environmental Entomology 42: 578–585. Huang CC. 1997. Flora Reipublicae Popularis Sinicae. Tomus 43 (2). Huang CH, Liaw CF, Chang, L, Lan T. 1990. Incidence and spread of citrus likubin in relation to the population fluctuation of Diaphorina citri. Plant Protection Bulletin (Taiwan, ROC) 32: 167–176. Huang CH, Tsai MY, Wang CL. 1984. Transmission of citrus likubin by a psyllid, Diaphorina citri. Journal of Agriculture Research in China 33: 65–72. Huang CH. 1978. Effect of hot-air treatment on likubin, tristeza virus and exocortis viroid. Journal of Agricultural Research of China 27: 193–197. Huang CH. 1979. Distribution of likubin pathogen in likubin–affected plants. Journal of Agricultural Research of China 28: 29–33. Huang PK. 1953. Preliminary observations on citrus psylla, Diaphorina citri Kuwayama (Homoptera, Psyllidae). Journal Fujian Agricultural College 1: 7–20. 327 Hung TH, Hung SC, Chen CN, Hsu MH, Su HJ. 2004. Detection by PCR of ‘Candidatus Liberibacter asiaticus’, the bacterium causing citrus huanglongbing in vector psyllids: application to the study of vector–pathogen relationships. Plant Pathology 53: 96−102. Hung TH, Wu ML, Su HJ. 2000. Identification of alternative hosts of the fastidious bacterium causing citrus greening disease. Journal of Phytopathology 148: 321–326. Hung TH, Wu ML, Su HJ. 2001. Identification of the Chinese box orange (Severinia buxifolia) as an alternative host of the bacterium causing citrus Huanglongbing. European Journal of Plant Pathology 107: 183–189. Husain MA, Nath D. 1924. The life-history of Tetrastichus radiatus parasitic on Euphalerm citri, Euw.; and its Hyperparasite. In: Fletcher, TB (ed), Report of the Proceedings of the Fifth Entomological Meeting. Office of the Superintendent of Government Printing Calcutta. pp. 122–128. Husain MA, Nath D. 1927. The citrus psylla (Diaphorina citri, Kuw.) [Psyllidae: Homoptera]. Memoirs of the Department of Agriculture India, Entomology Series 10: 5–27. 1 plate. Hwang UW, Kim W. 1999. General properties and phylogenetic utilities of nuclear ribosomal DNA and mitochondrial DNA commonly used in molecular systematics. The Korean Journal of Parasitology 37: 215–228. Hynniewta M, Malik SK, Rao SR. 2014. Genetic diversity and phylogenetic analysis of Citrus (L.) from north-east India as revealed by meiosis, and molecular analysis of internal transcribed spacer region of rDNA. Meta gene 2: 237–251. Inoue H, Ohnishi J, Ito T, Tomimura K, Miyata S, Iwanami T, Ashihara W. 2009. Enhanced proliferation and efficient transmission of Candidatus Liberibacter asiaticus by adult Diaphorina citri after acquisition feeding in the nymphal stage. Annals of Applied Biology 155: 29–36. Inoue H, Shinohara K, Okumara M, Ikeda K, Ashira W, Okira Y. 2006. Occurrence of Psylla evodiea Miyatake (Hemiptera: Psyllidae) on the cultivated orange jasmine, 328 Murraya paniculata (Rutaceae) in Kyushu and on Yakushima Island. Japanese Journal of Applied Entomology and Zoology 50: 66–68. Inoue H. 2010. The generic affiliation of Japanese species of the subfamily Psyllinae (Hemiptera: Psyllidae) with a revised checklist. Journal of Natural History 44: 333– 360. Irey MS, Gast T, Gottwald TA. 2006. Comparison of visual assessment to polymerase chain reaction assay testing to estimate the incidence of the huanglongbing pathogen in commercial planting in Florida. Proceedings of Florida State Horticulture Society 119: 89–93. Jagoueix S, Bové JM, Garnier M. 1994. The phloem-limited bacterium of greening disease of citrus is a member of the α subdivision of the Proteobacteria. International Journal of Systematic Bacteriology 44: 379–386. Jagoueix S, Bové JM, Garnier M. 1996. PCR detection of the two ‘Candidatus’ Liberobacter species associated with greening disease of citrus. Molecular and Cellular Probes 10: 43–50. Jenkins DA, Hall DG, Goenaga R. 2015. Diaphorina citri (Hemiptera: Liviidae) aboundance in Puerto Rico declines with elevation. Journal of Economic Entomology 108: 252–258. Jenkins J, Schmutz J, Prochnik S, Rokhsar D, Gmitter F, Ollitrault P, Machado M, Talon M, Wincker P, Jaillon O, Morgante M. Unpublished. https://www.ncbi.nlm.nih.gov/nucleotide/567862539?report=genbank&log$=nucltop &blast_rank=1&RID=0M002HE5014 Ji YJ, Zhang DX, and He LJ. 2003. Evolutionary conservation and versatility of a new set of primers for amplifying the ribosomal internal transcribed spacer regions in insects and other invertebrates. Molecular Ecology Notes 3: 581–585. Johnson LA, Soltis DE. 1994. matK DNA sequences and phylogenetic reconstruction in Saxifragaceae s. str. Systematic Botany 19: 143–156. 329 Jones DT. 1995. Rutaceae. In: Soepadmo E, Wong K (eds.), Tree Flora of Sabah and Sarawak, Volume 1. Forest Research Institute Malaysia, Sabah Forestry Department and Sarawak Forestry Department. pp. 351–419. Kaartinen R, Stone GN, Hearn J, Lohse K, and Roslin T. 2010. Revealing secret liaisons: DNA barcoding changes our understanding of food webs. Ecological Entomology 35: 623–638. Kaiser HF. 1960. The application of electronic computers to factor analysis. Educational and Psychological Measurement 20: 141–151. Kandasamy C. 1986. Taxonomy of South Indian psylids. Records of the Zoological Survey of India. Miscellaneous Publication Occasional Paper No. 84. Calcutta: Zoological Survey of India. iv + 111 pp. Kang AR, Baek JY, Lee SH, Cho YS, Kim WS, Han YS, Kim I. 2012. Geographic homogeneity and high gene flow of the pear psylla, Cacopsylla pyricola (Hemiptera: Psyllidae), detected by mitochondrial COI gene and nuclear ribosomal internal transcribed spacer 2. Animal Cells and Systems 16: 145–153. Katerova Z, Todorova D, Tasheva K, Sergiev I. 2012. Influence of ultraviolet radiation on plant secondary metabolite production. Genetics and Plant Physiology 2: 113–144. Katoh H, Inoue H, Kuchiki F, Ide Y, Uechi N, Iwanami T. 2013. Identification of a distinct lineage of Cacopsylla chinensis (Hemiptera: Psyllidae) in Japan on the basis of two mitochondrial DNA sequences. Journal of Economic Entomology 106: 536–542. Kearse M, Moir R, Wilson A, Stones-Havas S, Cheung M, Sturrock S, Buxton S, Cooper A, Markowitz S, Duran C. 2012. Geneious Basic: an integrated and extendable desktop software platform for the organization and analysis of sequence data. Bioinformatics 28: 1647–1649. Kimura M. 1980. A simple method for estimating evolutionary rates of base substitutions through comparative studies of nucleotide sequences. Journal of molecular evolution 16: 111–120. Knorr LC, Shah SM, Gupta OP. 1970. Greening disease of citrus in Nepal. Plant Disease Reporter 59: 1092–1095. 330 Koizumi M, Prommintara M, Deema N, Choopanya D. 1994. Phytopathological studies on citrus greening disease in Thailand. Japan International Research Center for Agricultural Sciences, Ministry of Agriculture, Forestry and Fisheries, Japan. 58 pp. Koizumi M, Prommintara M, Linwattana G, Kaisuwan T. 1993. Field evaluation of citrus cultivars for greening disease resistance in Thailand. In: Moreno P, da Graca JV, Timmer LW (eds), Proceedings of the Twelfth Conference of the International Organization of Citrus Virologists, New Delhi, India, 23–27 November 1992. Riverside: International Organization of Citrus Virologists, University of California, Riverside. pp. 274–279. Koizumi M, Prommintara M, Ohtsu Y. 1996. Wood apple, Limonia acidissima: a new host for the huanglongbing (greening) vector, Diaphorina citri. In: da Graca JV, Moreno P, Yokomi RK (eds), Proceedings of the Thirteenth Conference of the International Organization of Citrus Virologists, Fuzhou, Fujian, China, 16–23 November 1995. International Organization of Citrus Virologists, University of California: Riverside. pp. 271–275. Kong YC, Ng GKH, Wat CKH, But PPH. 1986. Pharmacognostic differentation between Murraya paniculata (L.) Jack and Murraya koenigii (L.) Spreng. International Journal of Crude Drug Research 24: 167–170. Kuhlmann F, Müller C. 2011. Impacts of ultraviolet radiation on interactions between plants and herbivorus insects: a chemo-ecological perspective. In, Lüttge U, Beyschlag W, Büdel B, Francis D (eds), Progress in Botany. Springer-Verlag Berlin Heidelberg. pp. 305–347. Kumar S, Nair KN, Jena SN. 2013. Molecular differentiation in Indian Citrus L. (Rutaceae) inferred from nrDNA ITS sequence analysis. Genetic Resources and Crop Evolution 60: 59–75. Kunta M, Viloria Z, Hilda S, Louzada ES. 2014. Diverse DNA extraction methods and PCR primers for detection of Huanglongbing-associated bacteria from roots of ‘Valencia’ sweet orange on sour orange rootstock. Scientia Horticulturae 178: 23–30. 