Bernardini et al. Journal of Inflammation 2012, 9:47
http://www.journal-inflammation.com/content/9/1/47
RESEARCH
Open Access
Differential expression of nitric oxide synthases
in porcine aortic endothelial cells during
LPS-induced apoptosis
Chiara Bernardini*, Francesca Greco, Augusta Zannoni, Maria Laura Bacci, Eraldo Seren and Monica Forni
Abstract
Background: It is well known that nitric oxide (NO) is generated by a family of constitutively (nNOS and eNOS) or
inducibly (iNOS) expressed enzymes and takes part in different aspects of the inflammatory response; nevertheless,
its effective role in the pathogenesis of multiple organ dysfunction and septic shock is not fully understood.
Methods: To investigate the Nitric Oxide Synthases (NOSs) expression in endothelial cells during endotoxin
exposure and the involvement of NO in lipopolysaccharide (LPS)-induced apoptosis, primary cultures of porcine
Aortic Endothelial Cells (pAECs) were exposed to LPS for different time periods (1-24 h) and to LPS + L-NAME (15 h).
Results: Lipopolysaccharide induced an increase in mRNA and protein iNOS expression; on the contrary, the
expression of eNOS was decreased. Furthermore, NOSs localisation was in part modified by LPS treatment. No
alteration in the total level of Nitric Oxide was observed. L-NAME (5 mM) addition determined a slight decrease of
LPS-induced apoptosis.
Conclusions: Endotoxin treatment strongly influenced NOS expression with an upregulation of iNOS and a
simultaneous down regulation of eNOS. Moreover, in our model, the involvement of NO on LPS-induced apoptosis
is very modest, suggesting that different pathways are involved in the regulation of this process.
Keywords: Endothelial cells, Endotoxin, Apoptosis, NO
Introduction
Several studies have suggested a key role of the endothelium in the pathophysiology of severe sepsis; during this
process, LPS (lipopolysaccharide), a component of the
bacterial wall is able to cause structural and functional
alterations of the endothelial phenotype and eventually
endothelial cell death [1]. The loss of balance between
pro-inflammatory and protective gene products is essential for converting endothelial cell activation, which
represents a normal adaptive response to various stimuli,
into endothelial dysfunction [2,3]. Since LPS-induced
apoptosis is regulated by a complex pathway of signals,
the identification of the molecules involved in this
process is important. Our previous data demonstrated
that LPS induces apoptosis in a model of a primary culture of porcine aortic endothelial cells (pAECs) and is
* Correspondence: chiara.bernardini5@unibo.it
Department of Veterinary Medical Sciences-DIMEVET, University of Bologna,
Via Tolara di Sopra 50, 40064 Bologna, Ozzano dell’Emilia, Italy
effective in evoking “the heat shock response” with an
increase of non-specific protective molecules, such as
Hsp70 and Hsp32, and a specific growth factor, such as
Vascular Endothelial Growth Factor (VEGF) [4].
It is well known that nitric oxide (NO) is generated by
a family of constitutively (nNOS and eNOS) or inducibly
(iNOS) expressed enzymes [5] and takes part in different
aspects of the inflammatory response; nevertheless, its
effective role in the pathogenesis of multiple organ dysfunction and septic shock is not fully understood [6].
The difficulty in clarifying the role of NO during septic
shock is also a consequence of species-specific variability; in fact, many differences in the pathogenesis of septic shock between humans and rodents have been
reported; plasma nitrite and nitrate concentrations
detected in patients with hypotensive septic shock are
lower in humans than in rodents [7]; moreover, human
hepatocytes [8] and human macrophages [9,10] produce
less NO than cells isolated from rodents. Furthermore, it
© 2012 Bernardini et al.; licensee BioMed Central Ltd. This is an Open Access article distributed under the terms of the Creative
Commons Attribution License (http://creativecommons.org/licenses/by/2.0), which permits unrestricted use, distribution, and
reproduction in any medium, provided the original work is properly cited.
Bernardini et al. Journal of Inflammation 2012, 9:47
http://www.journal-inflammation.com/content/9/1/47
has been described [10] that porcine macrophages, like
human but unlike bovine and rat cells, are not able to
produce NO in vitro suggesting that interspecies differences are also maintained in in vitro models.
The results obtained by the use of larger animal models [11-13] seem to indicate the pig as a better model of
septic shock for the investigation of this disease in
human.
