Saudi Journal of Biological Sciences (2014) xxx, xxxxxx

King Saud University

Saudi Journal of Biological Sciences

www.ksu.edu.sa
www.sciencedirect.com

ORIGINAL ARTICLE

Development of Cotton leaf curl virus resistant

transgenic cotton using antisense C1 gene
Sayed Sartaj Sohrab a,*, Mohammad A. Kamal a, Abdul Ilah c, Azamal Husen d,
P.S. Bhattacharya b, D. Rana b
a

King Fahd Medical Research Center, King Abdulaziz University, Post Box No. 80216, Jeddah 21589, Saudi Arabia
Division of Biotechnology, JK-AgriGenetics Ltd., Hyderabad, A.P., India
c
Faculty of Medical Technology, Omar Al Mukhtar University, Tobruk, Libya
d
Department of Biology, College of Natural and Computational Sciences, University of Gondar, Post Box No. 196, Gondar, Ethiopia
b

Received 4 November 2014; revised 10 November 2014; accepted 10 November 2014

KEYWORDS
Transgenic cotton plants;
CLCuV resistance;
Gene transfer;
Molecular verication;
Virus resistance

Abstract Cotton leaf curl virus (CLCuV) is a serious pathogen causing leaf curl disease and affecting the cotton production in major growing areas. The transgenic cotton (Gossypium hirsutum cv.
Coker 310) plants were developed by using bC1 gene in antisense orientation gene driven by
Cauliower mosaic virus-35S promoter and nos (nopaline synthase) terminator and mediated by
Agrobacterium tumefaciens transformation and somatic embryogenesis system. Molecular conrmation of the transformants was carried out by polymerase chain reaction (PCR) and Southern blot
hybridization. The developed transgenic and inoculated plants remained symptomless till their
growth period. In conclusion, the plants were observed as resistant to CLCuV.
2014 The Authors. Production and hosting by Elsevier B.V. on behalf of King Saud University. This is an
open access article under the CC BY-NC-ND license (http://creativecommons.org/licenses/by-nc-nd/3.0/).

1. Introduction
Abbreviations: CLCuV, Cotton leaf curl virus; CP, coat protein; PCR,
polymerase chain reaction; PDR, pathogen derived resistance; MS,
Murashige and Skoogs; A. tumefaciens, Agrobacterium tumefaciens
* Corresponding author at: Special Infectious Agents Unit, King
Fahd Medical Research Center, King Abdulaziz University, Post Box
No. 80216, Jeddah 21589, Saudi Arabia. Tel.: +966 554627872, +966
64001000x73530; fax: +966 6952521.
E-mail addresses: ssohrab@kau.edu.sa, sohrab_sartaj2@rediffmail.
com (S.S. Sohrab).
Peer review under responsibility of King Saud University.

Cotton growth and productivity is severely reduced by various

types of stress. Therefore, adequate techniques and management is required to increase its productivity. Cotton leaf curl
virus (CLCuV) has emerged as a serious threat to cotton plants
by causing leaf curl disease and affecting cotton production by
making up to 80% loss in North India and Pakistan (Varma
and Malathi, 2003; Mansoor et al., 2003; Sattar et al., 2013).
Cotton leaf curl virus belongs to begomovirus group, family,
Geminivirideae. CLCuV possesses DNA-A and a satellite molecule known as b DNA. The b DNA has only one gene
(bC1gene). It acts as the pathogenicity, a suppressor of post
transcriptional gene silencing (Hammond et al., 2001) and

Production and hosting by Elsevier

http://dx.doi.org/10.1016/j.sjbs.2014.11.013
1319-562X 2014 The Authors. Production and hosting by Elsevier B.V. on behalf of King Saud University.
This is an open access article under the CC BY-NC-ND license (http://creativecommons.org/licenses/by-nc-nd/3.0/).
Please cite this article in press as: Sohrab, S.S. et al., Development of Cotton leaf curl virus resistant transgenic cotton using antisense C1 gene. Saudi Journal of
Biological Sciences (2014), http://dx.doi.org/10.1016/j.sjbs.2014.11.013

