RESEARCH ARTICLE

Survival and development of potato psyllid

(Hemiptera: Triozidae) on Convolvulaceae:
Effects of a plant-fungus symbiosis
(Periglandula)
Navneet Kaur1,2*, William Rodney Cooper2, Jennifer M. Duringer3, Ismael E. Badillo-
Vargas4, Gabriela Esparza-Dı́az4¤, Arash Rashed1, David R. Horton2

1 Department of Entomology, Plant Pathology and Nematology, University of Idaho, Moscow, Idaho, United
States of America, 2 USDA-ARS, Temperate Tree Fruit and Vegetable Research Unit, Wapato, Washington,
a1111111111 United States of America, 3 Department of Environmental and Molecular Toxicology, Oregon State
a1111111111 University, Corvallis, Oregon, United States of America, 4 Department of Entomology, Texas A&M AgriLife
a1111111111 Research and Extension Center, Weslaco, Texas, United States of America
a1111111111
a1111111111 ¤ Current address: AmerStem Inc., Camarillo, California, United States of America
* Navneet.kaur2@ars.usda.gov

Abstract
OPEN ACCESS

Citation: Kaur N, Cooper WR, Duringer JM, Plant species in the family Solanaceae are the usual hosts of potato psyllid, Bactericera
Badillo-Vargas IE, Esparza-Dı́az G, Rashed A, et al. cockerelli (Šulc) (Hemiptera: Psylloidea: Triozidae). However, the psyllid has also been
(2018) Survival and development of potato psyllid shown to develop on some species of Convolvulaceae (bindweeds and morning glories).
(Hemiptera: Triozidae) on Convolvulaceae: Effects
Developmental success on Convolvulaceae is surprising given the rarity of psyllid species
of a plant-fungus symbiosis (Periglandula). PLoS
ONE 13(9): e0201506. https://doi.org/10.1371/ worldwide associated with this plant family. We assayed 14 species of Convolvulaceae
journal.pone.0201506 across four genera (Convolvulus, Calystegia, Ipomoea, Turbina) to identify species that
Editor: Sean Michael Prager, University of allow development of potato psyllid. Two populations of psyllids were assayed (Texas,
Saskatchewan College of Agriculture and Washington). The Texas population overlaps extensively with native Convolvulaceae,
Bioresources, CANADA whereas Washington State is noticeably lacking in Convolvulaceae. Results of assays were
Received: July 12, 2018 overlain on a phylogenetic analysis of plant species to examine whether Convolvulaceae
Accepted: August 29, 2018 distantly related to the typical host (potato) were less likely to allow development than spe-
cies of Convolvulaceae more closely related. Survival was independent of psyllid population
Published: September 11, 2018
and location of the plant species on our phylogenetic tree. We then examined whether pres-
Copyright: This is an open access article, free of all
ence of a fungal symbiont of Convolvulaceae (Periglandula spp.) affected psyllid survival.
copyright, and may be freely reproduced,
distributed, transmitted, modified, built upon, or These fungi associate with Convolvulaceae and produce a class of mycotoxins (ergot alka-
otherwise used by anyone for any lawful purpose. loids) that may confer protection against plant-feeding arthropods. Periglandula was found
The work is made available under the Creative in 11 of our 14 species, including in two genera (Convolvulus, Calystegia) not previously
Commons CC0 public domain dedication.
known to host the symbiont. Of these 11 species, leaf tissues from five contained large
Data Availability Statement: All relevant data are quantities of two classes of ergot alkaloids (clavines, amides of lysergic acid) when evalu-
within the paper and its Supporting Information
files.
ated by LC-MS/MS. All five species also harbored Periglandula. No ergot alkaloids were
detected in species free of the fungal symbiont. Potato psyllid rapidly died on the five spe-
Funding: This work was supported by the ARS
Federal-State Partnership Potato Research Grants
cies that harbored Periglandula and contained ergot alkaloids, but survived to adulthood on
program, the Northwest Potato Research seven of the nine species in which ergot alkaloids were not detected. These results support
Consortium, and USDA-NIFA-SCRI (#2015-51181-
24292) to DH. The funders had no role in study

PLOS ONE | https://doi.org/10.1371/journal.pone.0201506 September 11, 2018 1 / 19

 A plant mutualistic fungus, Periglandula species protecting Convolvulaceae from potato psyllid

design, data collection and analysis, decision to the hypothesis that a plant-fungus symbiotic relationship affects the suitability of certain
publish, or preparation of the manuscript. Convolvulaceae to potato psyllid.
Competing interests: The authors have declared
that no competing interests exist.

Introduction
The potato psyllid, Bactericera cockerelli (Šulc) (Hemiptera: Psylloidea: Triozidae) is a pest of
solanaceous crops such as potatoes, tomatoes, and peppers. The psyllid occurs throughout the
western and central United States, Canada, Mexico, and Central America [1], and as an intro-
duction in New Zealand and Australia [2, 3]. High densities of the psyllid may lead to plant
disorders known as “psyllid yellows” [4, 5] caused by a toxin that is injected into plants during
the psyllid’s feeding activities [6]. However, recent crop losses have been caused primarily by a
bacterial pathogen, ‘Candidatus Liberibacter solanacearum’ (Lso), that is transmitted by the
psyllid [1]. Difficulties in managing potato psyllid and its associated Liberibacter are in part
due to poor understanding of the role that non-crop species have in the biology of the vector.
Most species of psyllids are monophagous or oligophagous, limited to development on plants
within a single genus or family [7, 8]. Potato psyllid is unusual in being able to develop on
plants across more than a single family [9, 10, 11, 12]. Non-crop plant species act as reservoirs
of the insect during the growing season and may help the psyllid bridge intervals in which
crop hosts are unavailable [10, 13, 14, 15, 16, 17]. It is therefore important to know what non-
crop species of plants found in potato or tomato growing regions also support the reproduc-
tion and development of potato psyllid.
Although plant species in the family Solanaceae (Solanales) are the typical developmental
hosts for potato psyllid, at least some species in the Convolvulaceae (Solanales) also support
development [9, 10, 11, 12, 14, 18]. Observations leading to this conclusion include rearing tri-
als [9, 10, 11, 12] and field records [14, 18]. Developmental success on Convolvulaceae is unex-
pected given that Convolvulaceae is substantially underrepresented among plant families as
hosts of Psylloidea. Despite its extensive diversity and widespread distribution [19] Convolvu-
laceae is listed as a developmental host for only five species of psyllids worldwide, including
potato psyllid [20]. Rearing trials with potato psyllid have been limited to two species, Convol-
vulus arvensis L. (field bindweed) and Ipomoea batatas (L.) Lam. (sweet potato). While potato
psyllid is able to complete development on these species, development rates are slow and may
be accompanied by nymphal mortality [10, 12].
In this study, we examined the development of potato psyllid on species and genera of Con-
volvulaceae that have not previously been assayed. Our assays targeted species that are native
to North America and are thus likely to have an evolutionary history with at least some popula-
tions of potato psyllid. Our first objective was to assay a taxonomically broader group of Con-
volvulaceae than previously done, to determine whether plant suitability extends beyond Co.
arvensis and I. batatas. Part of this objective included a comparison of two haplotypes of the
psyllid on each plant species. Potato psyllid occurs as a minimum of four unique genetic types
or “haplotypes” [21, 22] that we now know differ biologically [23, 24, 25, 26, 27]. We compared
developmental success on Convolvulaceae between two of these haplotypes, the Central haplo-
type and the Northwestern haplotype. Convolvulaceae is highly diverse in the southern US
and Mexico [28] where its presence overlaps extensively with the distribution of the Central
haplotype [29]. In contrast, native Convolvulaceae are almost completely absent from the
Pacific Northwest region of the US [28] where the Northwestern haplotype of potato psyllid is
endemic [21, 22, 30]. Thus, the Northwestern haplotype is likely to have a much-reduced field
history with native Convolvulaceae in comparison to the Central haplotype.