Taking into account all these considerations, the aim
of the present study was to investigate the ability of
endotoxin exposure to influence eNOS and iNOS expression in terms of mRNA, protein amount and protein
localisation in our model of LPS-induced apoptosis in
pAECs [4]. The effect of nitric oxide in LPS-induced
apoptosis was also evaluated.
Materials and methods
Cell cultures
Porcine Aortic Endothelial Cells were isolated as previously described [4]. The cells were cultured in Human
Endothelial Basal Growth Medium (Gibco-Invitrogen,
Paisley, UK) supplemented with 5% Foetal Bovine Serum
(FBS, Gibco-Invitrogen) and 1% antibiotic/antimicotic
(Gibco-Invitrogen). Cell number and viability (95%) were
determined using a Thoma chamber under a phasecontrast microscope after vital staining with trypan blue
dye. The cells were placed in T-25 tissue culture flasks
(approximately 3x105 cells/flask) (T25 Falcon BecktonDickinson, Franklin Lakes, NJ, USA) in a 5% CO2
atmosphere at 38.5°C. The cells were maintained in a
logarithmic growth phase by routine passages every
2–3 days at a 1:3 split ratio.
Cell treatments
All experiments were performed with cells from the
third to the eighth passage.
Previous observations indicated that the time of culture could influence gene expression in a primary culture of pAECs; therefore, we decided to utilise a relative
time control point for each time of treatment. The
pAECs were grown until confluence in a flat bottom 24well assay plate (approximately 4x104 cells/well) (353813
Falcon Beckton-Dickinson) or, for immunohistochemical
study, in 8-well slide chambers (approximately 4x104
cells/well) (354631 Beckton-Dickinson).
Lipopolysaccharide 10 μg/ml (E. coli 055:B5, SigmaAldrich Co, St Louis, MO, USA) was added to the culture medium for different time periods (1, 2, 3, 4, 5, 6, 7,
15 and 24 h for iNOS and eNOS mRNA expression
study; 7, 15, 24 h for iNOS and eNOS protein expression
and immunolocalisation; 1, 3, 7, 15 and 24 h for NO
level determination. Control samples were utilised for
each time period of treatment. At the end of each
Page 2 of 9
experimental point, treated or control cells and media
were collected and stored until the analysis.
L-NAME 5 mM or 10 mM (N5751, Sigma) was added
to the culture with or without LPS (10 μg/ml) and incubated for 15 h. At the end of treatment the total levels
of NO and the apoptosis rate were evaluated.
Real-time PCR quantification of iNOS and eNOS mRNA
Total ribonucleic acid (RNA) from pAECs was isolated
using an RNeasy Mini Kit 50 (Qiagen Sciences Inc, MD,
USA) and treated with RNase-free DNase kit (Qiagen)
according to the manufacturer’s instructions.
The RNA concentration was spectrophotometrically
quantified (A260 nm) and 1 μg of total RNA was reverse
transcribed to cDNA using an iScript cDNA Synthesis
Kit (Bio-RAD Laboratories Inc., California, USA) at a
final volume of 20 μl. Swine primers (eNOS, iNOS and
Hypoxanthine-guanine phosphoribosiyltransferase -HPRT)
were designed using Beacon Designer 2.07 Software
(premier Biosoft International, Palo Alto, Ca, USA). Their
sequences, expected PCR product length and accession
number in the EMBL database are shown in Table 1.
Real-time quantitative polymerase chain reaction (PCR)
was carried out in an iCycler Thermal Cycler (Bio-RAD)
using SYBR green I detection. A master-mix of the following reaction components was prepared to the indicate
end-concentrations: forward primer (0.2 μM) and reverse
primer (0.2 μM), 1x IQ SYBR Green BioRad Supermix
(Bio-RAD Laboratories Inc.). Then, 2.5 μl of cDNA was
added to 22.5 μl of the master mix. All samples were carried out in duplicate. The following real-time PCR protocol was employed: initial denaturation for 3 min at 95°C,
40 cycles of 95°C for 15 sec and 60°C for 30 sec, followed
by a melting step with slow heating from 55°C-95°C with
a rate of 0.5°C/s. The housekeeping gene HPRT data were
used to normalise the amount of RNA.
