Q1. The diagram shows a short sequence of DNA bases.

TTTGTATACTAGTCTACTTCGTTAATA
(a) (i) What is the maximum number of amino acids for which this sequence of DNA
bases could code?

(1)

(ii) The number of amino acids coded for could be fewer than your answer to part
(a)(i).

Give one reason why.

.............................................................................................................

.............................................................................................................
(1)

(b) Explain how a change in the DNA base sequence for a protein may result in a change
in the structure of the protein.

......................................................................................................................

......................................................................................................................

......................................................................................................................

......................................................................................................................

......................................................................................................................

......................................................................................................................

(Extra space) ................................................................................................

......................................................................................................................

......................................................................................................................
(3)

Page 1
 (c) A piece of DNA consisted of 74 base pairs. The two strands of the DNA, strands A
and B, were analysed to find the number of bases of each type that were present.
Some of the results are shown in the table.

Number of bases

C G A T

Strand A 26

Strand B 19 9

Complete the table by writing in the missing values.

(2)
(Total 7 marks)

Q2. Figure 1 shows a short section of a DNA molecule.

Figure 1

(a) Name parts R and Q.

(i) R ....................................................

(ii) Q ....................................................
(2)

Page 2
(b) Name the bonds that join A and B.

......................................................................................................................
(1)

(c) Ribonuclease is an enzyme. It is 127 amino acids long.

What is the minimum number of DNA bases needed to code for ribonuclease?

(1)

(d) Figure 2 shows the sequence of DNA bases coding for seven amino acids in the
enzyme ribonuclease.

Figure 2

G T T T A C T A C T C T T C T T C T T T A

The number of each type of amino acid coded for by this sequence of DNA bases is
shown in the table.

Amino acid Number present

Arg 3

Met 2

Gln 1

Asn 1

Use the table and Figure 2 to work out the sequence of amino acids in this part of the
enzyme. Write your answer in the boxes below.

Gln

(1)

Page 3
 (e) Explain how a change in a sequence of DNA bases could result in a non-functional
enzyme.

......................................................................................................................

......................................................................................................................

......................................................................................................................

......................................................................................................................
(3)
(Total 8 marks)

Q3. (a) The diagram shows part of a DNA molecule. In the space below, draw a similar
diagram to show this part of the molecule after it has replicated.
Label the original strands and the new strands.

(b) Biologists found the mean mass of DNA in three different types of cells from different
animals. Their results are shown in the table.

Mass of DNA in nucleus/picograms

Animal
Liver cell Blood cell Sperm cell

Chicken 2.53 2.51 1.26

Goldfish 3.29 3.28 1.64

Trout 5.79 5.78 2.89

Toad 7.33 7.31 3.68

(i) What would you expect to be the mean mass of DNA in a skin cell from a toad?
Explain your answer.

.............................................................................................................

.............................................................................................................

.............................................................................................................

.............................................................................................................
(2)

Page 4
 (ii) A zygote is formed when a sperm cell fertilises an egg cell. How much DNA
would you expect to find in a trout zygote that had just been formed? Explain
your answer.

.............................................................................................................

.............................................................................................................

.............................................................................................................

.............................................................................................................
(2)
(Total 6 marks)

Q4. The diagram shows part of a DNA molecule.

(a) Name the two components of the part of the DNA molecule labelled M.

1 ...................................................................................................................

2 ...................................................................................................................
(2)

(b) What is the maximum number of amino acids for which this piece of DNA could code?

(1)

Page 5
(c) Scientists calculated the percentage of different bases in the DNA from a species of
bacterium. They found that 14% of the bases were guanine.

(i) What percentage of the bases in this species of bacterium was cytosine?

Answer .......................................
(1)

(ii) What percentage of the bases in this species of bacterium was adenine?

Answer .......................................
(1)

(d) The scientists found that, in a second species of bacterium, 29% of the bases were
guanine.

Explain the difference in the percentage of guanine bases in the two species of
bacterium.

......................................................................................................................

......................................................................................................................

......................................................................................................................

......................................................................................................................
(2)
(Total 7 marks)

Page 6
Q5. (a) There are two forms of nitrogen. These different forms are called isotopes. 15N is
a heavier isotope than the normal isotope 14N.