PLOS ONE | https://doi.org/10.1371/journal.pone.0201506 September 11, 2018 2 / 19

 A plant mutualistic fungus, Periglandula species protecting Convolvulaceae from potato psyllid

Our second objective was to look for traits that predict whether a given plant species allows
psyllid development. We addressed two separate questions in this objective. First, we examined
whether suitability is predicted by the location of plant species within a phylogenetic tree.
Because of the strong tendency towards host specificity among species of Psylloidea, host
switching or dietary expansion by psyllids tends to be phylogenetically conserved [31] such
that evolutionary shifts in diets by psyllids are often between closely related plant species [8,
31, 32]. This specialism prompted us to examine whether plant suitability tracked plant phy-
logeny. We constructed a phylogenetic tree from DNA-sequence data to examine whether
plant species allowing successful development of potato psyllid clustered together in the tree,
as would be expected if plant chemistry or other traits affecting psyllid host use also grouped
phylogenetically [33].
We then examined whether psyllid development was affected by the presence of a plant-
fungus mutualism found in Convolvulaceae. The Convolvulaceae is unusual among dicotyle-
donous plant families in its association with a class of chemicals known as ergot alkaloids [34].
Many species of Convolvulaceae have formed a symbiotic association with clavicipitaceous
fungi in the genus Periglandula [35, 36, 37, 38]. This fungus is vertically transmitted, and is
present systemically in members of the family Convolvulaceae [39] often forming epiphytic
colonies surrounding peltate glandular trichomes on the adaxial leaf surfaces [35, 40] where
the colonies produce ergot alkaloids [41]. This symbiosis appears to be most common in Ipo-
moea and related genera, with possibly 450 or more plant species worldwide having the associ-
ation [34, 42]. Similar alkaloids produced by clavicipitaceous fungi in grasses have been shown
to have deleterious effects against herbivorous insects [43, 44, 45]. The defensive properties of
ergot alkaloids associated with the Convolvulaceae-Periglandula symbiosis have received
almost no attention, although extracts from Ipomoea parasitica (H.B.K.) G. Don, have been
found to reduce feeding and digestive efficiency of caterpillars [46]. Our overall goal therefore
was to examine whether survival and development of the potato psyllid was correlated with the
presence or absence of Periglandula, and to determine whether psyllid development was
affected by the types and quantities of fungal alkaloids produced by this symbiosis.

Materials and methods

Source of plants and insects
Insect bioassays included a screening of 11 species of native Convolvulaceae distributed across
three plant genera (Convolvulus, Ipomoea, and Turbina), and three introduced species in Con-
volvulus and Calystegia including the widespread pest field bindweed, Co. arvensis (Table 1).
All species except Calystegia silvatica overlap geographically with psyllids of the Central haplo-
type (Table 1). The Northwestern haplotype overlaps geographically with Co. arvensis, possibly
with Ca. silvatica, and is likely to have some overlap with the four species of Ipomoea that are
grown extensively as summer ornamentals (Table 1). It is unlikely that these ornamentals are
able to survive the winter conditions of the Pacific Northwest.
Test plants were examined in side-by-side comparisons with potato, Solanum tuberosum L.
(‘Russet Burbank’) (Solanaceae), a typical and highly suitable host for potato psyllid. Plants
were grown either from seeds or from stem cuttings (sources listed in Table 1). Seeds were
scarified using sandpaper and soaked in gibberellic acid (1000 ppm in water) for 24 h prior to
planting. Plants were grown in 10-cm pots (volume ~ 473.3 cm3) containing four parts com-
mercial potting soil (Miracle-Gro Moisture Control Potting Mix, Scotts Company, Marysville,
OH), one part perlite (Miracle-Gro Perlite, Scotts Company, Marysville, OH), and one part
clean sand, and maintained in a greenhouse under ambient light supplemented with grow

PLOS ONE | https://doi.org/10.1371/journal.pone.0201506 September 11, 2018 3 / 19

 A plant mutualistic fungus, Periglandula species protecting Convolvulaceae from potato psyllid

Table 1. List of plant species used in assays (origin, geographic overlap with psyllid haplotype, and source).
Species North America Origin Overlap of insect haplotype and plant Source
Convolvulus equitans Benth. Native C Western Region Plant Introduction Station, Pullman WA
Convolvulus tricolor L. ǂ Introduced C+N J.L. Hudson, Seedsman, La Honda, CA
Convolvulus arvensis L. Introduced C+N Prosser, WA

Calystegia silvatica (Kit.) Griseb. Introduced N? Tillamook Co., OR
Ipomoea alba L. ǂ Native C+N The Sample Seed Shop, Buffalo, NY
Ipomoea cordatotriloba Dennstedt Native C Georgia Vines, Claxton, GA
Ipomoea hederacea L. Native C J.L. Hudson, Seedsman, La Honda, CA
Ipomoea ternifolia Torrey Native C Southwest Seeds, Dolores, CO
Ipomoea nil (L.) Rothǂ Native C+N The Sample Seed Shop, Buffalo, NY
Ipomoea imperati (Vahl) Grisebach Native C South Padre Island, TX
Ipomoea leptophylla Torrey Native C Georgia Vines, Claxton, GA
Ipomoea pandurata (L.) G.F. Meyer Native C Georgia Vines, Claxton, GA
Ipomoea tricolor Cavanillesǂ Native C+N J.L. Hudson, Seedsman, La Honda, CA
Turbina corymbosa (L.) Rafinesque Native C J.L. Hudson, Seedsman, La Honda, CA
Solanum tuberosum L. Native C+N Skone & Conners, Warden, WA

C: Central haplotype occurs within geographic range of plant; N: Northwestern haplotype occurs within geographic range of plant. Haplotype distribution data [21, 22,
29, 30]. Plant distribution data [28].

Calystegia is a taxonomically difficult genus with species often exhibiting substantial geographic variation in morphological traits [47]. We believe that the Calystegia
assayed in this study is Calystegia silvatica (Kit.) Griseb. subsp. disjuncta Brummitt [48, 49]. Calystegia silvatica subsp. disjuncta is likely of Mediterranean origin,
although there have been suggestions (probably incorrect) that it is native to North America [49]. It is unclear whether Ca. silvatica overlaps geographically with potato
psyllid given historical uncertainties in distribution of the plant in the western U.S.
ǂ In the Pacific Northwest plant is grown only as a summer ornamental. This may result in some level of sympatry with the Northwestern haplotype.

https://doi.org/10.1371/journal.pone.0201506.t001

lights. Assays were done at the USDA–ARS in Wapato, WA. Plants at 1 to 4 fully expanded
leaf stage were used in the assays.
Potato psyllids to be used in assays were obtained from colonies maintained at the
USDA-ARS facility in Wapato, WA. The parental insects for colonies were collected from
potato fields near Weslaco, TX in March 2017 (Central haplotype, APHIS permit P526P-17-
00366) and from solanaceous weeds growing near Prosser, WA in the summer and autumn of
2016 (Northwestern haplotype). The colonies were maintained on potato (‘Russet Burbank’) at
22˚C and a 16:8 h light: dark cycle. Colonies were assayed preceding the study using high reso-
lution melting analysis to confirm haplotype status [21]. Colonies were checked periodically
for Lso infection using PCR detection methods [50]. Colonies were Lso-free for the duration
of the study.

Suitability of Convolvulaceae to potato psyllid

Our primary objective was to determine whether the potato psyllid is able to complete devel-
opment on targeted plant species. Given the large size of the experimental design (two psyllid
haplotypes x 15 plant species), we limited our measures of psyllid performance to two traits:
egg-to-adult survival (as a yes/no variable), and egg-to-adult development time (in days). Ten
adults (unsexed) from both haplotypes were collected from their respective colony cages. The
ten psyllids of a given haplotype were confined for egg-laying on a test plant kept individually
in a 7.5 L plastic container (Cambro1, Huntington Beach, CA) modified to allow ventilation
at 22˚C and a 16:8 h light: dark cycle. Once 20 or more eggs were present on a test plant, the

PLOS ONE | https://doi.org/10.1371/journal.pone.0201506 September 11, 2018 4 / 19

 A plant mutualistic fungus, Periglandula species protecting Convolvulaceae from potato psyllid

adults were removed. Containers were monitored every 2–3 days for hatching of eggs and sub-
sequent development of nymphs.
For plant species on which psyllids developed successfully, we recorded the number of days
required to develop from egg deposition to production of the first adult (i.e., the minimum
time required to complete development). We did not attempt to compare survival rates among
plant species due to difficulties in obtaining accurate estimates of egg numbers on plants with-
out also damaging the plant. Once new adults were seen in a container, that plant and con-
tainer was dismantled. A leaf was collected from the plant for DNA extraction and
biochemical analysis (described below).
On species which failed to support development, mortality almost invariably occurred as
first instar nymphs often within 48 h of hatch. When monitoring showed that all nymphs on a
given plant were dead, the assay for that plant and container was dismantled, and leaf samples
were collected for DNA extraction and ergot alkaloid quantification. We had five replicates
per plant species per psyllid haplotype combination. The large number of treatments, com-
bined with uneven germination of seed, did not allow us to conduct the five replicates simulta-
neously. Thus, each replicate was initiated on a separate date, with date of assay included in
the statistical analyses as a blocking factor (see Statistical analyses).