The expression of iNOS and eNOS mRNA under
standard culture conditions was calculated as a threshold cycle (deltaCT) (HPRT CT – iNOS/eNOS CT). The
expression of iNOS and eNOS mRNA during LPS treatment was calculated as the fold of increase using the
ΔΔCt method (ABI Prism 7700 Sequence detection System User Bulletin #2. Relative quantification of gene expression; 1997 and 2001).
Real-time efficiency for each primer set was acquired
by amplification of a standardised cDNA dilution series.
The specificity of the amplified PCR products was verified by analysis of the melting curve, which is sequencespecific and by an agarose gel electrophoresis run.
iNOS and eNOS Western blot
The cells were harvested and lysed in SDS solution
(Tris–HCl 50 mM pH 6.8; SDS 2%; glycerol 5%). The
protein content of cellular lysates was determined by a
Bernardini et al. Journal of Inflammation 2012, 9:47
http://www.journal-inflammation.com/content/9/1/47
Page 3 of 9
Table 1 Forward and reverse primer sequences, RT-PCR product length and accession number (Acc.No.) in the EMBL
database
Primer
Sequence (50-30)
Product Length (bp)
Acc. No.
eNOS
For.: GCTCTCACCTTCTTCCTG
144
AY266137
119
U59390
115
AF143818
Rev.: CCACTTCCACTCCTCATAG
iNOS
For.: CAACAATGGCAACATCAGG
Rev.: CATCAGGCATCTGGTAGC
HPRT
For.: GGACAGGACTGAACGGCTTG
Rev.: GTAATCCAGCAGGTCAGCAAAG
Protein Assay Kit (TP0300, Sigma). Aliquots containing
20 μg of proteins were separated on NuPage 4-12% bisTris Gel (Gibco-Invitrogen) for 50 min at 200 V. The
proteins were then electrophoretically transferred onto a
nitrocellulose membrane. The blots were washed in PBS
and protein transfer was checked by staining the nitrocellulose membranes with 0.2% Ponceau Red. Nonspecific binding on nitrocellulose membranes was
blocked with 5% milk powder in PBS-T20 (Phosphate
Buffer saline-0.1% Tween-20) for 1 h at room
temperature. The membranes were then incubated overnight at 4°C with a 1:200 dilution of an anti-iNOS
(610332, BD Transduction) rabbit polyclonal antibody in
PBS-T20 with 3% milk powder or at 4°C overnight with
a 1:500 dilution of an anti-eNOS mouse monoclonal
antibody (Sa-258, Biomol, Butler Pike, Plymouth Meeting, PA, USA) in Tris Buffered Saline-T20 (TBS-T20
20 mM Tris–HCl, pH 7.4, 500 mM NaCl, 0.1% T-20).
After several washings with PBS-T20, the membranes
were incubated with the secondary biotin-conjugate
antibody and then with a 1:1000 dilution of an antibiotin horseradish peroxidase (HRP)-linked antibody.
The western blots were developed using chemiluminescent substrate (Super Signal West Pico Chemiluminescent Substrate, Pierce Biotechnology, Inc, Rockford, IL,
USA) according to the manufacturer’s instructions. The
intensity of the luminescent signal of the resultant bands
was acquired by Fluor-STM Multimager using Quantity
One Software (Bio-RAD).
In order to normalise the NOS data on the housekeeping protein, membranes were stripped (briefly: the membranes were washed 5 min in water, then 5 min in 0.2 M
NaOH and then washed again in water) and re-probed
for housekeeping β-tubulin (1:500 sc-5274 Santa Cruz
Biotechnology Inc, Santa Cruz, CA, USA).
The relative protein content (NOS/ β-tubulin) was
expressed as arbitrary units (AUs).
iNOS and eNOS protein localisation by
immunofluorescence staining
The cells were fixed with ethanol:acetic acid (2:1) for
10 min at −20°C, and permeabilised with 0.1% Triton
X-100. Thereafter, the cells were washed with PBS three
times and incubated for 1 h at RT with 10% FBS in
DPBS (Dulbecco Phosphate Buffer Solution, Cambrex
Bio-Science INC, Wakersville, MA, USA). Primary antibodies: 1:100 anti-iNOS (BD Transduction) and 1:100
anti eNOS (Biomol) were added, and the slides were
incubated in a humidified chamber at 4°C overnight.
