Plant Disease • 2019 • 103:2374-2384 • https://doi.org/10.

1094/PDIS-11-18-1963-RE

Understanding the Process of Latent Infection of Canker-Causing Pathogens

in Stone Fruit and Nut Crops in California
Yong Luo,1,† Paulo S. F. Lichtemberg,1 Franz J. A. Niederholzer,2 Danielle M. Lightle,3 Daniel G. Felts,1 and
Themis J. Michailides1,†
1
Department of Plant Pathology, University of California–Davis, Kearney Agricultural Research and Extension Center, Parlier,
CA 93648
2
University of California – Cooperative Extension, Colusa/Sutter/Yuba Counties, Yuba City, CA 95991
3
University of California – Cooperative Extension, Butte/Glenn/Tehama Counties, Orland, CA 95963

Abstract
The Botryosphaeriaceae family is considered a fungal family that in- observed in two dried plum (prune) orchards. Most orchards showed high
cludes pathogens causing latent infection of woody plants, and a number incidences of B. dothidea and Lasiodiplodia spp. and moderate inci-
of species were identified as causal pathogens of canker and shoot blight dences of Neofusicoccum spp. Variations in MS were observed among
diseases. To better understand the process of latent infection of major samples of the studied orchards, ranging from 4 to 8. The overall results
canker-causing pathogens in woody tissues in different tree crops impor- of LII demonstrated that species of Diplodia and Phomopsis were less
tant in California, shoot and bud samples were randomly collected from important in population development of canker-causing pathogens at
four tree crops: almond, dried plum, pistachio, and walnut. The previ- the latent phase. Lasiodiplodia spp. were the most aggressive and had
ously developed DNA primers and quantitative real-time PCR (qPCR) been well developed in populations among the studied tree crops. Cyto-
assay systems were applied to detect six canker-causing pathogen spora spp. became predominant in two of the three dried plum orchards,
groups, including Botryosphaeria dothidea, and species of Cytospora, whereas B. dothidea and Neofusicoccum spp. showed trends of increase
Diplodia, Lasiodiplodia, Neofusicoccum, and Phomopsis. The concepts in incidence across various tree crops. This study also demonstrated the
of molecular severity (MS) and latent infection index (LII) were intro- usefulness of this sensitive qPCR approach in providing evidence of the
duced and applied to quantify the latent infection levels for these sam- latent phase of major canker-causing pathogens of stone fruit and nut
ples. Variation in incidence of latent infection among pathogen groups crops at an early stage of latent infection in woody plant tissues.
was observed, whereas the incidences were relatively low among species
of Phomopsis and Diplodia. High incidences of Cytospora spp. were Keywords: etiology, pathogen detection, epidemiology, qPCR

Stone fruits (apricot, cherry, nectarine, peach, plum, and dried plum) Wingfield 2007). The factors triggering the latent infections to grow
and nut crops (almond, pistachio, and walnut) are over $1.2 billion and and cause a canker disease are unknown but need further investiga-
over $8.2 billion industries in California, respectively. Based on the tion. It is thought that the disease development through expression
2017 statistics, California accounted for 46% of the United States fruit of visible symptoms follows an abiotic stress or biological stress of
and nut production. However, Botryosphaeria canker and shoot blight tree growth rather than infection itself (Slippers and Wingfield
diseases, caused by various fungal species of Botryosphaeriaceae, are 2007). Such stress may include heat, drought, wound, frost, hail dam-
becoming more and more severe, thereby impacting on the production age, nutrition deficiency, and others. Climatic changes such as ex-
of stone fruits and nut crops in California (Chen et al. 2014a, 2014b; treme heat, cold, drought, and flood conditions lasting long might
Michailides 1991; Michailides and Morgan 2010). These diseases kill be important factors that trigger canker development and expression
branches, blight leaves and fruit, and also result in cankers on branches, widely and in many crops in California (Pathak et al. 2018).
shoots, and fruiting spurs. Initially, the fungal pathogen Botryosphae- Subsequent studies on the taxonomy of Botryosphaeriaceae iso-
ria dothidea was identified as the major causal agent of panicle and lated from nut crops in California showed that eight to 10 different
shoot blight of pistachio and band canker of almond in California (En- species in this family were associated with these canker and blight
glish et al. 1975; Michailides 1991). diseases (Chen et al. 2014a, 2014b; Inderbitzin et al. 2010). Specif-
The latency phase of Botryosphaeriaceae had been reviewed ex- ically, for the Botryosphaeria panicle and shoot blight of pistachio,
tensively by Slippers and Wingfield (2007). Although the initial pro- studies focused on disease epidemiology (Ahimera et al. 2004; Mila
cess of infection in some tree crops is still unclear, the cytological and et al. 2005; Ntahimpera et al. 2002), inoculum sources and spread
histological observations showed strong evidence of existence and (Ma et al. 2004; Michailides and Morgan 1993a, 1993b), popula-
development of the pathogen inside plant tissues (Slippers and tion structure (Ma et al. 2001a, 2004), fungicide resistance (Ma
et al. 2001b), and disease management (Michailides and Morgan
† 2010; Mila and Michailides 2006). Recently, Botryosphaeriaceae
Corresponding authors: Y. Luo; ygluo@ucanr.edu and T. J. Michailides;
and Diaporthaceae were defined as two families containing a num-
tjmichailides@ucanr.edu
ber of genera (Phillips et al. 2013) with important canker-causing
Funding: This research was supported by the California Dried Plum Research species in pistachio (Chen et al. 2014b), English walnut (Chen
Board (Roseville, CA), the California Pistachio Research Board (Fresno, CA), et al. 2014a), almond (English et al. 1975; Inderbitzin et al.
the Almond Board of California (Modesto, CA), and the California Walnut 2010), grapevine (Úrbez-Torres and Gubler 2009; Úrbez-Torres
Board (Folsom, CA). et al. 2006), olive (Moral et al. 2010; Úrbez-Torres et al. 2013), cit-
rus (Adesemoye et al. 2014), avocado (McDonald and Eskalen
The author(s) declare no conflict of interest. 2011), and other agricultural, forest (Aćimović et al. 2018), and or-
Accepted for publication 8 April 2019. namental trees and bushes in California and in other regions world-
wide (Damm et al. 2007).
The Botryosphaeriaceae family was studied extensively (Phillips
© 2019 The American Phytopathological Society et al. 2013), and most of its members include species with a

