World J Microbiol Biotechnol (2010) 26:1847–1856

DOI 10.1007/s11274-010-0366-y

ORIGINAL PAPER

Preliminary characterization of some Streptomyces species

isolated from a composting process and their antimicrobial
potential
Sabrina Pinto Salamoni • Michele B. Mann • Fabrı́cio S. Campos •

Ana Claudia Franco • José C. Germani • Sueli T. Van Der Sand

Received: 29 October 2009 / Accepted: 19 February 2010 / Published online: 5 March 2010
Ó Springer Science+Business Media B.V. 2010

Abstract The aim of this study was to screen Strepto- showed a broad spectrum of inhibitory activity; of these,
mycetes isolates with antimicrobial and antiviral activity, in the isolate Streptomyces spp. 1S was able to inhibit 46 of
a search for new metabolites. The isolates were obtained the test organisms, and, most importantly, the 16 Gram-
from a composting process, and identified based on mor- negative strains were inhibited. Of the 25 isolates, 44.4% of
phological characteristics and molecular biological meth- the isolates were able to grow and produce bioactive
ods. The antimicrobial activity was determined using the metabolites when grown in submerged culture. Four
double-layer agar method against 53 test organisms (bac- extracts showed a cytopathic effect in 10 CCID50 MDBK
teria, yeasts, and filamentous fungi). All isolates were cell, even though no viricidal effect was observed. The
grown in submerged culture, in mineral salts-starch-casein results obtained with these isolates indicated good bio-
(SC) broth and ISP2 media, and the filtrate cultures were technological potential of these Streptomyces strains.
used in the assays for antibacterial and antiviral activity.
Bovine Herpes virus (BoHV-I) was used for the antiviral Keywords Streptomyces  Antimicrobial  Antiviral 
activity. The morphological and molecular characteristics Secondary metabolites
confirmed that all 25 isolates belonged to the genus
Streptomyces. In the assay for antimicrobial activity, 80%
of the Streptomyces isolates were able to inhibit at least one Introduction
of the test organisms. Of these, 80% were active against
bacteria and 45% against fungi. Eight of the isolates The genus Streptomyces was proposed by Waksman and
Henrici (1943), and classified on the basis of morphologi-
cal and cell-wall chemotaxonomic characters in the family
Streptomycetaceae. They are aerobic, Gram-positive bac-
S. P. Salamoni  M. B. Mann  S. T. Van Der Sand (&) teria that have high DNA G–C% content, contain LL-dia-
Laboratório de Bacteriologia, Departamento de Microbiologia, minopimelic acid, and lack sugars in the cell wall (cell-wall
Instituto de Ciências Básicas da Saúde, Universidade Federal do type I), according to Lechevalier and Lechevalier (1967).
Rio Grande do Sul, Rua Sarmento Leite, 500, sala 158, Porto
They produce a substrate mycelium and extensively bran-
Alegre, RS 90050-170, Brazil
e-mail: svands@ufrgs.br ched aerial hyphae. Characteristic long chains of arthro-
spores are formed in the aerial mycelia at a mature stage of
F. S. Campos  A. C. Franco their life cycle (Anderson and Wellington 2001; Williams
Laboratório de Virologia, Instituto de Ciências Básicas da
et al. 1983).
Saúde, Universidade Federal do Rio Grande do Sul, Porto
Alegre, RS, Brazil Streptomyces species are generally saprophytic, soil-
dwelling microorganisms that spend the majority of their
J. C. Germani life cycle as spores. They are rich sources of many natural
Laboratório de Tecnologia Bioquı́mica, Departamento de
products with biological activity, notably antimicrobials,
Produção de Matéria Prima, Faculdade de Farmácia,
Universidade Federal do Rio Grande do Sul, Porto Alegre, RS, enzymes, enzyme inhibitors, toxins, antitumor agents,
Brazil immunomodulator agents, growth promoters of plants and

