Oncogene (2007) 26, 662–672
& 2007 Nature Publishing Group All rights reserved 0950-9232/07 $30.00
www.nature.com/onc
ORIGINAL ARTICLE
Kit and PDGFR-a activities are necessary for Notch4/Int3-induced
tumorigenesis
A Raafat1, A Zoltan-Jones1, L Strizzi, S Bargo, K Kimura, D Salomon and R Callahan
Oncogenetics Section, Mammary Biology and Tumorigenesis Laboratory, National Cancer Institute, National Institutes of Health,
Bethesda, MD, USA
Transgenic mice overexpressing Notch4 intracellular
domain (Int3) under the control of the whey acidic protein
(WAP) or mouse mammary tumor virus-long terminal
repeat promoters, develop mammary tumors. Microarray
analysis of these tumors revealed high levels of c-Kit
expression. Gleevec is a tyrosine kinase inhibitor that
targets c-Kit, platelet-derived growth factor receptors
(PDGFRs) and c-Abl. This led us to speculate that
tyrosine kinase receptor activity might be a driving force
in the development of Int3 mammary tumors. WAP-Int3
tumor-bearing mice were treated with continuous release
of Gleevec using subcutaneously implanted Alzet pumps.
Phoshorylation of c-Kit, PDGFRs and c-Abl is inhibited
in Int3 transgenic mammary tumors by Gleevec. Inhibition of these enzymes is associated with a decrease in cell
proliferation and angiogenesis, and an induction of
apoptosis. To examine the signaling mechanisms underlying Notch4/Int3 tumorigenesis, we employed small
interfering RNA (siRNA) to knock down c-Kit, PDGFRs
and c-Abl alone or in combination and observed the effects
on soft agar growth of HC11 cells overexpressing Int3.
Only siRNA constructs for c-Kit and/or PDGFR-a were
able to inhibit HC11-Int3 colony formation in soft agar.
Our data demonstrate an inhibitory effect of Gleevec on
Int3-induced transformation of HC11 cells and mammary
tumors and indicate an oncogenic role for c-Kit and
PDGFR-a tyrosine kinases in the context of Int3 signaling.
Oncogene (2007) 26, 662–672. doi:10.1038/sj.onc.1209823;
published online 31 July 2006
Keywords: Kit; PDGFR-a; Notch4/Int3; Gleevec; phosphorylation; siRNA
Introduction
The Notch signaling pathway is involved in cell fate
decisions of tissues and organs in several different
Correspondence: Dr R Callahan, Mammary Biology and Tumorigenesis Laboratory, National Cancer Institute, National Institutes of
Health, 37 Convent Drive, Bldg 37, Rm 1118A, Bethesda, MD 20892,
USA.
E-mail: rc54d@nih.gov
1
These authors contributed equally to this work
Received 4 April 2006; revised 22 May 2006; accepted 23 May 2006;
published online 31 July 2006
organisms (Callahan and Raafat, 2001). The Notch
gene encodes a transmembrane receptor protein. In
mammals, there are four members of the Notch gene
family, some of which are targets for mutations that
contribute to tumor development (Allenspach et al.,
2002). Developmental transitions and malignant transformations share many of the same signaling pathways.
An emerging view of malignant transformation is that of
a developmental program that lacks the precise control
and regulation seen during development. Recently,
growing evidence supports aberrant Notch signaling in
malignant transformation. Notch3 overexpression has
been implicated in cases of human lung cancer (Dang
et al., 2000) and activation of Notch3 in lung epithelium
leads to the inhibition of epithelial differentiation (Dang
et al., 2003). In a subset of human T-cell acute
lymphoblastic leukemias, there is a disruption in the
Notch1 gene locus that leads to activated Notch1
signaling (Pear and Aster, 2004; Chiaramonte et al.,
2005). An early indication that Notch4 signaling is
involved in mammary gland development and tumorigenesis stems from the identification of the Notch4 gene
as a common insertion site for the mouse mammary
tumor virus (MMTV) in a feral strain of mice (Gallahan
et al., 1987). MMTV integration into the Notch4 gene
results in the transcription of a truncated, constitutively
active Notch4 gene product (Int3) that corresponds to
the intracellular domain (ICD). Expression of Int3
represents a gain-of-function mutation (Robbins et al.,
1992; Gallahan and Callahan, 1997). We have shown
that expression of Int3 from either the MMTV long
terminal repeat (LTR) or the whey acidic protein (WAP)
promoter in transgenic mice blocks normal mammary
lobular development and the ability of these females to
lactate (Jhappan et al., 1992; Smith et al., 1995;
Gallahan et al., 1996). In addition, 100% of the females
develop mammary adenocarcinomas (Jhappan et al.,
1992; Gallahan et al., 1996; Gallahan and Callahan,
1997).
Microarray analysis of MMTV LTR and WAP-Int3
mammary tumor RNAs revealed high steady-state levels
of the c-Kit tyrosine kinase receptor, as compared to
control FVB mammary tissue (our unpublished data).
The c-Kit receptor is a transmembrane tyrosine kinase
that belongs to the larger receptor tyrosine kinase type
III family (RTK III). This family also includes the c-Abl
and platelet-derived growth factor receptors (PDGFR-a
Kit and PDGFR-a in Notch4/Int3-induced tumorigenesis
A Raafat et al
663
and PDGFR-b) (Besmer et al., 1986). The role of the
RTK III family in human malignancies is well known.
In chronic myeloid leukemia (CML), c-Abl is activated
by a translocation to create a Bcr/Abl fusion protein
(Marley and Gordon, 2005). Human gastrointestinal
stromal tumors (GIST) harbor activating mutations of
c-Kit (Lasota et al., 1999; Taniguchi et al., 1999; Kim
et al., 2000) or, in c-Kit-negative subsets, activating
mutations of PDGFR-a (Heinrich et al., 2003). The aim
of the present study was to investigate the significance of
elevated levels of c-Kit in MMTV LTR and WAP-Int3
mammary tumors and to determine whether the
expression of c-Kit and/or other RTK III family
members, in the context of Int3 signaling, contributes
to malignant growth.
Results
Expression of Gleevec targets in WAP-Int3 mammary
tumors
To investigate the effects of Int3 expression on alterations in gene expression, we performed a gene array
study comparing normal mammary tissue from FVB/N
females and WAP-Int3 or MMTV LTR-Int3 tumors
(data not shown). Of particular interest to us was the
increased steady-state levels of c-Kit RNA in theWAPInt3 and MMTV LTR-Int3 tumors as compared to
mammary tissue from normal virgin or pregnant FVB/
N mice (Figure 1a). To determine whether other related
RTK III including c-Abl, PDGFR-a and PDGFR-b
were also expressed in these tumors, total RNA extracts
from three independent primary WAP-Int3 mammary
tumors were analysed for c-Kit, c-Abl, PDGFR-a and
PDGFR-b expression by PCR with reverse transcription
(RT–PCR). All three tumors were positive for these
other RTK III RNAs (Figure 1b). Additionally,
immunohistochemical analysis demonstrated that all
three primary tumors express the respective proteins
(Figure 1c). The c-Kit and PDGFR-a proteins
(Figure 1c, panels 5 and 6, respectively) are expressed
in most of the tumor epithelium, whereas PDGFR-b
(Figure 1c, panel 7) was detected primarily in the stroma
of the tumors. Only a minor fraction of the tumor
epithelium was stained with the c-Abl antibody
(Figure 1c, panel 8).