2374 Plant Disease / Vol. 103 No. 9

world-wide distribution. Among them, 17 genera and 110 species Furthermore, evaluation of disease management also needs infor-
were identified and classified based on morphological and molecu- mation on the changes in latent pathogen populations related to
lar characteristics. The molecular characteristics include phyloge- various control methods.
netic relationships among genera through multilocus tree cluster Obviously, the traditional plating method to isolate the pathogens
analysis. Among these genera, Botryosphaeria, Diplodia, Dothior- in their latent infection phase is not sensitive enough to efficiently
ella, Lasiodiplodia, Neofusicoccum, and Neoscytalidium are the and accurately provide needed information at an early stage of dis-
most common ones containing some species of canker-causing ease after infection by the pathogen. The plating method also cannot
pathogens of fruit and nut trees in California (Chen et al. 2014a, quantify latent infection level in plant tissues. In this study, we col-
2014b). Additionally, nine families of ascomycete order Diapor- lected shoot and bud samples from different tree crops in California.
thales had been studied (Rossman et al. 2007), and the information We used previously designed pathogen group-specific primers and
on this order has been updated by the new studies on families of applied a previously published quantitative real-time PCR (qPCR)
Diaporthales by Senanayake et al. (2017). The genus Phomopsis method (Luo et al. 2017) to quantify infection levels of different
(teleomorph Diaporthe) includes several important plant patho- pathogen groups for these samples. Using the obtained data, we
gens associated with tree hosts and also consists of a number of established the methodology to define the infection levels and
latent and saprobic species (Diogo et al. 2010; Gomes et al. population situation of six canker-causing pathogen groups, such
2013; Udayanga et al. 2011). The canker-causing pathogens as B. dothidea and species of Cytospora, Diplodia, Lasiodiplodia,
Cytospora spp. belong to the ascomycetes in the order Diaporthales Neofusicoccum, and Phomopsis. The objectives of this study were
(Senanayake et al. 2017) and the family Valsaceae, comprising to (i) understand the current situation of the studied latent fungal
about 500 species in this genus and causing various plant diseases pathogen groups in stone fruits and nut crops in California, (ii) deter-
(Adams and Jacobi 2016). Thus far, the two species at the ana- mine the population levels of the studied pathogen groups in the la-
morphic stage, Cytospora cincta (Leucocytospora cincta) and tent phase, and (iii) compare infection and population levels of
C. leucostoma (Leucostoma persoonii) were found to be common different pathogen groups among different tree crops.
pathogens of fruit trees.
Some species of Botryosphaeriaceae were defined as canker-causing Materials and Methods
pathogens because they can infect directly through lenticels, stomata, or Sample collection. This study focused on samples obtained from
other openings on healthy plants (Brown and Hendrix 1981; Kim et al. one almond, three pistachio, three dried plum (prune), and two wal-
1999; Michailides 1991). However, the canker disease epidemics are nut orchards in California (Table 1). In each orchard, samples of
relatively complex. Usually more than one species is involved in asymptomatic shoots, 1 to 3 years old, were collected at different pe-
these canker disease complexes. These pathogens frequently form riods of time from 2015 to 2017. The sample sizes were from 14 to 34
pycnidia under the epidermal layers of branches and/or other woody shoots per orchard, depending on sampling availability (Table 1).
tissues, which produce the asexual, water-splashed conidia (pycni- The Dried plum-1 orchard showed severe canker disease history with
diospores). The conidia can cause latent infections that can survive typical canker symptoms, whereas the others showed much less dis-
in plant tissues for long before canker symptoms appear. The canker ease severity, with most symptomless shoots. Shoot dieback was not
symptoms also vary greatly from typical lesions to death of entire observed in these orchards. Bud samples, from 10 to 34 buds per or-
branches, scaffolds, or even trunks of the trees, with the last leading chard (Table 1), were also collected from an almond orchard and
to tree death. The pathogens can also infect fruit leading to blighted from one each of the pistachio and walnut orchards. These orchards
fruit, thus significantly affecting yields and fruit quality. were of different age and used different irrigation systems (Table 1).
How the latent pathogens develop in the plant tissue over long Different numbers of samples were collected depending on the spe-
period of time and how this development relates to canker expres- cific situation of the sampled orchards. The samples were collected
sion pose critical questions to understand the disease epidemic during the winter and spring in different years (Table 1).
mechanisms. Identification and quantification of such latent path- Shoots in each sample were cut into a 3-cm-long piece, washed un-
ogens in plant tissue are necessary to help define and describe der running tap water to remove the surface dust, soaked in 0.525%
their whole development process. We need to understand the cur- NaOCl (10% commercial bleach) for 15 min for surface sterilization,
rent latent situations in different tree crops in California before the washed with sterile distilled water three times, and placed on paper
expression of symptoms, so that large-area disease management towels to dry in ambient air for about 24 h. The shoot sections were
strategies can be designed. We also need an efficient method to ground into fine pieces with a manual pencil sharpener (X-Acto KS
track the development of latent fungal species to determine how Manual Pencil Sharpener, Elmer’s Products, High Point, NC),
they could induce disease expression. Understanding the popula- weighed (about 0.2 g for each sample), and extracted to obtain
tion dynamics of the latent pathogens in the plant tissue becomes a DNA using the FastDNA Spin kit (MP Biomedicals, Santa Ana,
core issue to estimate possible risk of canker disease epidemics. CA) by following the manufacturer’s instructions. The final DNA

Table 1. Orchards of different tree crops used for shoot and bud samplings in this studyz
Orchard age Plant Collection No. of Shoot age Irrigation
Crop Location (years) Orchard code tissue date samples (years) type
Almond KARE 12 Almond-1 Shoot 2/11/2016 34 1–2 Flood
Almond KARE 12 Almond-1 Bud 2/11/2016 34 NA Flood
Dried plum Yuba, CA 21 Dried plum-1 Shoot 12/6/2015 17 1–2 Drip
Dried plum Yuba, CA 21 Dried plum-2 Shoot 12/9/2015 14 1–2 Flood
Dried plum KARE 24 Dried plum-3 Shoot 2/28/2017 32 1–3 Flood
Pistachio KARE 27 Pistachio-1 Shoot 3/19/2016 32 1–3 Flood
Pistachio KARE 27 Pistachio-2 Shoot 1/20/2016 32 1–3 Drip
Pistachio KARE 27 Pistachio-2 Bud 1/20/2016 32 NA Drip
Pistachio Butte, CA 35 Pistachio-3 Shoot 3/18/2016 32 1–2 Flood
Walnut Butte, Nicolaus, CA >20 Walnut-1 Shoot 2/18/2016 32 1 Flood
Walnut KARE 11 Walnut-2 shoot 1/5/2016 26 1–2 Flood
Walnut KARE 11 Walnut-2 Bud 1/5/2016 10 NA Flood
z Different number of shoots and bud samples per orchard were collected. The quantitative real-time PCR assay was applied to process these samples to quantify
the latent infection levels. KARE = Kearney Agricultural Research and Extension Center, and NA = not applicable.