Phylogenetic mapping of Convolvulaceae

DNA was extracted using a cetyltrimethylammonium bromide (CTAB) precipitation method
[51]. Two different universal plant barcoding primer sets were used. The first primer set tar-
geted approximately 500 bp of the internal transcribed spacer region (ITS): ITS2F (ATGCGA
TACTTGGTGTGAAT) and ITS3R (GACGCTTCTCCAGACTACAAT) [52]. The second primer
set targeted approximately 684 bp region of the chloroplast maturase K gene (matK): matK
472-F (CCCRTYCATCTGGAAATCTTGGTT) and matK 1248-R (GCTRTRATAATGAGAAAGA
TTTCTGC) [53]. PCR conditions used for both primer sets were similar, consisting of an initial
denaturation step of 94˚C for 5 min followed by 35 cycles of 94˚C for 30 s, 56˚C for 30 s, and
72˚C for 42 s, followed by a final extension at 72˚C for 10 min. Each 20μl reaction contained
Amplitaq Gold 360 PCR Master Mix (Invitrogen, Carsbad, CA), 500nM of each primer, and
DNA template (10–20 ng). Upon amplification, bands were excised from agarose gels, purified
using GenElute minus ethidium bromide spin columns (Sigma, St. Louis, MO), and were
cloned using a TOPO TA cloning kit with TOP10 E. coli chemical competent cells (Invitrogen,
Carlsbad, CA). The QIAprep spin mini prep kit (Qiagen, Valencia, CA) was used to prepare
plasmid DNA for sequencing by MC Laboratories (MC Lab, San Francisco, CA). Sequences
were deposited into GenBank (Table 2).
DNA sequences were aligned and consensus sequences were made using Geneious R10
software (North America Biomatters Inc, Newark, NJ). The phylogenetic tree was constructed
using a Tamura-Nei model and neighbor-Joining method with the Tree Builder function of
Geneious R10 [54]. Phylogenetic distances for tree construction were estimated based upon
concatenated sequences of ITS and matK regions. Potato was treated as an outgroup.

Detection of the Convolvulaceae-Periglandula association

Because Periglandula is not always readily visible on plants even when the fungus is present,
extraction and analysis of DNA-sequences is often used to confirm infestation. Presence or
absence of the dmaW gene, encoding 4- (γ,γ –dimethylallyl) tryptophan synthase and required
for the determinant step of ergot alkaloid synthesis, was evaluated using PCR [35, 55]. Plant
DNA extracted using CTAB method was used to amplify approximately 1050 bp region using
dmaWF5 (GACCGTAAACGAGTCAGGAA) and dmaWR2 (AAATACACCTGGGGCTCG) primers.

PLOS ONE | https://doi.org/10.1371/journal.pone.0201506 September 11, 2018 5 / 19

 A plant mutualistic fungus, Periglandula species protecting Convolvulaceae from potato psyllid

Table 2. GenBank accession numbers.

Species ITS matK dmaW
Convolvulus equitans MG889580 MH198126 MH195190
Convolvulus tricolor MG889582 MH198117 MH195191
Convolvulus arvensis MG889579 MH198115 nd
Calystegia silvatica MG889581 MH198116 MH195189
Ipomoea alba MG910322 MH198118 nd
Ipomoea cordatotriloba MG910323 MH198119 MH195192
Ipomoea hederacea MG910324 MH198127 MH195193
Ipomoea ternifolia MG910327 MH198121 MH195196
Ipomoea nil MG910328 MH198122 nd
Ipomoea imperati MG910325 MH198120 MH195194
Ipomoea leptophylla MG910326 MH198128 MH195199
Ipomoea pandurata MG910329 MH198123 MH195195
Ipomoea tricolor MG910330 MH198124 MH195197
Turbina corymbosa MG910332 MH198125 MH195198
Solanum tuberosum MG910331 MH198129 nd

Not detected (nd)

https://doi.org/10.1371/journal.pone.0201506.t002

PCR conditions consisted of an initial denaturation step of 95˚C for 5 min followed by 40
cycles of 95˚C for 1 min, 52˚C for 1 min, and 72˚C for 45 s, followed by a final extension at
72˚C for 5 min. Each 20μl reaction contained Amplitaq Gold 360 PCR Master Mix (Invitrogen,
Carsbad, CA), 500nM of each primer, and DNA template (10–20 ng). Upon amplification,
bands were excised from agarose gels, purified using GenElute minus ethidium bromide spin
columns, and were cloned (methods described in previously). Sequencing again was done by
MC Laboratories. Sequences were deposited into GenBank (Table 2).

Quantification of ergot alkaloids

Acetonitrile (ACN) and methanol (LC-MS grade) as well as acetic acid (OmniTrace Ultra),
were purchased from EMD Millipore (Darmstadt, Germany). Ammonium acetate (>99.0%,
HPLC grade) was obtained from Sigma Aldrich (St. Louis, MO USA). Ergot alkaloid standards
were purchased from Romer Labs (Tulln, Austria) (biopure mix 6-ergocornine, ergocristine,
α-ergocryptine, ergometrine, ergosine and ergotamine) and Sigma-Aldrich (St. Louis, MO
USA) (ergonovine, agroclavine, lysergic acid and lysergol). Ultrapure 18 mO cm-1 water was
obtained from an Elga (Marlow, Buckinghamshire, UK.) PURELAB Ultra Genetic system.
Fully expanded leaves were collected from assayed plants at the end of suitability tests and
subjected to air drying at the room temperature ~22–25˚C for 3-5d. Dried tissue was ground
using either a mortar and pestle or a cyclone sample mill with a 0.5 mm screen (UDY Corpora-
tion, Fort Collins CO). Extraction solution (79:20:1 ACN:water:acetic acid) was added to
ground sample at a ratio of 4 mL/g and turned for 90 min in the dark [56]. The sample was
then centrifuged for 2 min at 1462 x g. Dilution solution (250 μL 20:79:1 ACN:water:acetic
acid) was added to 250 μL supernatant, vortexed for 10 sec, then placed in an amber HPLC vial
for ergot alkaloid analysis by LC-MS/MS.
An ABI/SCIEX 3200 QTRAP LC-MS/MS system (Applied Biosystems, Foster City, CA
USA) was used to monitor for ergoline and ergopeptide compounds via positive electrospray
ionization, with separation performed using a Perkin Elmer (Waltham, MA USA) Series 200

PLOS ONE | https://doi.org/10.1371/journal.pone.0201506 September 11, 2018 6 / 19

 A plant mutualistic fungus, Periglandula species protecting Convolvulaceae from potato psyllid

autosampler and HPLC connected to a Gemini C18 column (150 x 4.6 mm, 5 μ, Phenomenex
(Torrance, CA USA)) with a 4 x 3 mm security guard cartridge of similar packing [56]. Mobile
phases consisted of 5 mM ammonium acetate and methanol:water:acetic acid in a ratio of
10:89:1(v/v/v) (A) or 97:2:1 (B) and were run in a gradient program at 1 mL/min. Multiple
reaction monitoring (MRM) of two transitions (quantitative and qualitative) per compound
was used to detect the ergot alkaloids ergonovine, ergotamine, ergocornine, α-ergocryptine,
ergocristine, ergovaline, ergine, ergosine and their epimers, as well as agroclavine, chanocla-
vine, lysergol, lysergic acid, oxidized luol, dihydrolysergol, chanoclavine, dihydroergosine,
dihydroergotamine, festuclavine, fumigaclavine and elymoclavine.
The presence of a mycotoxin was confirmed when the signal was equal to or greater than a
signal-to-noise (S/N) ratio of 3:1 (limit of detection (LOD)), and both quantitative and qualita-
tive transitions were present. Samples were quantitated blind as to sample identity against a
standard curve using Analyst 1.6.2 and MultiQuant 3.0.1 (Applied Biosystems). The limit of
quantitation (LOQ) was defined as the concentration at which the analyte had a precision and
accuracy that did not exceed greater than 20% of the coefficient of variation [57]. LOD and
LOQ for detected mycotoxins were as follows: ergotamine, ergocornine, ergosine ergocristine
and agroclavine (1, 1 ng/mL); ergonovine (1, 2 ng/mL); lysergol (2, 2 ng/mL); lysergic acid (20
and 50 ng/mL). No commercial standards were available for chanoclavine, festuclavine, elymo-
clavine, elymoclavine fructoside, ergine and dihydrolysergol. These compounds were com-
pared on a scale of present (“+” indicating low, “++” indicating high) or not present (“-“)
amongst the plant species extracted based on relative peak area.