In an investigation, a culture of bacteria was obtained in which all the nitrogen in the
DNA was of the 15N form. The bacteria (generation 0) were transferred to a medium
containing only the normal isotope, 14N, and allowed to divide once. A sample of these
bacteria (generation 1) was then removed. The DNA in the bacteria of generation 1
was extracted and spun in a high-speed centrifuge.

The bacteria in the 14N medium were allowed to divide one more time. The DNA was
also extracted from these bacteria (generation 2) and spun in a high speed centrifuge.

The diagram shows the results of this investigation.

(i) Which part of the DNA molecule contains nitrogen?

.............................................................................................................
(1)

(ii) Explain why the DNA from generation 1 is found in the position shown.

.............................................................................................................

.............................................................................................................

.............................................................................................................

.............................................................................................................
(2)

Page 7
 (iii) Complete the diagram to show the results for generation 2.
(2)

(b) The table shows the percentage of different bases in the DNA of different organisms.

Organism Adenine% Guanine% Thymine% Cytosine%

Human 19

Bacterium 24 26 24 26

Virus 25 24 33 18

(i) Complete the table to show the percentages of different bases in human DNA.
(2)

(ii) The structure of virus DNA is different from the DNA of the other two organisms.
Giving evidence from the table, suggest what this difference might be.

.............................................................................................................

.............................................................................................................

.............................................................................................................

.............................................................................................................
(2)
(Total 9 marks)

Page 8
M1. (a) (i) 9;
Accept: nine
1

(ii) Introns / non-coding DNA / junk DNA;

Start/stop code/triplet;
Neutral: Repeats.
Accept: ‘Introns and exons present’.
Reject: ‘Due to exons’.
1 max

(b) Change in amino acid/s /primary structure;

Change in hydrogen/ionic/ disulfide bonds;

Alters tertiary structure;

Reject: ‘Different amino acid is formed’ – negates first marking
point.
Neutral: Reference to active site.
3

(c) Number of bases

Number of bases

C G A T

Strand A 26 19 20 9

Strand B 19 26 9 20

Second column correct;

Columns three and four correct;

2
[7]

Page 9
M2. (a) (i) Deoxyribose;
pentose/5C sugar = neutral
1

(ii) Phosphate/Phosphoric acid;

phosphorus/P = neutral
1

(b) Hydrogen (bonds);

1

(c) 381/384/387;
1

(d) (Gln) Met Met Arg Arg Arg Asn;

1

(e) Change in (sequence of) amino acids/primary structure;

Change in hydrogen/ionic/disulfide bonds;

Alters tertiary structure/active site (of enzyme);

Substrate cannot bind/no enzyme-substrate complexes form;

Q Reject = different amino acids are formed
3 max
[8]

M3. (a) Diagram showing two identical molecules;

Each with one original and one new strand;
2

(b) (i) 7.31 – 7.36;

Same as liver cell/blood cell/twice sperm cell;
2

(ii) 5.78;
Sperm cell + egg cell, both with 2.89/twice sperm cell;
2
[6]

Page 10
M4. (a) Phosphate;

Deoxyribose;
Q Candidates must specify deoxyribose. This term is a
specification requirement.
Ignore anything that is not incorrect.
2

(b) 4;
1

(c) (i) 14;

1

(ii) 36;
If (c)(i) incorrect accept [50 – (c)(i)]
1

(d) Different proteins;

Different genes;

Different (DNA) base sequences;

2 max
[7]

M5. (a) (i) base / named bases;

reject nucleotide or uracil
1

(ii) it has been produced by semi-conservative

replication / one old strand and one new; one
strand has 15N bases and the other 14N;
Accept light/ heavy N (therefore) it is less dense / lighter;
2 max

(iii) one band is in same position as generation 1;

Page 11
 one band higher;
accept a line. N.B. need a visible gap
2

(b) (i) A = 31 and JT = 31;

C = 19;
2

(ii) viral DNA single-stranded / not double-stranded;

evidence from table e.g. not equal amount of A and T
/ C and G / all different;
2
ignore no base-pairing In this Question assume It’ means
viral DNA
[9]

Page 12