123
1848 World J Microbiol Biotechnol (2010) 26:1847–1856

animals, and antiviral compounds (Basilio et al. 2003; Li Materials and methods
et al. 2008; Thakur et al. 2007).
Chemotaxonomic and molecular methods are now used Isolates
together with numerical taxonomic methods to improve our
understanding of species relationships within the genus For this study, 25 Streptomyces isolates were used. The
Streptomyces. These methods include analysis of the cell- strains were previously isolated from composting domestic
wall composition, DNA ± DNA hybridization, ELISA, residue on mineral salts-starch-casein-agar (SCA) medium
low-frequency restriction fragment analysis, and compari- (10.0 g starch, 0.3 g casein, 2.0 g K2HPO4, 2.0 g NaCl,
sons of 16S rRNA and 23S rRNA sequences (Lechevalier 2.0 g KNO3, 0.05 g MgSO47H2O, 0.01 g Fe2(SO4)3
and Lechevalier 1967; Stackebrandt et al. 1991). The c 6H2O, 15.0 g agar). The isolates were recognized on the
variable region of 16S rDNA has been used to resolve basis of morphological features of the colonies (Williams
inter- and- intraspecies relationships within the Strepto- et al. 1983). The colonies with the color and characteristics
mycetes (Anderson and Wellington 2001). of Streptomyces were further purified, and representative
Since the discovery of actinomycin, actinomycetes have cultures were preserved in our culture collection. The
provided many important bioactive compounds of high isolates were recovered in starch-casein (SC) broth. An
commercial value, and continue to be routinely screened aliquot of the preserved culture was inoculated in 5 ml of
for new bioactive substances. Approximately two-thirds of SC and incubated at 37°C for 10 days. After growth, cul-
the thousands of naturally occurring antibiotics have been tures were seeded on SCA medium and incubation took
isolated from these organisms, and about 75% are produced place as before. Those colonies that showed a Streptomy-
by members of the genus Streptomyces (Basilio et al. ces-like appearance were identified using morphological
2003). characteristics (Shirling and Gottlieb 1966; Williams and
Despite the long list of currently available antibiotics Cross 1971).
and their applications, the increase in the resistance of
human-pathogen populations to these compounds is of Characterization of the isolates
primary concern to the medical community and pharma-
ceutical industry, and the problem is particularly severe in The strains were characterized morphologically and phys-
hospitals. The use of antibiotics inevitably selects for iologically, following the directions given by the Interna-
resistant microbes, so there is a continuing and cyclical tional Streptomyces Project (ISP; Shirling and Gottlieb
need for new antibiotics. An antibiotic’s useful lifetime 1966, 1972; Williams et al. 1983). The morphology of
begins to diminish before clinically significant resistance aerial hyphae and substrate mycelia and spore chains was
emerges, impelling the need for new drugs to combat the determined by direct light-microscopy examination of
current generation of resistant pathogens. Therefore, new cultures after 10 days of growth at 30°C (Williams and
sources and strategies are required to find antimicrobial Cross 1971). The strains were grown on yeast extract-malt
agents that combine a broad spectrum of activity with extract agar (ISP2) (Shirling and Gottlieb 1966) and SCA
resistance to inactivation by bacterial enzymes. Recent following directions given in the Bergey’s Manual of
reports show that species of Streptomyces still remain an Systematic Bacteriology (Williams et al. 1989). The color
important source of antibiotics, with applications in med- determinations of the aerial mass, substrate mycelium
icine, veterinary medicine, and agriculture (El-Naggar (reverse color), and pigment production were examined in
et al. 2006; Shiomi et al. 2005). Most of the work of ISP2, inorganic salt-starch agar (ISP4), and glycerol-
screening new antibiotics has been done using a very asparagine agar (ISP5) respectively (Shirling and Gottlieb
limited number of test microorganisms, including Staphy- 1966).
lococcus aureus, Bacillus subtilis, Escherichia coli, Pseu-
domonas aeruginosa, Klebsiella pneumoniae, and Candida Molecular identification of the isolates
albicans (Barakate et al. 2002; Ilic et al. 2007; Saadoun and
Gharaibeh 2003; Thakur et al. 2007). In an effort to In order to confirm the morphological identification of the
broaden the scope of the search for new antibiotics, the isolates, genomic DNA was extracted and one pair of
main objective of this study was to evaluate the antimi- primers used for amplification of the 16S rDNA fragment.
crobial activity of Streptomyces isolates against 53 micro- The amplification was done using a pair of primers designed
organisms, including bacteria, yeasts, and filamentous by Rintala et al. (2001) which are specific for the genus
fungi, pathogenic and non-pathogenic to humans, animals, Streptomyces Strep B (50 ACAAGCCCTGGAAACGGGGT
and plants, as well as viruses; and to select potential iso- 30 ) and Strep F (50 ACGTGTGCAGCCCAAGACA 30 ). The
lates for further studies of production, purification, and PCR reactions were carried out in 0.2 ml tubes in a total
characterization of bioactive compounds. volume of 25 ll. The mixture contained 1x reaction buffer,