Statistical analyses
Effects of plant species and psyllid haplotype on mean psyllid development time were exam-
ined using a generalized linear mixed model (Proc GLIMMIX) [58]. Plant species, psyllid hap-
lotype, and the species x haplotype interaction were included as fixed effects. The analysis was
limited to plant species on which psyllids completed development to the adult stage. We speci-
fied an underlying gamma distribution using a DIST = gamma statement. This distribution is
useful for modeling time-to-occurrence data [59]. The ILINK function was used to back-trans-
form means into the original units (number of days to first adult). The CONTRAST statement
was used to examine a priori defined comparisons among plant species following a significant
plant species effect in the overall model (see results). The survival data (yes/no) were not ana-
lyzed statistically, as the two haplotypes showed identical results as to what plant species sup-
ported development (see results).
Genetic distances between species in a tree were calculated automatically by the Geneious
R10 software using the Tamura-Nei model. This approach expresses distance as nucleotide
substitutions per site. We used these distances to determine whether plant suitability for psyl-
lids decreased as genetic distance from potato increased. We conducted a two-sample t-test
[58] to determine whether mean genetic distance from potato differed between plant species
allowing development and plant species not allowing development. If suitability was affected
by genetic distance from the typical host (potato), we expected mean distance to be smaller for
plants on which psyllids survived than plants on which psyllids failed to survive.

Results
Psyllid developmental success and plant phylogeny
Eggs were present within 24–48 h of adding egg-laying psyllids on all plant species except for
Ipomoea pandurata and Turbina corymbosa which generally required 72 h before eggs were
present. Egglayers were noticeably reluctant to settle on these two plant species, and instead

PLOS ONE | https://doi.org/10.1371/journal.pone.0201506 September 11, 2018 7 / 19

 A plant mutualistic fungus, Periglandula species protecting Convolvulaceae from potato psyllid

Fig 1. Phylogeny of assayed Convolvulaceae based on ITS and matK sequences. Node confidence was calculated using Neighbor Joining tree (Bootstrap
replicates = 100). Species in red font followed by an insect kill icon failed to allow survival to adult stage; species in green font followed by a psyllid adult icon allowed
egg-to-adult development.
https://doi.org/10.1371/journal.pone.0201506.g001

were seen to spend considerable time wandering on the sides of the cages. Psyllids of both hap-
lotypes failed to complete development in all five replicates on Convolvulus equitans, Calystegia
silvatica, Ipomoea imperati, Ipomoea leptophylla, Ipomoea pandurata, Ipomoea tricolor, and
Turbina corymbosa. Nymphs invariably died within a week of hatch on these species. It was
not clear from our observations whether nymphs fed to any extent prior to death. On some
species, notably I. imperati, I. pandurata, and T. corymbosa, mortality occurred within 24–48 h
of egg hatch. Psyllids of both haplotypes completed development on potato, Convolvulus
arvensis, Convolvulus tricolor, Ipomoea alba, Ipomoea cordatotriloba, Ipomoea hederacea, Ipo-
moea ternifolia, and Ipomoea nil.
A tree generated from ITS and matK sequences resolved the 14 species of Convolvulaceae
into two major groups (Fig 1: Convolvuleae, Ipomoeeae), consistent with subfamilial group-
ings shown elsewhere in substantially more detailed taxonomic work [60]. The assay data were
overlain on the tree to search for evidence that plant phylogeny predicted survival. Within

PLOS ONE | https://doi.org/10.1371/journal.pone.0201506 September 11, 2018 8 / 19

 A plant mutualistic fungus, Periglandula species protecting Convolvulaceae from potato psyllid

Tribe Convolvuleae, psyllids of both haplotypes developed successfully on Co. arvensis and Co.
tricolor, but failed to survive on Ca. silvatica and Co. equitans, despite their phylogenetic close-
ness to Co. arvensis (Fig 1). Within Tribe Ipomoeeae, psyllids of both haplotypes developed
successfully on five species of Ipomoea, but failed to develop on four other Ipomoea or on T.
corymbosa. Phylogenetic distance from the control host plant (potato) was calculated for each
species of Convolvulaceae in the phylogenetic tree (distances calculated in Geneious1, S1
Table). A two-sample t-test demonstrated that mean phylogenetic distance from potato was
statistically identical between plant species that allowed psyllid survival versus species on
which psyllids failed to survive (P = 0.4563; Fig 2), confirming observations in the phylogenetic
tree that phylogenetic nearness of a species to potato did not predict whether the psyllid would
complete development on the plant (Fig 1).
We did not record actual rates of survival, so the assays cannot tell us whether percent sur-
vival on plant species that allowed egg-to-adult development was similar to survival on potato.
To determine if developmental rates on Convolvulaceae were similar to rates on potato, we
compared mean number of days from oviposition to production of the first adult (N = 5 repli-
cates per plant species and psyllid haplotype) between psyllids on potato and on those Convol-
vulaceae allowing survival to the adult stage. Development times varied between ~20–35 days
depending upon psyllid haplotype and plant species (Fig 3). Mean number of days between
egg deposition and emergence of the first adult differed statistically between psyllid haplotypes
(F = 15.5; df = 1, 57.0; P <0.001) and among plant species (F = 2.8; df = 7, 57.1; P = 0.013); the
haplotype x plant species interaction was not significant (F = 1.4; df = 7, 57.1; P = 0.22) indicat-
ing that the effects of plant species on psyllid development time was similar between the two
haplotypes. The Central haplotype developed more rapidly (mean = 24.7 ± 1.1 d) than the
Northwestern haplotype (mean = 29.4 ± 1.3 d), when averaged across host plant. We extracted
contrasts to examine two a priori defined comparisons of interest. A test of mean development
time on potato vs. Convolvulaceae was significant (F = 18.01; df = 1, 57.02; P < 0.001), and
showed that mean development time on potato was statistically shorter than development
time on Convolvulaceae, averaged over haplotype (Fig 3). A second set of contrasts was
extracted to examine whether there was evidence for plant effects within the Convolvulaceae,
ignoring potato. Averaged over the two haplotypes, there was no evidence that development
time of psyllids varied among species of Convolvulaceae (Fig 3: F = 0.31; df = 6, 57.1; P = 0.93).

Psyllid developmental success and a plant-fungus symbiosis

Visible evidence for the presence of Periglandula was most pronounced in two species, T. cor-
ymbosa and I. leptophylla (Fig 4A and 4B). The fungal colonies were found on the adaxial sur-
faces of younger leaves. Because visible evidence for presence of fungal colonies was rare, we
used a molecular approach for detection of the fungus. Analysis of DNA-sequences led to
detection of the dmaW gene in 11 of 14 plant species (Fig 4C and 4D; Table 2), indicating
widespread presence of Periglandula across species despite absence of visible evidence. Only
three species (Co. arvensis, I. alba, I. nil) failed to show presence of Periglandula. Presence of
Periglandula in Convolvulus and Calystegia (Convolvuleae) was unexpected, as there had been
no previous unambiguous evidence suggesting an association between Periglandula and plant
species outside of the Ipomoeeae [34, 42].
Ergot alkaloids are categorized into three classes (clavines, simple amides of lysergic acid,
and ergopeptines) based on their structural complexity and occurrence in the biochemical
pathway [61, 62]. Compounds from two classes (clavines, amides of lysergic acid) were
detected in leaf tissues of plant species in which the dmaW gene (indicating presence of Peri-
glandula) was also detected (Table 3). Compounds included eight clavines and two lysergic

PLOS ONE | https://doi.org/10.1371/journal.pone.0201506 September 11, 2018 9 / 19

 Table 3. Plant species assayed, psyllid survival (Y/N), and detection of ergot alkaloids (mean ± S.E., n = 3) by HPLC-MS.
Plant species Survival Clavines Simple Amides of Ergopeptines
Lysergic Acid
Chanoclavine Lysergic Agroclavine Lysergol Festuclavine Elymoclavine Elymoclavine Dihydrolysergol Ergonovine Ergine Ergotamine Ergocristine Ergocornine
acid (μg/g) (μg/g) (μg/g) fructoside (μg/g)
Ca. silvatica N - - - - - - - - - - - - -
(+)
Co. equitans N - - - - - - - - - - - - -
(+)
I. imperati (+) N ++ 4.4 ± 0.5 0.3 ± 0.04 0.4 ± 0.05 ++ ++ ⁻ ++ 5.5 ± 1.0 ++ ⁻ ⁻ ⁻
I. leptophylla N ++ 0.8 ± 0.02 - - + ++ ⁻ ++ 7.1 ± 0.3 ++ - ⁻ ⁻
(+)
I. pandurata N + - - - - ⁻ ⁻ ⁻ ⁻ ⁻ ⁻ ⁻ ⁻
(+)
I. tricolor (+) N ++ 0.9 ± 0.02 - - + + ++ ++ 0.3 ± 0.01 ++ ⁻ ⁻ ⁻
T. corymbosa N ++ 3.0 ± 0.03 - - - + - + 0.7 ± 0.04 ++ ⁻ ⁻ ⁻
(+)
Co. arvensis Y - - - - - - - - ⁻ ⁻ ⁻ ⁻ ⁻
Co. tricolor (+) Y - - - - - - - - ⁻ ⁻ - - -
I. alba Y - - - - - - - - ⁻ ⁻ ⁻ ⁻ ⁻