Plant Disease / September 2019 2375

was dissolved in 60 ml of nuclease-free water for each sample and of the six pathogen groups. To describe the overall situation of la-
stored at –20°C for later use. tent infection, we introduced the concept of latent infection index
qPCR assay. The six previously published primer pairs (Luo et al. (LII): LII = incidence × MS/15, which was in a range from 0 to
2017) specific to the corresponding six canker-causing pathogen 100%. LII combined information of incidence and severity for an
groups were used in this study (Table 2). The qPCR amplifications orchard; thus, it was used to present and compare the situation of
were performed with a CFX96 Touch Real-Time PCR Detection latent infection levels among orchards. The concept of statistical
System (Bio-Rad Laboratories, Hercules, CA) using SYBR Green analysis on multiple comparisons in proportion data (Zar 1999),
I fluorescent dye. Amplifications were conducted in 25-ml aliquots as well as a corresponding SAS program (https://support.sas.com/
containing 12.5 ml of SYBR Green Supermix (Biotool, Houston, resources/papers/proceedings/proceedings/sugi31/204-31.pdf)
TX), 2 ml of template DNA extracted or 2 ml of nuclease-free water with a certain modification, were used to determine the differences
as a negative control, 0.25 ml of each forward and reverse primers in incidence and LII among the studied orchards of various tree
(10 mM each), and 10 ml of nuclease-free water. The following pa- crops for each pathogen group. Comparison of values of mean
rameters were used for qPCR amplifications: an initial preheat for MS among orchards of the various tree crops was performed with
3 min at 95°C, followed by 40 cycles at 94°C for 15 s, 58°C for the ANOVA procedure of SAS (version 9.4, SAS Institute, Cary,
30 s, 72°C for 30 s, and then 73°C for 1 s in order to detect and quan- NC). To determine the importance of the studied pathogen groups
tify the fluorescence at a temperature above the denaturation of in causing latent infections in each tree crop, the data from different
primer–dimers. After the amplifications were completed, melting orchards of the same tree crop were combined. The same data anal-
curves were obtained based on a standard protocol from the manufac- ysis approaches described above were performed to determine the
turer’s instructions and were used to confirm the signal from the tar- significance in incidence, mean MS, and LII among pathogen
get product without primer–dimers. Thus, the temperature at which groups for each tree crop on shoots and buds. We also arbitrarily
the peak of melting curve was located was checked to confirm the defined four levels of pathogen population establishment situation
correct PCR product. The DNA extracted from pure culture of each for each pathogen group according to the incidence level as follows:
studied pathogen species was used as the positive control and water I, the pathogen is not found when incidence = 0; II, establishment of
as the negative control in each reaction (Table 2). Thus, the cycle the pathogen latent population is in a starting mode when 0 < incidence
threshold (Ct) value was obtained for each primer pair for each sam- # 25%; III, establishment of the pathogen latent population is in a de-
ple. The standard curve for each of the six pathogen groups estab- velopment mode when 25 < incidence # 75%; and IV, the pathogen
lished in a previous study (Luo et al. 2017) was applied to latent population is well established when incidence >75%. Using
calculate the corresponding DNA concentration of each sample the above concepts, the latent infection level for each pathogen group
based on the Ct value obtained from each reaction. was described for each sampled orchard.
Quantification of latent infection level. The level of latent infec-
tion for each sample was quantified as the molecular severity (MS) Results
described in a previous study (Luo et al. 2017). Briefly, MS = Incidence of latent infection in shoots. Although all six pathogen
log10(P/H), where P is the weight of the pathogen’s DNA in femto- groups were observed in some tree crops, the incidences of latent
grams (fg), which is calculated by using the equation of the standard infection of Phomopsis spp. and Diplodia spp. were comparatively
curve for the corresponding pathogen based on the Ct value from its lower than those of the other four pathogen groups for all the studied
reaction with the corresponding primers (Table 2), and where H is the tree crops (Fig. 1). The orchard Dried plum-3 showed significant
shoot/bud weight in grams. Thus, the range of MS value is 0 to 15. lower incidences of Cytospora spp., Diplodia spp., Neofusicoccum
However, because when no infection is detected we assign MS = spp., and Phomopsis spp. (Fig. 1) than other orchards. For
0, the theoretically detectable amount of pathogen DNA in 1 g of Almond-1 orchard, the incidences of latent infection of B. dothidea,
shoot should be >1 fg (Luo et al. 2017). Therefore, for each sample, Cytospora, and species of Lasiodiplodia and Neofusicoccum were all
six reactions were conducted using the corresponding primer pairs to greater than 50%, whereas those of species of Phomopsis and Diplo-
obtain six MS values each for each of the six corresponding patho- dia were only 18 and 10%, respectively. B. dothidea was present in
gens (Table 2). all orchards, whereas the two dried plum orchards and one walnut or-
Data analysis. For the samples (shoots or buds) of each orchard, chard showed higher incidences compared with those of the three pis-
mean MS value from samples showing a positive result and the cor- tachio orchards (Fig. 1). The incidences of Cytospora spp. were
responding standard deviation (SD) were calculated for each of the 100% in two dried plum orchards (Dried plum-1 and Dried plum-
six pathogen groups. For the samples from each orchard, the percent- 2), significantly higher than other orchards, implying that this path-
age of plant tissues (shoots or buds) showing a positive result from ogen was more predominant in dried plums than in other tree crops.
qPCR was calculated as the incidence of latent infection (%) for each All orchards showed high incidence (>60%) of Lasiodiplodia spp.