331 Kuwayama S. 1907. Die psylliden Japans. I. Transactions of the Sopporo Natural History Society 2; 149–189. (Diaphorina citri: p. 160–161, Plate III, Fig. 160). Kuwayama Satoru. 1931. A revision of the Psyllidae of Taiwan. Insecta Matsumarana 5: 117–133. Kuwayama Shigeru. 1908. Die psylliden Japans. I. Transactions of the Sopporo Natural History Society 2: 149–189. (D. citri: p. 160–161, Plate III, Fig. 16). Kuznetsova VG, Labina ES, Shapoval NA, Maryanska-Nadachowska A, Lukhtanov VA. 2012. Cacopsylla fraudatrix sp. n. (Hemiptera: Psylloidea) recognised from testis structure and mitochondrial gene COI. Zootaxa 3547: 55–63. Kyndt T, Dung TN, Goetghebeur P, Toan HT, Gheysen G. 2010. Analysis of ITS of the rDNA to infer phylogenetic relationships among Vietnamese Citrus accessions. Genetic Resources and Crop Evolution 57: 183–192. Ladaniya MS. 2008. Citrus Fruit: Biology, Technology and Evaluation. San Diego, California: Academic Press. 558 pp. Laflèche D, Bové JM. 1970. Structures de type mycoplasme dans les les feuilles d’orangeers aateints de la maladie du ‘greening’. Comptes Rendus de l’ Académie des Sciences, Paris 270: 1915–1917. Lahiri AR, Biswas S. 1979. On a collection of psyllids (Homoptera: Psyllidae) from Shillong, Khasi Hills. Bulletin of the Zoological Survey of India 2: 61–67. Lahiri AR, Biswas S. 1980. Observations on the relative intensity of infection on three species of cultivated citrus plants by Psylla murrayi Mathur (Homoptera: Psyllidae) at Shillong, Meghalaya. Bulletin of the Zoological Survey of India 2: 123–127. Lakra RK, Singh Z, Kharub WS. 1983. Population dynamics of citrus psylla, Diaphorina citri Kuwayama in Haryana. Indian Journal of Entomology 45: 301−310. Lal MM. 1917. Report of the Assistant Professor of Entomology. Report on the Operations of the Department of Agriculture, Punjab. In: Marshall GAK (ed.). 1920. Review of Applied Entomology, Series A: Agricultural 8: 109. 332 Lal MM. 1918. Report of the Assistant Professor of Entomology. Report on the Operations of the Department of Agriculture, Punjab. In: Marshall GAK (ed.). 1920. Review of Applied Entomology, Series A: Agricultural 8: 109. Lama TK, Amatya P. 1993. Survey of the incidence of citrus greening disease and its psyllid vector in Nepal and Bhutan. In: Moreno P, da Graça JV, Timmer LW (eds), Proceedings of the Twelfth Conference of the International Organization of Citrus Virologists, New Delhi, India, 23–27 November 1992. Riverside: International Organization of Citrus Virologists, University of California, Riverside. pp. 445–446. Lama TK, Amtya PM. 1991. Prevalence of citrs greening disease and its psyllid vestor in Nepal and Bhutan. In: Ke C, Osman SB (eds), Proceedings of the Sixth International Asia Pacific Workshop on Integrated Citrus Health Management, Kuala Lumpur, Malaysia, 24–30 June 1991. 1991 FAO-UNDP RAS/86/022 Regional Project. p. 63. Lashkari M, Manzari S, Sahragard A, Malagnini V, Boykin LM, Hosseini R. 2014. Global genetic variation in the Asian citrus psyllid, Diaphorina citri (Hemiptera: Liviidae) and the endosymbiont Wolbachia: links between Iran and the USA detected. Pest Management Science 70: 1033–1040. Lee HA. 1921. The relation of stocks to mottled leaf of citrus leaves. Philippine Journal of Science 18: 85–95. Lee HC, Yang MM, Yeh WB, Li FS. 2007. Genetic variation of Cacopsylla chinensis (Hemiptera: Psyllidae) in Taiwan based on mitochondrial 16S rDNA sequence. Formosan Entomologist 27: 157–168. Lee HC, Yang MM, Yeh WB. 2008. Identification of two invasive Cacopsylla chinensis (Hemiptera: Psyllidae) lineages based on two mitochondrial sequences and restriction fragment length polymorphism of cytochrome oxidase I amplicon. Journal of Economic Entomology 101: 1152–1157. Lee M, Park J, Lee H, Sohn S-H, Lee J. 2015. Complete chloroplast genomic sequence of Citrus platymamma determined by combined analysis of Sanger and NGS data. Horticulture, Environment, and Biotechnology 56: 704–711. 333 Lee R, Keremane M, Ramadugu C, Vidalakis G, Roose M, Halbert S, Rodrigues JL, Lopes S. 2011. Huanglongbing: Development of information needed for avoidance/management. Citrograph November–December: 34–40. Leong CTS. 2006. Spread of Huanglongbing, Population Dynamics and Control of Diaphorina citri Kuwayama, the Asiatic citrus Psyllid in Sarawak. PhD Thesis, Faculty of Resource Science and Technology, Universiti Malaysia Sarawak. 236 pp. Li FS. 1976. Psyllidomorpha of China (Insecta: Hemiptera). Science Press, Beijing, China. Li FS. 2011. Psyllid host plants. In: Li FS (ed), Psyliidomorpha in China (Insecta: Hemiptera) Volume I. Beijing: Science Press. Li T, Ke C. 2002. Detection of the bearing rate of Liberobacter asiaticum, in citrus psylla and its host plant Murraya paniculata by nested PCR. Acta Phytophylacica Sinica 29: 31–35. Li W, Hartung JS, Levy L. 2005. Quantitative real-time PCR for detection and identification of Candidatus Liberibacter species associated with citrus huanglongbing. Journal of Microbiological Methods 66: 104–115. Li W, Hartung JS, Levy L. 2007a Evaluation of DNA amplification methods for improved detection of ‘Candidatus Liberibacter species’ associated with citrus huanglongbing. Plant Disease 91: 51–58. Li W, Levy L, Hartung JS. 2009. Quantitative distribution of ‘Candidatus Liberibacter asiaticus’ in citrus plants with citrus huanglongbing. Phytopathology 99: 139–144. Li WB, Duan YP, Brlansky RH, Twieg E, Levy L. 2008. Incidence and population of ‘Candidatus Liberibacter asiaticus’ in Asian citrus psyllids (Diaphorina citri) on citrus plant affected by huanglongbing in Florida. In: Gottwald TR, Graham JH (eds), Proceedings of the Meeting, International Research Conference on HLB, Orlando, Florida, United States of America, 8 December 2008. pp. 261–264. Li WB, Hartung JS, Levy L. 2006. Quantitative real-time PCR for detection and identification of Candidatus Liberibacter species associated huanglongbing. Journal of Microbiological Methods 66: 104–115. 334 with citrus Li XM, Xie RJ, Lu ZH, Zhou ZQ. 2010. The origin of cultivated citrus as inferred from internal transcribed spacer and chloroplast DNA sequence and amplified fragment length polymorphism fingerprints. Journal of the American Society for Horticultural Science 135: 341–350. Li YZ, Cheng YJ, Tao NG, Denf XX. 2007b. Phylogenetic analysis of mandarin landraces, wild mandarins, and related species in China using nuclear LEAFY second intron and plastid trnL-trnF sequence. Journal of the American Society for Horticultural Science 132: 796–806. Liley JB, McKenzie RL. 2006. Where on Earth has the highest UV? In: UV radiation and its effects: an update, pp. 26–37, http://www.niwascience.co.nz/rc/atmos/uvconference. Lin H, Chen C, Doddapaneni H, Duan Y, Civerolo EL, Bai X, Zhao X. 2010. A new diagnostic system for ultra-sensitive and specific and specific detection and quantification of ‘Candidatus Liberibacter asiaticus’, the bacterium associated with citrus huanglongbing. Journal of Microbiological Methods 81: 17–25. doi: 10.1016/j.mimet.2010.01.014 Lin KH, 1956b. Observations on yellow shoot of citrus. Acta Phytopathologica Sinica 2: 1– 42. Lin KH, Lo HH. 1965. A preliminary study on thermotherapy of yellow shoot disease of citrus. Acta Phytophylacica Sinica 4: 169–175. Lin KH. 1956a. Etiological studies of yellow shoot of citrus. Acta Phytopathologica Sinica 2: 1–42. Linnaeus C (Linné C). 