123
World J Microbiol Biotechnol (2010) 26:1847–1856 1849

1.5 mM MgCl2, 1U Taq polymerase, 0.2 lM of each primer, visualized by ultraviolet (U.V.) fluorescence after ethidium
0.3 mM deoxynucleotide triphosphates, and 20 ng DNA. bromide staining.
The amplification conditions were: initial denaturing for The sequencing reaction was performed by the Molec-
5 min at 94°C, 35 cycles: 1 min at 94°C; 1 min at 58°C, and ular Biology Laboratory (UFCSPA—Porto Alegre) using
2 min at 72°C, with a final extension at 72°C for 10 min. The the same primers as before and an automated sequencer
reaction products were analysed by electrophoresis for was used for this purpose. The sequence obtained was
45 min at 75 V in 0.8% agarose. compared with the reference species of Streptomycetes
obtained from the genomic database EMBL/GenBank
Restriction digests of amplified products database, using NCBI BLAST.

For the confirmation of the the genus Streptomyces the Antimicrobial activity evaluation
amplification products from the Strep B and Strep F
primers from all isoates were digested with the restriction The antimicrobial activity of the isolates was determined
enzyme XhoII (isoschizomer of BstYI) as proposed by using the double-layer agar method. Streptomyces isolates
Rintala et al. (2001). The reactions were prepared follow- were inoculated, by the spot inoculation method, onto Petri
ing the manufacturer’s instructions individually for each dishes with SCA medium, and incubated at 30°C for
enzyme. All reactions were repeated twice. The reaction 14 days. Each plate was inoculated with four different
products were analysed by electrophoresis for 1 h 30 min isolates of Streptomyces, and three plates were prepared for
at 75 V in 1.5% agarose. each test microorganism. The bacteria and yeast strains to
be tested (Table 1) were grown on trypticase soy broth
(TSB) until the concentration of 109 cells/ml was reached.
Biochemical and physiological characterization
One milliliter (1 ml) of each bacteria culture was mixed
of strain 1S
with 9 ml of Mueller–Hinton agar and poured over the
layer with Streptomyces grown on Petri dishes. The same
For the biochemical and physiological studies of strain 1S,
procedure was performed with 1 ml of yeast on potato
36 tests were applied, including the utilization of 14 car-
dextrose agar (PDA) medium. After the inoculation, the
bohydrate compounds evaluated on basal carbon medium
plates were incubated for 24–72 h at 37°C for bacteria and
(ISP 9), the utilization of seven nitrogen sources, the
28°C for yeasts. After the incubation period, the inhibition
degradation of organic compounds: milk casein, cellulose,
haloes were observed. The filamentous fungi to be tested
Tween 80, gelatin, starch, esculin, urea, H2S production,
were grown on dishes with Sabouraud agar and incubated
production of melanoid pigments and diffusible pigments
at 28°C for 10 days. One aliquot of 2 ml of Sabouraud
on ISP1 medium, and nitrate reductase (Gottieb 1961). The
broth was laid over the colonies, and spores were dispersed
strain was also examined for its ability to grow on medium
with a Drigalsky loop. Aliquots of the spore suspension
supplemented with sodium chloride at concentrations of 4,
were transferred into 10 ml Sabouraud broth, and dilutions
7, 10, and 13% and at temperatures of 20, 37, and 45°C. All
were prepared until a concentration of 106 spores/ml was
cultures were incubated at 28 ± 2°C for 10 days, except
obtained. 1 ml of the suspension was added to 9 ml of
for gelatin liquefaction (21 days). The morphology of the
Sabouraud agar and poured onto the dishes with the
spores was examined by electron microscopy.
Streptomyces growth. The plates were incubated at 30°C
for 7 days. After the incubation period, the inhibition
Genetic characterization of strain 1S haloes were observed.