Gleevec dose response
To ascertain whether members of the RTK III family
are involved in Int3-induced mammary tumorigenesis,
we undertook a dose–response study to determine the
effects of Gleevec on WAP-Int3 tumor-bearing mice.
We used 21 or 10.5 mg/week of Gleevec per mouse. Mice
treated with a 10.5 mg/week dose showed no significant
change in the tumor weight. In contrast, there was a
significant reduction in mammary tumor weight (TW) in
mice treated with 21 mg/week (Figure 2a). Therefore, a
dose of 21 mg/week was used in all subsequent experiments. Mice treated with water showed a significant
continuous increase in tumor weight. We had to
Figure 1 Expression of Gleevec-sensitive kinases in mouse Int3
transgenic mammary tumors. (a) Evaluation of c-Kit expression in
FVB/N and Int3 transgenic mammary glands. Northern blot
analysis of FVB/N tissue of virgin and 15 days pregnant (P15)
mammary glands, also mammary tissue of 15 days pregnant WAPInt3 (Wap-P15), MMTV LTR-Int3 (LTR-V) and WAP-Int3
(WAP-V) tumors from virgin mice. The membrane was stripped
and re-probed with GAPDH. (b) Qualitative RT–PCR analysis of
Gleevec targets in three independent WAP-Int3 primary mammary
tumors shows detectable levels of c-Kit, PDGFR-a , PDGFR-b
and c-Abl. (c) Photomicrographs of immunohistochemical staining
of c-Kit (panels 1and 5), PDGFR-a (panels 2 and 6), PDGFR-b
(panels 3 and 7) and c-Abl (panels 4 and 8) in WAP-Int3 mammary
gland tumors; negative controls for c-Kit, PDGFR-a, PDGFR-b
and c-Abl are panels 5, 6, 7 and 8, respectively. Exhibited sections
were counterstained with hematoxylin. Magnification, 40.
euthanize these mice at day 4 of water treatment
because of the tumor weight. Histological analysis of
hematoxylin and eosin (H&E)-stained liver and kidney
sections from Gleevec-treated mice did not show any
evident morphological alterations such as necrosis or
inflammatory changes due to toxicity (data not shown).
These results demonstrate that WAP-Int3 mammary
tumors are sensitive to Gleevec and further provide a
strong rationale that the activation of one or more of the
RTK III targets of Gleevec, in the context of Int3
signaling, likely contributes to tumor growth. To
determine the range of Gleevec effects on tumor growth,
we treated five WAP-Int3 tumor-bearing mice with
21 mg/week Gleevec for 1 week and monitored TW
daily. At the end of the treatment period, TW was
significantly reduced (Figure 2b) in all mice. When the
pumps were depleted of Gleevec after day 6, there was a
resumption of tumor growth, suggesting that continuous inhibition of Gleevec targets is needed to
effectively inhibit tumor growth. In a separate experiment, we examined the effect of Gleevec on the growth
Oncogene
Kit and PDGFR-a in Notch4/Int3-induced tumorigenesis
A Raafat et al
664
of transplanted WAP-Int3 mammary tumor viable
tissue. As shown in Figure 2c, mammary tumor growth
was totally blocked in the Gleevec-treated mice,
indicating lower receptor activity compared to the
control.
Phoshorylation status of c-Kit, c-Abl, PDGFR-a and
PDGFR-b
We examined the in vivo effects of Gleevec treatment on
the steady-state levels of total and phosphorylated c-Kit,
PDGFR-a, PDGFR-b and c-Abl by immunohistochemistry. Transplanted tumor samples were obtained at
different time points after Gleevec treatment for
histologic and immunohistochemical analyses. Steadystate levels of all four proteins were comparable in the
tissue from Gleevec-treated and control- (water) treated
mice (Figure 3a–d, panels 1 and 3). Thus as shown in
Table 1, 75–80% of the tumor epithelium stained
positive for c-Kit, and 30 and 40% of tumor epithelium
was positive for PDGFR-a and c-Abl, respectively.
PDGFR-b was stained primarily in the stroma (35–38%
of the cells). Treatment with Gleevec did not affect
protein level; however, the level of receptor phosphorylation was significantly reduced in the samples from the
Gleevec-treated mice, whereas treatment with water had
no effect on inhibiting phosphorylation (Figure 3a–d,
panels 2 and 4 and Table 1).
Cell proliferation, apoptosis and microvascularization
levels in WAP-Int3 tumors from Gleevec-treated mice
We also examined the effects of Gleevec on cell
proliferation, apoptosis, and microvascularization.
Gleevec treatment resulted in 60% decrease in the
number of proliferating cells relative to the control
(Figure 4a and b). At the same time, there was a
fourfold increase in the number of apoptotic cells as
determined by TUNEL staining in the Gleevec treated
group as compared to the control (Figure 4c and d). In
addition, Gleevec treatment resulted in a 50% reduction
in microvascularization of the WAP-Int3 tumors
(Figure 4e and f).
Gleevec inhibits Int3-induced soft agar colony formation
The in vivo data raised the question of whether all four
RTK III kinases are required for tumor growth or if one
or a combination of them is sufficient to stimulate tumor
growth. To address this question, we next chose to
examine the activity of the individual Gleevec targets on
Int3- and hNotch1-ICD-induced transformation using
an in vitro system. We (Robbins et al., 1992; Imatani and
Callahan, 2000) and Dievart et al.(1999) have shown
previously that HC11 mouse mammary epithelial cells,
Figure 2 Continuous release of Gleevec inhibits WAP-Int3
mammary tumor growth in vivo. (a) Gleevec dose response. Mice
bearing primary WAP-Int3 mammary tumors were treated with
water, 10.5 or 21 mg/week Gleevec for 7 days. Gleevec was
administered using subcutaneous osmotic pumps (continuous
release) as described in Materials and methods. Treatment started
when tumor weight reached 500 mg. Mammary tumors were
palpated and measured on daily basis for the duration of the
experiment (6 days). Each data point indicates the average tumor
weight from a minimum of 5–6 different mice measured at the
specified day. *Po0.05 for 21 mg/week treated mice having lower
tumor weight than the 10.5 mg/week. (b) Regression of WAP-Int3
primary mammary tumors is Gleevec dependent. Gleevec treatment started when tumor weight reached 500 mg and continued for
7 days. Continuous release of Gleevec (21 mg/week) from osmotic
pumps reduced mammary tumor weight (compare day 1 vs. day 5).
Resumption of WAP-Int3 mammary tumor growth took place on
day 6 as the osmotic pumps were depleted of Gleevec. (c) Gleevec
effects on the in vivo growth of transplanted WAP-Int3 viable
mammary tumor tissue. Viable tissue from WAP-Int3 mammary
tumor was placed in the inguinal mammary gland of two different
FVB/N mice. Once tumors weight reached 100 mg, one mouse
received Gleevec (’) and the other received water (E). It took the
viable tissue 19 days to reach 100 mg and about 33 days to reach
500 mg. Early treatment of WAP-Int3 tumors with Gleevec (21 mg/
week) resulted in inhibition of tumor growth, whereas treatment of
the same tumors with water did not block tumor growth. Each data
point in these graphs indicates the average tumor weight from a
minimum of six different mice measured at the specified day.