PLOS ONE | https://doi.org/10.1371/journal.pone.0201506 September 11, 2018

I. Y - - - - - - - - - - - - -
cordatotriloba
(+)
I. hederacea Y - - - - - - - - - - - - -
(+)
I. ternifolia (+) Y - - - - - - - - ⁻ ⁻ ⁻ ⁻ ⁻
I. nil Y - - - - - - - - ⁻ ⁻ ⁻ ⁻ ⁻
Potato Y - - - - - - - - ⁻ ⁻ ⁻ ⁻ ⁻


Periglandula detected (+)

https://doi.org/10.1371/journal.pone.0201506.t003

10 / 19
A plant mutualistic fungus, Periglandula species protecting Convolvulaceae from potato psyllid
 A plant mutualistic fungus, Periglandula species protecting Convolvulaceae from potato psyllid

Fig 2. Scatter plot showing relationship between genetic distance of plant from potato (control) and survival of
potato psyllid to the adult stage. Horizontal lines indicate mean distances.
https://doi.org/10.1371/journal.pone.0201506.g002

acid amides (Table 3). No ergopeptines were detected. Additionally, no ergot alkaloids were
detected in species not shown to host Periglandula (Co. arvensis, I. nil, I. alba). However, the
presence of Periglandula did not always lead to detection of alkaloids in plant tissues. Alkaloid
content may vary with plant age or organ, with higher concentrations typically occurring in
seeds and seedlings over vegetative parts [46, 63]. This variation, combined with the possibility
that ergot alkaloid concentrations can fall below detection limits, may lead to a failure in con-
firming presence of ergot alkaloids despite detection of Periglandula by molecular methods
[55].
We observed often striking differences in alkaloid profiles between plant species that
allowed psyllid development and species on which the psyllid failed to develop (Table 3).
Plants in which clavines and amides of lysergic acid were readily detected were invariably fatal
to nymphal psyllids (Table 3). Mortality was quite rapid on these species. Nymphs always died
as first instars generally within 24–48 h following egg hatch (Kaur and Horton pers. observa-
tion). With two exceptions (Ca. silvatica, Co. equitans), plant species in which alkaloids were
not detected allowed egg-to-adult development (Table 3). Psyllids failed to develop successfully
on these two species despite a failure to detect alkaloids and despite detection of Periglandula
in host tissues (Fig 4C, Table 3). Whether ergot alkaloids were actually present, but not
detected, is not known. Lack of survival on Co. equitans may have been caused in part by the

PLOS ONE | https://doi.org/10.1371/journal.pone.0201506 September 11, 2018 11 / 19

 A plant mutualistic fungus, Periglandula species protecting Convolvulaceae from potato psyllid

Fig 3. Number of days required to complete development from egg to adult stage by psyllids of the Northwestern and the Central haplotypes on potato and
Convolvulaceae. Error bars represent standard error of mean. Mean development times differed statistically between psyllid haplotypes (F = 15.5; df = 1, 57.0; P <0.001)
and among plant species (F = 2.8; df = 7, 57.1; P = 0.013).
https://doi.org/10.1371/journal.pone.0201506.g003

plant’s extreme hairiness, as the pubescence was found to interfere with the ability of psyllids
to feed and settle (from visual observations). Psyllids did successfully develop on four other
species in which the dmaW gene was detected (Co. tricolor, I. cordatotriloba, I. hederacea, I. ter-
nifolia). However, no ergot alkaloids were detected in leaf tissues from these four species,
despite presence of the fungus (Table 3).

Discussion
This study adds to the list of Convolvulaceae that support egg-to-adult development of potato
psyllid, and shows conclusively that the psyllid is able to develop on Convolvulaceae other
than the two species (Co. arvensis and I. batatas) previously listed in literature accounts [9, 11,
12]. These additional taxa included an ornamental species of Convolvulus (Co. tricolor) likely
of Mediterranean origin [64] and five species of New World Ipomoea. The Ipomoea comprised
a mix of species that are grown as ornamentals (I. alba, I. nil, I. hederacea), and two species (I.
cordatotriloba, I. ternifolia) that are present naturally in regions of Central America, Mexico,
and the southwestern U.S. [28, 65, 66, 67]. Previous accounts of association between potato
psyllid and Convolvulaceae include rearing trials and field observations. Some care must be
taken in interpretation of the field records, as field observations can lead to inflated ideas of
true host range of psyllids due to the willingness of these insects to colonize and feed upon
plant species that nonetheless fail to support nymphal development [7, 11, 68]. In this study,
we followed the strict published guidelines of Burckhardt et al. [7] in defining psyllid “host
plant” as a species that allows egg-to-adult development. A failure to appreciate this distinction
has led to confusion about the host range of potato psyllid [11]. We obtained egg-laying and

PLOS ONE | https://doi.org/10.1371/journal.pone.0201506 September 11, 2018 12 / 19

 A plant mutualistic fungus, Periglandula species protecting Convolvulaceae from potato psyllid

Fig 4. Colonies of Periglandula spp. on (A) Turbina corymbosa and (B) Ipomoea leptophylla, (C) Agarose gel showing detection of Periglandula dmaW gene ~ 1050bp
amplicon, (D) List of species in which the dmaW gene was detected or not detected corresponding to lane numbers designated in the gel picture.
https://doi.org/10.1371/journal.pone.0201506.g004

egg hatch (presence of nymphs) on all 14 species of Convolvulaceae that were assayed in this
study, but development to the adult stage was limited to seven of these species.
Psyllids of the Central and Northwestern haplotypes were identical with respect to what
plant species allowed successful development. The haplotypes did differ in development rates
on species allowing development, with psyllids of the Central haplotype developing more rap-
idly than psyllids of the Northwestern haplotype. Other studies have shown that haplotypes of
potato psyllid differ in biological traits, including settling and oviposition behavior [69], devel-
opment rates [25], body size [24, 25], and composition of endosymbiont communities [27].
The Central haplotype developed more rapidly on cultivated and weedy Solanaceae than psyl-
lids of the Northwestern haplotype [25], which is consistent with our observations. It is likely
that differences in development times were partly or largely due to differences between haplo-
types in body size. Psyllids of the Northwestern haplotype are conspicuously larger than psyl-
lids of the Central haplotype [24, 25] and it seems likely that the size differences translated into
differences in development times between the haplotypes.
We examined whether survival of psyllids on a given plant species could be predicted by
location of the species in a phylogenetic tree. The Psylloidea have shown the ability to track
phylogenetic diversification of plants within lineages, and host switching or dietary expansion
in evolutionary or ecological time by psyllids appear to occur most often between phylogeneti-
cally related plants species [8, 31, 32]. One outcome of this sort of phylogenetic tracking is the
expectation that dietary breadth for a given psyllid species would likely encompass phylogenet-
ically related plant species rather than a mixture of less-related species. The phylogenetic tree
developed from our sequencing work is consistent with trees constructed by earlier phyloge-
netic work for the Convolvulaceae [60]. Our sequences resolved the fourteen assayed species

PLOS ONE | https://doi.org/10.1371/journal.pone.0201506 September 11, 2018 13 / 19

 A plant mutualistic fungus, Periglandula species protecting Convolvulaceae from potato psyllid