1767. Mantissa Plantarum. Generum editionis VI. et Specierum editionis II. Holmiae (Stockholm): Laurentii Salvii. Linnaeus C (Linné C). 1771. Mantissa Plantarum. Altera generum editionis VI. et Specierum editionis II. Regni animalis appendix. Holmiae (Stockholm): Laurentii Salvii. 335 Liu D, Trumble JT, Stouthamer R. 2006. Genetic differentiation between eastern populations and recent introductions of potato psyllid (Bactericera cockerelli) into western North America. Entomologia Experimentalis et Applicata 118: 177–183. Liu J, Yan HF, Newmaster SG, Pei NC, Ragupathy S, Ge X-J. 2015. The use of DNA barcoding as a tool for the conservation biogeography of subtropical forests in China. Diversity and Distributions 21: 188–199. Liu YH, Tsai JH. 2000. Effects of temperature on biology and life table parameters of the Asian citrus psyllid, Diaphorina citri Kuwayama (Homoptera: Psyllidae). Annals of Applied Biology 137: 201–206. Lo XH, Lo DD, Tang WW. 1981. Studies on the thermotherapy of citrus yellow shoot disease. Acta Phytophylacica Sinica 8: 47–52. Lo XH. 1983. Studies on the sterilization effect of the intermittent hot water treatment on citrus budwood and nursling infected with citrus yellow shoot. Journal of South China Agricultural College 4: 97–103. Lopes SA, Luiz FQBF, Martins EC, Fassini CG, Sousa MC, Barbosa JC, Beattie GAC. 2013. ‘Candidatus Liberibacter asiaticus’ titers in citrus and acquisition rates by Diaphorina citri are decreased by higher temperature. Plant Disease 97: 1563−1570. Lopes SA, Bassanezi RB, Belasque J Jr, Yamamoto PT. 2008. Management of citrus huanglongbing in the state of São Paulo–Brazil. In: Ku YT, Pham THH (eds), Proceedings of FFTC-PPRI-NIFTS Joint Workshop on Management of Citrus Greening and Virus Diseases for the Rehabilitation of Citrus Industry in the ASPAC, Plant Protection Research Institute, Hà Nội, Việt Nam, 8–12 September 2008. pp. 107–117. Lopes SA, Frare GF, Bertolini E, Cambra M, Fernandes NG, Ayres AJ, Marin DR, Bové JM. 2009. Liberibacters associated with citrus huanglongbing in Brazil: ‘Candidatus Liberibacter asiaticus’ is heat tolerant, ‘Ca. L. americanus’ is heat sensitive. Plant Disease 93: 257–262. 336 Lopes SA, Frare GF, Camargo LEA, Wulff NA, Teixeira DC, Bassanezi RB, Beattie GAC, Ayres AJ. 2010. Liberibacters associated with orange jasmine in Brazil: incidence in urban areas and relatedness to citrus liberibacters. Plant Pathology 59: 1044–1053. Lopes SA, Luiz FQBF, Martins EC, Fassini CG, Sousa MC, Barbosa JC, Beattie GAC. 2013. ‘Candidatus Liberibacter asiaticus’ titers in citrus and acquisition rates by Diaphorina citri are decreased by higher temperature. Plant Disease 97: 1563–1570. Lu ZH, Zhou ZQ, Xie RJ. 2011. Molecular phylogeny of the ‘‘true citrus fruit trees’’ group (Aurantioideae, Rutaceae) as inferred from chloroplast DNA sequence. Agricultural Sciences in China 10: 49–57. Luis M, Collaza C. Llauger R, Blanco E, Peña I, López D, González C, Casín JC, Batista L, Kitajima, Tanaka FAO, Salaroli RB, Teixeira DC, Martins EC, Bové JM. 2009. Occurrence of citrus huanglongbing in Cuba and association of the disease with ‘Candidatus Liberibacter asiaticus’. Journal of Plant Pahtology 91: 709‒712. Lunt D, Zhang DX, Szymura J, Hewltt O. 1996. The insect cytochrome oxidase I gene: evolutionary patterns and conserved primers for phylogenetic studies. Insect molecular biology 5: 153–165. Luo XY, Li Q, Li FS, Cai WZ. 2012. A revision of the endemic Chinese genus Cornopsylla (Hemiptera: Psyllidae), with potential pests on Zanthoxylum (Rutaceae). Zootaxa 3646: 127–148. Mabberley DJ. 1997. A classification for edible Citrus (Rutaceae). Telopea 7: 167–172. Mabberley DJ. 1998. Australian Citreae with notes on other Aurantioideae (Rutaceae). Telopea 7: 333–344. Mabberley DJ. 2004. Citrus (Rutaceae): a review of recent advances in etymology, systematics and medical applications. Blumea 49: 481–498. Mabberley DJ. 2008. Mabberley’s Plant Book: A Portable Dictionary of Plants, Their Classification and Uses. Third Edition. New York: Cambridge University Press. Mabberley DJ. 2016. Proposal to conserve the name Chalcas paniculata (Murraya paniculata) (Rutaceae) with a conserved type. Taxon 65: 394–395. 337 Maki M. 1915. Namiki oyobi Kanshôyô-Shokubutsu no Jûyô Gaichu ni kwansura Chôsa (Investigations on the principal insect pests of avenue and ornamental plants). Ringyô Shienjô Tokubetsu Hôkoku (Special Report of the Forest Experiment Station, Government of Formosa), 1: 112 + 29 pp., 18 pls (reference to Diaphorina citri and/or Murraya paniculata on pp. 36–38, Pl. VIII). Malagnini,V, Pedrazzoli F, Papetti C, Cainelli C, Zasso R, Gualandri V, Pozzebon A, Ioriatti C. Unpublished. studies. https://www.ncbi.nlm.nih.gov/nuccore/ FJ648818 Mandal SD, Chhakchhuak L, Gurusubramanian G, Kumar NS. 2014. Mitochondrial markers for identification and phylogenetic studies in insects–A review. DNA Barcodes 2: 1–9. Manjunath K, Halbert S, Ramadugu C, Webb S, Lee R. 2008. Detection of ‘Candidatus Liberibacter asiaticus’ in Diaphorina citri and its importance in the management of citrus huanglongbing in Florida. Phytopathology 98: 387–396. Manjunath KL, Ramadugu C, Majil VM, Williams S, Irey M, Lee RF. 2010. First report of the citrus huanglongbing associated bacterium ‘Candidatus Liberibacter asiaticus’ from Sweet Orange, Mexican lime, and the Asian citrus psyllid in Belize. Plant Disease 94: 781. Manjunath KL, Ramadugu C, Rodriguez E, Kubota R, Shibata S, Hall DG, Roose ML, Jenkins D, Lee RF. 2015. A rapid field detection system for citrus huanglongbing associated ‘Candidatus Liberibacter asiaticus’ from the psyllid vector, Diaphorina citri Kuwayama and its implications in disease management. Crop Protection 68: 41– 48. Mann RS, Stelinski LL. 2010. An Asian citrus psyllid parasitoid Tamarixia radiata (Waterson) (Insecta: Hymenoptera: Eulophidae). EENY 475, a series of Featured Creatures from the Entomology and Nematology Department, Florida Cooperative Extension Service, Institute of Food and Agricultural Sciences, University of Florida. Manthey J. 2008. Differences in secondary metabolites in leaves from orange (Citrus sinensis L.) trees affected with greening disease (huanglongbing) (HLB). Proceedings of the Florida State Horticultural Society 121: 285–288. 338 Markkula M, Laurema S. 1971. Phytotoxaemia caused by Trioza apicalis Först. (Hom., Triozidae) on carrot. Annales Agriculturae Fenniae 10: 181–184. Martinez AL, Nora DM, Price WC. 1971. Observations on greening in the Philippines. Animal Husbandry and Agricultural Journal March: 21–22. Martinez AL, Wallace JM. 1967a. A progress report of the studies on citrus decline in the Philippines. The Philippine Journal of Plant Industry 32: 253–266. Martinez AL, Wallace JM. 1967b. Citrus leaf–mottle–yellows disease in the Philippines and transmission of the causal virus by a psyllid, Diaphorina citri. Plant Disease Reporter 51: 692–695. Martinez AL, Wallace JM. 1969. Citrus greening disease in the Philippines. In: Chapman HD (ed.), Proceedings of the First International Citrus Symposium, University of California, Riverside, 16–26 March 1968. California: Publications Department of the University of California. 3: 1427–1431. Martínez Y, Llauger R, Batista L, Luis M, Iglesia A, Collazo C, Peña I, Casin JC, Cueto J, Tablada LM. 2009. First report of ‘Candidatus Liberibacter asiaticus’ associated with huanglongbing in Cuba. Plant Pathology 58: 389. Mathur RN. 1935. Notes on the biology of the Psyllidae (Homopt.). Indian Forest Records I (2): 35–71. Mathur RN. 1975. Psyllidae of the Indian Subcontinent. New Delhi: Indian Council of Agricultural Research. 