Oncogene
Kit and PDGFR-a in Notch4/Int3-induced tumorigenesis
A Raafat et al
665
when stably transfected with the Int3 (HC11-Int3) or
Notch1-ICD, will form colonies in soft agar, a hallmark
of cellular transformation. Gleevec treatment inhibited
Int3- and hNotch1-ICD- induced colony formation in a
dose-dependent manner (Figure 5a, lanes 5–8 and lanes
Table 1 Total and phosphorylated protein kinase expression in waplnt3 mammary tumors (% positive cells7s.e.m.)
Protein kinase
Total
P-value
Water gleevec
c-Kit
PDGFR-a
PDGFR-b
c-Abl
7579
3073
3574
4077
80714
3075
3875
3574
p1.0
p1.0
p0.8
p0.2
Phosphorylated
Water
gleevec
7077
3073
3074
3275
5076
1073
271
271
P-value
p0.007
p0.02
p0.02
p0.02
Abbreviation: PDGFR, platelet-derieved growth factor receptor.
Positive cells were scored and labeling index is expressed as a
percentage of positive nuclei of 3000 counted cells.
9–11, respectively), whereas HC11 control cells did not
form colonies in soft agar (Figure 5a, lanes 1–4). We
next assessed the expression levels of the Gleevec targets
by Western blot analysis. Both HC11 and HC11-Int3
cells expressed c-Kit, PDGFR-a and c-Abl at similar
levels (Figure 5b). Neither cell line expressed the
PDGFR-b receptor, which differs from our in vivo
result with tumors from transgenic mice. However, as
PDGFR-b is usually expressed in the stroma, we might
not expect to detect this receptor in HC11 epithelial
cells. Although there was no difference in the steadystate levels of these receptors in the control and Int3 cell
lines, we found that cells expressing Int3 have elevated
levels of phosphorylated c-Kit and PDGFR-a, indicating increased receptor activity as compared to the
control HC11 cell line (Figure 5c, compare lanes 1 and
3). The phosphorylation status of c-Abl was relatively
unchanged in the two cell lines. When we treated these
cells with Gleevec, receptor phosphorylation was
inhibited in a dose-dependent manner (Figure 5c,
compare lanes 4–6 with lane 3), consistent with
Gleevec’s mechanism of action.
siRNA knockdown of c-Kit and PDGFR-a inhibits soft
agar growth
Gleevec inhibition of Int3-induced soft agar growth
suggested that the activity of the target RTK III was
important in Int3-induced cell transformation. To
determine which receptor, or combination of receptors,
was important, we employed a small interfering RNA
(siRNA) approach to knock down each receptor
individually or in combination and looked at the effect
on soft agar growth. The effect of non-silencing and
Figure 3 In vivo inhibition of c-Kit, PDGFR-a, PDGFR-b and
c-Abl phosphorylation by Gleevec. Viable tissue from each WAPInt3 mammary tumor was placed in the inguinal mammary gland
of two separate 10-week-old FVB/N mice. Once the tumors weight
reached 500 mg, one mouse received Gleevec (21 mg/week) and the
other mouse received water, using Alzet pumps as described in the
Materials and methods. Mice were killed at 72 h after treatment.
Immunohistochemical analysis of total (panels 1and 3) and
phosphorylated(P) (panels 2 and 4), c-Kit (a), PDGFR-a (b),
PDGFR-b (c) and c-Abl (d) is shown. Magnification, 40. Arrows
point to endothelial cells. In panels C5 and C6, the magnification
is 100.
Oncogene
Kit and PDGFR-a in Notch4/Int3-induced tumorigenesis
A Raafat et al
666
Figure 4 In vivo effect of Gleevec on proliferation, apoptosis and
angiogenesis of WAP-Int3 mammary tumors. Tumor-bearing mice
were treated with Gleevec (21 mg/week) as described in Materials
and methods. At days 1, 3 and 5 after treatment, mice were killed
and tissue was collected. Gleevec-induced inhibition of proliferation (a and b), induction of apoptosis (c and d) and reduction of
blood vessels (e and f) was determined as described in Materials
and methods. Proliferating and apoptotic cells were scored and
labeling index expressed as a percentage of positive nuclei of at
least 3000 counted cells. Arrows point to blood vessels. Blood
vessels were scored as number of blood vessels/microscopic field.
*P o0.05. Magnification, 40.
silencing siRNA on the expression of each of the
receptors was validated by Western blot analysis
(Figure 6a). When we transfected cells with siRNA
oligomers for c-Kit, PDGFR-a, PDGFR-b or c-Abl soft
agar colony formation was significantly inhibited by
c-Kit siRNA (84%) (Figure 6b, compare lanes 6 and 7)
and PDGFR-a siRNA (76%) (compare lanes 6 and 8)
knockdown, as compared to a non-silencing control
siRNA oligomer. Transfection with the c-Abl siRNA
construct significantly inhibited soft agar growth, but
only by 30% (Figure 6b, compare lanes 6 and 10) as
compared to non-silencing control. Inhibition by the
PDGFR-b siRNA oligomers was not significant
(Figure 6b, compare lanes 6 and 9). As expected,
HC11 control cells did not grow in soft agar
(Figure 6b, lanes 1–5). Because Int3-induced soft agar
Oncogene
Figure 5 Gleevec inhibits Int3 and hNotch1-ICD- induced cell
colony formation in soft agar by blocking c-Kit and PDGFR-a
receptor activity. (a) HC11 (lanes 1–4) and HC11-Int3 (lanes 5–8)
or HC11-hNotch1-ICD (lanes 9–11) cell lines were grown in soft
agar in the presence or absence of a range of Gleevec concentrations (0.625–2.5 mM) as described in Materials and methods. HC11
no treatment (Lane1), HC11 0.626 mM Gleevec (lane2), HC11
1.25 mM Gleevec (lane3), HC11 2.5 mM Gleevec (lane 4), HC11 Int3
no treatment (lane 5), HC11-Int3 0.625 mM Gleevec (lane 6), HC11Int3 1.25 mM Gleevec (lane 7), HC11-Int3 2.5 mM Gleevec (lane 8),
HC11-hNotch1-ICD no treatment (lane 9), HC11-hNotch1-ICD
1.25 mM Gleevec (lane 10) and HC11-hNotch1-ICD 2.5 mM Gleevec
(lane 11). *Po0.001, Gleevec-treated versus untreated. Gleevec
reduced HC11-Int3 and HC11-hNotch1-ICD colony formation in
a dose-dependent manner. (b) Western blot analysis to assess c-Kit,
PDGFR-a, PDGFR-b and c-Abl protein levels in HC11 and
HC11-Int3 cells in the presence or absence of Gleevec. Lane 1
corresponds to HC11 control cells and lane 2 to HC11-Int3 cells.