The 16S rDNA of strain 1S was partially amplified using two Submerged cultures
primers, forward A (50 GAGTTTGATCCTGGCTCAG0 3)
and reverse H (50 AGGAGGTGATCCAGCCGCAC 30 ) Streptomyces isolates were grown in submerged culture in
designed by Edwards et al. (1989). The amplification was 250-ml flasks containing 50 ml of SC broth and ISP2
carried out in 0.2 ml tubes in a total volume of 50 ll. The (Shirling and Gottlieb 1966) culture medium. Inoculation
mixture contained 1x reaction buffer, 1.5 mM MgCl2, 1 U was performed with a 10% culture grown for 48 h, of each
Taq polymerase, 0.2 lM of each primer, 0.3 mM deoxy- isolate. These cultures were grown in a rotary shaker at 150
nucleoside triphosphates, and 20 ng DNA. The amplifica- rev/min at 30°C for 7 days. Each of the resulting culture
tion conditions were: initial denaturing for 5 min at 94°C, 35 broths (approximately 50 ml) obtained following the
cycles: 1 min at 94°C; 1 min at 58°C, and 2 min at 72°C; growth of each isolate in each culture medium was sepa-
with a final extension at 72°C for 10 min. The PCR product rated from the mycelium by centrifugation. The superna-
was detected by agarose gel electrophoresis and was tant, sterilized by filtration, was used for assessment of the

123
1850 World J Microbiol Biotechnol (2010) 26:1847–1856

Table 1 Test organisms, used

Test organisms
in the antimicrobial assay and
percentage of Streptomyces Bacillus cereus ATCC 33019 (32%) Escherichia coli rough 12%
isolates with activity
Bacillus stearothermophilus ATCC 12980 (68%) Escherichia coli LT? (4%)
Bacillus subtilis ATCC 19659 (40%) Escherichia coli ATCC 25922 (4%)
Enterococcus faecium (20%) Enterobacter cloacae ATCC 23355 (4%)
Enterococcus hirae ATCC 10541 (16%) Enterobacter agglomerans (28%)
Lactobacillus plantarum ATCC 4356 (36%) Klebsiella pneumoniae ATCC 13883 (4%)
Listeria inocua ATCC 33090 (32%) Pectobacterium brasiliensis** (4%)
Listeria monocytogenes ATCC 1644 (32%) Proteus mirabilis ATCC 25933 (4%)
Listeria monocytogenes (16%) Pseudomonas aeruginosa ATCC 15422 (8%)
Micrococcus luteus ATCC 7468 (36%) P. aeruginosa ATCC 27853 (8%)
Paenibacillus alvei ATCC 6344 (48%) Ralstonia solanacearum** (4%)
Paenibacillus polymyxa ATCC 842 (32%) Salmonella cholerasius ATCC 13076 (4%)
Staphylococcus aureus ATCC 25923 (40%) Salmonella enteritidis SE 86* (4%)
Staphylococcus aureus INCQS 00387 (40%) Shigella dysenteriae ATCC 13313 (4%)
ATCC American Type Culture S. aureus MRSA ATCC 33591 (16%) Xanthomonas axonopodis pv. citri** (44%)
Collection; INCQS Instituto
Nacional de Controle de S. agalactiae ATCC 17153 (36%) X. campestris pv. campestris** (4%)
Qualidade em Saúde (Fundação Streptococccus pyogenes ATCC 8668 (36%) Microsporus gypseum * (0%)
Oswaldo Cruz, Rio de Janeiro, Alternaria solani (4%) Penicillium verruculosum (12%)
Brazil); * Sample from the
Bipolaris oryzae (4%) Penicillium thomii (12%)
Instituto de Ciências e
Tecnologia dos Alimentos— Bipolaris sorokiniana 98017 (4%) Rizoctonia (0%)
ICTA/UFRGS, B. sorokiniana 98022 (4%) T. mentagrophytes (8%)
** Departamento de Fitotecnia, Fonsecaea pedrosoi 46422 (4%) Verticillium alboatrum (4%)
Faculdade de Agronomia
(UFRGS), Mycology laboratory Fusarium oxysporum (4%) Candida tropicalis (4%)
collection ICBS/UFRGS. All Candida albicans ATCC 10231 (16%) Saccharomyces cerevisiae (12%)
other samples are from our own Candida albicans (4%) Candida glabrata (0%)
laboratory collection