After several washes with PBS, a 1:800 dilution of fluorescein isothiocyanate (FITC)-conjugated secondary antibodies was added. The cells were then counterstained
with propidium iodide (PI) and examined under an epifluorescence microscope (Eclipse e600 Nikon, Japan)
equipped with appropriate filters and a Nikon DXM
1200 digital camera with ACT-2U software for DMX
1200.
NO determination
The NO concentrations in culture media were determined by the “Total Nitric Oxide Assay” (DE 1600
R&D Systems, Minneapolis, MN 55413, USA) using
Appliskan 100-240 V (Thermo Electron Corporation,
Vantaa Finland). This assay determines total nitric
oxide concentration based on the enzymatic conversion of nitrate to nitrites by nitrate reductase. The reaction is followed by a colorimetric detection of
nitrite as an azo dye product of the Griess Reaction.
The sensitivity of the assay was less than 1.35 μmol/L,
and the intra- and interassay coefficients of variation
were less than 5% and 7% respectively. The basal level
of NO present in the fresh endothelial medium was
subtracted from all samples (CTR or treated cells).
Apoptosis detection
A photometric enzyme immunoassay for the qualitative
and quantitative in vitro determination of cytoplasmic
histone-associated DNA fragments mono- and oligonucleosomes was carried out according to the manufacturer’s instructions (1774425, Roche Diagnostics GmbH,
82372 Penzberg, Germany) using Appliskan 100-240 V
(Thermo Electron Corporation, Vantaa Finland). Briefly,
the cells were lysed directly in the well, and the cytoplasmatic and nuclear fractions were separated by centrifugation at 200 x g. Twenty microliters of cytoplasmatic
fraction were added to a streptavidin-coated microtiter
Bernardini et al. Journal of Inflammation 2012, 9:47
http://www.journal-inflammation.com/content/9/1/47
plate. The biotin-labeled anti-histone antibody was
added, followed by an HRP-conjugated anti-DNA antibody. The reaction of the nucleosome-bound DNA fragments was quantified using photometric analysis.
Statistical analysis
Each treatment was replicated three times (mRNA and
protein analysis) or six times (NO and apoptosis detection) in three independent experiments (n = 3). The data
were analysed by a one-way analysis of variance
(ANOVA) followed by the Tukey post hoc comparison
Test (SPSS program version 13.0; SPSS Inc, Chicago, IL,
USA). Differences of at least p < 0.05 were considered
significant.
Results
Standard culture conditions did not affect NOS expression or NO production.
The morphology of an untreated pAEC primary
culture is shown in Figure 1A. Lipopolysaccharide treatment induced a moderate spindle-shaped morphological change which was well evidenced after 24 h
(Figure 1B-D).
Quantification of iNOS and eNOS mRNA expression
Under standard culture conditions, the iNOS mRNA
expression level was notably lower than eNOS (Figure 2).
Page 4 of 9
Lipopolysaccharide induced a significant increase of
iNOS mRNA levels starting after 2 h of continuous
treatment, remaining stable until 7 h and declining at 15
and 24 h, without reaching the iNOS mRNA level in the
pAECs cultured under standard conditions (Figure 3A).
Conversely, eNOS mRNA levels were decreased by
LPS treatment starting after 5 h of continuous treatment
until the end of the experiment (Figure 3B).
Quantification of iNOS and eNOS protein expression
The iNOS protein level detected in the pAECs cultured
under standard culture conditions was very low while
the LPS treatment induced a significant increase of
iNOS at 7 h; the protein content then decreased without
reaching the basal level of the control cells (Figure 4A).
The eNOS protein is largely expressed in pAECs cultured under standard conditions while LPS treatment
induced a significant decrease of eNOS protein expression (Figure 5A).
iNOS and eNOS protein localisation
The iNOS protein was detected in the cytoplasm of the
pAECs cultured under standard culture conditions
(Figure 6A-C) while, in LPS treated cells, in addition to
a cytoplasmatic signal, nuclear staining was detected
(Figure 6D-F).
Figure 1 Representative images of pAEC morphology. A) pAECs under standard culture conditions. B, C, D) pAECs after 7, 15 and 24 h of LPS
treatment, respectively (phase contrast microscope 200X). LPS treatment induced a moderate spindle-shape morphological change well
evidenced after 24 h.