(c) Immunoprecipitation of cell lysates from HC11 and HC11-Int3
cells treated with or without different concentrations of Gleevec
(0.625–2.5 mM) with anti-phosphotyrosine antibody. lane 1, HC11;
lane 2, HC11-Int3 IP IgG; lane 3, HC11-Int3 no treatment; lane 4,
HC11-Int3 0.625 mM Gleevec; lane 5, HC11-Int3 1.25 mM Gleevec;
and lane 6, HC11-Int3 2.5 mM Gleevec. Immunoblotting was with
the indicated antibodies.
growth was not completely inhibited with either c-Kit or
PDGFR-a knockdown alone, we used a double knockdown approach of both receptors and included various
dosages of c-Kit and PDGFR-a siRNA oligomers to
determine if there was a dose that was not sufficient to
inhibit colony growth alone, but was sufficient to inhibit
colony formation when c-Kit and PDGFR-a knockdown were combined. We found that although we were
never able to inhibit colony formation beyond a level of
B85% with double transfection of c-Kit and PDGFR-a
siRNA oligomers (Figure 6c, compare lane 2 with lanes
3 and 4), we were able to titrate the amount of single
c-Kit or PDGFR-a siRNA oligomer down to a
concentration that would not inhibit soft agar growth
when transfected alone (Figure 6c, lanes 5 and 6).
However, when c-Kit and PDGFR-a siRNA oligomers
Kit and PDGFR-a in Notch4/Int3-induced tumorigenesis
A Raafat et al
667
Figure 7 Effect of SCF stimulation in the presence of c-Kit or
PDGFR-a siRNA inhibition of soft agar growth. HC11 and HC11Int3 cells were plated for soft agar growth assay with SCF (50–
200 ng/ml), in the presence of c-Kit and/or PDGFR-a siRNA
oligomers or non-silencing siRNA control. HC11 cells with nonsilencing siRNA (lane 1), HC11 cells with non-silencing siRNA þ SCF 50 ng/ml (lane 2), HC11 cells with non-silencing
siRNA þ SCF 200 ng/ml, HC11-Int3 cells with non-silencing
siRNA (lane 4), HC11-Int3 cells with non-silencing siRNA þ SCF
50 ng/ml (lane 5), HC11-Int3 cells with non-silencing siRNA þ SCF
200 ng/ml (lane 6), HC11-Int3 cells with PDGFR-a siRNA (lane 7),
HC11-Int3 cells with PDGFR-b siRNA þ SCF 50 ng/ml (lane 8)
and HC11-Int3 cells with PDGFR-a siRNA þ SCF 200 ng/ml (lane
9). SCF accelerates colony onset, numbers and size but is not able
to overcome PDGFR-a inhibition. PDGFR-a is essential for
colony formation. Columns, mean; Bars, 7s.e.m.
effect on inhibition of Int3-induced transformation by
c-Kit and PDGFR-a siRNA (Figure 6c, lane 7).
Figure 6 siRNA knockdown of c-Kit and PDGFR-a inhibits soft
agar growth. Western blot and soft agar assay of HC11 or HC11Int3 cells transfected with the indicated siRNA oligomers. (a)
Western blot analysis of c-Kit, PDGFR-a and c-Abl expression in
HC11 and HC11-Int3 cells treated with non-silencing or silencing
siRNA. Only silencing siRNA reduced the expression of its target
protein, confirming the specificity of the siRNA. Immunoblotting
was performed with the indicated antibodies. (b) Soft agar growth
of HC11 cells with non-silencing siRNA (lane 1), HC11 cells with
c-Kit siRNA (lane 2). HC11 cells with PDGFR-a siRNA (lane 3),
HC11 cells with PDGFR-b siRNA (lane 4), HC11 cells with c-Abl
siRNA (lane 5), HC11-Int3 cells with non-silencing siRNA (lane 6),
HC11-Int3 cells with c-Kit siRNA (lane 7), HC11-Int3 cells with
PDGFR-a siRNA (lane 8), HC11-Int3 cells with PDGFR-b siRNA
(lane 9) and HC11-Int3 cells with c-Abl siRNA (Lane 10), (c) The
effect of combinations of siRNA on soft agar growth: HC11 cells
with non-silencing siRNA (lane 1), HC11-Int3 cells with nonsilencing siRNA (lane 2), HC11-Int3 cells with c-Kit siRNA (lane
3), HC11-Int3 cells with PDGFR-a siRNA (lane 4), HC11-Int3
cells with c-Kit 50 nM siRNA (lane 5), HC11-Int3 cells with
PDGFR-a 50 nM siRNA (lane 6) and HC11-Int3 cells with 50 nM
of c-Kit and 50 nM of PDGFR-a siRNA (lane 7). Unless indicated,
the concentration of siRNA oligomer used was 100 nM. Only,
groups 5–7 in (C) were transfected with 50 nM siRNA oligomer as
indicated. *Po0.001, receptor siRNA transfected as compared to
non-silencing siRNA control. Columns, mean; Bars7s.e.m.
at this non-inhibitory concentration were combined, the
result was an inhibition of colony formation, equivalent
to the maximal inhibition level achieved with high dose
of either siRNA alone. These data suggest a cooperative
c-Kit and PDGFR-a activity are both required for
Int3-induced transformation
To further explore the role of c-Kit and PDGFR-a in
this system, we used the c-Kit ligand stem cell factor
(SCF) to stimulate the cells and observe the effects on
colony formation. When HC11-Int3 cells are stimulated
with SCF, the number of colonies formed per well
increased B1.5-fold over untreated HC11-Int3 cells
(Figure 7, compare lane 4 with lanes 5 and 6). Most
striking was the rapid onset of HC11-Int3 colony
formation in the presence of SCF. By day 10 after
plating, scorable colonies were observed in the SCFtreated Int3 cells (data not shown). Knockdown of c-Kit
receptor activity via siRNA inhibits this rapid onset of
colony formation. Because the HC11-Int3 cells have
such a marked response to SCF, we determined whether
the stimulation of these cells with SCF would be
sufficient to overcome the effects of PDGFR-a knockdown on Int3-induced soft agar growth. In this
experiment, we used siRNA oligomers to knock down
PDGFR-a in the presence of SCF. Interestingly, we
found that even with increasing doses of SCF, stimulation of the c-Kit receptor in the presence of PDGFR-a
knockdown was not sufficient to induce soft agar
growth (Figure 7, compare lane 7 with lanes 8 and 9).
Thus, in this setting, PDGFR-a activity is at least
equally as important as c-Kit receptor activity in
regulating soft agar growth of HC11-Int3 cells.
Oncogene
Kit and PDGFR-a in Notch4/Int3-induced tumorigenesis
A Raafat et al
668
Discussion
In the present work, we have shown that WAP-Int3
mammary tumors contain high steady-state levels of
c-Kit and other members of the RTK III family. The
linkage between Notch and Kit/PDGFR signaling is not
unprecedented. For instance, endothelial-to-mesenchymal transformation is associated with Notch4 signaling,
which leads to the upregulation of PDGFR expression
(Noseda et al., 2004). Interestingly, human mammospheres that are enriched for early progenitor/stem cells
of the mammary gland coexpress Notch4 and PDGFRa (Dontu et al., 2004). In other tissues such as ciliary
epithelium neural stem cells, c-Kit-mediated signaling
upregulates Notch expression and signaling (Das et al.,
2004). Enriched hematopoietic stem cells also coexpress
Notch1 and c-Kit (Ramalho-Santos et al., 2002).
