Oncogene (2007) 26, 662–672 & 2007 Nature Publishing Group All rights reserved 0950-9232/07 $30.00 www.nature.com/onc ORIGINAL ARTICLE Kit and PDGFR-a activities are necessary for Notch4/Int3-induced tumorigenesis A Raafat1, A Zoltan-Jones1, L Strizzi, S Bargo, K Kimura, D Salomon and R Callahan Oncogenetics Section, Mammary Biology and Tumorigenesis Laboratory, National Cancer Institute, National Institutes of Health, Bethesda, MD, USA Transgenic mice overexpressing Notch4 intracellular domain (Int3) under the control of the whey acidic protein (WAP) or mouse mammary tumor virus-long terminal repeat promoters, develop mammary tumors. Microarray analysis of these tumors revealed high levels of c-Kit expression. Gleevec is a tyrosine kinase inhibitor that targets c-Kit, platelet-derived growth factor receptors (PDGFRs) and c-Abl. This led us to speculate that tyrosine kinase receptor activity might be a driving force in the development of Int3 mammary tumors. WAP-Int3 tumor-bearing mice were treated with continuous release of Gleevec using subcutaneously implanted Alzet pumps. Phoshorylation of c-Kit, PDGFRs and c-Abl is inhibited in Int3 transgenic mammary tumors by Gleevec. Inhibition of these enzymes is associated with a decrease in cell proliferation and angiogenesis, and an induction of apoptosis. To examine the signaling mechanisms underlying Notch4/Int3 tumorigenesis, we employed small interfering RNA (siRNA) to knock down c-Kit, PDGFRs and c-Abl alone or in combination and observed the effects on soft agar growth of HC11 cells overexpressing Int3. Only siRNA constructs for c-Kit and/or PDGFR-a were able to inhibit HC11-Int3 colony formation in soft agar. Our data demonstrate an inhibitory effect of Gleevec on Int3-induced transformation of HC11 cells and mammary tumors and indicate an oncogenic role for c-Kit and PDGFR-a tyrosine kinases in the context of Int3 signaling. Oncogene (2007) 26, 662–672. doi:10.1038/sj.onc.1209823; published online 31 July 2006 Keywords: Kit; PDGFR-a; Notch4/Int3; Gleevec; phosphorylation; siRNA Introduction The Notch signaling pathway is involved in cell fate decisions of tissues and organs in several different Correspondence: Dr R Callahan, Mammary Biology and Tumorigenesis Laboratory, National Cancer Institute, National Institutes of Health, 37 Convent Drive, Bldg 37, Rm 1118A, Bethesda, MD 20892, USA. E-mail: rc54d@nih.gov 1 These authors contributed equally to this work Received 4 April 2006; revised 22 May 2006; accepted 23 May 2006; published online 31 July 2006 organisms (Callahan and Raafat, 2001). The Notch gene encodes a transmembrane receptor protein. In mammals, there are four members of the Notch gene family, some of which are targets for mutations that contribute to tumor development (Allenspach et al., 2002). Developmental transitions and malignant transformations share many of the same signaling pathways. An emerging view of malignant transformation is that of a developmental program that lacks the precise control and regulation seen during development. Recently, growing evidence supports aberrant Notch signaling in malignant transformation. Notch3 overexpression has been implicated in cases of human lung cancer (Dang et al., 2000) and activation of Notch3 in lung epithelium leads to the inhibition of epithelial differentiation (Dang et al., 2003). In a subset of human T-cell acute lymphoblastic leukemias, there is a disruption in the Notch1 gene locus that leads to activated Notch1 signaling (Pear and Aster, 2004; Chiaramonte et al., 2005). An early indication that Notch4 signaling is involved in mammary gland development and tumorigenesis stems from the identification of the Notch4 gene as a common insertion site for the mouse mammary tumor virus (MMTV) in a feral strain of mice (Gallahan et al., 1987). MMTV integration into the Notch4 gene results in the transcription of a truncated, constitutively active Notch4 gene product (Int3) that corresponds to the intracellular domain (ICD). Expression of Int3 represents a gain-of-function mutation (Robbins et al., 1992; Gallahan and Callahan, 1997). We have shown that expression of Int3 from either the MMTV long terminal repeat (LTR) or the whey acidic protein (WAP) promoter in transgenic mice blocks normal mammary lobular development and the ability of these females to lactate (Jhappan et al., 1992; Smith et al., 1995; Gallahan et al., 1996). In addition, 100% of the females develop mammary adenocarcinomas (Jhappan et al., 1992; Gallahan et al., 1996; Gallahan and Callahan, 1997). Microarray analysis of MMTV LTR and WAP-Int3 mammary tumor RNAs revealed high steady-state levels of the c-Kit tyrosine kinase receptor, as compared to control FVB mammary tissue (our unpublished data). The c-Kit receptor is a transmembrane tyrosine kinase that belongs to the larger receptor tyrosine kinase type III family (RTK III). This family also includes the c-Abl and platelet-derived growth factor receptors (PDGFR-a Kit and PDGFR-a in Notch4/Int3-induced tumorigenesis A Raafat et al 663 and PDGFR-b) (Besmer et al., 1986). The role of the RTK III family in human malignancies is well known. In chronic myeloid leukemia (CML), c-Abl is activated by a translocation to create a Bcr/Abl fusion protein (Marley and Gordon, 2005). Human gastrointestinal stromal tumors (GIST) harbor activating mutations of c-Kit (Lasota et al., 1999; Taniguchi et al., 1999; Kim et al., 2000) or, in c-Kit-negative subsets, activating mutations of PDGFR-a (Heinrich et al., 2003). The aim of the present study was to investigate the significance of elevated levels of c-Kit in MMTV LTR and WAP-Int3 mammary tumors and to determine whether the expression of c-Kit and/or other RTK III family members, in the context of Int3 signaling, contributes to malignant growth. Results Expression of Gleevec targets in WAP-Int3 mammary tumors To investigate the effects of Int3 expression on alterations in gene expression, we performed a gene array study comparing normal mammary tissue from FVB/N females and WAP-Int3 or MMTV LTR-Int3 tumors (data not shown). Of particular interest to us was the increased steady-state levels of c-Kit RNA in theWAPInt3 and MMTV LTR-Int3 tumors as compared to mammary tissue from normal virgin or pregnant FVB/ N mice (Figure 1a). To determine whether other related RTK III including c-Abl, PDGFR-a and PDGFR-b were also expressed in these tumors, total RNA extracts from three independent primary WAP-Int3 mammary tumors were analysed for c-Kit, c-Abl, PDGFR-a and PDGFR-b