S.S. Sohrab et al.

modulates the level of microRNAs development (Qazi et al.,

2007; Saeed et al., 2005; Amin et al., 2011a,b).
Virus resistant plants can be developed by using pathogen
derived resistance (PDR). PDR based on cross protection and
antisense approach has long been employed in the management
of viral diseases in plants. In case of begomoviruses, expression
of viral coat protein (CP), replicase and movement proteins has
been proved to be more promising (Yang et al., 2004). The CP
mediated resistance has been successfully applied to numerous
crop species (Prins, 2003; Pang et al., 2000).
Currently, various new technologies are being used like
antisense RNA, RNAi, siRNA, miRNA to develop transgenic
plants for virus resistance (Agrawal et al., 2003; Shelly et al.,
2005; Brodersen et al., 2008; Prins et al., 2008; Ai et al.,
2011; Vu et al., 2012; Ali et al., 2013). A number of CLCuV
genome and b DNA fragments can be exploited to repress
the expression of viral genes. The development of CLCuV
transgenic with rep gene using A. Tumefaciens mediated transformation has been reported earlier by 0.3% of transformation
frequency (Balasubramani et al., 2003; Katageri et al., 2007;
Amudha et al., 2011; Hashmi et al., 2011). Recently, transgenic
tobacco resistant to Cotton leaf curl Burewala virus has been
developed by using articial microRNA technology (Ali
et al., 2013). Various explants like hypocotyl, shoot apex and
cotyledons of cotton were inoculated with a suspension of A.
tumefaciens and differentiated somatic embryos, which eventually germinated and developed into mature plants (Kumar and
Tuli 2004; Tenllado et al., 2004; Amudha et al., 2011). The
present study was designed for the development of transgenic
cotton plant resistant to CLCuV through expression of antisense bC1genes by A. tumefaciens mediated transformation
using a standardized protocol for rapid genotype-independent
transformation and regeneration (Kumar and Tuli, 2004). A.
tumefaciens mediated transformation protocol has been
reported for Indian varieties using shoot tips as explants. In
this study, the developed cotton plants showed better resistance against CLCuV as compared to non transgenic plants.

The hypocotyl explants were co-cultivated with bacterial culture prepared in Agrobacterium minimal medium supplemented with 100 lM Acetosyringone. Half-MS medium and
Cefotaxime (300 mg/ml) was used for washing of co-cultivated
explants and further cultured on MS medium containing
growth hormone 2,4-D (0.5 mg/l) and BAP (0.1 mg/l). After
4 weeks, the explants were further sub-cultured on MS medium for somatic embryo induction till 6 weeks. The resistant
somatic embryos were sub-cultured in a MS medium for elongation. The elongated somatic embryos were cultured on MS
with BAP and GA3 medium for germination. The germinated
seedling were hardened well and transferred to bigger pots and
nally shifted to greenhouse under natural condition.

2. Materials and methods

2.5. Screening for transformed plants using PCR

2.1. Cotton seed material

Cotton (Gossypium hirsutum L.) cv. Coker 312 seeds were
washed with tap and double distilled water. The seeds were
sterilized with HgCl2 (0.1%) followed by rinsing with sterile
water. The seeds were inoculated in 1/2 MS medium (Murashighe and Skoogs) and incubated for 2 weeks at 16 h photo period, 28 C temperature for germination on culture racks.

2.2. Callus induction and somatic embryo proliferation

The hypocotyls were excised from germinated cotton seedlings
and used as explants. The callus induction and somatic embryo
proliferation were obtained after culturing on modied MS
medium (Kumar and Tuli, 2004).
2.3. Bacterial strain and vector
The bC1gene was amplied by PCR and cloned into pGEMTEasy vector in antisense orientation. The resulting clones were
sequenced and further sub-cloned into binary vector-PBI 121
and electroporation was used to mobilize into A. Tumefaciens
(strain LBA 4404). The conrmation of correct clones were
done by colony PCR and sequencing. Bacterial culture was
maintained on luria broth medium containing kanamycin
(50 mg/l) and Rifampicin (25 mg/l). The Agrobacterium culture was developed by inoculating and overnight culture of a
single colony in the Agrobacterium minimal medium. The
design of gene construct is presented in Fig. 1.
2.4. Cotton transformation