Bernardini et al. Journal of Inflammation 2012, 9:47
http://www.journal-inflammation.com/content/9/1/47
Figure 2 Relative gene expression of iNOS and eNOS in pAECs
under standard culture conditions at different time periods.
Relative mRNA data are expressed as delta Ct (HPRT Ct - iNOS or
eNOS Ct). The data represent the mean ± SEM (n = 3). Time of
culture did not influence iNOS and eNOS mRNA expression.
Page 5 of 9
Figure 4 Expression of iNOS protein in pAECs treated with LPS
(10 μg/ml) for different time periods (7, 15, 24 h). A) LPS
induced a significant increase of iNOS protein expression with
respect to the control (CTR = mean ± SEM of all control time points).
The data represent the mean ± SEM (n = 3) of relative protein
content (AU = Arbitrary Units). The different letters above the bars
indicate significant differences among the various time points (p < 0.05,
ANOVA post hoc Tukey’s test, n = 3). B) Representative Western Blot of
iNOS and relative housekeeping β-tubulin were reported.
Under standard culture conditions, the eNOS protein
is diffusely distributed in the cytoplasm of pAECs
(Figure 7A, B); LPS treatment resulted in a modification
of the signal with more intense staining in the perinuclear region (Figure 7C-F).
Figure 3 Relative gene expression of iNOS (A) and eNOS (B) in
pAECs treated with LPS (10 μg/ml) at different time periods
(n = 3). LPS increased iNOS mRNA expression while eNOS mRNA
expression was decreased. Relative mRNA data are expressed as
the fold of increase (Ct method) in respect to the control
(CTR = mean ± SEM of all control time points). Error bars represent
the range of relative expression. The different letters above the bars
indicate significant differences in the various time points (p < 0.05,
ANOVA post hoc Tukey’s test).
Figure 5 Expression of eNOS protein in pAECs treated with
LPS (10 μg/ml) for different time periods (7, 15, 24 h). A) LPS
induced a significant decrease of eNOS protein expression in respect
to the control (CTR = mean ± SEM of all control time points). The data
represent the mean ± SEM (n = 3) of the relative protein content (AU
= Arbitrary Units). The different letters above the bars indicate
significant differences among the various time points (p < 0.05,
ANOVA post hoc Tukey’s test, n = 3). B) Representative Western Blot
of eNOS and relative housekeeping β-tubulin were reported.
Bernardini et al. Journal of Inflammation 2012, 9:47
http://www.journal-inflammation.com/content/9/1/47
Page 6 of 9
Figure 6 Representative iNOS immunofluorescent staining on pAECs. Green fluorescence indicates positive immunostaining revealed by
FITC, red fluorescence indicates nuclear staining with Propidium Iodide (A, D magnification 200X; B, C, E, F magnification 1000X). A-C) iNOS
protein localization in standard cultured pAECs; a cytoplasmatic signal is evidenced. D-F) iNOS protein localisation after LPS treatment (15 h); a
nuclear signal in the form of bright granules is revealed.
Quantification of total NO level
Lipopolysaccharide treatment did not induce any significant change in the total level of nitric oxide (Figure 8).
L-NAME (5-10 mM) induced a dose dependent decrease
of total NO, both under standard control conditions and
with LPS treatment (Figure 9).
L-NAME effect on LPS-induced apoptosis
Lipopolysaccharide induced a significant increase of the
apoptosis rate in pAECs while L-NAME treatment
(5 mM) partially protected cells against LPS-induced
apoptosis (Figure 10). L-NAME 10 mM produced a
slight but significant increase of the apoptosis rate in
pAECs cultured under standard culture conditions and
was unable to reduce LPS-induced apoptosis.
Discussion
The present study demonstrated that LPS influenced the
expression of eNOS and iNOS in a primary culture of
pAECs.
Endotoxin treatment deeply influenced the expression
of eNOS and iNOS with an opposite effect: a significant
up-regulation of the inducible iNOS and a significant
down-regulation of the constitutive eNOS. This effect was
demonstrated by both mRNA and the protein data; in fact,
eNOS mRNA is reduced after 5 h of LPS treatment, and
these low levels remain constant and do not return to the
basal amount. The eNOS protein level confirmed and
reflected the mRNA kinetic trend. The iNOS mRNA upregulation is more intense and constant from 3 to 7 h of
LPS treatment while, after 15 and 24 h iNOS stimulation
is lower even if it does not return to the basal level.