Table 2. Primer sequences for six canker-causing pathogen groups and their corresponding standard curve equations used to quantify the latent infection level of
shoots and buds of different tree crops by using a quantitative real-time PCR (qPCR) assay (Luo et al. 2017) in this study
Pathogen Product
group Primer name Primer sequence (59 - 39) (forward/reverse) size (bp) Standard curvey Representative speciesz
Botryosphaeria BdF/BdR CAGCGTGGGAGAACATCAA/ 103 y = –0.249x + 11.9462 B. dothidea
dothidea GTGAGAGAGTACCTCGTTGAAATAG
Cytospora spp. CtBTFF1/CtBtFR1 GAGCGCATGAACGTCTACTT/ 106 y = –0.2873x + 13.22 N/D
GGAAGAAAGCGCGTCAGTAA
Diplodia spp. DpF/DpR GTGTAAGTTTGCGCTGTCTTTG/ 118 y = –0.2566x + 12.8618 D. mutila, D. seriata
GTAGAGAGTACCTCGTTGAAGTAGA
Lasiodiplodia LcBT-F2/LcBT-R2 CTGCTTTCTGGTTTGTTGCC/ 128 y = –0.3055x + 11.9171 L. citricola, L. parva
spp. GAGAAGGCGCACACTTACA
Neofusicoccum NpBT-F2/NpBT-R2 ACCACAGGCAGACCATTTC/ 118 y = –0.2465x + 11.1531 N. mediterraneum,
spp. GTCGGAGGTGCCATTGTAG N. parvum, N. vitifusiforme
Phomopsis/ PhBT-F1/PhBT-R1 CATCGTTACTGACCTCGACTTT/ 102 y = –0.2404x + 12.0255 N/D
Diaporthe spp. ACGAGATTTGAAGACAGGGAATAG
yy is log10 (DNA concentration in femtograms), and x is the cycle threshold (Ct) value from qPCR. All R2 values are >0.99, and P < 0.001.
z N/D = species not defined.

2376 Plant Disease / Vol. 103 No. 9

except for the orchards Dried plum-3 and Pistachio-3 (Fig. 1), dem- higher than or equal to those of other pathogens for all the studied
onstrating the high aggressiveness of this species as a canker-causing crops (Table 3), demonstrating the importance of this fungus as a
pathogen in most tree crops. There was a variation in incidence of canker-causing pathogen among the pathogen groups. Following
Neofusicoccum spp. among different crops (Fig. 1), except that this this, B. dothidea and Cytospora spp. were ranked as second in impor-
pathogen was not detected in the Dried plum-3 orchard. tance in the dried plum and pistachio crops (Table 3). However, there
Comparison among the pathogen groups for each studied tree crop was no difference in incidence among B. dothidea, Cytospora spp.,
showed that incidences of Lasiodiplodia spp. were significantly Neofusicoccum spp., and Phomopsis spp. in almond (Table 3), and

Fig. 1. Incidence (%) of latent infection of shoots of different tree crops caused by six canker-causing pathogens determined in this study. Various numbers of samples were
collected (Table 1). The previously published DNA primers and quantitative real-time PCR assays (Luo et al. 2017) were applied in this study to obtain the incidence data.
The multiple comparisons in proportion data method (Zar 1999) was applied to determine the difference in incidence among orchards. The same letters in the bars indicate
no significant difference in incidence for each canker-causing pathogen group at P < 0.05.

Plant Disease / September 2019 2377

no difference in incidence among B. dothidea, Cytospora spp., and spp., and Neofusicoccum spp. (Table 3). The overall result demon-
Neofusicoccum spp. was found (Table 3) in walnut. strated that no significant difference in MS among the six pathogen
MS of latent infection in shoots. Because the MS was calculated groups was found for most studied tree crops.
only from pathogen-positive samples, MS reflects the average se- LII in shoots. Because LII combined the information of both in-
verity level among the infected samples. The corresponding SD cidence and severity, it can be used to reflect the general situation
reflected the variation of MS among these positive samples. Gen- of latent infection and pathogen population level in an orchard. This
erally, the MS values were in the range between 4.0 and 6.0 with study showed that the range of LII of both Diplodia spp. and Pho-
SD from 0.0 to 1.0 for most cases (Fig. 2). The MS values of all mopsis spp. was below 10% in all the studied orchards, except for
studied pathogens in Dried plum-3 orchard were the lowest among Phomopsis in the Pistachio-1 orchard (Fig. 3). The result implied less
all other orchards (Fig. 2). For B. dothidea, two walnut orchards importance of these two pathogen groups in population development
and two dried plum orchards showed significantly higher MS than in the studied tree crops. However, the range of LII of B. dothidea
the other orchards (Fig. 2). Variation in MS of Cytospora spp. was was from 7 to 31%, with lowest ones in two pistachio orchards
detected among various orchards, whereas the highest MS was pre- (Pitachio-1 and Pistachio-2) (Fig. 3). Clearly, the highest LII oc-
sent in Dried plum-1 orchard, compared with the MS values in the curred in two dried plum orchards at 53 and 41% for Dried plum-1
other orchards (Fig. 2). The range of MS of Lasiodiplodia spp. was and Dried plum-2, respectively, which was much higher than the
from 4.0 to 6.0, with the lowest value in Dried plum-3 orchard LII values of the other orchards (Fig. 3). The lowest LII of Lasiodi-
(Fig. 2). There was no large difference in MS between Neofusicoc- plodia spp. was determined in Dried plum-1 and Pistachio-3,
cum spp. and Phomopsis spp. among the orchards (Fig. 2), demon- whereas there was no significant difference in LII among other or-
strating a similar situation in latent infection by these two pathogen chards, and the range of LII among these orchards was from 21 to
groups. 33% (Fig. 3). These results demonstrated that this pathogen was well
Comparison in MS among different pathogen groups for each tree established across the studied tree crops. Basically, infection level of
crop showed less variations. There was no significant difference in Neofusicoccum spp. was comparatively lower than the levels of the
MS among six pathogen groups for dried plum and pistachio, except three pathogens mentioned above, and its LII values ranged across
that Diplodia spp. showed lower MS than other pathogens for pista- orchards from 14 to 34%, with the highest one in Walnut-1 orchard
chio (Table 3). Similarly, MS of Lasiodiplodia spp. was significantly (Fig. 3). Thus, this pathogen was also evenly distributed across the
higher than that of Diplodia spp. on walnut, whereas no difference tree crops, but at a relatively low level. The overall range of LII val-
was found among other pathogen groups (Table 3). For almond, ues was below 50%. In summary, there were major differences in the
MS values of Lasiodiplodia spp. and Phomopsis spp. were signifi- development of latent infection among these six canker-causing path-
cantly higher than those of other pathogen groups, whereas that of ogen groups. Furthermore, variations in latent infection levels were
B. dothidea was also higher than those of Cytospora spp., Diplodia detected also among the orchards used in this study.