expression by PCR with reverse transcription (RT–PCR). All three tumors were positive for these other RTK III RNAs (Figure 1b). Additionally, immunohistochemical analysis demonstrated that all three primary tumors express the respective proteins (Figure 1c). The c-Kit and PDGFR-a proteins (Figure 1c, panels 5 and 6, respectively) are expressed in most of the tumor epithelium, whereas PDGFR-b (Figure 1c, panel 7) was detected primarily in the stroma of the tumors. Only a minor fraction of the tumor epithelium was stained with the c-Abl antibody (Figure 1c, panel 8). Gleevec dose response To ascertain whether members of the RTK III family are involved in Int3-induced mammary tumorigenesis, we undertook a dose–response study to determine the effects of Gleevec on WAP-Int3 tumor-bearing mice. We used 21 or 10.5 mg/week of Gleevec per mouse. Mice treated with a 10.5 mg/week dose showed no significant change in the tumor weight. In contrast, there was a significant reduction in mammary tumor weight (TW) in mice treated with 21 mg/week (Figure 2a). Therefore, a dose of 21 mg/week was used in all subsequent experiments. Mice treated with water showed a significant continuous increase in tumor weight. We had to Figure 1 Expression of Gleevec-sensitive kinases in mouse Int3 transgenic mammary tumors. (a) Evaluation of c-Kit expression in FVB/N and Int3 transgenic mammary glands. Northern blot analysis of FVB/N tissue of virgin and 15 days pregnant (P15) mammary glands, also mammary tissue of 15 days pregnant WAPInt3 (Wap-P15), MMTV LTR-Int3 (LTR-V) and WAP-Int3 (WAP-V) tumors from virgin mice. The membrane was stripped and re-probed with GAPDH. (b) Qualitative RT–PCR analysis of Gleevec targets in three independent WAP-Int3 primary mammary tumors shows detectable levels of c-Kit, PDGFR-a , PDGFR-b and c-Abl. (c) Photomicrographs of immunohistochemical staining of c-Kit (panels 1and 5), PDGFR-a (panels 2 and 6), PDGFR-b (panels 3 and 7) and c-Abl (panels 4 and 8) in WAP-Int3 mammary gland tumors; negative controls for c-Kit, PDGFR-a, PDGFR-b and c-Abl are panels 5, 6, 7 and 8, respectively. Exhibited sections were counterstained with hematoxylin. Magnification,
40. euthanize these mice at day 4 of water treatment because of the tumor weight. Histological analysis of hematoxylin and eosin (H&E)-stained liver and kidney sections from Gleevec-treated mice did not show any evident morphological alterations such as necrosis or inflammatory changes due to toxicity (data not shown). These results demonstrate that WAP-Int3 mammary tumors are sensitive to Gleevec and further provide a strong rationale that the activation of one or more of the RTK III targets of Gleevec, in the context of Int3 signaling, likely contributes to tumor growth. To determine the range of Gleevec effects on tumor growth, we treated five WAP-Int3 tumor-bearing mice with 21 mg/week Gleevec for 1 week and monitored TW daily. At the end of the treatment period, TW was significantly reduced (Figure 2b) in all mice. When the pumps were depleted of Gleevec after day 6, there was a resumption of tumor growth, suggesting that continuous inhibition of Gleevec targets is needed to effectively inhibit tumor growth. In a separate experiment, we examined the effect of Gleevec on the growth Oncogene Kit and PDGFR-a in Notch4/Int3-induced tumorigenesis A Raafat et al 664 of transplanted WAP-Int3 mammary tumor viable tissue. As shown in Figure 2c, mammary tumor growth was totally blocked in the Gleevec-treated mice, indicating lower receptor activity compared to the control. Phoshorylation status of c-Kit, c-Abl, PDGFR-a and PDGFR-b We examined the in vivo effects of Gleevec treatment on the steady-state levels of total and phosphorylated c-Kit, PDGFR-a, PDGFR-b and c-Abl by immunohistochemistry. Transplanted tumor samples were obtained at different time points after Gleevec treatment for histologic and immunohistochemical analyses. Steadystate levels of all four proteins were comparable in the tissue from Gleevec-treated and control- (water) treated mice (Figure 3a–d, panels 1 and 3). Thus as shown in Table 1, 75–80% of the tumor epithelium stained positive for c-Kit, and 30 and 40% of tumor epithelium was positive for PDGFR-a and c-Abl, respectively. PDGFR-b was stained primarily in the stroma (35–38% of the cells). Treatment with Gleevec did not affect protein level; however, the level of receptor phosphorylation was significantly reduced in the samples from the Gleevec-treated mice, whereas treatment with water had no effect on inhibiting phosphorylation (Figure 3a–d, panels 2 and 4 and Table 1). Cell proliferation, apoptosis and microvascularization levels in WAP-Int3 tumors from Gleevec-treated mice We also examined the effects of Gleevec on cell proliferation, apoptosis, and microvascularization. Gleevec treatment resulted in 60% decrease in the number of proliferating cells relative to the control (Figure 4a and b). At the same time, there was a fourfold increase in the number of apoptotic cells as determined by TUNEL staining in the Gleevec treated group as compared to the control (Figure 4c and d). In addition, Gleevec treatment resulted in a 50% reduction in microvascularization of the WAP-Int3 tumors (Figure 4e and f). Gleevec inhibits Int3-induced soft agar colony formation The in vivo data raised the question of whether all four RTK III kinases are required for tumor growth or if one or a combination of them is sufficient to stimulate tumor growth. To address this question, we next chose to examine the activity of the individual Gleevec targets on Int3- and hNotch1-ICD-induced transformation using an in vitro system. We (Robbins et al., 1992; Imatani and Callahan, 2000) and Dievart et al.