Bernardini et al. Journal of Inflammation 2012, 9:47
http://www.journal-inflammation.com/content/9/1/47
Page 7 of 9
Figure 7 Representative eNOS immunofluorescent staining on pAEC. Green fluorescence indicates positive immunostaining revealed by
FITC, red fluorescence indicates nuclear staining with Propidium Iodide (magnification 400X). A, B) eNOS protein localisation in standard cultured
pAECs; a cytoplasmatic signal evenly diffused was detected. (C-F) LPS treatment resulted in a modification of the signal with more intense
staining in the perinuclear region.
Despite the fact that the effect of LPS on the expression of NOSs is evident, the nitric oxide levels recorded
in the culture medium after the administration of the
endotoxin did not undergo significant changes. To explain this result, we must, first of all, consider that the
determination of the total levels of NO in the endothelial culture medium is extremely difficult due to the high
concentrations of NO present in this specific medium,
as indicated by Papapetropoulos et al. [14]. In order to
reduce the effect of the culture medium on NO detection, we subtracted the basal level of the NO present in
the medium of standard culture conditions from all
values. The data thus obtained, however, do not show
significant variations as has also been indicated by other
authors who showed no significant changes in the levels
of NO following LPS administration in the same cellular
line [15] but also in mouse [16] and bovine [17] endothelial cells. Therefore, our hypothesis was that the elevated presence of NO in basal culture medium may
mask the small change of NO level generated by the decrease of eNOS expression and the simultaneous increase of iNOS expression.
Increasing evidence [18-20] demonstrated the different
roles performed by NOS enzymes on the basis of different cellular localisations. In our model we demonstrated
that endotoxin exposure influenced NOS localisation.
Under standard culture conditions, iNOS is detected as
a cytoplasmatic signal while after LPS treatment, the signal is evident in the nuclear region. The presence of
iNOS in the nucleus was demonstrated in different cellular types including brown adipocytes [21], rat neutrophils [18] and rat VSMC [22]. The meaning of the
Bernardini et al. Journal of Inflammation 2012, 9:47
http://www.journal-inflammation.com/content/9/1/47
Figure 8 The effect of LPS treatment on NO level (μmol/L) in
the culture medium of the pAECs. The cells are treated with LPS
(10 μg/ml) (white bars) for 1, 3, 7, 15 and 24 h (CTR = mean ± SEM of
all control time points, black bars). The data represent the mean ±
SEM (n = 3). No significant differences are observed.
nuclear presence of iNOS is not well clarified but the
hypothesis that NO could exert a toxic effect, caused
by direct damage of the DNA or indirect damage by
affecting gene transcription and cell proliferation, was
formulated [23]. Constitutive eNOS is diffusely distributed in the cytoplasm of pAECs in accordance with
the multiple functions of eNOS in ECs physiological
condition. Lipopolysaccharide treatment determined
more intense staining in the perinuclear region in accordance with that observed by Iwakiri et al. [19] and
Zhang et al. [20]. Additional investigation is necessary
to clarify the functional significance of eNOS distribution after LPS treatment, taking into account the
Page 8 of 9
Figure 10 Effects of L-NAME treatment on pAEC LPS-induced
apoptosis. Cells are treated with or without LPS (10 μg/ml) for 15 h,
with or without L-NAME (5 or 10 mM). The apoptosis level was
calculated as the fold of increase with respect to the control (CTR)
Data represent the mean ± SEM (n = 3). The different letters above
the bars indicate significant differences in the various time points (p
< 0.05, ANOVA post hoc Tukey’s test).
complex change in endothelial cell morphology
induced by endotoxins [24,25].
The last step of our study was to evaluate the involvement of eNOS and iNOS activity on LPS-induced apoptosis. As indicated by other authors [14], an elevated
concentration of L-NAME in the range of mM is necessary to block NO release in the culture medium of endothelial cells. Our results indicated that L-NAME 10 mM
increased the apoptosis rate, thus suggesting a toxic effect
of this dose. On the contrary we detected a slight decrease
in LPS-induced apoptosis when adding L-NAME 5 mM,
indicating a modest role of NO as a pro-apoptotic factor.