DNeasy plant mini kit (Qiagen) was used to isolate DNA from
newly emerged cotton leaves. The template DNA was used for
PCR amplication with bC1gene (antisense) primer F-T
CACCATCGCTAATCAAGTATG and R-CATTGCTGGT
TTGTGTTTGGAA. The PCR reaction was performed in a
mixture, containing 1.0 ll DNA (50 ng) 2.0 ll buffer (10),
2.0 ll dNTPs (10 Mm), 0.5 ll of 100 ng forward and reverse
primer, 0.5 ll of 2.5U Taq DNA polymerase. The following

Figure 1 Schematic representation of the binary vector pBI 121 carrying full length of 35S CaMV promoter, NPTII, NOS promotor and
terminator and bC1 gene in antisense orientation. LB, Left border; RB, Right border.

Please cite this article in press as: Sohrab, S.S. et al., Development of Cotton leaf curl virus resistant transgenic cotton using antisense C1 gene. Saudi Journal of
Biological Sciences (2014), http://dx.doi.org/10.1016/j.sjbs.2014.11.013

Development of Cotton leaf curl virus resistant transgenic cotton using antisense C1 gene
PCR conditions of 94 C for 4 min, followed by 35 cycles of
94 C for 30 s, 58 C for 1 min, 72 C for 1 min followed by
extension for 5 min at 72 C was used. Southern blotting was
performed by using PCR amplied products. The blot was
hybridized with random labeled bC1gene with P32 dCTP probe
following the standard Southern hybridization protocol
(Sambrook et al., 1989).
2.6. Inoculation of whiteies
The virus inoculation was done by using whitey (Bemisia tabaci) on individually raised cotton seedlings. Healthy whiteies
were reared and maintained on tobacco plants under insect
proof greenhouse. The acquisition access was given for 24 h
on infected cotton plants and thereafter a group of 1520
whiteies were released to putative transgenic cotton plants
and after 2 days, the whiteies were killed by insecticide spraying. The developed plants were further tested at T2 stage for
resistance in the greenhouse and natural eld. The inoculated
plants were kept under observation till their growth period
for symptom development. The virus infection was conrmed
by PCR in both transgenic and non transgenic plants (data not
shown).

3. Results and discussion

3.1. Cotton transformation and regeneration
A total of 2346 hypocotyl explants were co-cultivated with
Agrobacterium culture in 4 independent experiments and 475
transformed explants were further selected by using kanamycin
100 mg/l. The callus formation was observed after 20 days culture on callus induction medium. The embryogenic callus was
observed after 34 subculture and embryo formation were
observed just after ve sub-cultures. The developed embryos
were germinated elongated in the elongation medium. After
two weeks proper root formation took place upon culture in
the rooting medium. Total, nineteen PCR positive cotton
plants were regenerated from transformed tissue and hardened
into big pots (Fig. 2, Table 1).
3.2. Molecular conrmation of transformants
The developed plants were shifted to bigger pots and maintained under greenhouse. The presence of bC1gene was conrmed by PCR amplication of developed plants (Fig. 3).

Figure 2 Stage of transformed cotton regeneration and plant development. (A) Hypocotyls. (B) Somatic embryos. (C) Emerged cotton
plants. (D) Elongated plants. (E) Rooted plants. (F) Hardened cotton plant.

Table 1

Number of hypocotyls (Coker 312) used and plants developed.

S. No.

Number of experiments

Gene constructs used

Total No. of explants used

Total number of plants developed

(PCR positive)

1
2
3
4
Total

1
2
3
4

bC1gene
bC1gene
bC1gene
bC1gene

580
576
598
592
2346

5
2
6
6
19

Please cite this article in press as: Sohrab, S.S. et al., Development of Cotton leaf curl virus resistant transgenic cotton using antisense C1 gene. Saudi Journal of
Biological Sciences (2014), http://dx.doi.org/10.1016/j.sjbs.2014.11.013

S.S. Sohrab et al.