Table 3. Comparisons in incidence, molecular severity (MS), and latent infection index (LII) of canker-causing pathogen groups for each of studied tree cropsz
Pathogen group
Botryosphaeria Cytospora Diplodia Lasiodiplodia Neofusicoccum Phomopsis
Tree crop dothidea spp. spp. spp. spp. spp.
Incidence of latent infection
Shoots
Almond 62.0 b 56.0 b 9.0 c 91.0 a 62.0 b 17.6 bc
Dried plum 70.9 a 68.7 ab 4.3 cd 77.3 a 34.7 c 6.7 d
Pistachio 27.7 b 29.3 b 7.3 c 55.3 a 58.3 a 28.3 b
Walnut 69.5 b 64.0 b 2.0 d 91.0 a 65.0 b 15.0 c
Buds
Almond 55.9 ab 47.1 b 8.8 c 85.3 a 2.9 c 38.2 b
Pistachio 46.9 bc 50.0 b 0.0 d 50.0 b 100.0 a 15.6 c
Walnut 40.0 a 30.0 a 0.0 b 0.0 b 10.0 a 0.0 b
MS
Shoots
Almond 5.4 ± 0.40 b 5.07 ± 0.39 c 6.40 ± 0.41 a 4.60 ± 0.44 d 4.54 ± 0.35 d 5.8 ± 0.59 a
Dried plum 5.29 ± 0.98 a 6.26 ± 1.77 a 6.31 ± 0.49 a 4.40 ± 1.02 a 4.61 ± 0.16 a 5.75 ± 0.18 a
Pistachio 4.98 ± 0.21 ab 5.16 ± 0.62 ab 5.37 ± 0.11 ab 4.25 ± 0.41 b 5.70 ± 0.62 a 5.63 ± 0.85 a
Walnut 5.98 ± 0.12 ab 5.84 ± 0.38 ab 6.76 ± 0 a 5.45 ± 0.46 b 5.78 ± 0.46 ab 6.02 ± 0.49 ab
Buds
Almond 5.20 ± 0.38 d 5.78 ± 0.52 bc 6.64 ± 0.83 a 4.08 ± 0.42 e 4.54 ± 0 cde 6.21 ± 1.23 ab
Pistachio 4.74 ± 0.74 b 2.65 ± 0.26 d … 4.2 ± 0.42 c 5.39 ± 0.68 a 5.63 ± 0.63 a
Walnut 4.5 ± 0.31 a 4.24 ± 0.13 ab … … 3.66 ± 0 b …
LII
Shoots
Almond 22.4 a 19.0 ab 3.8 c 27.9 a 18.8 ab 6.9 bc
Dried plum 25.1 ab 32.4 a 1.5 c 24.1 ab 10.6 bc 2.6 c
Pistachio 8.9 ab 10.1 ab 2.6 b 15.6 a 21.9 a 10.6 ab
Walnut 27.6 a 24.9 a 0.5 b 32.9 a 25.4 a 6.3 b
Buds
Almond 19.4 a 18.1 a 3.9 b 23.2 a 0.9 b 15.8 a
Pistachio 14.8 b 8.8 b … 14.1 b 35.9 a 6.0 b
Walnut 12.0 a 8.5 a … … 2.4 b …
z The multiple comparisons in proportion data method (Zar 1999) was applied to determine the differences in incidence and LII among pathogen groups for each
tree crop. Comparison in MS among pathogen groups was performed with analysis of variance with LSD. Values followed by the same letters were not sig-
nificantly different at P < 0.05 among pathogen groups (in each row) for each tree crop in this study.

2378 Plant Disease / Vol. 103 No. 9

 Considering the comparisons in LII among pathogen groups in al- from the LIIs of B. dothidea, Cytospora spp., and Phomopsis spp.
mond and dried plum, Diplodia spp. and Phomopsis spp. were signif- (Table 3). Similarly, for walnut, LIIs of Diplodia spp. and Phomopsis
icantly lower than those of the other four pathogen groups, in which spp. were significantly lower than those of the other four pathogen
no significant difference was found (Table 3). For pistachio, LIIs of groups (Table 3).
Lasiodiplodia spp. and Neofusicoccum spp. were significantly higher Incidence of latent infection on buds. All the six pathogen
than that of Diplodia spp., whereas they did not differ significantly groups were detected in buds collected from Almond-1 orchard.

Fig. 2. Comparisons in mean molecular severity (MS, see the text for the definition) of latent infection of shoots from various tree crops for six canker-causing pathogen groups. The
previously published DNA primers and quantitative real-time PCR assays (Luo et al. 2017) were applied in this study to determine the MS for each sample. Analysis of variance with
LSD was applied to determine the difference in mean MS among orchards. Vertical bars represent the standard errors for the means. The same letters in the bars indicate no
significant difference in MS for each canker-causing pathogen group at P < 0.05.

Plant Disease / September 2019 2379

B. dothidea, Cytospora spp., Lasiodiplodia spp., Neofusicoccum orchard (Fig. 4), whereas those of Lasiodiplodia spp. and Phomopsis
spp., and Phomopsis spp. were detected in Pistachio-2 orchard, and spp. in Almond-1 orchard were significantly higher than those in
only B. dothidea, Cytospora spp., and Neofusicoccum spp. were de- Pistachio-2 orchard (Fig. 4). Clearly, the incidence of Neofusicoccum
tected in Walnut-2 orchard (Fig. 4). No difference in the incidence of spp. in Pistachio-2 orchard was much higher than those in Almond-1
B. dothidea on buds among the three tree crops was found (Fig. 4). and Walnut-2 orchards (Fig. 4).
The incidences of Cytospora spp. in Almond-1 orchard and Comparisons in incidence among the six pathogen groups for
Pistachio-2 orchard were significantly higher than that in Walnut-2 almond showed that B. dothidea and Lasiodiplodia spp. were

Fig. 3. Latent infection index (%) of shoots (LII, see the text for definition and calculation) of canker disease quantified for the samples from different tree crops for six canker-causing
pathogen groups. The multiple comparisons in proportion data method (Zar 1999) was applied to determine the difference in LII among orchards. The same letters in the bars
indicate no significant difference in LII for each canker-causing pathogen group at P < 0.05.

2380 Plant Disease / Vol. 103 No. 9

significantly higher than those of the other four pathogen groups, spp. were detected (Table 3). However, Diplodia spp., Lasiodiplodia
whereas those of Diplodia spp. and Neofusicoccum spp. were the spp., and Phomopsis spp. were not detected in walnut buds, and no
lowest (Table 3). However, Neofusicoccum spp. was detected on differences in the incidence among the other three pathogen groups
100% buds of pistachio, whereas Diplodia spp. was not detected. were found (Table 3).
The incidence of Phomopsis spp. was the lowest, and no differences MS of latent infection on buds. The MS values of all the patho-
in incidence among B. dothidea, Cytospora spp., and Lasiodiplodia gen groups in Almond-1 orchards were significantly higher than or

Fig. 4. Incidence (%) and molecular severity (MS) of latent infections of six canker-causing pathogen groups for the bud samples collected from three tree-crop orchards. The
multiple comparisons in proportion data method (Zar 1999) and analysis of variance with LSD were applied to determine the difference in incidence and mean MS among orchards,
respectively. Vertical bars represent the standard errors for the means of MS. The same letters in lowercase and uppercase in the bars indicate no significant difference in incidence
and mean MS, respectively, among orchards for each canker-causing pathogen group at P < 0.05.