The role of NO as a pro-apoptotic or an anti-apoptotic factor is controversial [26,27]; in fact, in several models including porcine endothelial cells [15], the administration of
exogenous NO protected cells from apoptosis; nevertheless, the authors failed to obtain a protective effect by the
inhibition of endogenous NO production. All these findings may suggest that the effect of NOS activity on apoptosis could involve several different pathways and only
additional investigation will be able to assess whether the
involvement of NO in our model was independent of the
absolute amount of NO produced or was instead due to its
cellular localisation.
Competing interests
The authors declare that they have no competing interests.
Figure 9 The dffect of L-NAME on NO levels in pAEC culture
medium. The pAECs were treated with L-NAME (5 or 10 mM) in the
presence or absence of LPS (10 μg/ml 15 h). The data represent the
mean ± SEM (n = 3). The different letters above the bars indicate
significant differences in the various time points (p < 0.05, ANOVA
post hoc Tukey’s test).
Authors’ contribution
CB designed and performed research, analyzed the data and wrote the
manuscript. FG performed research. AZ performed research, analyzed the
data. MLB designed research, provided funding and edited the manuscript.
ES partecipated in experimental design and provided funding. MF designed
the experiment, analyzed the data, edited and approved the manuscript. All
authors read and approved the final manuscript.
Bernardini et al. Journal of Inflammation 2012, 9:47
http://www.journal-inflammation.com/content/9/1/47
Acknowledgements
This work was supported by the following research Grants: MIUR PRIN, RFO,
Consorzio Interuniversitario Trapianto d’Organo (CITO) and Fondazione del
Monte.
Received: 30 August 2011 Accepted: 20 November 2012
Published: 26 November 2012
References
1. Aird WC: The role of the endothelium in severe sepsis and multiple
organ dysfunction syndrome. Blood 2003, 101:3765–3777.
2. Hack CE, Zeerleder S: The endothelium in sepsis: source of and a target
for inflammation. Crit Care Med 2001, 29:S21–S27.
3. Vapaatalo H, Mervaala E: Clinically important factors influencing
endothelial function. Med Sci Monit 2001, 7:1075–1085.
4. Bernardini C, Zannoni A, Turba ME, Fantinati P, Tamanini C, Bacci ML,
Forni M: Heat shock protein 70, heat shock protein 32 and vascular
endothelial growth factor production and their effects on
lipopolysaccharide-induced apoptosis in Porcine Aortic Endothelial Cells.
Cell Stress Chaperones 2005, 10:340–348.
5. Wang Y, Marsden PA: Nitric oxide synthases: biochemical and molecular
regulation. Curr Opin Nephrol Hypertens 1995, 4:12–22.
6. Wallace JL: Nitric oxide as a regulator of inflammatory processes.
Mem Inst Oswaldo Cruz 2005, 100:5–9.
7. Pastor CM, Suter PM: Evidence that humans produce less nitric oxide
than experimental animals in septic shock. Crit Care Med 1998, 26:1135.
8. Nussler AK, Beger HG, Liu ZZ, Billiar TR: Nitric oxide, hepatocytes and
inflammation. Res Immunol 1995, 146:671–677.
9. Albina JE: On the expression of nitric oxide synthase by human
macrophages. Why no NO? J Leukoc Biol 1995, 58:643–649.
10. Zelnickova P, Matiasovic J, Pavlova B, Kudlackova H, Kovaru F, Faldyna M:
Quantitative nitric oxide production by rat, bovine and porcine
macrophages. Nitric Oxide 2008, 19:36–41.
11. Mehta S, Javeshghani D, Datta P, Levy RD, Magder S: Porcine endotoxemic
shock is associated with increased expired nitric oxide. Crit Care Med
1999, 27:385–393.
12. Albertini M, Lafortuna CL, Clement MG, Mazzola S, Radice S, Hussain SN:
Effect of NO synthase inhibition on cardiovascular and pulmonary
dysfunction in a porcine short-term model of endotoxic shock.
Prostaglandins Leukot Essent Fatty Acids 2002, 67:365–372.
13. Zannoni A, Giunti M, Bernardini C, Gentilini F, Zaniboni A, Bacci ML, Forni M:
Procalcitonin gene expression after LPS stimulation in the porcine
animal model. Res Vet Sci 2012, 93:921–927.
14. Papapetropoulos A, García-Cardeña G, Madri JA, Sessa WC: Nitric oxide
production contributes to the angiogenic properties of vascular
endothelial growth factor in human endothelial cells. J Clin Invest 1997,
100(12):3131–3139.