into two clades which fall respectively into two major tribes [60], the Convolvuleae and Ipo-
moeeae. The Ipomoeeae was further resolved into two clades [60]: the Argyreiinae, which
includes one of our assayed species (Turbina corymbosa); and the Astripomoeinae clade,
which contains the remaining Ipomoeeae (all species of Ipomoea) that were assayed. Our data
failed to show that developmental success of psyllids was affected by location of plants in our
phylogenetic tree. Plant species that allowed development were represented in both Tribes
of Convolvulaceae that were assayed here, as were species that failed to allow development
(Fig 1).
Observations in the literature indicate that species of Convolvulaceae may often harbor a
class of alkaloids (ergot alkaloids) known in grasses to confer resistance to insect herbivory
[43, 45, 61]. These compounds are produced in grasses by fungal species in the family Clavici-
pitaceae (genus Epichloё) which have formed a mutualistic relationship with grasses. A similar
mutualistic association between Convolvulaceae and clavicipitaceous fungi in a different genus
(Periglandula) has been shown to explain the presence of ergot alkaloids in Convolvulaceae
[35, 36, 37, 38, 39]. The visual presence of fungal colonies on at least some of our targeted spe-
cies (Fig 4A and 4B), combined with extensive literature confirming the presence of ergot alka-
loids in Convolvulaceae, prompted us to examine whether psyllid development or lack of
development was correlated with the presence or absence of ergot alkaloids.
We detected Periglandula in a surprisingly large proportion of assayed plants (11 of 14 spe-
cies), including in two genera (Convolvulus, Calystegia) not previously known to host this fun-
gal symbiont. Previous surveys have suggested that the occurrence of ergot alkaloids (and thus
this mutualistic association) was limited to the tribe Ipomoeeae and two clades (Argyreiinae
and Astripomoeinae) within this tribe (data based on analyses of 46 species) [34, 42]. It has
now been estimated that approximately 50% of Ipomoeeae species, or upwards of 450 species
worldwide, could contain ergot alkaloids. These observations understandably have led
researchers to focus on the tribe Ipomoeeae in efforts to document presence of ergot alkaloids
[34, 42, 37] and it is possible that this focus has led workers to substantially underestimate the
taxonomic diversity of Convolvulaceae actually harboring ergot alkaloids. The few reports in
the literature suggesting that ergot alkaloids in the Convolvulaceae occur outside of the Ipo-
moeeae, including in Calystegia and Convolvulus, have been categorized as “unverified” [34].
Our results are the first to demonstrate that the presence of Periglandula in Convolvulaceae
does indeed extend outside of Ipomoeeae.
Ergot alkaloids representing two classes (clavines and amides of lysergic acid) were detected
in five of our assayed plant species (Table 3). Previous literature accounts summarized in Eich
(2008) report these same two classes of alkaloids in four of these five species (failing to list only
I. pandurata). These same accounts identified many of the same specific compounds that were
identified in this study [34, 37]. All species in this study which showed presence of ergot alka-
loids were shown (with PCR) to also host Periglandula. No ergot alkaloids were detected in the
three species in which we failed to detect Periglandula (I. nil, I. alba, Co. arvensis). This result is
consistent with other studies of these three species [34].
We invariably observed 100% mortality of psyllid nymphs on species in which ergot alka-
loids were detected (Table 3). Mortality occurred very rapidly following egg hatch, generally
within 24–48 h of hatch. Assuming that nymphal mortality was due to the presence of these
alkaloids, the next logical question is what mode of action explains our results? Absence of
development could have been caused by direct toxicity of the alkaloids or because the com-
pounds deter feeding. At this time, we cannot separate these effects. Insecticidal activity of this
class of alkaloids could arise from their capacity to act as agonists or antagonists to neurotrans-
mitter receptors and subsequent malfunctioning of the central nervous system [61]. However,
it is also possible that the compounds deterred feeding enough that newly hatched nymphs

PLOS ONE | https://doi.org/10.1371/journal.pone.0201506 September 11, 2018 14 / 19

 A plant mutualistic fungus, Periglandula species protecting Convolvulaceae from potato psyllid

rapidly desiccated and died. An evaluation of these competing effects will require additional
assays, likely including assays that allow measurement of feeding rates (e.g., production of
honeydew). Studies in which synthetic analogues of targeted compounds are assayed would
also be useful, as use of synthesized compounds would allow insect responses to be examined
relative to specific concentrations of compounds or to mixtures of compounds [45, 70].
We failed to detect ergot alkaloids in six species that nonetheless were shown by PCR to
harbor Periglandula (Table 3). It is unclear if the alkaloids were actually present but were not
at detectable levels, if ergot alkaloids were present but were different compounds than targeted
by our biochemistry work, or if indeed alkaloids were not present at all. Efforts to detect ergot
alkaloids in Convolvulaceae can lead to inconsistent results, even in assays of plant species
known from previous studies to harbor the chemicals [34, 55]. These inconsistencies may be
the consequence of any of a number of factors, including sensitivity of the analytical approach
chosen to look for alkaloids, age of the plant seed or conditions under which the seed was
stored, age of the plant, which plant structures are examined, and incorrect taxonomic work
leading to mistakes in species identification [34, 71]. Alkaloid levels within a single plant may
vary with plant structure. Levels in vegetative tissues, as were targeted here, may be lower than
levels in other plant parts, such as seed or newly expanded cotyledons [46, 63]. It may be that
analysis and extraction of plant structures other than those that were targeted here (the fully
expanded leaf) would have led to detection of ergot alkaloids in those species found to harbor
Periglandula but in which we failed to detect the chemicals. Potato psyllid successfully com-
pleted development on five species in which Periglandula was present but in which ergot alka-
loids were not detected. If ergot alkaloids do have psyllicidal effects, as suggested by our results
in Fig 4C and 4D and Table 3, then successful development by psyllids on those five Periglan-
dula-positive species from which we failed to detect alkaloids may indicate that alkaloids were
indeed not present, or that they were at levels low enough to allow psyllid development and to
escape biochemical detection.
Symbiotic association between plants and clavicipitaceous fungi is best known for monocot-
yledonous plants (Poaceae, Cyperaceae and Junaceae), where (as with Convolvulaceae) the sym-
bioses lead to production of ergot alkaloids [41, 72, 73]. These associations may lead to any of
several benefits for the plant, notably protection against herbivores, but including also nonde-
fense type functions such as enhanced growth rates of the plant or increased ability to withstand
drought or other abiotic stresses [74, 75, 76, 77]. Observations that benefits to plants may
include multiple types of effects, combined with observations showing that these effects are not
always predictable across studies, species, or environments, have led to a large body of literature
debating the actual evolutionary processes leading to these associations [77, 78, 79, 80]. Our
results provide correlative evidence that presence of ergot alkaloids in Convolvulaceae prevents
development of psyllid nymphs, suggesting that the Periglandula-Convolvulaceae symbiosis
does lead to protection of plants against insect herbivores. Our results also showed, however,
that presence of the fungus does not necessarily indicate that psyllids would not survive on the
plant host, as species in which Periglandula was present but from which alkaloids were not
detected did allow egg-to-adult development by psyllids. Future studies will include screening
of a larger diversity of Convolvulaceae than assayed here, comprising both Periglandula-positive
and Periglandula-negative species, and we believe that this larger study will shed additional light
on the role of this fungal symbiosis in affecting fitness of phloem-feeding insects.

Supporting information
S1 Table. Genetic distance from potato as calculated by Geneious1.
(DOCX)

PLOS ONE | https://doi.org/10.1371/journal.pone.0201506 September 11, 2018 15 / 19

 A plant mutualistic fungus, Periglandula species protecting Convolvulaceae from potato psyllid

Acknowledgments
We thank Deb Broers and Jen Stout for technical assistance. We thank Dan Johnson, Jürgen
Gross, Joe Munyaneza, and Kylie Swisher for reviewing an earlier draft of this manuscript.
Psyllids from Weslaco TX (Central haplotype) were shipped to the ARS facility in Washington
State under APHIS permit P526P-17-00366.

Author Contributions
Conceptualization: Navneet Kaur, William Rodney Cooper, David R. Horton.
Formal analysis: Navneet Kaur, Jennifer M. Duringer.
Funding acquisition: David R. Horton.
Investigation: Navneet Kaur, William Rodney Cooper, David R. Horton.
Methodology: Navneet Kaur, William Rodney Cooper, Jennifer M. Duringer, David R.
Horton.
Project administration: David R. Horton.
Resources: William Rodney Cooper, Jennifer M. Duringer, Ismael E. Badillo-Vargas, Gabriela
Esparza-Dı́az, Arash Rashed, David R. Horton.
Supervision: Arash Rashed, David R. Horton.
Writing – original draft: Navneet Kaur.
Writing – review & editing: David R. Horton.

References
1. Munyaneza JE (2012) Zebra chip disease of potato: biology, epidemiology, and management. Am. J.
Potato Res. 89: 329–350.
2. Teulon DA, Workman PJ, Thomas KL, Nielsen MC (2009) Bactericera cockerelli: incursion, dispersal
and current distribution on vegetable crops in New Zealand. N.Z. Plant Prot. 62: 136–144.
3. Western Australia Agriculture and Food (2017) Tomato potato psyllid (TPP). https://www.agric.wa.gov.
au/tomato-potato-psyllid-tpp. (Accessed September 2017).
4. Richards BL (1928) A new and destructive disease of the potato in Utah and its relation to the potato
psylla. Phytopath. 18: 140–141.
5. Richards BL, Blood H (1933) Psyllid yellows of the potato. J. Agric. Res. 46: 189–216.
6. Capinera JL (2001) Handbook of vegetable pests. Academic Press, New York, NY.
7. Burckhardt D, Ouvrard D, Queiroz D, Percy D (2014) Psyllid host-plants (Hemiptera: Psylloidea): resolv-
ing a semantic problem. Fla. Entomol. 97: 242–246.
8. Ouvrard D, Chalise P, Percy DM (2015) Host-plant leaps versus host-plant shuffle: a global survey
reveals contrasting patterns in an oligophagous insect group (Hemiptera, Psylloidea). Syst. Biodiv. 13:
434–454.
9. Knowlton GF, Thomas WL (1934) Host plants of the potato psyllid. J. Econ. Entomol. 27: 547.
10. Pletsch DJ (1947) The potato psyllid Paratrioza cockerelli (Sulc): its biology and control. Montana
Experiment Station, Bulletin 446; 95 pp.
11. Martin NA (2008) Host plants of the potato/tomato psyllid: a cautionary tale. The Weta 35: 12–16.
12. Puketapu A, Roskruge N (2011) The tomato-potato psyllid lifecyle on three traditional Maori food
sources. Agron. N.Z. 41: 167–173.
13. Romney VE (1939) Breeding areas of the tomato psyllid, Paratrioza cockerelli (Sulc). J. Econ. Entomol.
32: 150–151.
14. Wallis RL (1955) Ecological studies on the potato psyllid as a pest of potatoes. United States Depart-
ment of Agriculture, Technical Bulletin 1107. 24 pp.