(1999) have shown previously that HC11 mouse mammary epithelial cells, Figure 2 Continuous release of Gleevec inhibits WAP-Int3 mammary tumor growth in vivo. (a) Gleevec dose response. Mice bearing primary WAP-Int3 mammary tumors were treated with water, 10.5 or 21 mg/week Gleevec for 7 days. Gleevec was administered using subcutaneous osmotic pumps (continuous release) as described in Materials and methods. Treatment started when tumor weight reached 500 mg. Mammary tumors were palpated and measured on daily basis for the duration of the experiment (6 days). Each data point indicates the average tumor weight from a minimum of 5–6 different mice measured at the specified day. *Po0.05 for 21 mg/week treated mice having lower tumor weight than the 10.5 mg/week. (b) Regression of WAP-Int3 primary mammary tumors is Gleevec dependent. Gleevec treatment started when tumor weight reached 500 mg and continued for 7 days. Continuous release of Gleevec (21 mg/week) from osmotic pumps reduced mammary tumor weight (compare day 1 vs. day 5). Resumption of WAP-Int3 mammary tumor growth took place on day 6 as the osmotic pumps were depleted of Gleevec. (c) Gleevec effects on the in vivo growth of transplanted WAP-Int3 viable mammary tumor tissue. Viable tissue from WAP-Int3 mammary tumor was placed in the inguinal mammary gland of two different FVB/N mice. Once tumors weight reached 100 mg, one mouse received Gleevec (’) and the other received water (E). It took the viable tissue 19 days to reach 100 mg and about 33 days to reach 500 mg. Early treatment of WAP-Int3 tumors with Gleevec (21 mg/ week) resulted in inhibition of tumor growth, whereas treatment of the same tumors with water did not block tumor growth. Each data point in these graphs indicates the average tumor weight from a minimum of six different mice measured at the specified day. Oncogene Kit and PDGFR-a in Notch4/Int3-induced tumorigenesis A Raafat et al 665 when stably transfected with the Int3 (HC11-Int3) or Notch1-ICD, will form colonies in soft agar, a hallmark of cellular transformation. Gleevec treatment inhibited Int3- and hNotch1-ICD- induced colony formation in a dose-dependent manner (Figure 5a, lanes 5–8 and lanes Table 1 Total and phosphorylated protein kinase expression in waplnt3 mammary tumors (% positive cells7s.e.m.) Protein kinase Total P-value Water gleevec c-Kit PDGFR-a PDGFR-b c-Abl 7579 3073 3574 4077 80714 3075 3875 3574 p1.0 p1.0 p0.8 p0.2 Phosphorylated Water gleevec 7077 3073 3074 3275 5076 1073 271 271 P-value p0.007 p0.02 p0.02 p0.02 Abbreviation: PDGFR, platelet-derieved growth factor receptor. Positive cells were scored and labeling index is expressed as a percentage of positive nuclei of 3000 counted cells. 9–11, respectively), whereas HC11 control cells did not form colonies in soft agar (Figure 5a, lanes 1–4). We next assessed the expression levels of the Gleevec targets by Western blot analysis. Both HC11 and HC11-Int3 cells expressed c-Kit, PDGFR-a and c-Abl at similar levels (Figure 5b). Neither cell line expressed the PDGFR-b receptor, which differs from our in vivo result with tumors from transgenic mice. However, as PDGFR-b is usually expressed in the stroma, we might not expect to detect this receptor in HC11 epithelial cells. Although there was no difference in the steadystate levels of these receptors in the control and Int3 cell lines, we found that cells expressing Int3 have elevated levels of phosphorylated c-Kit and PDGFR-a, indicating increased receptor activity as compared to the control HC11 cell line (Figure 5c, compare lanes 1 and 3). The phosphorylation status of c-Abl was relatively unchanged in the two cell lines. When we treated these cells with Gleevec, receptor phosphorylation was inhibited in a dose-dependent manner (Figure 5c, compare lanes 4–6 with lane 3), consistent with Gleevec’s mechanism of action. siRNA knockdown of c-Kit and PDGFR-a inhibits soft agar growth Gleevec inhibition of Int3-induced soft agar growth suggested that the activity of the target RTK III was important in Int3-induced cell transformation. To determine which receptor, or combination of receptors, was important, we employed a small interfering RNA (siRNA) approach to knock down each receptor individually or in combination and looked at the effect on soft agar growth. The effect of non-silencing and Figure 3 In vivo inhibition of c-Kit, PDGFR-a, PDGFR-b and c-Abl phosphorylation by Gleevec. Viable tissue from each WAPInt3 mammary tumor was placed in the inguinal mammary gland of two separate 10-week-old FVB/N mice. Once the tumors weight reached 500 mg, one mouse received Gleevec (21 mg/week) and the other mouse received water, using Alzet pumps as described in the Materials and methods. Mice were killed at 72 h after treatment. Immunohistochemical analysis of total (panels 1and 3) and phosphorylated(P) (panels 2 and 4), c-Kit (a), PDGFR-a (b), PDGFR-b (c) and c-Abl (d) is shown. Magnification,
40. Arrows point to endothelial cells. In panels C5 and C6, the magnification is
100. Oncogene Kit and PDGFR-a in Notch4/Int3-induced tumorigenesis A Raafat et al 666 Figure 4 In vivo effect of Gleevec on proliferation, apoptosis and angiogenesis of WAP-Int3 mammary tumors. Tumor-bearing mice were treated with Gleevec (21 mg/week) as described in Materials and methods. At days 1, 3 and 5 after treatment, mice were killed and tissue was collected. Gleevec-induced inhibition of proliferation (a and b), induction of apoptosis (c and d) and reduction of blood vessels (e and f) was determined as described in Materials and methods. Proliferating and apoptotic cells were scored and labeling index expressed as a percentage of positive nuclei of at least 3000 counted cells. Arrows point to blood vessels. Blood vessels were scored as number of blood vessels/microscopic field. *P o0.05. Magnification,
40. silencing siRNA on the expression of each of the receptors was validated by Western blot analysis (Figure 6a). When we transfected cells with siRNA oligomers for c-Kit, PDGFR-a, PDGFR-b or c-Abl soft agar colony formation was significantly inhibited by c-Kit siRNA (84%) (Figure 6b, compare lanes 6 and 7) and PDGFR-a siRNA (76%) (compare lanes 6 and 8) knockdown, as compared to a non-silencing control siRNA oligomer. Transfection with the c-Abl siRNA construct significantly inhibited soft agar growth, but only by 30% (Figure 6b, compare lanes 6 and 10) as compared to non-silencing control. Inhibition by the PDGFR-b siRNA oligomers was not significant (Figure 6b, compare lanes 6 and 9). As expected, HC11 control cells did not grow in soft agar (Figure 6b, lanes 1–5). Because Int3-induced soft agar Oncogene Figure 5 Gleevec inhibits Int3 and hNotch1-ICD- induced cell colony formation in soft agar by blocking c-Kit and PDGFR-a receptor activity. (a) HC11 (lanes 1–4) and HC11-Int3 (lanes 5–8) or HC11-hNotch1-ICD (lanes 9–11) cell lines were grown in soft agar in the presence or absence of a range of Gleevec concentrations (0.625–2.5 mM) as described in Materials and methods. HC11 no treatment (Lane1), HC11 0.626 mM Gleevec (lane2), HC11 1.25 mM Gleevec (lane3), HC11 2.5 mM Gleevec (lane 4), HC11 Int3 no treatment (lane 5), HC11-Int3 0.625 mM Gleevec (lane 6), HC11Int3 1.25 mM Gleevec (lane 7), HC11-Int3 2.5 mM Gleevec (lane 8), HC11-hNotch1-ICD no treatment (lane 