15. DeMeester SL, Qiu Y, Buchman TG, Hotchkiss RS, Dunnigan K, Karl IE,
Cobb JP: Nitric oxide inhibits stress-induced endothelial cell apoptosis.
Cri Care Med 1998, 26:1500–1509.
16. Sugiyama T, Fujita M, Koide N, Morikawa A, Takahashi K, Yoshida T, Mori H,
Yokochi T: Differences in the mechanism of nitric oxide production
between mouse vascular endothelial cells and macrophages. J Endotoxin
Res 2003, 9:108–112.
17. Dighiero P, Behar-Cohen F, Courtois Y, Goureau O: Expression of inducible
nitric oxide synthase in bovine corneal endothelial cells and keratocytes
in vitro after lipopolysaccharide and cytokines stimulation. Invest
Ophthalmol Vis Sci 1997, 38:2045–2052.
18. Saini R, Patel S, Saluja R, Sahasrabuddhe AA, Singh MP, Habib S, Bajpai VK,
Dikshit M: Nitric oxide synthase localization in the rat neutrophils:
immunocytochemical, molecular, and biochemical studies. Leukoc Biol
2006, 79:519–528.
19. Iwakiri Y, Satoh A, Chatterjee S, Toomre DK, Chalouni CM, Fulton D,
Groszmann RJ, Shah VH, Sessa WC: Nitric oxide synthase generates nitric
oxide locally to regulate compartmentalized protein S-nitrosylation and
protein trafficking. Proc Natl Acad Sci USA 2006, 103:19777–19782.
20. Zhang Q, Church JE, Jagnandan D, Catravas JD, Sessa WC, Fulton D:
Functional relevance of Golgi- and plasma membrane-localized
endothelial NO synthase in reconstituted endothelial cells. Arterioscler
Thromb Vasc Biol 2006, 26:1015–1021.
Page 9 of 9
21. Giordano A, Tonello C, Bulbarelli A, Cozzi V, Cinti S, Carruba MO, Nisoli E:
Evidence for a fuctional nitric oxide synthases system in brown
adipocyte nucleus. FEBS Lett 2002, 13:135–140.
22. Jones RJ, Jourd’heuil D, Salerno JC, Smith SM, Singer HA: iNOS regulation
by calcium/calmodulin-dependent protein kinase II in vascular smooth
muscle. Am J Physiol Heart Circ Physiol 2007, 292:H2634–H2642.
23. Tamir S, de Rojas-Walker T, Wishnok JS, Tannenbaum SR: DNA damage and
genotoxicity by nitric oxide. Methods Enzymol 1996, 269:230–243.
24. Bogatcheva NV, Zemskova MA, Kovalenkov Y, Poirier C, Verin AD: Molecular
mechanisms mediating protective effect of cAMP on lipopolysaccharide
(LPS)-induced human lung microvascular endothelial cells (HLMVEC)
hyperpermeability. J Cell Physiol 2009, 221(3):750–759. [25] Y. Ge.
25. Deng T, Zheng X: Dynamic monitoring of changes in endothelial
cell-substrate adhesiveness during leukocyte adhesion by microelectrical
impedance assay. Acta Biochim Biophys Sin (Shanghai) 2009, 41(3):256–262.
26. Choi BM, Pae HO, Jang SI, Kim YM, Chung HT: Nitric oxide as a proapoptotic as well as anti-apoptotic modulator. J Biochem Mol Biol 2002,
35:116–126.
27. Thippeswamy T, McKay JS, Quinn JP, Morris R: Nitric oxide, a biological
double-faced janus–is this good or bad? Histol Histopathol 2006,
21:445–458.
doi:10.1186/1476-9255-9-47
Cite this article as: Bernardini et al.: Differential expression of nitric oxide
synthases in porcine aortic endothelial cells during LPS-induced
apoptosis. Journal of Inflammation 2012 9:47.
Submit your next manuscript to BioMed Central
and take full advantage of:
• Convenient online submission
• Thorough peer review
• No space constraints or color figure charges
• Immediate publication on acceptance
• Inclusion in PubMed, CAS, Scopus and Google Scholar
• Research which is freely available for redistribution
Submit your manuscript at
www.biomedcentral.com/submit