429 pp. Matsumoto T, Wang MC, Su HJ. 1961. Studies on likubin. In: Price WC (ed.), Proceedings of the Second Conference of the International Organization of Citrus Virologists, Lake Alfred, Florida, United States of America, 7–11 November 1960. Gainesville: University of Florida Press. pp. 121–125. Mbabane, Swaziland, 21–28 August 1972. Richmond: University of California, Division of Agriculture Sciences. pp. 53–57. McClean APD, Schwarz RE. 1970. Greening or blotchy-mottle disease of citrus. Phytophylactica 2: 177–194. 339 Meyer CP, Paulay G. 2005. DNA barcoding: error rates based on comprehensive sampling. PLOS Biology 3: e422. Meyer JM, Hoy MA, Boucias DG, Singh R, Rogers ME. 2007. ‘Friendly fungi’ killing psyllids in Florida. Citrus Industry May: 23–24. Meyer JM, Hoy MA, Boucias DG. 2008. Isolation and characterization of an Isaria fumosorosea isolate infecting the Asian citrus psyllid in Florida. Journal of Invertebrate Pathology 99: 96–102 Michaud JP. 2002. Biological control of Asian citrus psyllid, Diaphorina citri (Hemiptera: Psyllidae) in Florida: A preliminary report. Entomological News 113: 216–222. Miller B, Crabtree M, Savage H. 1996. Phylogeny of fourteen Culex mosquito species, including the Culex pipiens complex, inferred from the internal transcribed spacers of ribosomal DNA. Insect Molecular Biology 5: 93–107. Miyakawa T, Zhao XY. 1990. Citrus host range of greening disease. In: Aubert B, Tontyaporn S, Buangsuwon D (eds), Proceedings of the Fourth International Asia Pacific Conference on Citrus Rehabilitation, Chiang Mai, Thailand, 4–5 February 1990. Rome: FAO UNDP. pp. 118–121. Miyakawa T. 1980. Experimentally-induced symptoms and host range of citrus likubin (greening disease). Annals of the Phytopathological Society of Japan 46: 224–230. Moll JN, Martin MM. 1974. Comparison of the organism causing greening disease with several plant pathogenic gram–negative bacteria, rickettsia-like organisms, and mycoplasma–like organisms, Insitut National de la Santé Recherche Médicale (INSERM), Bordeaux 33: 89–96. Monti M, Nappo A, Giorgini M. 2005. Molecular characterization of closely related species in the parasitic genus Encarsia (Hymenoptera: Aphelinidae) based on the mitochondrial cytochrome oxidase subunit I gene. Bulletin of Entomological Research 95: 401–408. Moreno P, da Graca JV, Yokomi RK (eds). 1996. Preface. In: da Graca JV, Moreno P, Yokomi RK (eds), Proceedings of the Thirteen Conference of the International Organization of Citrus Virologists, Fuzhou, Fujian, China, 16–23 November 1995. 340 Riverside: International Organization of Citrus Virologists, University of California: Riverside. pp. v–vi. Morris RA, Muraro RP, Spreen TH. 2008. Invasive diseases and fruits tree production: economic tradeoffs of citrus greening control on Florida’s citrus industry. Southern Agricultural Economics Association Annual Meeting, Dalla, Texas, 2–6 February 2008. Morton CM, Grant M, Blackmore S. 2003. Phylogenetic relationships of the Aurantioideae inferred from chloroplast DNA sequence data. American Journal of Botany 90: 1463–1469. Morton CM. 2009. Phylogenetic relationships of the Aurantioideae (Rutaceae) based on the nuclear ribosomal DNA ITS region and three noncoding chloroplast DNA regions, atpB-rbcL spacer, rps16, and trnL-trnF. Organisms Diversity & Evolution 9: 52–68. Morton CM. 2015. Phylogenetic relationships of Zieria (Rutaceae) inferred from chloroplast, nuclear, and morphological data. PhytoKeys 44: 15–38. Morton MC, Grant M, Blackmore S. 2003. Phylogenetic relationships of the Aurantioidae inferred from chloroplast DNA sequence data. American Journal of Botany 90: 1463–1469. Mou FJ, Tu T, Zhang DX. Unpublished. https://www.ncbi.nlm.nih.gov/nuccore/ JX144255–56; JX144194–95; JX144237. Munyaneza JE. 2010. Psyllids as vectors of emerging bacterial diseases of annual crops. Southwestern Entomologist 35: 471–477. Nariani TK, Raychaudhuri SP. 1968. Occurrence of tristeza and greening viruses in Bihar, West Bengal and Sikkim. Indian Phytopathological Notes Volume XXI. pp. 343– 344. Nariani TK. 1981. Integrated approach to control citrus greening disease in India. In: Matsumoto K (ed), Proceedings of the Fourth International Society of Citriculture Congress, Tokyo, Japan, 9–12 November 1981. Riverside: International Society of Citriculture 1: 471–472. 341 Nava DE, Torres MLG, Rodrigues MDL, Bento JMS, Parra JRP. 2007. Biology of Diaphorina citri (Hem., Psyllidae) on different hosts and at different temperatures. Journal of Applied Entomology 131: 709–715. Nei M, Kumar S. 2000. Molecular Evolution and Phylogenetics. Oxford University Press, New York. Nevado B, Fazalova V, Backeljau T, Hanssens M, Verheyen E. 2011. Repeated unidirectional introgression of nuclear and mitochondrial DNA between four congeneric Tanganyikan cichlids. Molecular Biology and Evolution 28: 2253–2267. Nguyen HC. 2011. Circumscription of Murraya and Merrilia (Saphindales: Rutaceae: Aurantioideae) and suceptibility of species and forms to huanglongbing. PhD Thesis. University of Western Sydney. NSW Australia. Nicolosi E, Deng Z, Gentile A, La Malfa S, Continella G, Tribulato E. 2000. Citrus phylogeny and genetic origin of important species as investigated by molecular markers. Theoretical and Applied Genetics 100: 1155–1166. Nishida R. 2014. Chemical ecology of insect–plant interactions: ecological significance of plant secondary metabolites. Bioscience, Biotechnology, and Biochemistry 78:1−13. Nokkala C, Kuznetsova VG, Nokkala S. 2013. Meiosis in rare males in parthenogenetic Cacopsylla myrtilli (Wagner, 1947) (Hemiptera, Psyllidae) populations from northern Europe. Comparative Cytogenetics 7: 241–251. NPPC 2003. National Plant Protection Centre, Semtokha, Thimphu, Bhutan. Unpublished report. NPPC survey report. 2003. National Plant Protection Centre, Semtokha, Thimphu, Bhutan. Unpublished report. NPPC-ACIAR report. 2003. National Plant Protection Centre-Australian Centre for International Agricultural Research. Unpublished report. Odrzykoski IJ, Szweykowski J. 1991. Genetic differentiation without concordant morphological divergence in the thallose liverwort Conocephalum conicum. Plant Systematics and Evolution. 178: 135–152. 342 Oettl S, Schlink K. 2015. Molecular identification of two vector species, Cacopsylla melanoneura and Cacopsylla picta (Hemiptera: Psyllidae), of apple proliferation disease and further common psyllids of northern Italy. Journal of Economic Entomology 108: 2174–2183. Ohtsu Y, Nakashima K, Prommintara M, Tomiyasu Y. 1998. Typical symptoms of citrus greening on mandarin trees in Nepal, supported by detection and characterization of ribosomal DNA of the causal organisms. Annals of the Phytopathological Society of Japan 64: 539–545. Okuda M, Matsumoto M, Tanaka Y, Subandiyah S, Iwanami T. 2005. Characterization of the tufB-secE-nusG-rplKAJL-rpoB gene cluster of the citrus greening organism and detection by loop mediated isothermal amplification. Plant Disease 89: 705–711. Okuyama Y, Kato M. 2009. Unveiling cryptic species diversity of flowering plants: successful biological species identification of Asian Mitella using nuclear ribosomal DNA sequences. BMC Evolutionary Biology 9: 105. Oliver D. 1861. The natural order Aurantiaceae, with a synopsis of the India species. Journal of the Linnean Society Botany 2: 1–45. Olmstead RG, Palmer JD. 1994. Chloroplast DNA systematics: a review of methods and data analysis. American Journal of Botany 81: 1205–1224. Osman MS, Lim WH. 1992. Studies on vector distribution, etiology and transmission of greening disease of citrus in P. Malaysia. In: Setyobudi L, Bahar FA, Winaro m, Whittle AM (eds), Proceedings of Asian Citrus Rehabilitaiton Conference, Malang, Indonesia, 4–14 July 1989, Ministry of Agriculture, Republic of Inodnesia Agency for Agricultural Research and Development FAO UNDP INS/84/007. pp. 157–165. Othman RN, Jordan GJ, Worth JR, Steane DA, Duretto MF. 2010. Phylogeny and infrageneric classification of Correa Andrews (Rutaceae) on the basis of nuclear and chloroplast DNA. Plant Systematics and Evolution 288: 127–138. Palmer JD, Jansen RK, Michaels HJ, Chase MW, Manhart JR. Chloroplast DNA variation and plant phylogeny. 