9), HC11-hNotch1-ICD 1.25 mM Gleevec (lane 10) and HC11-hNotch1-ICD 2.5 mM Gleevec (lane 11). *Po0.001, Gleevec-treated versus untreated. Gleevec reduced HC11-Int3 and HC11-hNotch1-ICD colony formation in a dose-dependent manner. (b) Western blot analysis to assess c-Kit, PDGFR-a, PDGFR-b and c-Abl protein levels in HC11 and HC11-Int3 cells in the presence or absence of Gleevec. Lane 1 corresponds to HC11 control cells and lane 2 to HC11-Int3 cells. (c) Immunoprecipitation of cell lysates from HC11 and HC11-Int3 cells treated with or without different concentrations of Gleevec (0.625–2.5 mM) with anti-phosphotyrosine antibody. lane 1, HC11; lane 2, HC11-Int3 IP IgG; lane 3, HC11-Int3 no treatment; lane 4, HC11-Int3 0.625 mM Gleevec; lane 5, HC11-Int3 1.25 mM Gleevec; and lane 6, HC11-Int3 2.5 mM Gleevec. Immunoblotting was with the indicated antibodies. growth was not completely inhibited with either c-Kit or PDGFR-a knockdown alone, we used a double knockdown approach of both receptors and included various dosages of c-Kit and PDGFR-a siRNA oligomers to determine if there was a dose that was not sufficient to inhibit colony growth alone, but was sufficient to inhibit colony formation when c-Kit and PDGFR-a knockdown were combined. We found that although we were never able to inhibit colony formation beyond a level of B85% with double transfection of c-Kit and PDGFR-a siRNA oligomers (Figure 6c, compare lane 2 with lanes 3 and 4), we were able to titrate the amount of single c-Kit or PDGFR-a siRNA oligomer down to a concentration that would not inhibit soft agar growth when transfected alone (Figure 6c, lanes 5 and 6). However, when c-Kit and PDGFR-a siRNA oligomers Kit and PDGFR-a in Notch4/Int3-induced tumorigenesis A Raafat et al 667 Figure 7 Effect of SCF stimulation in the presence of c-Kit or PDGFR-a siRNA inhibition of soft agar growth. HC11 and HC11Int3 cells were plated for soft agar growth assay with SCF (50– 200 ng/ml), in the presence of c-Kit and/or PDGFR-a siRNA oligomers or non-silencing siRNA control. HC11 cells with nonsilencing siRNA (lane 1), HC11 cells with non-silencing siRNA þ SCF 50 ng/ml (lane 2), HC11 cells with non-silencing siRNA þ SCF 200 ng/ml, HC11-Int3 cells with non-silencing siRNA (lane 4), HC11-Int3 cells with non-silencing siRNA þ SCF 50 ng/ml (lane 5), HC11-Int3 cells with non-silencing siRNA þ SCF 200 ng/ml (lane 6), HC11-Int3 cells with PDGFR-a siRNA (lane 7), HC11-Int3 cells with PDGFR-b siRNA þ SCF 50 ng/ml (lane 8) and HC11-Int3 cells with PDGFR-a siRNA þ SCF 200 ng/ml (lane 9). SCF accelerates colony onset, numbers and size but is not able to overcome PDGFR-a inhibition. PDGFR-a is essential for colony formation. Columns, mean; Bars, 7s.e.m. effect on inhibition of Int3-induced transformation by c-Kit and PDGFR-a siRNA (Figure 6c, lane 7). Figure 6 siRNA knockdown of c-Kit and PDGFR-a inhibits soft agar growth. Western blot and soft agar assay of HC11 or HC11Int3 cells transfected with the indicated siRNA oligomers. (a) Western blot analysis of c-Kit, PDGFR-a and c-Abl expression in HC11 and HC11-Int3 cells treated with non-silencing or silencing siRNA. Only silencing siRNA reduced the expression of its target protein, confirming the specificity of the siRNA. Immunoblotting was performed with the indicated antibodies. (b) Soft agar growth of HC11 cells with non-silencing siRNA (lane 1), HC11 cells with c-Kit siRNA (lane 2). HC11 cells with PDGFR-a siRNA (lane 3), HC11 cells with PDGFR-b siRNA (lane 4), HC11 cells with c-Abl siRNA (lane 5), HC11-Int3 cells with non-silencing siRNA (lane 6), HC11-Int3 cells with c-Kit siRNA (lane 7), HC11-Int3 cells with PDGFR-a siRNA (lane 8), HC11-Int3 cells with PDGFR-b siRNA (lane 9) and HC11-Int3 cells with c-Abl siRNA (Lane 10), (c) The effect of combinations of siRNA on soft agar growth: HC11 cells with non-silencing siRNA (lane 1), HC11-Int3 cells with nonsilencing siRNA (lane 2), HC11-Int3 cells with c-Kit siRNA (lane 3), HC11-Int3 cells with PDGFR-a siRNA (lane 4), HC11-Int3 cells with c-Kit 50 nM siRNA (lane 5), HC11-Int3 cells with PDGFR-a 50 nM siRNA (lane 6) and HC11-Int3 cells with 50 nM of c-Kit and 50 nM of PDGFR-a siRNA (lane 7). Unless indicated, the concentration of siRNA oligomer used was 100 nM. Only, groups 5–7 in (C) were transfected with 50 nM siRNA oligomer as indicated. *Po0.001, receptor siRNA transfected as compared to non-silencing siRNA control. Columns, mean; Bars7s.e.m. at this non-inhibitory concentration were combined, the result was an inhibition of colony formation, equivalent to the maximal inhibition level achieved with high dose of either siRNA alone. These data suggest a cooperative c-Kit and PDGFR-a activity are both required for Int3-induced transformation To further explore the role of c-Kit and PDGFR-a in this system, we used the c-Kit ligand stem cell factor (SCF) to stimulate the cells and observe the effects on colony formation. When HC11-Int3 cells are stimulated with SCF, the number of colonies formed per well increased B1.5-fold over untreated HC11-Int3 cells (Figure 7, compare lane 4 with lanes 5 and 6). Most striking was the rapid onset of HC11-Int3 colony formation in the presence of SCF. By day 10 after plating, scorable colonies were observed in the SCFtreated Int3 cells (data not shown). Knockdown of c-Kit receptor activity via siRNA inhibits this rapid onset of colony formation. Because the HC11-Int3 cells have such a marked response to SCF, we determined whether the stimulation of these cells with SCF would be sufficient to overcome the effects of PDGFR-a knockdown on Int3-induced soft agar growth. In this experiment, we used siRNA oligomers to knock down PDGFR-a in the presence of SCF. Interestingly, we found that even with increasing doses of SCF, stimulation of the c-Kit receptor in the presence of PDGFR-a knockdown was not sufficient to induce soft agar growth (Figure 7, compare lane 7 with lanes 8 and 9). Thus, in this setting, PDGFR-a activity is at least equally as important as c-Kit receptor activity in regulating soft agar growth of HC11-Int3 cells. Oncogene Kit and PDGFR-a in Notch4/Int3-induced tumorigenesis A Raafat et al 668 Discussion In the present work, we have shown that WAP-Int3 mammary tumors contain high steady-state levels of c-Kit and other members of the RTK III family. The linkage between Notch and Kit/PDGFR signaling is not unprecedented. For instance, endothelial-to-mesenchymal transformation is associated with Notch4 signaling, which leads to the upregulation of PDGFR