Plant Disease / September 2019 2381

equal to those of the other two orchards (Fig. 4). Differences in values LIIs of B. dothidea, Cytospora spp., Lasiodiplodia spp., and Pho-
of MS of Cytospora spp. among the three orchards were detected, mopsis spp. were significantly higher than those of other two patho-
and the MS of Neofusicoccum spp. in Walut-2 orchard was signifi- gen groups (Table 3). In pistachio buds, LII of Neofusicoccum spp.
cantly lower than those in the other two orchards (Fig. 4). Compari- was significantly higher than the LII of the other pathogen groups,
sons showed large differences and great variation in MS values whereas it was lower than those of B. dothidea and Cytospora spp.
among the pathogen groups in almond and pistachio buds, whereas in walnut buds (Table 3).
no significant difference in MS between B. dothidea and Cytospora Establishment of pathogen population in latent phase. Regard-
spp. was detected in walnut buds (Table 3). ing the situation of pathogen latent population establishment that we
LII on buds. There was no significant difference in LII among the arbitrarily defined in this study, Phomopsis spp. and Diplodia spp.
three crops for any of the six pathogen groups, except for the LII of were not found in some of the sampled orchards, or they were just
Neofusicoccum spp. in Pistachio-2 orchard, which was significantly found in the starting mode (Fig. 6). The latent populations of Lasio-
higher than those of the other two orchards (Fig. 5). Comparison diplodia spp. have been well established in several orchards of these
among the different pathogen groups in almond buds showed that four tree crops, and similar well-established situations were observed
in a few orchards for B. dothidea and Neofusicoccum spp. popula-
tions. The latent infections of the pathogen populations were at the
developing stage in most orchards (Fig. 6).

Discussion
Using the previously designed primers and qPCR assay, the results
of this study help understand the current situation regarding latent
phase of six canker-causing pathogen groups in shoots and buds of
four different tree crops in California. Variations in the incidence
of latent infection among canker-causing pathogen groups were ob-
served, with Phomopsis spp. and Diplodia spp. showing low levels
compared with those of the other four pathogen groups. High inci-
dences caused by Cytospora spp. were observed in two dried plum
orchards, and dried plum orchards in general are frequently affected
by Cytospora canker. Most orchards showed high incidences caused
by B. dothidea and Lasiodiplodia spp. and moderate levels caused by
Neofusicoccum spp. Among the infected samples, the MSs were
maintained at a certain range among pathogen groups and among tree
crops. This may reflect the detectable infection level in the tissues be-
fore canker symptom appearance. The parameter LII reflected the
overall latent situation of each pathogen in plant tissues, which can
be used as a standard measurement in further studies to evaluate
and compare situations among different causal pathogens and among
various tree crops. Using the concept of latent pathogen population
establishment, we classified each of the six pathogen population lev-
els for the different sampled tree crops. This parameter quantified by
diagnostic laboratories might be used to help growers estimate situ-
ations of latent infection levels in their orchards as a basic informa-
tion for disease management and risk assessment of possible
canker and pathogen population development.
We found that different canker-causing pathogens were predom-
inant on different crops. For instance, the population of Cytospora
spp. is in an increasing mode, and at present Cytospora is consid-
ered a major canker pathogen in dried plum orchards, whereas it is a
minor pathogen in almond and walnut orchards. Phomopsis spp.
could be detected relatively easier in walnut orchards than in dried
plum orchards. Phomopsis spp. have been reported causing a can-
ker and blight disease on walnut (Chen et al. 2014a) but only a fruit
rot in wounded dried plum fruit (Michailides and Morgan 1993a).
Neofusicoccum spp. now is becoming the major causal pathogen of
band canker in almond orchards, whereas the population of this
pathogen seemed not well established in dried plum and walnut or-
chards. However, Lasiodiplodia spp. was found in almost all or-
chards, indicating that it is the most aggressive pathogen of
canker disease across the various tree crops, and the high latent in-
fection levels reflected a high-risk potential of disease development
in the future.
Symptoms and signs of canker diseases develop very slowly in
shoots and other parts of trees, during which the pathogen develop-
ment could last a long time without showing disease signs. Although
the latent infection level of tissues by canker-causing pathogens
could be very low, still the qPCR assay is better than the traditional
plating isolation method, which could not detect any low infection. A
Fig. 5. Latent infection index (%) (LII) of bud samples from three tree crops for six
canker-causing pathogen groups used in this study. The multiple comparisons in previous study in our laboratory showed that the qPCR could pas-
proportion data method (Zar 1999) was applied to determine the difference in LII sively detect samples with low infection levels for some specific
among orchards. The same letters in the bars indicate no significant difference in pathogens, whereas the conventional method of culturing on agar
LII for each canker-causing pathogen group at P < 0.05. media cannot detect them because of the low infection levels in the
2382 Plant Disease / Vol. 103 No. 9
samples and the chance of contamination owing to long incubation investigation to determine how the pathogens could exist in young
time of plated tissues (data not shown). In other words, the whole plants, even in those from nurseries (Stanosz et al. 2005), and how
process of canker-pathogen development inside the plant tissues is they can develop after planting in the field. In our study, most shoot
difficult to elucidate using traditional approaches. Our qPCR assay samples were 1 to 2 years old. The detected pathogens already
overcame this deficiency because it can detect and quantify low lev- existed in young plant tissues in a latent phase of the pathogen spe-
els of latent infection. Thus, the method could be widely used to cies. However, Bills (1996) identified a core group of organisms
study the canker development and epidemiological mechanism be- consisting of ascomycetous fungi. Along with applications of
fore symptom appearance. Similar research had been performed by qPCR in plant pathological research, the pathogen establishment
Luchi et al. (2005). They used species-specific primers in qPCR to process could be detected and quantified at an early stage, and
detect and quantify Sphaeropsis sapinea from inoculated Pinus nigra the mechanisms of interaction between host and pathogen could
shoots. Our study used a similar method to quantify not only one but be more clearly defined. Understanding such processes may help
six different canker-causing pathogens in naturally developed latent monitor pathogen development and design proper disease manage-
infections. ment strategies.
There are still many questions in the development and epidemiol- How the latent pathogen could trigger the appearance of canker
ogy of canker diseases. The initial infection process is still unclear. symptoms is a critical question, needing additional experimentation
Regarding the possible epidemiological mechanisms of canker dis- to obtain the answer. Because types of canker symptoms vary widely,
eases, there might be several possibilities: First, canker development depending on the tree crop, position of trees (bark of stems, branches,
mainly relies on yearly infections through direct penetration, espe- twigs, and even buds), period of growing season, and environments,
cially in severely infected orchards. With the exception of almond, the appearance of symptoms might not be always related to the accu-
inoculum originates mainly from diseased shoots, on which the can- mulation of the pathogens around symptoms. Based on the common
ker fungi produce easily and abundantly the spore-producing struc- knowledge that the development of canker symptoms is linked to en-
tures, pycnidia and perithecia, during the season. Thus, spore vironmental stress, such stress might affect both host and latent path-
inoculum splashed by rain and irrigation water (dried plum, almond, ogens. Using our sensitive qPCR approach, we might be able to
pistachio, and walnut) and airborne inoculum (almond and walnut) determine the early process in interactions among host, pathogen,
could serve as the main source of infection and disease development and environment. Moreover, it is still unknown whether such interac-
(Michailides 1991). Second, pruning wounds (and other type of tion could promote the development of some compounds inside plant
wounds, e.g., those caused by hail, freezing, insects, birds, etc.) serve tissues that are toxic to plant growth, leading to canker symptom ap-
as entrance points for penetration and canker disease development. pearance. Dynamics of latent pathogens during a growing season and
Specifically, pruning wounds could serve as sinks for infection from even over years should be studied by using our qPCR system to fig-
inoculum brought by rain or irrigation water splashing, air, insects, ure out their development patterns, accumulation of latent infection,
birds, or even spread from latent infections on the surface of a shoot possible population change, and even adaption of the pathogens to
(Slippers and Wingfield 2007). Finally, the groups of canker-causing environmental change. Extreme weather (heat or drought) in recent
pathogens behave as latent fungi and exist even early in young plants years in California might promote the quick development of canker
as they grow in a nursery. When these young plants are planted in the disease in different tree crops. Therefore, different from row crops,
field, the latent fungi (Botryosphaeriaceae and Diaporthaceae) could multiyear research is needed to answer questions relevant to canker
accumulate as latent infection in the shoots of the growing trees (Y. development and help design disease management strategies for dif-
Luo and T. J. Michailides, personal observations). Therefore, when ferent tree crops.
trees encounter environmental stress (e.g., drought, freezing, nutrient Chemical control and biocontrol of canker disease are still under
deficiency, etc.) or even wounding (mechanical damage, pruning and study. In addition to uses of host resistance, prevention of entry of
hedging wounds), some of the latent species could transition to caus- pathogenic species and genotypes into the orchards was recom-
ing cankers. And because these pathogens could accumulate in mended (Slippers and Wingfield 2007). Elimination of latent patho-
shoots, canker disease epidemics might not necessarily rely on new gens and reduction of their development in young plants, such as
yearly infections by external inoculum. when they are produced in nurseries, might be suggested. Prediction
The latent fungi were broadly defined as those established inside of canker development trends based on monitoring latent pathogen
healthy plant tissues without causing overt symptoms in or apparent development might help estimate the possible risk of future occur-
injury to the host (Bills 1996; Petrini 1991). It is still under rence of canker disease depending on climatic situations. For all