As members of the Kit/PDGFR RTK III family are
involved in multiple tumor-associated processes, we
questioned whether their signaling contributes to
mammary tumor development in the context of Int3
signaling. Treatment of Int3 tumor-bearing mice with
Gleevec, an inhibitor specific for this family of RTK,
caused the tumors to regress to a point that in many
cases they were unpalpable. At a molecular level, a
primary consequence of Gleevec treatment on c-Kit,
PDGFR-a and c-Abl was to decrease their phosphorylation. A secondary consequence of Gleevec treatment
was the decrease in the number of proliferating cells and
the level of the microvascularization of the tumors
coupled with an increase in the level of apoptotic cells in
the tumors. The increase in apoptosis and decrease in
proliferation in response to Gleevec might explain the
reduction in tumor growth. Continuous release of
Gleevec for a week resulted in 33% inhibition of tumor
growth by day 2 and 66% by day 4. Gleevec treatment
produced a complete inhibition of tumor growth,
indicating that a continuous block of Gleevec targets
activity is needed to produce complete tumor regression.
Similar results were observed when Gleevec was
administered every 8 h in mice bearing Leydig cell
tumors (Basciani et al., 2005) and in nude mice bearing
Bcr/Abl-positive human leukemia cell lines (le Coutre
et al., 1999). Discontinuation of Gleevec treatment
resulted in rapid tumor re-growth, confirming the need
for a sustained blockage of Gleevec targets to inhibit
tumorigenesis. These results are in agreement with
clinical data in CML patients (Cortes et al., 2004). The
antiangiogenic effect of Gleevec has been observed in
several types of cancers (Hwang et al., 2003; Uehara
et al., 2003). This effect has been attributed to the
inhibition of PDGFRs and c-Kit, which are important
survival factors for endothelial cells (Betsholtz,
2003; Matsui et al., 2004). Gleevec inhibits vascular
endothelial growth factor expression indirectly through
a PDGF inhibition-mediated mechanism (Wang et al.,
1999). In addition, both PDGFR-b and PDGF-b null
mutant mice die at late gestation from widespread
microvascular bleeding (Leveen et al., 1994; Soriano,
1994). Taken together, we conclude from our data
that signaling by at least one RTK III member is
Oncogene
necessary for initiating or maintaining Int3 mammary
tumorigenesis.
To determine which RTK III member or combination
of members is responsible for tumor promotion, we used
an in vitro model in which Int3 expression confers on
HC11 mouse mammary epithelial cells the ability for
anchorage independent-growth in soft agar. Treatment
of HC11-Int3 cells with Gleevec blocks, in a dosedependent manner, their ability to grow in an anchorage-independent manner, whereas it is not cytotoxic to
HC11 cells grown on monolayer. From this result, we
concluded that it was not RTK III signaling per se, but a
collaboration between Int3 and RTK III signaling. To
define more fully which RTK III family member(s) are
involved in this collaboration, we used siRNA against
each of the RTK III members in the HC11-Int3 soft
agar assay. As with Gleevec, siRNA against individual
RTK III members is not toxic for HC11 cells. In
addition, HC11 cells do not express PDGFR-b, and
knockdown of c-Abl with siRNA had a minimal effect
on the ability of HC11-Int3 cells to grow in soft agar.
Therefore, we conclude that the primary contributors to
HC11-Int3 soft agar growth are due to the activation of
c-Kit and PDGFR-a. Two observations suggest that
both c-Kit and PDGFR-a are required to promote Int3induced HC11 soft agar growth. First, suboptimal levels
of siRNA for c-Kit and PDGFR-a act cooperatively in
the inhibition of HC11-Int3 soft agar growth, and
second, SCF induction of c-Kit activity was unable to
overcome PDGFR-a siRNA inhibition of HC11-Int3
soft agar growth. We conclude that there are components of the c-Kit and PDGFR-a signaling pathways
that are unique to each and that they collaborate with
Int3 signaling in mammary tumor progression.
Notch1-ICD (ICD1) also confers on HC11 cells the
capability of growth in soft agar (Dievart et al., 1999).
Like HC11-Int3 cells, Gleevec blocks HC11-ICD1 cell
growth in soft agar, suggesting that c-Kit and PDGFR-a
are the targets for the drug in these cells as well. It seems
pertinent, therefore, that in human foreskin fibroblasts
(BJ) and human embryonic kidney (HEK) epithelial
cells, oncogenic Ras activates the expression of Notch1
that in turn activates the expression of Notch4 (Weijzen
et al., 2002). In this setting, oncogenic Ras is upstream
of Notch1, as suppression of Notch1 expression inhibits
the growth of Ras-transformed cells.
At the present time, only a limited number of studies
have been undertaken to look at the expression of
Notch, c-Kit and PDGFR-a in normal human breast
and in primary breast carcinomas. Reedijk et al.(2005)
found that the expression of each member of the Notch
gene family could be detected to varying degrees in a
survey of 184 breast carcinomas. In fact, high levels of
Notch1 and its ligand JAG1 were linked to poor overall
survival. Imatani and Callahan (2000) identified a
truncated Notch4 RNA species in certain human breast,
colon and lung carcinoma cell lines. This Notch4 RNA
species encodes a portion of the ICD of the protein.
Expression of this Notch4 RNA species from a
transgene in the mouse mammary gland is associated
with mammary tumor development (Raafat et al., 2004).
Kit and PDGFR-a in Notch4/Int3-induced tumorigenesis
A Raafat et al
669
High levels of c-Kit were observed in the normal
mammary ductal epithelium but not in myoepithelial
cells (Weijzen et al., 2002). Assessment of breast
carcinomas for c-Kit expression have shown that as
the tumors become more invasive, the levels of c-Kit
expression decrease; thus, 44–53% of ductal carcinomas
in situ (DCIS) are c-Kit positive, whereas only 9–10% of
invasive ductal carcinomas (IDC) are c-Kit positive
(Ulivi et al., 2004; Tsuda et al., 2005a; b; Diallo et al.,
2006). In contrast, 39% of IDC are positive for
PDGFR-a expression (de Jong et al., 1998; Carvalho
et al., 2005). In these tumors, the stroma and
endothelium also stain positive for PDGFR-a (de Jong
et al., 1998). In conclusion, the reports of elevated
steady-state levels of Notch, c-Kit and PDGFR-a
expression in human breast cancer tissue (Carvalho
et al., 2005; Diallo et al., 2006) suggest that Gleevec is a
potential candidate drug for breast cancer treatment and
prevention.
Materials and methods
Animals and experimental design
Primary mammary tumors in the WAP-Int3 females were
palpated weekly. The length, width and depth of palpable
tumors were measured with Vernier calipers. TW was
determined using the equation TW (mg) ¼ (S)2 L/2 where
S and L (le Coutre et al., 1999) were measured in millimeters.
S and L are the shortest and longest diameters of the tumor,
respectively. Primary tumors were allowed to grow until they
reached 500 mg, at which time the WAP-Int3 tumor-bearing
mice were killed and mammary tumors were collected as viable
tissue. To reduce inter-tumor variations, virgin FVB/N female
mice from our colony were used at 10 weeks of age and the
inguinal mammary glands of these FVB\N mice served as the
transplantation site of the primary WAP-Int3 viable tumor
tissue. Viable tissue from each WAP-Int3 mammary tumor
was placed in the inguinal mammary gland of two separate
FVB/N mice. Once tumors reached the desired weight, one
mouse with tissue from a single primary tumor received
Gleevec and its matching control received water (control).