Figure 3 Electrophoretic analysis of putative cotton transgenic showing PCR amplication of bC1 gene using specic primers. Lane 1
19. Putative plants; M: 1 kb ladder.

Figure 4 Southern blot analysis of transgenic cotton plants.

Lane 13; Independent transgenic cotton lines Lane 4; Nontransformed cotton. 5: Positive control (Cloned DNA).

The Southern blot results conrm the gene integration in

developed transgenic plants (Fig. 4).

virus (Aragao et al., 2013). Cotton transgenic has been developed earlier by using antisense movement protein gene an
Indian variety (F846) and was observed to be resistant against
cotton leaf curl disease (Sanjaya et al., 2005). The genetic
transformation and regeneration of cotton (G. hirsutum cv.
Coker 310) plants have been developed earlier by using
somatic embryogenesis (Chaudhary et al., 2004; Kumar and
Tuli 2004). However, in our study, the bC1gene has been used
to transform the hypocotyls of cotton (Coker 312). The developed plants were conrmed by PCR and Southern blot hybridization. Southern blot hybridization is the excellent techniques
to determine the virus load in the plant tissue and has a direct
correlation with disease resistance (Taylor et al., 2004). The
developed cotton lines showed a variable resistance pattern
against Cotton leaf curl virus after inoculation, not only in
the greenhouse, but also in open eld conditions. It is observed
that the level of virus accumulation in transgenic plants was
low as it produced delayed or less severe symptoms. Finally,
we were able to select some resistant plants with signicant
or delayed symptom appearance. The developed plants have
single copy integration in the cotton genome and their inheritance pattern showed the stable integration, but their stability
will be further evaluated in the breeding program.

3.3. Whitey screening and evaluation of resistance

Conict of interest
Resistance evaluation was done for individual plants by inoculation with Cotton leaf curl virus by a whiteies vector (B. tabaci). After whitees inoculation, leaf curling was observed in
non transgenic plants. All T1 plants showed 6070% resistance
as compared to control. The few lines remained free from symptoms throughout the growth period. Based on the resistance,
three plants were nally selected showed good resistance.
We found that entire bC1gene integrated with antisense orientation in susceptible cotton plants were very much promising
to combat viral infection in outdoor condition. Similar report
showed that begomovirus gene has been utilized for developing
pathogen derived resistance against plant disease which
involved the use of entire, partial, sense, antisense, truncated
viral genomes or articial microRNA (Yang et al., 2004;
Shelly et al., 2005; Amudha et al., 2011; Hashmi et al., 2011;
Ali et al., 2013). Numerous models have been proposed for
the gene silencing induction and operation associated with
antisense, MicroRNA, SiRNA and RNAi strategies (Meister
and Tusch, 2004; Brodersen et al., 2008; Ali et al., 2013).
The antisense approach has also been utilized, based on
homology dependent for development of resistant transgenic
plants against Tomato yellow leaf curl virus resistance (Yang
et al., 2004), Tomato leaf curl virus (Praveen et al., 2005), Cotton leaf curl virus (Asad et al., 2003) and Bean golden mosaic

The authors conrm that there is no conict of interest for the

information presented in this manuscript.
Acknowledgements
Authors extend their thanks to Mr. S.K. Gupta (CEO, JK
AgriGenetics Ltd. Hyderabad, India) for providing funds, necessary facilities, guidance, valuable suggestions and continuous
encouragement.
References
Agrawal, N., Dasaradhi, P.V.N., Mohmmed, A., Malhotra, P.,
Bhatnagar, R.K., Mukherjee, S.K., 2003. RNA interference:
biology, mechanism, and applications. Microbiol. Mol. Biol. Rev.
67, 657685.
Ai, T., Zhang, L., Gao, Z., Zhu, C.X., Guo, X., 2011. Highly efcient
virus resistance mediated by articial microRNAs that target the
suppressor of PVX and PVY in plants. Plant Biol. 13, 304316.
Ali, I., Imran, A., Briddon, R.W., Mansoor, S., 2013. Articial
microRNA-mediated resistance against the monopartite begomovirus Cotton leaf curl Burewala virus. Virol. J. 10, 231.
Amin, I., Hussain, K., Akbergenov, R., Yadav, J.S., Qazi, J.,
Mansoor, S., Hohn, T., Fauquet, C.M., Briddon, R.W., 2011a.