expression (Noseda et al., 2004). Interestingly, human mammospheres that are enriched for early progenitor/stem cells of the mammary gland coexpress Notch4 and PDGFRa (Dontu et al., 2004). In other tissues such as ciliary epithelium neural stem cells, c-Kit-mediated signaling upregulates Notch expression and signaling (Das et al., 2004). Enriched hematopoietic stem cells also coexpress Notch1 and c-Kit (Ramalho-Santos et al., 2002). As members of the Kit/PDGFR RTK III family are involved in multiple tumor-associated processes, we questioned whether their signaling contributes to mammary tumor development in the context of Int3 signaling. Treatment of Int3 tumor-bearing mice with Gleevec, an inhibitor specific for this family of RTK, caused the tumors to regress to a point that in many cases they were unpalpable. At a molecular level, a primary consequence of Gleevec treatment on c-Kit, PDGFR-a and c-Abl was to decrease their phosphorylation. A secondary consequence of Gleevec treatment was the decrease in the number of proliferating cells and the level of the microvascularization of the tumors coupled with an increase in the level of apoptotic cells in the tumors. The increase in apoptosis and decrease in proliferation in response to Gleevec might explain the reduction in tumor growth. Continuous release of Gleevec for a week resulted in 33% inhibition of tumor growth by day 2 and 66% by day 4. Gleevec treatment produced a complete inhibition of tumor growth, indicating that a continuous block of Gleevec targets activity is needed to produce complete tumor regression. Similar results were observed when Gleevec was administered every 8 h in mice bearing Leydig cell tumors (Basciani et al., 2005) and in nude mice bearing Bcr/Abl-positive human leukemia cell lines (le Coutre et al., 1999). Discontinuation of Gleevec treatment resulted in rapid tumor re-growth, confirming the need for a sustained blockage of Gleevec targets to inhibit tumorigenesis. These results are in agreement with clinical data in CML patients (Cortes et al., 2004). The antiangiogenic effect of Gleevec has been observed in several types of cancers (Hwang et al., 2003; Uehara et al., 2003). This effect has been attributed to the inhibition of PDGFRs and c-Kit, which are important survival factors for endothelial cells (Betsholtz, 2003; Matsui et al., 2004). Gleevec inhibits vascular endothelial growth factor expression indirectly through a PDGF inhibition-mediated mechanism (Wang et al., 1999). In addition, both PDGFR-b and PDGF-b null mutant mice die at late gestation from widespread microvascular bleeding (Leveen et al., 1994; Soriano, 1994). Taken together, we conclude from our data that signaling by at least one RTK III member is Oncogene necessary for initiating or maintaining Int3 mammary tumorigenesis. To determine which RTK III member or combination of members is responsible for tumor promotion, we used an in vitro model in which Int3 expression confers on HC11 mouse mammary epithelial cells the ability for anchorage independent-growth in soft agar. Treatment of HC11-Int3 cells with Gleevec blocks, in a dosedependent manner, their ability to grow in an anchorage-independent manner, whereas it is not cytotoxic to HC11 cells grown on monolayer. From this result, we concluded that it was not RTK III signaling per se, but a collaboration between Int3 and RTK III signaling. To define more fully which RTK III family member(s) are involved in this collaboration, we used siRNA against each of the RTK III members in the HC11-Int3 soft agar assay. As with Gleevec, siRNA against individual RTK III members is not toxic for HC11 cells. In addition, HC11 cells do not express PDGFR-b, and knockdown of c-Abl with siRNA had a minimal effect on the ability of HC11-Int3 cells to grow in soft agar. Therefore, we conclude that the primary contributors to HC11-Int3 soft agar growth are due to the activation of c-Kit and PDGFR-a. Two observations suggest that both c-Kit and PDGFR-a are required to promote Int3induced HC11 soft agar growth. First, suboptimal levels of siRNA for c-Kit and PDGFR-a act cooperatively in the inhibition of HC11-Int3 soft agar growth, and second, SCF induction of c-Kit activity was unable to overcome PDGFR-a siRNA inhibition of HC11-Int3 soft agar growth. We conclude that there are components of the c-Kit and PDGFR-a signaling pathways that are unique to each and that they collaborate with Int3 signaling in mammary tumor progression. Notch1-ICD (ICD1) also confers on HC11 cells the capability of growth in soft agar (Dievart et al., 1999). Like HC11-Int3 cells, Gleevec blocks HC11-ICD1 cell growth in soft agar, suggesting that c-Kit and PDGFR-a are the targets for the drug in these cells as well. It seems pertinent, therefore, that in human foreskin fibroblasts (BJ) and human embryonic kidney (HEK) epithelial cells, oncogenic Ras activates the expression of Notch1 that in turn activates the expression of Notch4 (Weijzen et al., 2002). In this setting, oncogenic Ras is upstream of Notch1, as suppression of Notch1 expression inhibits the growth of Ras-transformed cells. At the present time, only a limited number of studies have been undertaken to look at the expression of Notch, c-Kit and PDGFR-a in normal human breast and in primary breast carcinomas. Reedijk et al.(2005) found that the expression of each member of the Notch gene family could be detected to varying degrees in a survey of 184 breast carcinomas. In fact, high levels of Notch1 and its ligand JAG1 were linked to poor overall survival. Imatani and Callahan (2000) identified a truncated Notch4 RNA species in certain human breast, colon and lung carcinoma cell lines. This Notch4 RNA species encodes a portion of the ICD of the protein. Expression of this Notch4 RNA species from a transgene in the mouse mammary gland is associated with mammary tumor development (Raafat et al., 2004). Kit and PDGFR-a in Notch4/Int3-induced tumorigenesis A Raafat et al 669 High levels of c-Kit were observed in the normal mammary ductal epithelium but not in myoepithelial cells (Weijzen et al., 2002). Assessment of breast carcinomas for c-Kit expression have shown that as the tumors become more invasive, the levels of c-Kit expression decrease; thus, 44–53% of ductal carcinomas in situ (DCIS) are c-Kit positive, whereas only 9–10% of invasive ductal carcinomas (IDC) are c-Kit positive (Ulivi et al., 2004; Tsuda et al., 2005a; b; Diallo et al., 2006). In contrast, 39% of IDC are positive for PDGFR-a expression (de Jong et al., 1998; Carvalho et al., 2005). In these tumors, the stroma and endothelium also stain positive for PDGFR-a (de Jong et al., 1998). In conclusion, the reports of elevated steady-state levels of Notch, c-Kit and PDGFR-a expression in human breast cancer tissue (Carvalho et al., 2005; Diallo et al., 2006) suggest that Gleevec is a potential candidate drug for breast cancer treatment and prevention. Materials and methods Animals and experimental design Primary mammary tumors in the WAP-Int3 females were palpated weekly. The length, width and depth of palpable tumors were measured with Vernier calipers. TW was determined using the equation TW (mg) ¼ (S)2