Alzet miniosmotic pumps (Model 2001, pumping rate 1 ml/h,
Durect Corp., Cupertino, CA, USA), implanted subcutaneously on the dorsal surface of the mouse, were used to
deliver a subcutaneous dose of Gleevec (10.5 or 21 mg/mouse/
week) or water (control). For studies longer than 7 days, fresh
pumps were used every 7 days. Gleevec was generously
provided by Novartis Pharma (Basel, Switzerland). Treated
mice were killed at various time points. Mice were kept under
standard laboratory conditions according to the guidelines of
the National Cancer Institute. This study was approved by the
Institutional Ethics Committee for Laboratory Animals used
in Experimental Research.
Northern Blot Analysis and RT–PCR
To detect c-Kit, c-Abl, PDGFR-a and PDGFR-b expression
in WAP-Int3 tumors, total RNA extracts were prepared
from WAP-Int3 mammary tumors using TRIzol (Invitrogen
Life Technologies, Carlsbad, CA, USA), according to the
manufacturer’s instructions.
Twenty-five micrograms of total RNA from WAP-Int3 and
MMTV LTR-Int3 mammary tumors as well as mammary
tissue from normal FVB/N and WAP-Int3 females was used in
Northern blot analysis as previously described (Robbins et al.,
1992; Gallahan and Callahan, 1997). Full-length cDNAs for
c-KIT (ATCC 10699933) and GAPDH (ATCC 10539048)
were used for hybridization as described previously (Robbins
et al., 1992; Gallahan and Callahan, 1997).
The nucleotide sequences of synthetic oligonucleotides for
RT–PCR are as follows: c-Kit: 50 -CCAGTGCTTCCGTGA
CATTC-30 and 50 -CGTCCACTGGTGAGACAGGA-30 ; cAbl: 50 -CGCATGTTCCGGGACAAAAGC-30 and 50 -CCAT
TTTCTCATCTCCAA GCC-30 ; PDGFR-a: 50 -CGACTCCA
GATGGGAGTTCCC-30 and 50 -TGCCATCCACTTCACA
GGCA-30 ; PDGFR-b: 50 -AGCTACATGGCCCCTTATGA-30
and 50 -GGATCCCAAAAGACCAGACA-30 . For each experiment, a control reaction without reverse transcriptase was
performed. A thermal cycle of 581C annealing temperature was
repeated 32 times using Superscript One-Step RT–PCR with
Platinum Taq (Invitrogen Life Technologies, Carlsbad, CA,
USA) according to the manufacturer’s protocol. RT–PCR
products were separated on a 1.5% agarose gel and visualized
with ethidium bromide.
Preparation of tissue for histology
Mammary glands were routinely fixed in 4% freshly prepared
paraformaldehyde in phosphate-buffered saline (PBS) (pH 7.4)
for 2 h, rinsed through several changes of buffer, dehydrated in
ethanol and embedded in paraffin. Paraffin sections (5 mm)
were placed on slides, deparaffanized and stained with H&E.
Immunohistochemistry
Immunohistochemistry was carried out with the ABC method
according to the manufacturer’s protocol (Vector Laboratories
Inc., Burlingame, CA, USA). Primary antibody incubation
was carried out overnight at 41C: PCNA (sc-9857; Santa Cruz,
Santa Cruz, CA, USA), c-Kit (sc-168), PDGFR-a (sc-338),
PDGFR-b (sc-1627), c-Abl antibody (2862, Cell Signaling Inc.,
Technologies Inc., Beverly, MA, USA). For phosphorylated
(P) proteins, P-c-Kit (sc-180676R), P-PDGFR-a (sc-12911R),
P-PDGFR-b (3161, Cell Signaling Technologies, Inc., Beverly,
MA, USA) and P-c-Abl antibody (2861, Cell Signaling
Technologies Inc., Beverly, MA, USA) were used. Primary
antibodies were diluted 100 in PBS–1% BSA and appropriate biotinylated secondary anti-goat (PK-6105, Vector
Laboratories Inc., Burlingame, CA, USA) or anti-rabbit
(PK-6101, Vector Laboratories, Inc., Burlingame, CA, USA)
antibodies were diluted according to the manufacturer’s
recommendations. For apoptosis and angiogenesis assay, the
Roche in situ cell detection POD kit (1684817, Roche,
Indianapolis, IN, USA) and the Chemicon, blood vessel
staining kit (ECM590, Temecula, CA, USA) were used
according to the manufacturer’s recommendations, respectively. Labeling index was determined in at least a total of 3000
cells in each experimental condition.
Cell culture
HC11 (Ball et al., 1988) and HC11-Int3 mouse mammary
epithelial cells were grown in RPMI medium (Gibco BRL,
Grand Island, NY, USA) supplemented with 10% FBS
(Mediatech, Herndon, VA, USA), 5 mg/ml insulin (Gibco
BRL, Grand Island, NY, USA), 10 ng/ml EGF (Gibco BRL,
Grand Island, NY, USA) and 1% penicillin–streptomycin
(Gibco BRL, Grand Island, NY, USA). The HC11-Int3 cell
line was generated as described previously (Raafat et al., 2004).
Human Notch1 intracellular domain (hNotch1-ICD) was a
generous gift from Dr Sean Jeffries (Jeffries and Capobianco,
2000).
Oncogene
Kit and PDGFR-a in Notch4/Int3-induced tumorigenesis
A Raafat et al
670
Colony formation in soft agar
Five thousand cells in 2 growth medium with or without
SCF (50 mM; Peprotech, Rocky Hill, NJ, USA) or c-Kit
activity-blocking antibody, Clone K44.2 (200 mg/ml; Sigma St
Louis, MO, USA) were mixed 1 : 1 with 0.4% agar and then
analysed for colony formation as described previously (Ghatak
et al., 2002). After 20 days of growth in agar, 1 ml of nitroblue
tetrazolium vital dye (Sigma, St. Louis, MO, USA) was added
to each well to visualize viable colonies. The following day,
colonies were counted at a magnification of 10 using a
manufactured ocular scale (Electron Microscopy Sciences,
Fort Washington, PA, USA). Colonies measuring larger than
150 mm in diameter were counted. Each experiment was carried
out in duplicate and performed at least three times.
RNAi gene silencing
c-Kit, c-Abl, PDGFR-a and PDGFR-b gene silencing was
performed using Qiagen-designed siRNA duplexes for c-Kit,
c-Abl, PDGFR-a and PDGFR-b (Qiagen Inc., Valencia, CA,
USA). Two double-stranded siRNAs were generated for each
target, except for c-Abl, which was generated and prevalidated by the manufacturer. All oligomers were tested. An
asterisk indicates the siRNA that showed the greatest
inhibition and was subsequently used in the experiment.