Please cite this article in press as: Sohrab, S.S. et al., Development of Cotton leaf curl virus resistant transgenic cotton using antisense C1 gene. Saudi Journal of
Biological Sciences (2014), http://dx.doi.org/10.1016/j.sjbs.2014.11.013

Development of Cotton leaf curl virus resistant transgenic cotton using antisense C1 gene
Suppressors of RNA silencing encoded by the components of the
cotton leaf curl begomovirus-beta satellite complex. Mol. Plant
Microbe Interact. 24, 973983.
Amin, I., Patil, B.L., Briddon, R.W., Mansoor, S., Fauquet, C.M.,
2011b. Comparison of phenotypes produced in response to
transient expression of genes encoded by four distinct begomoviruses in Nicotiana benthamiana and their correlation with the levels
of developmental miRNAs. Virol. J. 8, 238.
Amudha, J., Balasubramani, G., Malathi, V.G., Monga, D., Kranthi,
K,R., 2011. Cotton leaf curl virus resistance transgenic with the
antisense coat protein gene (AV1). Curr. Sci. 101, 300307.
Aragao, F.J., Nogueira, E.O., Tinoco, M.L., Faria, J.C., 2013.
Molecular characterization of the rst commercial transgenic
common bean immune to the Bean golden mosaic virus. J.
Biotechnol. 166 (12), 4250.
Asad, S., Haris, W.A.A., Bashir, A., Zafar, Y., Malik, K.A.A., Malik,
N.N., Lichtenstein, C.P., 2003. Transgenic tobacco expressing
Gemini viral RNAs are resistant to the serious viral pathogen
causing cotton leaf curl disease. Arch. Virol. 148, 23412352.
Balasubramani, G., Amudha, J., Mayer, C.D., 2003. Agrobacterium
mediated transformation and regeneration by direct shoot organogenesis in cotton (G. hirsutum). Cotton Sci. 1, 5158.
Brodersen, P., Sakvarelidze-Achard, L., Bruun-Rasmussen, M.,
Dunoyer, P., Yamamoto, Y.Y., Sieburth, L., Voinnet, O., 2008.
Widespread translational inhibition by plant miRNAs and siRNAs. Science 320, 11851190.
Chaudhary, B., Kumar, S., Prasad, K.V.S.K., Oinam, G.S., Burma,
B.K., Pental, D., 2004. Slow desiccation leads to high frequency
shoot recovery from transformed somatic embryos of cotton
(Gossypium hirsutum L. cv. Coker 310 FR). Plant Cell Rep. 21,
955960.
Hammond, S.M., Caudy, A.A., Hannon, G.J., 2001. Posttranscriptional gene silencing by double-stranded RNA. Nat. Rev. Genet. 2,
110119.
Hashmi, J.A., Zafar, Y., Arshad, M., Mansoor, S., Asad, S., 2011.
Engineering cotton (Gossypium hirsutum L.) for resistance to
cotton leaf curl disease using viral truncated AC1 DNA sequences.
Virus Genes 42, 286296.
Katageri, I.S., Vamadevaiah, H.M., Udikeri, S.S., Khadi, B.M.,
Polumetla, A.K., 2007. Genetic transformation of an elite Indian
genotype of cotton (Gossypium hirsutum L.) for insect resistance.
Curr. Sci. 93, 1225.
Kumar, M., Tuli, R., 2004. Plant regeneration in cotton: a short-term
inositol starvation promotes developmental synchrony in somatic
embryogenesis. In Vitro Cell. Dev. Biol. Plant 40, 294298.
Mansoor, S., Briddon, R.W., Zafar, Y., Stanley, J., 2003. Geminivirus
disease complexes: an emerging threat. Trends Plant Sci. 8, 128
134.
Meister, G., Tusch, T., 2004. Mechanisms of gene silencing by doublestranded RNA. Nature 431, 343349.
Pang, S.Z., Jan, F.J., Tricoli, D.M., Russell, P.F., Carney, K.J., John,
S., Hu, J.S., Fuchs, M., Quemada, H.D., Gonsalves, D., 2000.