Fig. 6. Diagram chart of population establishment (see text for the definition) of six canker-causing pathogen groups in shoots and buds for various tree crop orchards used in this
study. I = incidence.

Plant Disease / September 2019 2383

the above, our qPCR system could serve as efficient and valuable tool McDonald, V., and Eskalen, A. 2011. Botryosphaeriaceae species associated with
to achieve the proposed goals. avocado branch cankers in California. Plant Dis. 95:1465-1473.
Michailides, T. J. 1991. Pathogenicity, distribution, sources of inoculum, and
infection courts of Botryosphaeria dothidea on pistachio. Phytopathology 81:
Literature Cited 566-573.
Aćimović, S. G., Rooney-Latham, S., Albu, S., Grosman, D. M., and Doccola, J. J. 2018. Michailides, T. J., and Morgan, D. P. 1993a. Wind scab of French prune:
Characterization and pathogenicity of Botryosphaeriaceae fungi associated with Symptomatology and predisposition to preharvest and postharvest fungal
declining urban stands of coast redwood in California. Plant Dis. 102:1950-1957. decay. Plant Dis. 77:90-95.
Adams, G. C., and Jacobi, W. R. 2016. Cytospora canker of hardwoods. Pages Michailides, T. J., and Morgan, D. P. 1993b. Spore release by Botryosphaeria
91-93 in: Diseases of Trees in the Great Plains. General Technical Report dothidea in pistachio orchards and disease control by altering trajectory angle
RMRS-GTR-335. U.S. Department of Agriculture, Forest Service, Rocky of sprinklers. Phytopathology 83:145-152.
Mountain Research Station, Fort Collins, CO. Michailides, T. J., and Morgan, D. P. 2010. Diseases of tree nut crops caused by
Adesemoye, A. O., Mayorquin, J. S., Wang, D. H., Twizeyimana, M., Lynch, S. Botryosphaeriaceae fungi. CAPCA Adviser 13:34-35, 38-40.
C., and Eskalen, A. 2014. Identification of species of Botryosphaeriaceae Mila, A. L., Driever, G. F., Morgan, D. P., and Michailides, T. J. 2005. Effects of
causing bot gummosis in citrus in California. Plant Dis. 98:55-61. latent infection, temperature, precipitation, and irrigation on panicle and shoot
Ahimera, N., Gisler, S., Morgan, D. P., and Michailides, T. J. 2004. Effects of blight of pistachio in California. Phytopathology 95:926-932.
single-drop impactions and natural and simulated rains on the dispersal of Mila, A. L., and Michailides, T. J. 2006. Use of Bayesian methods to improve
Botryosphaeria dothidea conidia. Phytopathology 94:1189-1197. prediction of panicle and shoot blight severity of pistachio in California.
Bills, G. F. 1996. Isolation and analysis of endophytic fungal communities from Phytopathology 96:1142-1147.
woody plants. Pages 31-63 in: Endophytic Fungi in Grasses and Woody Moral, J., Muñoz-Dı́ez, C., González, N., Trapero, A., and Michailides, T. J. 2010.
Plants—Systematics, Ecology, and Evolution. S. C. Redlin and L. M. Carris, Characterization and pathogenicity of Botryosphaeriaceae species collected
eds. APS Press, St. Paul, MN. from olive and other hosts in Spain and California. Phytopathology 100:
Brown, E. A., and Hendrix, F. F. 1981. Pathogenicity and histopathology of 1340-1351.
Botryosphaeria dothidea on apple stems. Phytopathology 71:375-379. Ntahimpera, N., Driever, G. F., Felts, D., Morgan, D. P., and Michailides, T. J.
Chen, S. F., Morgan, D. P., Hasey, J. K., Anderson, K., and Michailides, T. J. 2014a. 2002. Dynamics and pattern of infection by Botryosphaeria dothidea on
Phylogeny, morphology, distribution, and pathogenicity of Botryosphaeriaceae and pistachio buds. Plant Dis. 86:282-287.
Diaporthaceae from English walnut in California. Plant Dis. 98:636-652. Pathak, T. B., Maskey, M. L., Dahlberg, J. A., Kearns, F., Bali, K. M., and
Chen, S. F., Morgan, D. P., and Michailides, T. J. 2014b. Botryosphaeriaceae Zaccaria, D. 2018. Climate change trends and impacts on California
and Diaporthaceae associated with panicle and shoot blight of pistachio in agriculture: A detailed review. Agronomy (Basel) 8:25.
California, USA. Fungal Divers. 67:157-179. Petrini, O. 1991. Fungal endophytes of tree leaves. Pages 179-197 in: Microbial
Damm, U., Crous, P. W., and Fourie, P. H. 2007. Botryosphaeriaceae as potential Ecology of Leaves. J. H. Andrews and S. S. Hirano, eds. Springer, New