L/2 where S and L (le Coutre et al., 1999) were measured in millimeters. S and L are the shortest and longest diameters of the tumor, respectively. Primary tumors were allowed to grow until they reached 500 mg, at which time the WAP-Int3 tumor-bearing mice were killed and mammary tumors were collected as viable tissue. To reduce inter-tumor variations, virgin FVB/N female mice from our colony were used at 10 weeks of age and the inguinal mammary glands of these FVB\N mice served as the transplantation site of the primary WAP-Int3 viable tumor tissue. Viable tissue from each WAP-Int3 mammary tumor was placed in the inguinal mammary gland of two separate FVB/N mice. Once tumors reached the desired weight, one mouse with tissue from a single primary tumor received Gleevec and its matching control received water (control). Alzet miniosmotic pumps (Model 2001, pumping rate 1 ml/h, Durect Corp., Cupertino, CA, USA), implanted subcutaneously on the dorsal surface of the mouse, were used to deliver a subcutaneous dose of Gleevec (10.5 or 21 mg/mouse/ week) or water (control). For studies longer than 7 days, fresh pumps were used every 7 days. Gleevec was generously provided by Novartis Pharma (Basel, Switzerland). Treated mice were killed at various time points. Mice were kept under standard laboratory conditions according to the guidelines of the National Cancer Institute. This study was approved by the Institutional Ethics Committee for Laboratory Animals used in Experimental Research. Northern Blot Analysis and RT–PCR To detect c-Kit, c-Abl, PDGFR-a and PDGFR-b expression in WAP-Int3 tumors, total RNA extracts were prepared from WAP-Int3 mammary tumors using TRIzol (Invitrogen Life Technologies, Carlsbad, CA, USA), according to the manufacturer’s instructions. Twenty-five micrograms of total RNA from WAP-Int3 and MMTV LTR-Int3 mammary tumors as well as mammary tissue from normal FVB/N and WAP-Int3 females was used in Northern blot analysis as previously described (Robbins et al., 1992; Gallahan and Callahan, 1997). Full-length cDNAs for c-KIT (ATCC 10699933) and GAPDH (ATCC 10539048) were used for hybridization as described previously (Robbins et al., 1992; Gallahan and Callahan, 1997). The nucleotide sequences of synthetic oligonucleotides for RT–PCR are as follows: c-Kit: 50 -CCAGTGCTTCCGTGA CATTC-30 and 50 -CGTCCACTGGTGAGACAGGA-30 ; cAbl: 50 -CGCATGTTCCGGGACAAAAGC-30 and 50 -CCAT TTTCTCATCTCCAA GCC-30 ; PDGFR-a: 50 -CGACTCCA GATGGGAGTTCCC-30 and 50 -TGCCATCCACTTCACA GGCA-30 ; PDGFR-b: 50 -AGCTACATGGCCCCTTATGA-30 and 50 -GGATCCCAAAAGACCAGACA-30 . For each experiment, a control reaction without reverse transcriptase was performed. A thermal cycle of 581C annealing temperature was repeated 32 times using Superscript One-Step RT–PCR with Platinum Taq (Invitrogen Life Technologies, Carlsbad, CA, USA) according to the manufacturer’s protocol. RT–PCR products were separated on a 1.5% agarose gel and visualized with ethidium bromide. Preparation of tissue for histology Mammary glands were routinely fixed in 4% freshly prepared paraformaldehyde in phosphate-buffered saline (PBS) (pH 7.4) for 2 h, rinsed through several changes of buffer, dehydrated in ethanol and embedded in paraffin. Paraffin sections (5 mm) were placed on slides, deparaffanized and stained with H&E. Immunohistochemistry Immunohistochemistry was carried out with the ABC method according to the manufacturer’s protocol (Vector Laboratories Inc., Burlingame, CA, USA). Primary antibody incubation was carried out overnight at 41C: PCNA (sc-9857; Santa Cruz, Santa Cruz, CA, USA), c-Kit (sc-168), PDGFR-a (sc-338), PDGFR-b (sc-1627), c-Abl antibody (2862, Cell Signaling Inc., Technologies Inc., Beverly, MA, USA). For phosphorylated (P) proteins, P-c-Kit (sc-180676R), P-PDGFR-a (sc-12911R), P-PDGFR-b (3161, Cell Signaling Technologies, Inc., Beverly, MA, USA) and P-c-Abl antibody (2861, Cell Signaling Technologies Inc., Beverly, MA, USA) were used. Primary antibodies were diluted 100
in PBS–1% BSA and appropriate biotinylated secondary anti-goat (PK-6105, Vector Laboratories Inc., Burlingame, CA, USA) or anti-rabbit (PK-6101, Vector Laboratories, Inc., Burlingame, CA, USA) antibodies were diluted according to the manufacturer’s recommendations. For apoptosis and angiogenesis assay, the Roche in situ cell detection POD kit (1684817, Roche, Indianapolis, IN, USA) and the Chemicon, blood vessel staining kit (ECM590, Temecula, CA, USA) were used according to the manufacturer’s recommendations, respectively. Labeling index was determined in at least a total of 3000 cells in each experimental condition. Cell culture HC11 (Ball et al., 1988) and HC11-Int3 mouse mammary epithelial cells were grown in RPMI medium (Gibco BRL, Grand Island, NY, USA) supplemented with 10% FBS (Mediatech, Herndon, VA, USA), 5 mg/ml insulin (Gibco BRL, Grand Island, NY, USA), 10 ng/ml EGF (Gibco BRL, Grand Island, NY, USA) and 1% penicillin–streptomycin (Gibco BRL, Grand Island, NY, USA). The HC11-Int3 cell line was generated as described previously (Raafat et al., 2004). Human Notch1 intracellular domain (hNotch1-ICD) was a generous gift from Dr Sean Jeffries (Jeffries and Capobianco, 2000). Oncogene Kit and PDGFR-a in Notch4/Int3-induced tumorigenesis A Raafat et al 670 Colony formation in soft agar Five thousand cells in 2
growth medium with or without SCF (50 mM; Peprotech, Rocky Hill, NJ, USA) or c-Kit activity-blocking antibody, Clone K44.2 (200 mg/ml; Sigma St Louis, MO, USA) were mixed 1 : 1 with 0.4% agar and then analysed for colony formation as described previously (Ghatak et al., 2002). After 20 days of growth in agar, 1 ml of nitroblue tetrazolium vital dye (Sigma, St. Louis, MO, USA) was added to each well to visualize viable colonies. The following day, colonies were counted at a magnification of