Resistance to Squash mosaic comovirus in transgenic plants

expressing its coat protein genes. Mol. Breed 6, 8793.
Praveen, S., Kushwaha, C.M., Mishra, A.K., Singh, V., Jain, R.K.,
Varma, A., 2005. Engineering tomato for resistance to tomato leaf
curl disease using viral rep gene sequences. Plant Cell Tissue Organ
Cult. 83, 311318.
Prins, M., 2003. Broad virus resistance in transgenic plants. Trends
Biotechnol. 21, 373375.
Prins, M., Laimer, M., Noris, E., Schubert, J., Wassenegger, M.,
Tepfer, M., 2008. Strategies for antiviral resistance in transgenic
plants. Mol. Plant Pathol. 9, 7383.
Qazi, J., Amin, I., Mansoor, S., Iqbal, M.J., Briddon, R.W., 2007.
Contribution of the satellite encoded gene betaC1 to cotton leaf
curl disease symptoms. Virus Res. 128, 135139.
Saeed, M., Behjatnia, S.A.A., Mansoor, S., Zafar, Y., Hasnain, S.,
Rezaian, M.A., 2005. A single complementary-sense transcript of a
geminiviral DNA b satellite is determinant of pathogenicity. Mol.
Plant Microbe Interact. 18, 714.
Sambrook, J., Fritsch, E.F., Maniatis, T., 1989. Molecular Cloning
A Laboratory Manual. Cold Spring Harbour Laboratory, New
York, USA.
Satyavathi, V.V., Prasad, V., Kirthi, N., Maiya, S.P., Savithri, H.S.,
Sita, G.L., 2005. Development of cotton transgenics with anti-sense
AV2 gene for resistance against cotton leaf curl virus (CLCuD) via
Agrobacterium tumefaciens. Plant Cell Tissue Organ Cult. 81, 55
63.
Sattar, M.N., Kvarnheden, A., Saeed, M., Briddon, R.W., 2013.
Cotton leaf curl diseasean emerging threat to cotton production
worldwide. J. Gen. Virol. 94, 695710.
Shelly, P., Kushwaha, C.M., Mishra, A.K., Singh, V., Jain, R.K.,
Varma, A., 2005. Engineering tomato for resistance to tomato leaf
curl disease using viral rep gene sequences. Plant Cell Tissue Organ
Cult. 83, 311318.
Taylor, N., Chavariaga, P., Raemakers, K., Siritunga, D., Zhang, P.,
2004. Development and application of transgenic technologies in
cassava. Plant Mol. Biol. 56, 671688.
Tenllado, F., Llave, C., Diaz-Ruiz, J.R., 2004. RNA interference
(RNAi) as a new biotechnological tool for the control of virus
diseases in plants. Virus Res. 102, 8596.
Varma, A., Malathi, V.G., 2003. Emerging geminiviruses problems: a
serious threat to crop production. Ann. Appl. Biol. 142, 145164.
Vu, T.V., Choudhury, N.R., Mukherjee, S.M., 2012. Transgenic
tomato plants expressing articial microRNAs for silencing the
pre-coat and coat proteins of a begomovirus, Tomato leaf curl New
Delhi virus, show tolerance to virus infection. Virus Res. 172, 35
45.
Yang, Y., Sherwood, T.A., Patte, C.P., Hiebert, E., Poiston, J.E.,
2004. Use of Tomato yellow leaf curl virus (TYLCV) Rep gene
sequence to engineer TYLCV resistance in tomato. Phytopathology
94, 490496.

Please cite this article in press as: Sohrab, S.S. et al., Development of Cotton leaf curl virus resistant transgenic cotton using antisense C1 gene. Saudi Journal of
Biological Sciences (2014), http://dx.doi.org/10.1016/j.sjbs.2014.11.013