pathogens of Prunus species in South Africa, with descriptions of Diplodia York, NY.
africana and Lasiodiplodia plurivora sp. nov. Mycologia 99:664-680. Phillips, A. J. L., Alves, A., Abdollahzadeh, J., Slippers, B., Wingfield, M. J.,
Diogo, E. L. F., Santos, J. M., and Phillips, A. J. L. 2010. Phylogeny, morphology Groenewald, J. Z., and Crous, P. W. 2013. The Botryosphaeriaceae: Genera
and pathogenicity of Diaporthe and Phomopsis species on almond in Portugal. and species known from culture. Stud. Mycol. 76:51-167.
Fungal Divers. 44:107-115. Rossman, A. Y., Farr, D. F., and Castlebury, L. A. 2007. A review of the
English, H., Davis, J. R., and DeVay, J. E. 1975. Relationship of Botryosphaeria phylogeny and biology of the Diaporthales. Mycoscience 48:135-144.
dothidea and Hendersonula toruloidea to a canker disease of almond. Senanayake, I. C., Crous, P. W., Groenewald, J. Z., Maharachchikumbura, S. S. N.,
Phytopathology 65:114-122. Jeewon, R., Phillips, A. J. L., Bhat, J. D., Perera, R. H., Li, Q. R., Li, W. J.,
Gomes, R. R., Glienke, C., Videira, S. I. R., Lombard, L., Groenewald, J. Z., and Tangthirasunun, N., Norphanphoun, C., Karunarathna, S. C., Camporesi, E.,
Crous, P. W. 2013. Diaporthe: A genus of endophytic, saprobic and plant Manawasighe, I. S., Al-Sadi, A. M., and Hyde, K. D. 2017. Families of
pathogenic fungi. Persoonia 31:1-41. Diaporthales based on morphological and phylogenetic evidence. Stud.
Inderbitzin, P., Bostock, R. M., Trouillas, F. P., and Michailides, T. J. 2010. A six Mycol. 86:217-296.
locus phylogeny reveals high species diversity in Botryosphaeriaceae from Slippers, B., and Wingfield, M. J. 2007. Botryosphaeriaceae as endophytes and
California almond. Mycologia 102:1350-1368. latent pathogens of woody plants: Diversity, ecology and impact. Fungal
Kim, K. W., Park, E. W., and Ahn, K.-K. 1999. Pre-penetration behavior of Biol. Rev. 21:90-106.
Botryosphaeria dothidea on apple fruits. Plant Pathol. J. 15:223-227. Stanosz, G. R., Smith, D. R., and Albers, A. J. 2005. Surveys for asymptomatic
Luchi, N., Capretti, P., Surico, G., Orlando, C., Pazzagli, M., and Pinzani, P. 2005. persistence of Sphaeropsis sapinea on or in stems of red pine seedlings from
A real-time quantitative PCR assay for the detection of Sphaeropsis sapinea seven Great Lakes region nurseries. For. Pathol. 35:233-244.
from inoculated Pinus nigra shoots. J. Phytopathol. 153:37-42. Udayanga, D., Liu, X. Z., McKenzie, E. H. C., Chukeatirote, E., Bahkali, A. H. A.,
Luo, Y., Gu, S., Felts, D., Puckett, R. D., Morgan, D. P., and Michailides, T. J. 2017. and Hyde, K. D. 2011. The genus Phomopsis: Biology, applications, species
Development of qPCR systems to quantify shoot infections by canker-causing concepts and names of common phytopathogens. Fungal Divers. 50:189-225.
pathogens in stone fruits and nut crops. J. Appl. Microbiol. 122:416-428. Úrbez-Torres, J. R., and Gubler, W. D. 2009. Pathogenicity of Botryosphaeriaceae
Ma, Z., Boehm, E. W. A., Luo, Y., and Michailides, T. J. 2001a. Population species isolated from grapevine cankers in California. Plant Dis. 93:584-592.
structure of Botryosphaeria dothidea from pistachio and other hosts in Úrbez-Torres, J. R., Leavitt, G. M., Voegel, T. M., and Gubler, W. D. 2006.
California. Phytopathology 91:665-672. Identification and distribution of Botryosphaeria species associated with
Ma, Z., Luo, Y., and Michailides, T. J. 2001b. Resistance of Botryosphaeria grapevines cankers in California. Plant Dis. 90:1490-1503.
dothidea from pistachio to iprodione. Plant Dis. 85:183-188. Úrbez-Torres, J. R., Peduto, F., Vossen, P. M., Krueger, W. H., and Gubler, W. D.
Ma, Z., Luo, Y., and Michailides, T. J. 2004. Spatiotemporal changes in the 2013. Olive twig and branch dieback: Etiology, incidence, and distribution in
population structure of Botryosphaeria dothidea from California pistachio California. Plant Dis. 97:231-244.
orchards. Phytopathology 94:326-332. Zar, J. H. 1999. Biostatistical Analysis, 4th Ed. Prentice-Hall, Englewood Cliffs, NJ.

2384 Plant Disease / Vol. 103 No. 9