10 using a manufactured ocular scale (Electron Microscopy Sciences, Fort Washington, PA, USA). Colonies measuring larger than 150 mm in diameter were counted. Each experiment was carried out in duplicate and performed at least three times. RNAi gene silencing c-Kit, c-Abl, PDGFR-a and PDGFR-b gene silencing was performed using Qiagen-designed siRNA duplexes for c-Kit, c-Abl, PDGFR-a and PDGFR-b (Qiagen Inc., Valencia, CA, USA). Two double-stranded siRNAs were generated for each target, except for c-Abl, which was generated and prevalidated by the manufacturer. All oligomers were tested. An asterisk indicates the siRNA that showed the greatest inhibition and was subsequently used in the experiment. DNA target sequences or regions are as follows: c-Kit (1) TTCCGTGACATTCAACGTTTA, c-Kit (2)* CCCACTGT GATTCCGCCTTTA, PDGFR-a (1) CGGCGACTACATG GACATGAA, PDGFR-a (2)* ACGGATGAGAGTGA GATC GAA, PGDFR-b (1)* CCGGTACGTGTCAGAACT GAT, PGDFR-b (2) GCGGGTGGTGTTCGAGGCTTA and c-Abl* 1818–1863. In all experiments, a non-silencing duplex siRNA was used as a control. HC11 cells were plated the day before transfection to reach 60–80% confluency the next day. All transfections were carried out in six-well plates according to the Qiagen protocol, using a 1:3 ratio of siRNA:RNAi Fect Reagent. Gene silencing was monitored at the protein level by Western blotting of cell lysates collected 48 h following transfection. Cells were harvested for soft agar assay 48 h following transfection. Immunoblotting Cells were harvested with trypsin-ethylene diaminetetraacetic acid (1
) (Gibco BRL) and collected as a pellet by centrifugation at 41C. Cells were lysed in buffer containing 1% Nonidet-40, 0.5 mM ethylene glycol tetraacetate, 5 mM sodium orthovanadate, 10% glycerol, 1
concentration of Calbiochem Protease Inhibitor Cocktail I (La Jolla, CA, USA) and 50 mM HEPES, pH 7.5. SDS–polyacrylamide gel electrophoresis (SDS—PAGE), followed by transfer to nitrocellulose. After blocking for 1 h and washing with Tris-buffered saline– 0.1% Tween 20, the membranes were probed overnight with primary antibodies to c-Kit, c-Abl, PDGFR-a, PDGFR-b (all 1:100; Santa Cruz, Santa Cruz, CA, USA), or tubulin (1:5000. Sigma, St Louis, MO, USA). Membranes were washed as described above, followed by incubation with horseradish peroxidase (HRP)-conjugated secondary antibody (1:5000; Amersham Biosciences, Piscataway, NJ, USA). ECL reagent (Amersham Biosciences, Piscataway, NJ, USA) was used for detection. Immunoprecipitation Cells were harvested as described above and lysates were normalized to 1 mg/ml total protein. Anti-phosphotyrosine (clone 4G10) immunoprecipitating antibody (4 mg; Upstate Lake Placid, NY, USA) was added to the cell lysate and incubated on a rotator at 41C overnight. Protein G agarose beads (Roche Diagnostics, Indianapolis, IN, USA) were added to capture the immunocomplex and incubated on a rotator at 41C for 2 h. The agarose beads were collected, washed once with ice-cold PBS, twice with 1
Tris-buffered saline–0.25 M sodium chloride and resuspended in 5
sample buffer. Beads were heated at 1001C for 5 min, centrifuged and the supernatant was subjected to SDS–PAGE and transfer. Membranes were incubated with antibodies against c-Kit, c-Abl, PDGFR-a or PDGFR-b (1:100; all Santa Cruz), followed by HRPconjugated secondary antibody as described above. Statistics Quantitative values are represented as the mean of at least three experiments. All in vivo experiments were repeated at least three times, and at least five mice were used in each experiment. The statistical significance of the difference between groups was determined by the Wilcoxon rank sum test. Comparisons resulting in P-values less than 0.05 were considered statistically significant and identified in the figures with an asterisk (*). Acknowledgements We thank Dr Barbara Vonderhaar and Dr Gilbert H Smith for their critical review of the manuscript. We specially thank Novartis Pharmaceuticals for providing Gleevec. References Allenspach EJ, Maillard I, Aster JC, Pear WS. (2002). Notch signaling in cancer. Cancer Biol Ther 1: 466–476. Ball RK, Friis RR, Schoenenberger CA, Doppler W, Groner B. (1988). Prolactin regulation of beta-casein gene expression and of a cytosolic 120-kDa protein in a cloned mouse mammary epithelial cell line. EMBO J 7: 2089–2095. Basciani S, Brama M, Mariani S, De Luca G, Arizzi M, Vesci L et al. (2005). Imatinib mesylate inhibits Leydig cell tumor growth: evidence for in vitro and in vivo activity. Cancer Res 65: 1897–1903. Besmer P, Murphy JE, George PC, Qiu FH, Bergold PJ, Lederman L et al. (1986). A new acute transforming feline retrovirus and relationship of its oncogene v-kit with the protein kinase gene family. Nature 320: 415–421. Betsholtz C. (2003). Biology of platelet-derived growth factors in development. Birth Defects Res C Embryo Today 69: 272–285. Oncogene Callahan R, Raafat A. (2001). Notch signaling in mammary gland tumorigenesis. J Mammary Gland Biol Neoplasia 6: 23–36. Carvalho I, Milanezi F, Martins A, Reis RM, Schmitt F. (2005). Overexpression of platelet-derived growth factor receptor alpha in breast cancer is associated with tumour progression. Breast Cancer Res 7: R788–R795. Chiaramonte R, Basile A, Tassi E, Calzavara E, Cecchinato V, Rossi V et al. (2005). A wide role for NOTCH1 signaling in acute leukemia. Cancer Lett 219: 113–120. Cortes J, O’Brien S, Kantarjian H. (2004). Discontinuation of imatinib therapy after achieving a molecular response. Blood 104: 2204–2205. Dang TP, Eichenberger S, Gonzalez A, Olson S, Carbone DP. (2003). Constitutive activation of Notch3 inhibits terminal epithelial differentiation in lungs of transgenic mice. Oncogene 22: 1988–1997. Kit and PDGFR-a in Notch4/Int3-induced tumorigenesis A Raafat et al 671 Dang TP, Gazdar AF, Virmani AK, Sepetavec T, Hande KR, Minna JD et al. (2000). Chromosome 19 translocation, overexpression of Notch3, and human lung cancer. J Natl Cancer Inst 92: 1355–1357. Das AV, James J, Zhao X, Rahnenfuhrer J, Ahmad I. (2004). Identification of c-Kit receptor as a regulator of adult neural stem cells in the mammalian eye: interactions with Notch signaling. Dev Biol 273: 87–105. de Jong JS, van Diest PJ, van der Valk P, Baak JP. (1998). Expression of growth factors, growth inhibiting factors, and their receptors in invasive breast cancer. I: an inventory in search of autocrine and paracrine loops. J Pathol 184: 44–52. Diallo R, Rody A, Jackisch C, Ting E, Schaefer KL, Kissler S et al. (2006). C-KIT expression in ductal carcinoma in situ of the breast: co-expression with