1988. Annals of the Missouri Botanical Garden. 75: 1180– 1206. 343 Pande YD 1971. Biology of citrus psylla, Diaphorina citri Kuw. (Hemiptera: Psyllidae). Israel Journal of Entomology 6: 307–311. Parra JRP, Alves GR, Diniz AJF, Vieira JM. 2016. Tamarixia radiata (Hymenoptera: Eulophidae) × Diaphorina citri (Hemiptera: Liviidae): mass rearing and potential use of the parasitoid in Brazil. Journal of Integrated Pest Management 7: 1–11. Peccoud J, Labonne G, Sauvion N. 2013. Molecular test to assign individuals within the Cacopsylla pruni complex. PLOS One 8: e72454. Pelz-Stelinski KS, Brlansky RH, Ebert TA, Rogers ME. 2010. Transmission parameters for ‘Candidatus Liberibacter asiaticus’ by Asian citrus psyllid (Hemiptera: Psyllidae). Journal of Economic Entomology 103:1531–1541. Peña-Carrillo KI, González-Hernández A, López-Arroyo JI, Mercado-Hernández R, Favela-Lara S. 2015. Morphological and genetic variation in Mexican wild populations of Tamarixia radiata (Hymenoptera: Eulophidae). Florida Entomologist 98: 1093–1100. Peña-Carrillo KI, González-Hernández A, López-Arroyo JI, Varela-Fuentes S. 2014. Haplotipos del parasitoide Tamarixia radiata (Waterston) (Hymenoptera: Eulophidae) en los cítricos del estado de Tamaulipas, México. Revista Mexicana de Ciencias Agrícolas 5: 661–672. Penjor T, Nagano Y, Mimura T, Matsumoto R, Yamamoto M. 2014. Exploration of local citrus genetic resources in Bhutan and their chloroplast DNA analysis. Horticultural Research (Japan) 13: 307–314． Pfeiler E, Bitler B, Ramsey J, Palacios-Cardiel C, Markow T. 2006. Genetic variation, population structure, and phylogenetic relationships of Triatoma rubida and T. recurva (Hemiptera: Reduviidae: Triatominae) from the Sonoran desert, insect vectors of the Chagas’ disease parasite Trypanosoma cruzi. Molecular Phylogenetics and Evolution 41: 209–221. Phahladira MNB, Viljoen R, Pietersen G. 2012. Widespread occurrence of ‘Candidatus liberibacter africanus subspecies capensis’ in Calodendrum capense in South Africa. European Journal of Plant Pathology 134: 39–47. 344 Poe SR, Shea K. 2007. Citrus greening and Asian citrus psyllid; availability of an environmental assessment. United States Department of Agriculture Federal Register 72 (212): 62204–62205. Prager SM, Esquivel I, Trumble JT. 2014. Factors influencing host plant choice and larval performance in Bactericera cockerelli. PLoS One 9: e94047. Pruthi HS, Batra HN. 1938. A preliminary annotated list of fruit pests of the North–West Frontier Province. Miscellaneous Bulletin of the Imperial Council of Agricultural Research, India 19: 10–12. Pruthi HS, Mani MS. 1945. Our knowledge of the insect and mite pests of citrus in India and their control. The Imperial Council of Agriculture Research, Science Monograph 16: 2–42. 6 plates. Que SQ, Yu LP, Xin TR, Zou ZW, Hu LX, Xia B. 2016. Complete mitochondrial genome of Cacopsylla coccinae (Hemiptera: Psyllidae). Mitochondrial DNA Part A 27 (5): 3169–3170. Ramadugu C, Keremane ML, Halbert SE, Duan Y, Roose M, Stover E, Lee RF. 2016. Long-term field evaluation reveals huanglongbing resistance in Citrus relatives. Plant Disease 100: 1858–1869. Raychaudhuri SP, Nariani TK, Ghosh SK, Viswanath SM, Kumar D. 1974. Recent studies on citrus greening in India. In: Weathers LG & Cohen M (eds), Proceedings of the Sixth Conference of the International Organization of Citrus Virologists, Mbabane, Swaziland, 21–28 August 1972. Richmond: University of California, Division of Agricultural Sciences. pp. 53–57. Raychaudhuri SP, Nariani TK, Lele VC, Singh GR. 1972. Greening and citrus decline in India. In: Price WC (ed.), Proceedings of the Fifth Conference of the International Organization of Citrus Virologists, Tokyo, Japan, 30 October – 8 November 1969. Gainesville: University of Florida Press. pp. 35–37. Raychaudhuri SP. 1991. Citrus dieback in India. In: Huang BY, Yang Q (eds), Proceedings of the International Citrus Symposium, Guangzhou, November 5‒8, 1990. International Academic Press. Beijing. 609‒615. 345 Razi MF, Keremane ML, Ramadugu C, Roose M, Khan IA, Lee RF. 2014. Detection of citrus huanglongbing-associated ‘Candidatus Liberibacter asiaticus’ in citrus and Diaphorina citri in Pakistan, seasonal variability, and implications for disease management. Phytopathology 104: 257–268. Reetha B, Poorani J, Venkatesan T, Jalali SK. Unpublished. https://www.ncbi.nlm.nih.gov/nuccore/KJ627790. Regmi C, Lama TK. 1988. Greening incidence and greening vector population dynamics in Pokhara. In: Timmer LW, Garnsey SM, Navarro L (eds) Proceedings of the Tenth Conference of the International Organization of Citrus Virologists, Valencia, Spain, 17–21 November 1986. Riverside: International Organization of Citrus Virologists, University of California: Riverside. pp. 238–242. Reinking OA. 1919. Diseases of economic plants in southern China. Philippine Agriculture 8: 109–135. Reynolds DR. 1999. Capnodium citri: the sooty mold fungi comprising the taxon concept. Mycopathologia 148: 141–147. Rigano LA, Malamud F, Orce IG, Filippone MP, Marano MR, do Amaral AM, Castagnaro AP, Vojnov AA. 2014. Rapid and sensitive detection of ‘Candidatus Liberibacter asiaticus’ by loop mediated isothermal amplification combined with a lateral flow dipstick. BMC Microbiology 14: 1. doi:10.1186/1471-2180-14-86 RNR Statistical Coordination Section, Policy and Planning Division. 2015. Bhutan RNR Statistics 2015. Royal Government of Bhutan, Ministry of Agriculture and Forests. www.moaf.gov.bt/download/Rates/ Bhutan%20RNR% 20Statistics%202015.pdf Robinson J, Harris S, Juniper B. 2001. Taxonomy of the genus Malus Mill. (Rosaceae) with emphasis on the cultivated apple, Malus domestica Borkh. Plant Systematics and Evolution 226: 35–58. Roe AD, Sperling FA. 2007. Patterns of evolution of mitochondrial cytochrome c oxidase I and II DNA and implications for DNA barcoding. Molecular Phylogenetics and Evolution 44: 325–345. 346 Rohrig E. 2011. An Asian citrus psyllid parasitoid: Diaphorencyrtus aligarhensis (Shafee, Alam and Agarwal) (Insecta: Hymenoptera: Encrytidae). EENY–505. A series of the Entomology and Nematology Department, Florida Cooperative Extension Service, Institute of Food and Agriculture Sciences, University of Florida. Website at http://edis.ifas.ufl.edu Roistacher CN. 1996. The economics of living with citrus diseases: huanglongbing (greening) in Thailand. In: da Graca JV, Moreno P, Yokomi RK (eds), Proceedings of the Thirteenth Conference of the International Organization of Citrus Virologists, Fuzhou, Fujian, China, 16–23 November 1995. Riverside: International Organization of Citrus Virologists, University of California: Riverside. pp. 279–285. Rokaya PR, Baral DR, Gautam DM, Shrestha AK, Paudyal KP. 2016. Effect of altitude and maturity stages on quality attributes of mandarin (Citrus reticulata Blanco). American Journal of Plant Sciences 7: 958–966. Roxburgh W. 1832. Flora Indica: Descriptions of Indian Plants. Vol. II. Serampore: W Thacker and Co. pp. 374–375. Plate 48. Sagaram US, Tatineni S, Kim J, Wang N. 2008. In planta distribution and quantification of Asiatic strain of citrus huanglongbing pathogen. Phytopathology 98: S138 Salibe AA, Cortez RE. 1966. Studies on the leaf mottling disease in the Philippines. FAO Plant Protection Bulletin 14: 141–144. Salt DT, Moody SA, Whittaker J, Paul ND. 1998. Effects of enhanced UVB on populations of the phloem feeding insect Strophingia ericae (Homoptera: Psylloidea) on heather (Calluna vulgaris). Global Change Biology 4: 91–96. Samways MJ, Grech NM. 1986. Assessment of the fungus Cladosporium oxysporium (Berk. and Curt.) as a potential biocontrol agent against certain Homoptera. Agriculture, Ecosystems and Environment 15: 231–239. Sang T, Crawford DJ, Stuessy TF. 1995. Documentation of reticulate evolution in peonies (Paeonia) using internal transcribed spacer sequences of nuclear ribosomal DNA: implications for biogeography and concerted evolution. Proceedings of the National Academy of Sciences 92: 6813–6817. 