PLOS ONE | https://doi.org/10.1371/journal.pone.0201506 September 11, 2018 16 / 19

 A plant mutualistic fungus, Periglandula species protecting Convolvulaceae from potato psyllid

15. Jensen AS, Rondon SI, Murphy AF, Echegaray E, Workneh F, Rashed A, et al. (2012) Overwintering of
the potato psyllid in the Northwest on Solanum dulcamara. Proceedings of the 12th Annual SCRI Zebra
Chip Reporting Session, San Antonio, TX. (http://zebrachipscri.tamu.edu/files/2013/04/2012-
Proceedings.pdf)
16. Horton DR, Cooper WR, Munyaneza JE, Swisher KD, Echegaray ER, Murphy AF, et al. (2015) A new
problem and old questions: potato psyllid in the Pacific Northwest. Am. Entomol. 61: 234–244.
17. Thinakaran J, Horton DR, Cooper WR, Jensen AS, Wohleb CH, Dahan J, et al. (2017) Association of
potato psyllid (Bactericera cockerelli; Hemiptera: Triozidae) with Lycium spp. (Solanaceae) in potato
growing regions of Washington, Idaho, and Oregon. Am. J. Pot. Res. 94: 490–499.
18. Horton DR, Miliczky E, Lewis TM, Cooper WR, Munyaneza JE, Mustafa T, et al. (2017) New geographic
records for the Nearctic psyllid Bactericera maculipennis (Crawford) with biological notes and descrip-
tions of the egg and fifth-instar nymph (Hemiptera: Psylloidea: Triozidae). Proc. Entomol. Soc. Wa.
119: 191–214.
19. Staples GW, Brummitt R.K. (2007) Convolvulaceae, pp. 108–110. In V.H. Heywood, R.K. Brummitt, A.
Culham, and O. Seberg (eds.), Flowering Plant Families of the World. Firefly Books, Ontario, Canada.
20. Ouvrard D (2017) Psyl’list–the world Psylloidea database. http://www.hemiptera-databases.com/
psyllist. Accessed December 2017.
21. Swisher KD, Munyaneza JE, Crosslin JM (2012) High resolution melting analysis of the cytochrome oxi-
dase I gene identifies three haplotypes of the potato psyllid in the United States. Environ. Entomol. 41:
1019–1028.
22. Swisher KD, Henne DC, Crosslin JM (2014) Identification of a fourth haplotype of the potato psyllid,
Bactericera cockerelli, in the United States. J. Insect Sci. 14(11): 2014; https://doi.org/10.1093/jisesa/
ieu023 PMID: 25368079
23. Liu D, Trumble JT (2007) Comparative fitness of invasive and native populations of the potato psyllid
(Bactericera cockerelli). Entomol. Exp. Appl. 123: 35–42.
24. Horton DR, Miliczky E, Munyaneza JE, Swisher KD, Jensen AS (2014) Absence of photoperiod effects
on mating and ovarian maturation by three haplotypes of potato psyllid, Bactericera cockerelli (Hemi-
ptera: Triozidae). J. Entomol. Soc. Brit. Col. 111: 1–12.
25. Mustafa T, Horton DR, Swisher KD, Zack RS, Munyaneza JE. (2015a) Effects of host plant on develop-
ment and body size of three haplotypes of Bactericera cockerelli (Hemiptera: Triozidae). Environ. Ento-
mol. 44: 593–600.
26. Mustafa T, Horton DR, Cooper WR, Swisher KD, Zack RS, Munyaneza JE. (2015b) Interhaplotype fer-
tility and effects of host plant on reproductive traits of three haplotypes of Bactericera cockerelli (Hemi-
ptera: Triozidae). Environ. Entomol. 44: 300–308.
27. Cooper WR, Swisher KD, Garczynski SF, Mustafa T, Munyaneza JE, Horton DR (2015) Wolbachia
infection differs among divergent mitochondrial haplotypes of Bactericera cockerelli (Hemiptera: Triozi-
dae). Ann. Entomol. Soc. Am. 108: 137–145.
28. Kartesz JT (2011) The biota of North America program (BONAP). North American plant atlas. (http://
bonap.net/NAPA/Genus/Traditional/County)
29. Swisher KD, Arp AP, Bextine BR, Álvarez EA, Crosslin JM, Munyaneza JE (2013b) Haplotyping the
potato psyllid, Bactericera cockerelli, in Mexico and Central America. Southwestern Entomol. 38: 201–
208.
30. Swisher KD, Munyaneza JE, Crosslin JM (2013a) Temporal and spatial analysis of potato psyllid haplo-
types in the United States. Environ. Entomol. 42: 381–393.
31. Percy DM, Page RD, Cronk QC (2004) Plant–insect interactions: double-dating associated insect and
plant lineages reveals asynchronous radiations. Syst. Biol. 53: 120–127. PMID: 14965907
32. Percy DM (2003) Legume-feeding psyllids (Hemiptera, Psylloidea) of the Canary Islands and Madeira.
J. Nat. Hist. 37: 397–461
33. Becerra JX (1997) Insects on plants: macroevolutionary chemical trends in host use. Science 276:
253–256. PMID: 9092474
34. Eich E (2008) Solanaceae and Convolvulaceae: Secondary metabolites: biosynthesis, chemotaxon-
omy, biological and economic significance. Springer, Berlin.
35. Steiner U, Leibner S, Schardl CL, Leuchtmann A, Leistner E (2011) Periglandula, a new fungal genus
within the Clavicipitaceae and its association with convolvulaceae. Mycologia 103: 1133–1145. https://
doi.org/10.3852/11-031 PMID: 21558502
36. Steiner U, Hellwig S, Ahimsa-Müller MA, Grundmann N, Li SM, Drewke C, Leistner E (2015) The key
role of peltate glandular trichomes in symbiota comprising clavicipitaceous fungi of the genus Periglan-
dula and their host plants. Toxins 7:1355–1373. https://doi.org/10.3390/toxins7041355 PMID:
25894995

PLOS ONE | https://doi.org/10.1371/journal.pone.0201506 September 11, 2018 17 / 19

 A plant mutualistic fungus, Periglandula species protecting Convolvulaceae from potato psyllid