HER-2/neu. Hum Pathol 37: 205–211. Dievart A, Beaulieu N, Jolicoeur P. (1999). Involvement of Notch1 in the development of mouse mammary tumors. Oncogene 18: 5973–5981. Dontu G, Jackson KW, McNicholas E, Kawamura MJ, Abdallah WM, Wicha MS. (2004). Role of Notch signaling in cell-fate determination of human mammary stem/progenitor cells. Breast Cancer Res 6: R605–R615. Gallahan D, Callahan R. (1997). The mouse mammary tumor associated gene INT3 is a unique member of the NOTCH gene family (NOTCH4). Oncogene 14: 1883–1890. Gallahan D, Jhappan C, Robinson G, Hennighausen L, Sharp R, Kordon E et al. (1996). Expression of a truncated Int3 gene in developing secretory mammary epithelium specifically retards lobular differentiation resulting in tumorigenesis. Cancer Res 56: 1775–1785. Gallahan D, Kozak C, Callahan R. (1987). A new common integration region (int-3) for mouse mammary tumor virus on mouse chromosome 17. J Virol 61: 218–220. Ghatak S, Misra S, Toole BP. (2002). Hyaluronan oligosaccharides inhibit anchorage-independent growth of tumor cells by suppressing the phosphoinositide 3-kinase/Akt cell survival pathway. J Biol Chem 277: 38013–38020. Heinrich MC, Corless CL, Duensing A, McGreevey L, Chen CJ, Joseph N et al. (2003). PDGFRA activating mutations in gastrointestinal stromal tumors. Science 299: 708–710. Hwang RF, Yokoi K, Bucana CD, Tsan R, Killion JJ, Evans DB et al. (2003). Inhibition of platelet-derived growth factor receptor phosphorylation by STI571 (Gleevec) reduces growth and metastasis of human pancreatic carcinoma in an orthotopic nude mouse model. Clin Cancer Res 9: 6534–6544. Imatani A, Callahan R. (2000). Identification of a novel NOTCH-4/INT-3 RNA species encoding an activated gene product in certain human tumor cell lines. Oncogene 19: 223–231. Jeffries S, Capobianco AJ. (2000). Neoplastic transformation by Notch requires nuclear localization. Mol Cell Biol 20: 3928–3941. Jhappan C, Gallahan D, Stahle C, Chu E, Smith GH, Merlino G et al. (1992). Expression of an activated Notch-related int3 transgene interferes with cell differentiation and induces neoplastic transformation in mammary and salivary glands. Genes Dev 6: 345–355. Kim MK, Higgins J, Cho EY, Ko YH, Oh YL. (2000). Expression of CD34, bcl-2, and kit in inflammatory fibroid polyps of the gastrointestinal tract. Appl Immunohistochem Mol Morphol 8: 147–153. Lasota J, Jasinski M, Sarlomo-Rikala M, Miettinen M. (1999). Mutations in exon 11 of c-Kit occur preferentially in malignant versus benign gastrointestinal stromal tumors and do not occur in leiomyomas or leiomyosarcomas. Am J Pathol 154: 53–60. le Coutre P, Mologni L, Cleris L, Marchesi E, Buchdunger E, Giardini R et al. (1999). In vivo eradication of human BCR/ ABL-positive leukemia cells with an ABL kinase inhibitor. J Natl Cancer Inst 91: 163–168. Leveen P, Pekny M, Gebre-Medhin S, Swolin B, Larsson E, Betsholtz C. (1994). Mice deficient for PDGF B show renal, cardiovascular, and hematological abnormalities. Genes Dev 8: 1875–1887. Marley SB, Gordon MY. (2005). Chronic myeloid leukaemia: stem cell derived but progenitor cell driven. Clin Sci (London) 109: 13–25. Matsui J, Wakabayashi T, Asada M, Yoshimatsu K, Okada M. (2004). Stem cell factor/c-kit signaling promotes the survival, migration, and capillary tube formation of human umbilical vein endothelial cells. J Biol Chem 279: 18600–18607. Noseda M, McLean G, Niessen K, Chang L, Pollet I, Montpetit R et al. (2004). Notch activation results in phenotypic and functional changes consistent with endothelial-to-mesenchymal transformation. Circ Res 94: 910–917. Pear WS, Aster JC. (2004). T cell acute lymphoblastic leukemia/lymphoma: a human cancer commonly associated with aberrant NOTCH1 signaling. Curr Opin Hematol 11: 426–433. Raafat A, Bargo S, Anver MR, Callahan R. (2004). Mammary development and tumorigenesis in mice expressing a truncated human Notch4/Int3 intracellular domain (hInt3sh). Oncogene 23: 9401–9407. Ramalho-Santos M, Yoon S, Matsuzaki Y, Mulligan RC, Melton DA. (2002). ‘Stemness’: transcriptional profiling of embryonic and adult stem cells. Science 298: 597–600. Reedijk M, Odorcic S, Chang L, Zhang H, Miller N, McCready DR et al. (2005). High-level coexpression of JAG1 and NOTCH1 is observed in human breast cancer and is associated with poor overall survival. Cancer Res 65: 8530–8537. Robbins J, Blondel BJ, Gallahan D, Callahan R. (1992). Mouse mammary tumor gene int-3: a member of the notch gene family transforms mammary epithelial cells. J Virol 66: 2594–2599. Smith GH, Gallahan D, Diella F, Jhappan C, Merlino G, Callahan R. (1995). Constitutive expression of a truncated INT3 gene in mouse mammary epithelium impairs differentiation and functional development. Cell Growth Differ 6: 563–577. Soriano P. (1994). Abnormal kidney development and hematological disorders in PDGF beta-receptor mutant mice. Genes Dev 8: 1888–1896. Taniguchi M, Nishida T, Hirota S, Isozaki K, Ito T, Nomura T et al. (1999). Effect of c-kit mutation on prognosis of gastrointestinal stromal tumors. Cancer Res 59: 4297–4300. Tsuda H, Morita D, Kimura M, Shinto E, Ohtsuka Y, Matsubara O et al. (2005a). Correlation of KIT and EGFR overexpression with invasive ductal breast carcinoma of the solid-tubular subtype, nuclear grade 3, and mesenchymal or myoepithelial differentiation. Cancer Sci 96: 48–53. Tsuda H, Tani Y, Weisenberger J, Kitada S, Hasegawa T, Murata T et al. (2005b). Frequent KIT and epidermal growth factor receptor overexpressions in undifferentiatedtype breast carcinomas with ‘stem-cell-like’ features. Cancer Sci 96: 333–339. Uehara H, Kim SJ, Karashima T, Shepherd DL, Fan D, Tsan R et al. (2003). Effects of blocking platelet-derived growth factor-receptor signaling in a mouse model of experimental Oncogene Kit and PDGFR-a in Notch4/Int3-induced tumorigenesis A Raafat et al 672 prostate cancer bone metastases. J Natl Cancer Inst 95: 458–470. Ulivi P, Zoli W, Medri L, Amadori D, Saragoni L, Barbanti F et al. (2004). c-kit and SCF expression in normal and tumor breast tissue. Breast Cancer Res Treat 83: 33–42. Wang D, Huang HJ, Kazlauskas A, Cavenee WK. (1999). Induction of vascular endothelial growth factor expression Oncogene in endothelial cells by platelet-derived growth factor through the activation of phosphatidylinositol 3-kinase. Cancer Res 59: 1464–1472. Weijzen S, Rizzo P, Braid M, Vaishnav R, Jonkheer SM, Zlobin A et al. (2002). Activation of Notch-1 signaling maintains the neoplastic phenotype in human Ras-transformed cells. Nat Med 8: 979–986.