DNA target sequences or regions are as follows: c-Kit (1)
TTCCGTGACATTCAACGTTTA, c-Kit (2)* CCCACTGT
GATTCCGCCTTTA, PDGFR-a (1) CGGCGACTACATG
GACATGAA, PDGFR-a (2)* ACGGATGAGAGTGA
GATC GAA, PGDFR-b (1)* CCGGTACGTGTCAGAACT
GAT, PGDFR-b (2) GCGGGTGGTGTTCGAGGCTTA
and c-Abl* 1818–1863. In all experiments, a non-silencing
duplex siRNA was used as a control. HC11 cells were plated
the day before transfection to reach 60–80% confluency the
next day. All transfections were carried out in six-well plates
according to the Qiagen protocol, using a 1:3 ratio of
siRNA:RNAi Fect Reagent. Gene silencing was monitored
at the protein level by Western blotting of cell lysates collected
48 h following transfection. Cells were harvested for soft agar
assay 48 h following transfection.
Immunoblotting
Cells were harvested with trypsin-ethylene diaminetetraacetic
acid (1 ) (Gibco BRL) and collected as a pellet by
centrifugation at 41C. Cells were lysed in buffer containing
1% Nonidet-40, 0.5 mM ethylene glycol tetraacetate, 5 mM
sodium orthovanadate, 10% glycerol, 1 concentration of
Calbiochem Protease Inhibitor Cocktail I (La Jolla, CA, USA)
and 50 mM HEPES, pH 7.5. SDS–polyacrylamide gel electrophoresis (SDS—PAGE), followed by transfer to nitrocellulose.
After blocking for 1 h and washing with Tris-buffered saline–
0.1% Tween 20, the membranes were probed overnight with
primary antibodies to c-Kit, c-Abl, PDGFR-a, PDGFR-b (all
1:100; Santa Cruz, Santa Cruz, CA, USA), or tubulin (1:5000.
Sigma, St Louis, MO, USA). Membranes were washed as
described above, followed by incubation with horseradish
peroxidase (HRP)-conjugated secondary antibody (1:5000;
Amersham Biosciences, Piscataway, NJ, USA). ECL reagent
(Amersham Biosciences, Piscataway, NJ, USA) was used for
detection.
Immunoprecipitation
Cells were harvested as described above and lysates were
normalized to 1 mg/ml total protein. Anti-phosphotyrosine
(clone 4G10) immunoprecipitating antibody (4 mg; Upstate
Lake Placid, NY, USA) was added to the cell lysate and
incubated on a rotator at 41C overnight. Protein G agarose
beads (Roche Diagnostics, Indianapolis, IN, USA) were added
to capture the immunocomplex and incubated on a rotator at
41C for 2 h. The agarose beads were collected, washed once
with ice-cold PBS, twice with 1 Tris-buffered saline–0.25 M
sodium chloride and resuspended in 5 sample buffer. Beads
were heated at 1001C for 5 min, centrifuged and the supernatant was subjected to SDS–PAGE and transfer. Membranes
were incubated with antibodies against c-Kit, c-Abl, PDGFR-a
or PDGFR-b (1:100; all Santa Cruz), followed by HRPconjugated secondary antibody as described above.
Statistics
Quantitative values are represented as the mean of at least
three experiments. All in vivo experiments were repeated at
least three times, and at least five mice were used in each
experiment. The statistical significance of the difference
between groups was determined by the Wilcoxon rank sum
test. Comparisons resulting in P-values less than 0.05 were
considered statistically significant and identified in the figures
with an asterisk (*).
Acknowledgements
We thank Dr Barbara Vonderhaar and Dr Gilbert H Smith for
their critical review of the manuscript. We specially thank
Novartis Pharmaceuticals for providing Gleevec.
References
Allenspach EJ, Maillard I, Aster JC, Pear WS. (2002). Notch
signaling in cancer. Cancer Biol Ther 1: 466–476.
Ball RK, Friis RR, Schoenenberger CA, Doppler W, Groner
B. (1988). Prolactin regulation of beta-casein gene expression
and of a cytosolic 120-kDa protein in a cloned mouse
mammary epithelial cell line. EMBO J 7: 2089–2095.
Basciani S, Brama M, Mariani S, De Luca G, Arizzi M, Vesci
L et al. (2005). Imatinib mesylate inhibits Leydig cell tumor
growth: evidence for in vitro and in vivo activity. Cancer Res
65: 1897–1903.
Besmer P, Murphy JE, George PC, Qiu FH, Bergold PJ,
Lederman L et al. (1986). A new acute transforming feline
retrovirus and relationship of its oncogene v-kit with the
protein kinase gene family. Nature 320: 415–421.
Betsholtz C. (2003). Biology of platelet-derived growth factors in
development. Birth Defects Res C Embryo Today 69: 272–285.
Oncogene
Callahan R, Raafat A. (2001). Notch signaling in mammary gland
tumorigenesis. J Mammary Gland Biol Neoplasia 6: 23–36.
Carvalho I, Milanezi F, Martins A, Reis RM, Schmitt F.
(2005). Overexpression of platelet-derived growth factor
receptor alpha in breast cancer is associated with tumour
progression. Breast Cancer Res 7: R788–R795.
Chiaramonte R, Basile A, Tassi E, Calzavara E, Cecchinato V,
Rossi V et al. (2005). A wide role for NOTCH1 signaling in
acute leukemia. Cancer Lett 219: 113–120.
Cortes J, O’Brien S, Kantarjian H. (2004). Discontinuation of
imatinib therapy after achieving a molecular response. Blood
104: 2204–2205.
Dang TP, Eichenberger S, Gonzalez A, Olson S, Carbone DP.
(2003). Constitutive activation of Notch3 inhibits terminal
epithelial differentiation in lungs of transgenic mice.
Oncogene 22: 1988–1997.
Kit and PDGFR-a in Notch4/Int3-induced tumorigenesis
A Raafat et al
671
Dang TP, Gazdar AF, Virmani AK, Sepetavec T, Hande KR,
Minna JD et al. (2000). Chromosome 19 translocation,
overexpression of Notch3, and human lung cancer. J Natl
Cancer Inst 92: 1355–1357.
Das AV, James J, Zhao X, Rahnenfuhrer J, Ahmad I. (2004).
Identification of c-Kit receptor as a regulator of adult neural
stem cells in the mammalian eye: interactions with Notch
signaling. Dev Biol 273: 87–105.
de Jong JS, van Diest PJ, van der Valk P, Baak JP. (1998).
Expression of growth factors, growth inhibiting factors, and
their receptors in invasive breast cancer. I: an inventory in
search of autocrine and paracrine loops. J Pathol 184: 44–52.
Diallo R, Rody A, Jackisch C, Ting E, Schaefer KL, Kissler S
et al. (2006). C-KIT expression in ductal carcinoma in situ of
the breast: co-expression with HER-2/neu. Hum Pathol 37:
205–211.
Dievart A, Beaulieu N, Jolicoeur P. (1999). Involvement of
Notch1 in the development of mouse mammary tumors.
Oncogene 18: 5973–5981.
Dontu G, Jackson KW, McNicholas E, Kawamura MJ,
Abdallah WM, Wicha MS. (2004). Role of Notch signaling
in cell-fate determination of human mammary stem/progenitor cells. Breast Cancer Res 6: R605–R615.
Gallahan D, Callahan R. (1997). The mouse mammary tumor
associated gene INT3 is a unique member of the NOTCH
gene family (NOTCH4). Oncogene 14: 1883–1890.