347 Sang T. 2002. Utility of low-copy nuclear gene sequences in plant phylogenetics. Critical Reviews in Biochemistry and Molecular Biology 37: 121–147. Schaad N, Sechler A, Schuenzel E. 2009. Isolation, cultivation, and Koch’s postulates of the HLB bacterium. Phytopathology 99: S157. Schneider H. 1966. South Africa’s greening disease and Morocco’s stubborn disease. California Citrograph 51: 299–305. Schneider H. 1968. Anatomy of greening-diseased sweet orange shoots. Phytopathology 58: 1155–1160. Schutze, MK, Aketarawong N, Amornsak W, Armstrong KF, Augustinos AA, Barr N, Cameron SL. 2015. Synonymization of key pest species within the Bactrocera dorsalis species complex (Diptera: Tephritidae): taxonomic changes based on a review of 20 years of integrative morphological, molecular, cytogenetic, behavioural and chemoecological data. Systematic Entomology 40: 456–471. Schwartz T, Nylinder S, Ramadugu C, Antonelli A, Pfeil BE. 2015. The origin of Oranges: A multi-locus phylogeny of Rutaceae subfamily Aurantioideae. Systematic Botany 40: 1053–1062. Schwartz T. 2011. A phylogeny of the Rutaceae and a biogeographic study of its subfamily Aurantioideae. MS Dissertation. University of Gothenburg. Schwarz RE, Knorr LC, Prommintara M. 1973. Greening—cause of a recent decline of citrus in Thailand. Plant Protection Service Technical Bulletin 20. Department of Agriculture, Ministry of Agriculture & Co-operatives, Bangkok, Thailand & UNDP9/FAO THA 68/526. Schwarz RE. 1965. A fluorescent substance present in tissues of greening-affected sweet orange. South African Journal of Agricultural Science 8: 1177–1180. Sechler A, Schuenzel El, Cooke P, Donna S, Thaveechai N, Postnikova E, Stone AL, Scheider WL, Damsteegt VD, Schaad NW. 2009. Cultivation of ‘Candidatus Liberibacter asiaticus’, ‘Ca. L. africanus’, ‘Ca. L. americanus’ associated with huanglongbing. Phytopathology 99: 480–486. 348 Shafee SA, Alam SM, Agarwal MM. 1975. Taxonomic survey of encyrtid parasites (Hymenoptera: Encyrtidae) in India. Aligarh Muslim University (Zoological Series) on Indian on Indian Insect Types 10 (i–iii): 1–125. Shaw J, Lickey EB, Beck JT, Farmer SB, Liu W, Miller J, Siripun KC, Winder CT, Schilling EE, Small RL. 2005. The tortoise and the hare II: relative utility of 21 noncoding chloroplast DNA sequences for phylogenetic analysis. American Journal of Botany 92: 142–166. Shaw J, Lickey EB, Schilling EE, Small RL. 2007. Comparison of whole chloroplast genome sequences to choose noncoding regions for phylogenetic studies in angiosperms: the tortoise and the hare III. American Journal of Botany 94: 275–288. Shaw J, Shafer HL, Leonard OR, Kovach MJ, Schorr M, Morris AB. 2014. Chloroplast DNA sequence utility for the lowest phylogenetic and phylogeographic inferences in angiosperms: The tortoise and the hare IV. American Journal of Botany 101: 1987– 2004. Shneyer V, Kotseruba V. 2015. Cryptic species in plants and their detection by genetic differentiation between populations. Russian Journal of Genetics: Applied Research 5: 528–541. Shouche YS, Patole MS. 2000. Sequence analysis of mitochondrial 16S ribosomal RNA gene fragment from seven mosquito species. Journal of Biosciences 25: 361–366. Shylesha AN, AbrahamV. Unpublished. https://www.ncbi.nlm.nih.gov/nuccore/ KJ701414. Siampour MKA, Izadpanah, AR, Afsharifar, Salehi M, Taghizade M. 2006. Detection of phytoplasma in insects in witches’ broom affected lime groves. Iranian Journal of Plant Pathology 42: 139–158. Simon C, Frati F, Beckenbach A, Crespi B, Liu H, Flook P. 1994. Evolution, weighting, and phylogenetic utility of mitochondrial gene sequences and a compilation of conserved polymerase chain reaction primers. Annals of the Entomological Society of America 87: 651–701. 349 Simon S, Schierwater B, Hadrys H. 2010. On the value of elongation factor-1α for reconstructing pterygote insect phylogeny. Molecular Phylogenetics and Evolution 54: 651–656. Skelley LH, Hoy MA. 2004. A synchronous rearing method for the Asian citrus psyllid and its parasitoids in quarantine. Biological Control 29: 14−23. Small RL, Cronn RC, Wendel JF. 2004. LAS Johnson Review No. 2. Use of nuclear genes for phylogeny reconstruction in plants. Australian Systematic Botany 17: 145–170. Small RL, Lickey EB, Shaw J, Hauk WD. 2005. Amplification of noncoding chloroplast DNA for phylogenetic studies in lycophytes and monilophytes with a comparative example of relative phylogenetic utility from Ophioglossaceae. Molecular Phylogenetics and Evolution 36: 509–522. Soltis DE, Soltis PS. 1998. Choosing an approach and an appropriate gene for phylogenetic analysis In: Soltis PS, Soltis DE, Doyle JJ (eds), Molecular Systematics of Plants. Chapman and Hall. New York. pp. 1–42. Spann TM, Atwood RA, Rucks P, Graham JH. 2008. Rebirth of the Florida citrus nursery industry. http://citrusagents.ifas.edu/agents/atwood/PDF/rebirth_fl_citrus_nursery_ind.pdf. Spanoghe JR. 1841. Prodromus florae Timorensis. Linnaea 15: 178. Stone BC. 1985. Rutaceae. In: Dassanayake MD, Fosberg FR (eds), A Revised Handbook to the Flora of Ceylon. New Delhi: Amerind Publishing Co. Pvt. Ltd. pp. 406–465. Stone GN, Lohse K, Nicholls JA, Fuentes-Utrilla P, Sinclair F, Schönrogge K, Csóka G, Melika G, Nieves-Aldrey JL, Pujade-Villar J. 2012. Reconstructing community assembly in time and space reveals enemy escape in a Western Palearctic insect community. Current Biology 22: 532–537. Su HJ, Chang SC. 1976. The response of the likubin pathogen to antibiotics and heat therapy. In: Calavan EC (ed.) Proceedings of the Seventh Conference of the International Organization of Citrus Virologists, Athens, Greece, 29 September-4 October 1975. International Organization of Citrus Virologists, University of California: Riverside. pp. 27–34. 350 Su HJ, Hogenhout SA, Al-Sadi AM, Kuo CH. 2014. Complete chloroplast genome sequence of Omani Lime (Citrus aurantiifolia) and comparative analysis within the rosids. PLoS One 9:e113049. Su HJ, Huang AL. 1990. The nature of likubin organism, life cycle morphology and possible strains. In: Aubert B, S. Tontyaporn S, Buangsuwon D (eds), Proceedings of the Fourth International Asia Pacific Conference on Citrus Rehabilitation, Chiang Mai, Thailand, 4–10 February 1990. Rome: FAO UNDP. pp. 106–110. Su HJ, Hung TH, Lim WH. 1995. Infection and spreading of citrus greening. In: Abstracts of the International Symposium on Integrated Management Insect-borne Virus Diseases of Tropical fruit. FFTC/ASPAC, Taipei, Taiwan. p. 29. Su HJ, Matsumoto T. 1972. Further studies on the complex causing likubin of citrus in Taiwan. In: Price WC (ed.), Proceedings of the Fifth Conference of the International Organization of Citrus Virologists, Tokyo, Japan, 30 October–8 November 1969. Gainesville: University of Florida Press. pp. 28–34. Su HJ. 2000. Epidemiological review on citrus greening and viral diseases of citrus and banana with special reference to disease-free nursery system. In: Molina AB, Roa VN, Bay-Petersen J, Carpio AT, Joven