37. Beaulieu WT, Panaccione DG, Ryan KL, Kaonongbua W, Clay K (2015) Phylogenetic and chemotypic
diversity of Periglandula species in eight new morning glory hosts (Convolvulaceae). Mycologia.
107:667–78. https://doi.org/10.3852/14-239 PMID: 25977213
38. Leistner E, Steiner U (2018) The genus Periglandula and its symbiotum with morning glory plants
(Convolvulaceae), pp.131–147. Physiology and Genetics: the Mycota (A comprehensive treatise on
fungi as experimental systems for basic and applied research), vol. 15. Springer, Cham.
39. Steiner U, Hellwig S, Leistner E (2008) Specificity in the interaction between an epibiotic clavicipitalean
fungus and its convolvulaceous host in a fungus/plant symbiotum. Plant Signal Behav. 3: 704–706.
PMID: 19704834
40. Kucht S, Groß J, Hussein Y, Grothe T, Keller U, Basar S, et al. (2004) Elimination of ergoline alkaloids
following treatment of Ipomoea asarifolia (Convolvulaceae) with fungicides. Planta 219: 619–625.
https://doi.org/10.1007/s00425-004-1261-2 PMID: 15085432
41. Schardl CL, Panaccione DG, Tudzynski P (2006) Ergot alkaloids—biology and molecular biology. In:
Cordell GA, ed. The alkaloids: chemistry and biology. Vol. 63. New York: Academic Press. p 45–86.
42. Eserman LA, Tiley GP, Jarret RL, Leebens-Mack JH, Miller RE (2014) Phylogenetics and diversification
of morning glories (tribe Ipomoeeae, Convolvulaceae) based on whole plastome sequences. Am. J.
Bot. 101: 92–103. https://doi.org/10.3732/ajb.1300207 PMID: 24375828
43. Clay K, Cheplick GP (1989) Effect of ergot alkaloids from fungal endophyte-infected grasses on fall
armyworm (Spodoptera frugiperda). J. Chem. Ecol. 15: 169–182. https://doi.org/10.1007/BF02027781
PMID: 24271434
44. Potter DA, Tyler Stokes J, Redmond CT, Schardl CL, Panaccione DG (2008) Contribution of ergot alka-
loids to suppression of a grass-feeding caterpillar assessed with gene knockout endophytes in perennial
ryegrass. Entomol. Exp. Appl. 126: 138–147.
45. Shymanovich T, Saari S, Lovin ME, Jarmusch AK, Jarmusch SA, Musso AM, et al. (2015) Alkaloid vari-
ation among epichloid endophytes of sleepygrass (Achnatherum robustum) and consequences for
resistance to insect herbivores. J. Chem. Ecol. 41: 93–104. https://doi.org/10.1007/s10886-014-0534-x
PMID: 25501262
46. Amor-Prats D, Harborne JB (1993) Allelochemical effects of ergoline alkaloids from Ipomoea parasitica
on Heliothis virescens. Chemoecology. 4: 55–61.
47. Brummitt RK (1963) A taxonomic revision of the genus Calystegia. Ph.D. thesis, University of Liverpool.
48. Brummitt RK (1980) Further names in the genus Calystegia (Convolvulaceae). Kew Bull. 35: 327–334.
49. Brummitt RK (2002) Calystegia silvatica (Convolvulaceae) in Western North America. Madroño 49:
130–131.
50. Jagoueix S, Bové JM, Garnier M. (1996) PCR detection of the two ‘Candidatus Liberibacter species’
associated with greening disease of citrus. Mol. Cell. Probes 10: 43–50. https://doi.org/10.1006/mcpr.
1996.0006 PMID: 8684375
51. Zhang YP, Uyemoto JK, Kirkpatrick BC (1998) A small-scale procedure for extracting nucleic acids
from woody plants infected with various phytopathogens for PCR assay. J. Virol. Methods 71: 45–50.
PMID: 9628220
52. Chen S, Yao H, Han J, Liu C, Song J, Shi L, et al. (2010) Validation of the ITS2 region as a novel DNA
barcode for identifying medicinal plant species. PLoS ONE 5: e8613. https://doi.org/10.1371/journal.
pone.0008613 PMID: 20062805
53. Yu J, Xue JH, Zhou SL (2011) New universal matK primers for DNA barcoding angiosperms. J. System-
atics Evol. 49: 176–181.
54. Kearse M, Moir R, Wilson A, Stones-Havas S, Cheung M, Sturrock S, Buxton S, Cooper A, Markowitz
S, Duran C, Thierer T (2012) Geneious Basic: an integrated and extendable desktop software platform
for the organization and analysis of sequence data. Bioinformatics 28: 1647–1649. https://doi.org/10.
1093/bioinformatics/bts199 PMID: 22543367
55. Brown AM (2013) Detection methods and phylogenetic investigation of the morning glory associated
fungal symbiont, Periglandula. M.S. thesis. Southeastern Louisiana University, Louisiana.
56. Sulyok M, Krska R, Schuhmacher R (2007) A liquid chromatography/tandem mass spectrometric multi-
mycotoxin method for the quantification of 87 analytes and its application to semi-quantitative screening
of moldy food samples. Anal. Bioanal. Chem. 389: 1505–1523. https://doi.org/10.1007/s00216-007-
1542-2 PMID: 17874237
57. United States Food and Drug Administration (2001) Guidance for industry bioanalytical method valida-
tion [WWW Document]. URL http://www.fda.gov/downloads/Drugs/Guidances/ucm070107.pdf
(accessed 7.18.14).
58. SAS Institute (2012) SAS version 9.4. SAS Institute, Cary, NC.

PLOS ONE | https://doi.org/10.1371/journal.pone.0201506 September 11, 2018 18 / 19

 A plant mutualistic fungus, Periglandula species protecting Convolvulaceae from potato psyllid

59. Gbur EE, Stroup WW, McCarter KS, Durham S, Young LJ, Christman M, et al. (2012) Generalized lin-
ear models, pp. 35–58. Analysis of Generalized Linear Mixed Models in the Agricultural and Natural
Resources Sciences. Book News Inc., Portland, OR.
60. Stefanović S, Austin DF, Olmstead RG. (2003) Classification of Convolvulaceae: a phylogenetic
approach. Syst. Bot. 28: 791–806.
61. Panaccione DG, Beaulieu WT, Cook D (2014) Bioactive alkaloids in vertically transmitted fungal endo-
phytes. Funct. Ecol. 28: 299–314.
62. Florea S, Panaccione DG, Schardl CL (2017) Ergot alkaloids of the family Clavicipitaceae. Phytopath.
107: 504–518.
63. Beaulieu WT, Panaccione DG, Hazekamp CS, Mckee MC, Ryan KL, Clay K (2013) Differential alloca-
tion of seed-borne ergot alkaloids during early ontogeny of morning glories (Convolvulaceae). J. Chem.
Ecol. 39: 919–30. https://doi.org/10.1007/s10886-013-0314-z PMID: 23835852
64. Wood JR, Williams BR, Mitchell TC, Carine MA, Harris DJ, Scotland RW (2015) A foundation mono-
graph of Convolvulus L. (Convolvulaceae). PhytoKeys 51: 1–282.
65. Austin DF (1990) Annotated checklist of New Mexican Convolvulaceae. Sida 14: 273–286.
66. McDonald JA (1995) Revision of Ipomoea section Leptocallis (Convolvulaceae). Harv. Pap. Bot. 6: 97–
122.
67. Austin DF and Huáman Z (1996) A synopsis of Ipomoea (Convolvulaceae) in the Americas. Taxon 45:
3–38.
68. Gallinger J and Gross J. (2018) Unraveling the host plant alternation of Cacopsylla pruni–adults but not
nymphs can survive on conifers due to phloem/xylem composition. Front. Plant Sci. 9: 484. https://doi.
org/10.3389/fpls.2018.00484 PMID: 29706983
69. Prager SM, Esquivel I, Trumble JT (2014) Factors influencing host plant choice and larval performance
in Bactericera cockerelli. PLoS ONE 9: e94047. https://doi.org/10.1371/journal.pone.0094047 PMID:
24710468
70. Bacetty AA, Snook ME, Glenn AE, Noe JP, Hill N, Culbreath A, et al. (2009) Toxicity of endophyte-
infected tall fescue alkaloids and grass metabolites on Pratylenchus scribneri. Phytopathology.
99:1336–45. https://doi.org/10.1094/PHYTO-99-12-1336 PMID: 19899999
71. Amor-Prats D, Harborne JB (1993b) New sources of ergoline alkaloids within the genus Ipomoea. Bio-
chemical systematics and ecology. 4: 455–61.
72. Clay K, Schardl C (2002) Evolutionary origins and ecological consequences of endophyte symbiosis
with grasses. Am. Nat. 160: 99–127.
73. White JF Jr, Bacon CW, Hywel-Jones NL, Spatafora JW (2003) Clavicipitalean fungi, evolutionary biol-
ogy, chemistry, biocontrol, and cultural impacts. Marcel Dekker, New York.
74. Clay K (1988) Fungal endophytes of grasses: a defensive mutualism between plants and fungi. Ecology
69: 10–16.
75. Malinowski DP, Belesky DP (2000) Adaptations of endophyte-infected cool-season grasses to environ-
mental stresses. Crop Sci. 40: 923–940.
76. Brem D, Leuchtmann A (2002) Intraspecific competition of endophyte infected vs. uninfected plants in
two woodland grass species. Oikos. 96: 281–290.
77. Cheplick GP, Faeth SH (2009) Ecology and evolution of the grass-endophyte symbiosis. Oxford Uni-
versity Press. USA.
78. Faeth SH (2002) Are endophytic fungi defensive plant mutualists?. Oikos 98: 25–36.
79. Saikkonen K, Wäli P, Helander M, Faeth SH (2004) Evolution of endophyte–plant symbioses. Trends
Plant Sci. 9: 275–280. https://doi.org/10.1016/j.tplants.2004.04.005 PMID: 15165558
80. Clay K (2009) Defensive mutualism and grass endophytes: still valid after all these years. Defensive
mutualism in Microbial Symbiosis. Taylor and Francis Publications, pp. 9–20.

PLOS ONE | https://doi.org/10.1371/journal.pone.0201506 September 11, 2018 19 / 19