Gallahan D, Jhappan C, Robinson G, Hennighausen L, Sharp
R, Kordon E et al. (1996). Expression of a truncated Int3
gene in developing secretory mammary epithelium specifically retards lobular differentiation resulting in tumorigenesis. Cancer Res 56: 1775–1785.
Gallahan D, Kozak C, Callahan R. (1987). A new common
integration region (int-3) for mouse mammary tumor virus
on mouse chromosome 17. J Virol 61: 218–220.
Ghatak S, Misra S, Toole BP. (2002). Hyaluronan oligosaccharides inhibit anchorage-independent growth of tumor
cells by suppressing the phosphoinositide 3-kinase/Akt cell
survival pathway. J Biol Chem 277: 38013–38020.
Heinrich MC, Corless CL, Duensing A, McGreevey L, Chen
CJ, Joseph N et al. (2003). PDGFRA activating mutations
in gastrointestinal stromal tumors. Science 299: 708–710.
Hwang RF, Yokoi K, Bucana CD, Tsan R, Killion JJ, Evans
DB et al. (2003). Inhibition of platelet-derived growth factor
receptor phosphorylation by STI571 (Gleevec) reduces
growth and metastasis of human pancreatic carcinoma in
an orthotopic nude mouse model. Clin Cancer Res 9:
6534–6544.
Imatani A, Callahan R. (2000). Identification of a novel
NOTCH-4/INT-3 RNA species encoding an activated gene
product in certain human tumor cell lines. Oncogene 19:
223–231.
Jeffries S, Capobianco AJ. (2000). Neoplastic transformation
by Notch requires nuclear localization. Mol Cell Biol 20:
3928–3941.
Jhappan C, Gallahan D, Stahle C, Chu E, Smith GH, Merlino
G et al. (1992). Expression of an activated Notch-related int3 transgene interferes with cell differentiation and induces
neoplastic transformation in mammary and salivary glands.
Genes Dev 6: 345–355.
Kim MK, Higgins J, Cho EY, Ko YH, Oh YL. (2000).
Expression of CD34, bcl-2, and kit in inflammatory fibroid
polyps of the gastrointestinal tract. Appl Immunohistochem
Mol Morphol 8: 147–153.
Lasota J, Jasinski M, Sarlomo-Rikala M, Miettinen M. (1999).
Mutations in exon 11 of c-Kit occur preferentially in
malignant versus benign gastrointestinal stromal tumors
and do not occur in leiomyomas or leiomyosarcomas. Am J
Pathol 154: 53–60.
le Coutre P, Mologni L, Cleris L, Marchesi E, Buchdunger E,
Giardini R et al. (1999). In vivo eradication of human BCR/
ABL-positive leukemia cells with an ABL kinase inhibitor.
J Natl Cancer Inst 91: 163–168.
Leveen P, Pekny M, Gebre-Medhin S, Swolin B, Larsson E,
Betsholtz C. (1994). Mice deficient for PDGF B show renal,
cardiovascular, and hematological abnormalities. Genes Dev
8: 1875–1887.
Marley SB, Gordon MY. (2005). Chronic myeloid leukaemia:
stem cell derived but progenitor cell driven. Clin Sci
(London) 109: 13–25.
Matsui J, Wakabayashi T, Asada M, Yoshimatsu K, Okada
M. (2004). Stem cell factor/c-kit signaling promotes the
survival, migration, and capillary tube formation of
human umbilical vein endothelial cells. J Biol Chem 279:
18600–18607.
Noseda M, McLean G, Niessen K, Chang L, Pollet I,
Montpetit R et al. (2004). Notch activation results in
phenotypic and functional changes consistent with endothelial-to-mesenchymal transformation. Circ Res 94: 910–917.
Pear WS, Aster JC. (2004). T cell acute lymphoblastic
leukemia/lymphoma: a human cancer commonly associated
with aberrant NOTCH1 signaling. Curr Opin Hematol 11:
426–433.
Raafat A, Bargo S, Anver MR, Callahan R. (2004). Mammary
development and tumorigenesis in mice expressing a
truncated human Notch4/Int3 intracellular domain (hInt3sh). Oncogene 23: 9401–9407.
Ramalho-Santos M, Yoon S, Matsuzaki Y, Mulligan RC,
Melton DA. (2002). ‘Stemness’: transcriptional profiling of
embryonic and adult stem cells. Science 298: 597–600.
Reedijk M, Odorcic S, Chang L, Zhang H, Miller N,
McCready DR et al. (2005). High-level coexpression of
JAG1 and NOTCH1 is observed in human breast cancer and
is associated with poor overall survival. Cancer Res 65:
8530–8537.
Robbins J, Blondel BJ, Gallahan D, Callahan R. (1992).
Mouse mammary tumor gene int-3: a member of the notch
gene family transforms mammary epithelial cells. J Virol 66:
2594–2599.
Smith GH, Gallahan D, Diella F, Jhappan C, Merlino G,
Callahan R. (1995). Constitutive expression of a truncated
INT3 gene in mouse mammary epithelium impairs differentiation and functional development. Cell Growth Differ 6:
563–577.
Soriano P. (1994). Abnormal kidney development and
hematological disorders in PDGF beta-receptor mutant
mice. Genes Dev 8: 1888–1896.
Taniguchi M, Nishida T, Hirota S, Isozaki K, Ito T, Nomura
T et al. (1999). Effect of c-kit mutation on prognosis of
gastrointestinal stromal tumors. Cancer Res 59: 4297–4300.
Tsuda H, Morita D, Kimura M, Shinto E, Ohtsuka Y,
Matsubara O et al. (2005a). Correlation of KIT and EGFR
overexpression with invasive ductal breast carcinoma of the
solid-tubular subtype, nuclear grade 3, and mesenchymal or
myoepithelial differentiation. Cancer Sci 96: 48–53.
Tsuda H, Tani Y, Weisenberger J, Kitada S, Hasegawa T,
Murata T et al. (2005b). Frequent KIT and epidermal
growth factor receptor overexpressions in undifferentiatedtype breast carcinomas with ‘stem-cell-like’ features. Cancer
Sci 96: 333–339.
Uehara H, Kim SJ, Karashima T, Shepherd DL, Fan D, Tsan
R et al. (2003). Effects of blocking platelet-derived growth
factor-receptor signaling in a mouse model of experimental
Oncogene
Kit and PDGFR-a in Notch4/Int3-induced tumorigenesis
A Raafat et al
672
prostate cancer bone metastases. J Natl Cancer Inst 95:
458–470.
Ulivi P, Zoli W, Medri L, Amadori D, Saragoni L, Barbanti F
et al. (2004). c-kit and SCF expression in normal and tumor
breast tissue. Breast Cancer Res Treat 83: 33–42.
Wang D, Huang HJ, Kazlauskas A, Cavenee WK. (1999).
Induction of vascular endothelial growth factor expression
Oncogene
in endothelial cells by platelet-derived growth factor through
the activation of phosphatidylinositol 3-kinase. Cancer Res
59: 1464–1472.
Weijzen S, Rizzo P, Braid M, Vaishnav R, Jonkheer SM,
Zlobin A et al. (2002). Activation of Notch-1 signaling
maintains the neoplastic phenotype in human Ras-transformed cells. Nat Med 8: 979–986.