JEA (eds), Proceedings of a Regional Workshop on Disease Management of Banana and Citrus Through the Use of Disease–Free Planting Materials, Davao City, Philippines, 14–16 October 1998. International Network for the Improvement of Banana and Plantain‒Asia and the Pacific Network, Los Baños, Laguna, Philippines. Subandiyah S, Nikoh N, Tsuyumu S, Somowiyarjo S, Fukatsu T. 2000. Complex endosymbiotic microbiota of the citrus psyllid Diaphorina citri (Homoptera: Psylloidea). Zoological Science 17: 983–989. Sun YL, Kang HM, Han SH, Park YC, Hong SK. 2015. Taxonomy and phylogeny of the genus citrus based on the nuclear ribosomal dna its region sequence. Pakistan Journal of Botany 47: 95–101. Susanto S, Abdila A, Sulistyaningrum D. 2013. Growth and postharvest quality of mandarin (Citrus reticulata ‘Fremont’) fruit harvested from different altitudes. In: 351 Palupi ER, Krisantini, Warrington IJ (eds), Proceedings of the Fourth International Symposium on Tropical and Subtropical Fruits, Bogor, Indonesia, 3 November 2008. pp. 421–426. Swingle W, Reece P. 1967. The botany of citrus and its wild relatives In: Reuther W, Webber HJ, Batchelor LD (eds), The Citrus Industry. Volume 1. Berkeley: University of California. pp. 190–430. Swisher K, Crosslin J. 2014. Restriction digesection method for haplotyping the potato psyllid, Bactericera cockerelli. Southwestern Entomologist 39: 49–56. Taberlet P, Gielly L, Pautou G, Bouvet J. 1991. Universal primers for amplification of three non-coding regions of chloroplast DNA. Plant Molecular Biology 17: 1105–1109. Tamura K .1992. Estimation of the number of nucleotide substitutions when there are strong transition-transversion and G + C-content biases. Molecular Biology and Evolution 9: 678–687. Tamura K, Nei M. 1993. Estimation of the number of nucleotide substitutions in the control region of mitochondrial DNA in humans and chimpanzees. Molecular Biology and Evolution 10: 512–526. Tamura K, Stecher G, Peterson D, Filipski A, Kumar S. 2013. MEGA6: molecular evolutionary genetics analysis version 6.0. Molecular Biology and Evolution 30: 2725–2729. Tanaka T. 1929. Chalcas, a Linnean genus which includes many new types of Asiatic plants. Journal of the Society for Tropical Agriculture 1: 23–44. Tang J, Toé L, Back C, Unnasch T. 1996. Intra-specific heterogeneity of the rDNA internal transcribed spacer in the Simulium damnosum (Diptera: Simuliidae) complex. Molecular Biology and Evolution 13: 244–252. Tang YQ. 1989. A preliminary survey on the parasite complex of Diaphorina citri Kuwayama (Homoptera: Psyllidae) in Fujian. In: B. Aubert, Ke C, Gonzales C (eds), Proceedings of the Second Asian/Pacific Regional Workshop on citrus greening, Lipa, Philippines, 20–26 November 1988. UNDP-FAO, Rome, Italy. pp. 10–16. 352 Tanner DA, González JM, Matthews RW, Vinson SB, and Pitts JP. 2011. Evolution of the courtship display of Melittobia (Hymenoptera: Eulophidae). Molecular Phylogenetics and Evolution 60: 219–227. Tara JS, Sharma M. 2010a. Record of hemipteran insect pest diversity on Murraya koenigii (L.) Sprengel (curry leaf), a medicinally important plant from Jammu region of J and K State. The Bioscan 5: 71–74. Tara JS, Sharma M. 2010b. Survey of insect pest diversity on economically important plant Murraya koenigii (L.) Sprengel in Jammu, J & K. Journal of Entomological Research 34: 265–270. Tatineni S, Sagaram US, Gowda S, Robertson CJ, Dawson WO, Iwanami T, Wang N. 2008. In planta distribution of ‘Candidatus Liberibacter asiaticus’ as revealed by polymerase chain reaction (PCR) and real-time PCR. Phytopathology 98: 592–599. Teixeira DC, Danet JL, Eveillard S, Martins, EC, de Jesus Junior WC, Yamamoto PD, Lopes SA, Bassanezi RB, Ayres AJ, Saillard C, Bové JM. 2005a. Citrus Huanglongbing in São Paulo, Brazil: PCR detection of the ‘Candidatus’ Liberibacter species associated with the disease. Molecular and Cellular Probe 19: 173–179. Teixeira DC, Saillard C, Couture C, Martins EC, Wulff NA, Eveillard-Jagoueix S, Yamamoto PT, Ayres AJ, Bové JM. 2008. Distribution and quantification of ‘Candidatus Liberibacter americanus’, agent of huanglongbing disease of citrus in Sao Paulo State, Brasil, in leaves of an affected sweet orange tree as determined by PCR. Molecular and Cellular Probes 22: 139–150. Teixeira DC, Saillard C, Eveillard S, Danet JL, Costa IP, Ayres AJ, Bové JM. 2005b. ‘Candidatus Liberibacter americanus’, associated with citrus huanglonbing (greening disease) in São Paulo State, Brazil. International Journal of Systematic and Evolutionary Microbiology 55: 1857–1862. Thao ML, Moran NA, Abbot P, Brennan EB, Burckhardt DH, Baumann P. 2000. Cospeciation of psyllids and their primary prokaryotic endosymbionts. Applied and Environmental Microbiology 66: 2898–2905. 353 Tinmaker MIR, Ali K, Pawar SD. 2010. Thunderstorm electrical parameters vis-à-vis rainfall and surface air temperatures over a tropical inland station, Pune, India. Journal of the Meteorological Society of Japan 88: 899–908. Tirtawidjaja S, Hadiwidjaja T, Lasheen AM. 1965. Citrus vein-phloem degeneration virus, a possible cause of citrus chlorosis in Java. Proceedings of the America Society of Horticultural Science 86: 235–243. Tirtawidjaja S. 1972. Further studies on vein phloem degeneration disease of citrus. A report to the Horticultural Research Institute and the Central Horticultrual Service of the Department of Agriculture, October 1972. 16 pp. (Indonesia) Tirtawidjaja S. 1980. Citrus virus research in Indonesia. In: Calavan EC, Garnsey SM, Timmer LW (eds), Proceedings of the Eighth Conference of the International Organization of Citrus Virologists, Mildura, Victoria, Australia, 23–25 May 1979. Riverside: International Organization of Citrus Virologists, University of California: Riverside. pp. 129–132. Tirtawidjaja S. 1981. Insect, dodder and seed transmissions of citrus vein phloem degeneration (CVPD). In: Matsumoto K (ed.), proceedings of the Fourth International Society Citriculture Congress, Tokyo, Japan, 9–12 November 1981. Riverside: International Society of Citriculture. 1: 469–471. Toorawa P. 1998. La maladie du huanglongbing (greening) des agrumes a L’Île Maurice. Detection de ‘Candidatus Liberobacter asiaticum’ et ‘Candidatus Liberobacter africanum’ dans les agrumes et les insects vecteurs. Doctoral Thesis, L’University de Bordeaux. 186 pp. Tsai JH, Liu YH. 2000. Biology of Diaphorina citri (Homoptera: Psyllidae) on four host plants. Journal of Economic Entomology 93: 1721–1725. Turechek WW, Irey M, Sieburth P, Brlansky R, DaGraça J, Graham J, Gottwald T, Hartung J, Hilf M, Kunta M, Manjunath K, Ling H, Ramdugu C, Roberts P, Rogers M, Shatters R, Sun X, Wang N. 2009. Evaluation of quantitative real-time PCR assays for detection of citrus greening. In: D.M. Gadoury DM, Seem RC, Moyer MM, Fry WE (eds), Proceedings of the Tenth International Epidemiology Workshop, New 354 York State Agricultural Experiment Station, Geneva, New York, 2–7 June 2009. pp. 158–160. USDA-APHIS. 2012. New pest response guidelines: Citrus greening disease. APHIS website, https://www.aphis.usda.gov/plant_health/plant_pest_info/citrus_greening/downloads/ pdf_files/cg-nprg.pdf van den Berg MA, van Vuuren SP, Deacon VE. 1991–1992. Studies on greening disease transmission by the citrus psylla, Trioza erytreae (Hemiptera: Triozidae). Isreal Journal of Entomology 25–26: 51–56. van Iterson W, Ruys AC. 1960. The fine structure of the Mycoplasmataceae (Microorganisms of the Pleuropneumonia Group = PPLO). 1. Mycoplasma hominis, M. fermentans and M. salivarium. Journal of Ultrastructure Research 3: 282–301. van Vuuren SP. 1996. Huanglongbing. The official name for greening disease of citrus. Inligtingsbulletin‒Instituut vir Tropiese en Subtropiese Gewasse 287: 5‒6. Varma A, Ahlawat YS, Chakraborty NK, Garnier M, Bové JM. 1993. Detection of the greening BLO by electron microscopy, DNA hybridization and ELISA in citrus leaves with and without mottle from various regions in India. In: Moreno P, da Graça JV, Timmer LW (eds), Proceedings of the Twelfth Conference of the International Organization of Citrus Virologists, New Delhi, India, 23–27 November 1992. Riverside: International Organization of Citrus Virologists, University of California: Riverside. pp. 280–286. Villechanoux S, Garnier M, Renaudin J, Bové JM. 1992. Detection of several strains of bacterium-like organism of citrus greening disease by DNA probes. Current Microbiology 24: 89–95. Wallace JM. 1978. Virus and viruslike diseases. In: Reuther W, Clavan EC, Carman GE (eds), The Citrus Industry, Volume IV, Crop Protection. Berkeley: Division of Agricultural Sciences, University of California. pp. 67‒184. Wallis RL. 1955. Ecological studies on the potato psyllid as a pest of potatoes. United States Department of Agriculture Technical Bulletin 1107. 355 Walter AJ, Duan Y, Hall DG. 2012a. Titers of ‘Ca. Liberibacter asiaticus’ in Murraya paniculata and Murraya-reared Diaphorina citri are much lower than in citrus and citrus-reared psyllids. HortScience 47: 1449–1452. Walter AJ, Hall DG, Duan YP. 2012b. Low incidence of 'Candidatus Liberibacter asiaticus' in Murraya paniculata and associated Diaphorina citri. Plant Disease 96: 827–832. Wang H, Kim MK, Kim YJ, Lee HN, Jin H, Chen J, Yang DC. 2012. Molecular authentication of the oriental medicines Pericarpium Citri Reticulatae and Citri Unshius Pericarpium using SNP markers. Gene 494: 92–95. Wang N, Trivedi P. 2013. Citrus huanglongbing: a newly relevant disease presents unprecedented challenges. Phytopathology 103: 652–665. Wang YJ, Cen YJ, Jiang HY, Luo XZ, Deng XL, Xia YL. 2015. Identification of haplotypes of Cacopsylla citrisuga from Yunnan Province based on mitochondria COI sequence. Journal of South China Agricultural University 36: 81–86. Waterhouse 1998. Biological control of insect pests: Southeast Asian prospects. Australian Centre for International Agricultural Research, Canberra, Australia. pp. 113–134 Waterston J. 1922. On the chalcidoid parasites of psyllids (Hemiptera, Homoptera). Bulletin of Entomological Research 13: 41–58. Weinert MP, Jacobson SC, Grimshaw JF, Bellis GA, Stephens PM, Gunua TG, Kame MF, Davis RI. 2004. Detection of huanglongbing (citrus greening disease) in Timor Leste (East Timor) and in Papua New Guinea. Australasian Plant Pathology 33: 135–136. Wenninger EJ, Hall DG. 2008. Daily and seasonal dynamics in abdomen color in Diaphorina citri (Hemiptera: Psyllidae. Annals of Entomological Society of America 101: 585–592. Westbrook CJ, Hall DG, Stover E, Duan YP, Lee RF. 2011. Colonization of Citrus and Citrus-related germplasm by Diaphorina citri (Hemiptera: Psyllidae). HortScience 46: 997–1005. White TJ, Bruns T, Lee S, Taylor J. 1990. Amplification and direct sequencing of fungal ribosomal RNA genes for phylogenetics. In: Innis MA, Gelfand DH, Sninsky JJ, 356 White TJ (eds), PCR Protocols: A Guide to Methods and Applications. Academic Press, Inc., New York. Wirta H, Varkonyi G, Rasmussen C, Kaartinen R, Schmidt NM, Hebert PD, Bartak M, Blagoev G, Disney H, Ertl S, Gjelstrup P, Gwiazdowicz DJ, Hulden L, Ilmonen J, Jakovlev J, Jaschhof M, Kahanpaa J, Kankaanpaa T, Krogh PH, Labbee R, Lettner C, Michelsen V, Nielsen SA, Nielsen TR, Paasivirta L, Pedersen S, Pohjoismaki J, Salmela J, Vilkamaa P, Vare H, von Tschirnhaus M, Roslin T. 2016. Establishing a community-wide DNA barcode library as a new tool for arctic research. Molecular Ecology Resources 16: 809–822. Wu FN, Cen YJ, Deng XL, Zheng Z, Chen JC, Liang GW. 2016. The complete mitochondrial genome sequence of Diaphorina citri (Hemiptera: Psyllidae). Mitochondrial DNA Part B: 1-2. Wu S, Zhang, Q. 1985. Observations on cytopathic effects of citrus yellow shoot disease. Journal of Chinese Electron Microscopy Society 4(2): 69– 72. Xu CF, Li KB, Ke C, Liao JZ. 1985. On the transmission of citrus yellow shoot by psylla and observation with electron microscopy. Acta Phytopathologica Sinica 15: 241245. Xu CF, Xia YH, Li KB, Ke C. 1988a. Preliminary study on the bionomics of Diaphorina citri Kuwayama the vector of the disease huanglongbing disease. In: Aubert B, Ke C, Gonzales C (eds), Proceedings of the Second Asian/Pacific Regional Workshop on citrus greening, Lipa, Philippines, 20–26 November 1988. Rome. UNDP-FAO. pp. 29–31. Xu CF, Xia YH, Li KB, Ke C. 1988b. Further study of the transmission of citrus huanglongbing by a psyllid, Diaphorina citri Kuwayama. In: Timmer LW, Garnsey SM, Navarro L (eds), Proceedings of the Tenth Conference of the International Organization of Citrus Virologists, Valencia, Spain, 17–21 November 1986. Riverside: International Organization of Citrus Virologists, University of California: Riverside. pp. 243–248. 357 Xu CF, Xia YH, Li KB, Ke C. 1988c. Studies on the law of transmission of citrus huanglongbing by psyllid, Diaphorina citri and the distribution of pathogen in the adult. Journal of Fujian Academy of Agricultural Science 3: 57–62. Yamaji H, Kondo K, Takeda O. 2013. Origin of cultivated citrus (Rutaceae) documented by the content of interanl transcribed spacer sequences (ITS) in nuclear ribosomal DNA. Journal of Japanese Botany 88: 222–238. Yamamoto PT, Felippe MR, Garbim LF, Coelho JHC, Ximenes NL, Martins EC, Leite APR, Sousa MC, Abrahão DP, Braz JD. 2006. Diaphorina citri (Kuwayama) (Hemiptera: Psyllidae): Vector of the bacterium Candidatus Liberibacter americanus. Proceedings of the Huanglongbing-Greening International Workshop, Ribeirão Preto, São Paulo, Brazil, 16–20 July 2006. Araraquara: Fundecitrus. p. 96 Yamamoto, PT. 2007. Control of citrus huanglongbing (ex-greening) and citrus tristeza virus. Report of Mission, September 14 to 27, 2007. Bhutan. FAO Technical Cooperation Program/BHU/3001 (A). TR: NPPC/ADM-25, Techincal Report 1. Yang CK, Li FS. 1984. Nine new species and a new genus of psyllids from Yunnan. Entomotaxonomia 6: 251–266. Yang CT. 1984. Psyllidae of Taiwan. Taiwan Museum Special Publication Series 3: 1–305. (Diaphorina citri pp. 37–41). Yang YP, Huang MD, Beattie GAC, Xia YL, Ouyang GC, Xiong JJ. 2006. Distribution, biology, ecology and control of the psyllid Diaphorina citri Kuwayama, a major pest of citrus: A status report for China. International Journal of Pest Management 52: 343–352. Young I, Coleman AW. 2004. The advantages of the ITS2 region of the nuclear rDNA cistron for analysis of phylogenetic relationships of insects: a Drosophila example. Molecular Phylogenetics and Evolution 30: 236–242. Zhang DX, Hartley TG, Mabberley DJ. 2008. Rutaceae. In: Wu ZY, Raven PH, Hong DY (eds.), Flora of China, Vol. 11 (Oxalidaceae through Aceraceae). Beijing: Science Press, St. Louis: Missouri Botanical Garden Press. 358 Zhang DX, Hewitt GM. 1997. Insect mitochondrial control region: a review of its structure, evolution and usefulness in evolutionary studies. Biochemical Systematics and Ecology 25: 99–120. Zhao XY. 1981. Citrus yellow shoot disease (huanglongbing) in China—a review. In: Matsumoto K (ed.), Proceedings of the Fourth International Society Citriculture Congress, Tokyo, Japan, 9–12 November 1981. Riverside: International Society of Citriculture. 1: 466–469. Zhou LJ, Duan YP, Gabriel D, Gottwald TR. 2008. Seed transmission of ‘Candidatus Liberibacter asiaticus’ in periwinkle and dodder resulted in low bacterial titer and very mild disease in perwinkle. Phytopathology 98: S181. Zhou LJ, Gabriel DW, Duan YP, Halbert SE, Dixon WN. 2007. First report of dodder transmission of huanglongbing from naturally infected Murraya paniculata to citrus. Plant Disease 91: 227–227. Zohdi H, Hossini R. Unpublished. https://www.ncbi.nlm.nih.gov/nuccore/KP843860. 359