extracellular antimicrobial activity by the agar-well diffu- inhibition zones were measured. Assays were carried out in
sion method against test microorganisms and the antiviral triplicate.
test. The crude antimicrobial compound was recovered
from the culture filtrate of each active isolate by solvent Cytotoxic and antiviral activity
extraction with ethyl acetate. Ethyl acetate was added to
the filtrate in the ratio 1:2 (v/v) and shaken vigorously for Tests were performed using bovine kidney cells (Madin-
30 min. The extraction was repeated three times. The Darbyn bovine kidney—MDBK) for the multiplication of
organic layers were collected, and the organic solvent was bovine herpesvirus type I (BoHV-I), and for the cytotoxic
evaporated to dryness in a vacuum evaporator at 40°C to and antiviral tests. Cells were cultured in Eagle minimal
obtain a gummy crude extract. essential medium (E-MEM), supplemented with 10% fetal
calf serum, 2.5 lg of amphotericin B, and 10 lg of enro-
Antibacterial activity of the filtrate floxacin. The BoHV-l sample used was EVl 123/98, iso-
lated in the state of Rio Grande do Sul in southern Brazil
For the evaluation of the antimicrobial activity of the fil- (D’Arce et al. 2002). The cytotoxic assays were performed
trate, the test organisms used were Gram-positive (nine by incubating the samples in duplicate onto MDBK cell
strains) and Gram-negative bacteria (seven strains). By monolayers cultured in 96-well microplates. Serial dilu-
means of a sterile cork borer, wells were punctured in tions on Log2 up to 1:64 of the crude extract and the
plates containing Mueller–Hinton agar previously seeded organic fraction were prepared, and 50 ll of each dilution
with one of the test organisms. One hundred microliters of was added to the cell monolayer in the microplates. Plates
supernatant of each isolate was added in each well. The were incubated at 37°C for 24–72 h. The morphological
Petri dishes were incubated at 8–10°C for 16 h for the alterations of the treated cells were observed by means of
diffusion of the bioactive compound. After that, the incu- an inverted optical microscope. The lowest dilution of the
bation continued at 37°C for 24 h. After incubation, organic fraction or the crude extract that did not cause

123
World J Microbiol Biotechnol (2010) 26:1847–1856 1851

visible morphological cell changes was designated the characteristics. The isolates were identified to genus level
minimum non-toxic dilution (Miranda et al. 1997). To by comparing the morphology spore chain as described in
detect a possible antiviral effect of the samples, MDBK Bergey’s Manual (Table 2). In order to determine their
cells were infected with 100 and 50% cell-culture infective taxonomic status, more detailed characterization studies
doses (CCID50). Next, 50 ll of Streptomyces extract was were carried out. Some of the cultural characteristics of the
added to the infected cells in duplicate. Microplates were strains are given in Table 2.
incubated at 37°C with 5% CO2 for 96 h. During this The 25 isolates, when submitted to amplification with
period, the cells were observed using an inverted optical the Strep B and Strep F primers, yielded a product with a
microscope, for any characteristic sign of cytopathic effect. molecular weight around 1074 bp, The amplified products
The complete inhibition of the cytopathic effect in the of all isolates after digestion with the restriction enzyme
presence of a minimal 10 CCID50 was considered as an XhoII generated two fragments of approximately 567 and
antiviral activity. Virus titers (CCID50) were calculated by 507 bp as expected for Streptomyces sp. isolates (Fig. 1).
the Reed and Muench (1938) statistical method. Cells and In this study, 25 Streptomyces isolates were screened
virus controls were included in all assays. against 53 test organisms, including bacteria, yeasts, and
filamentous fungi, searching for bioactivity of the Strep-
tomyces isolates against these strains (Table 1). Eighty
Results percent of the isolates were active against one or more of
the test organisms. Of these, 90% (18) showed activity
The isolates were identified as species belonging to the against bacteria, 45% (9) against fungi, and 35% (7) of the
genus Streptomyces by analyzing their morphological isolates showed activity against both bacteria and fungi. Of

Table 2 Cultural characteristics of the Streptomyces isolates

Isolates Aerial mycelium Substrate mycelium Melanin (ISP1) Soluble pigment Microculture
(mycelium)
ISP2 ISP4 ISP5 ISP2 ISP5

1S W G W W R absent R S
2S G G W G R absent R S
3S G G G Br W absent Absent F
6E G G G W G absent absent S
6S G G G G R absent R S
8E G G G W Y absent absent RA
8S G G G Br G absent absent S
23 NG W NG B B absent Absent F
28 G G W Br W absent absent RA
29 G NG G W G absent absent F
31 W NG Y W W absent Absent ND
34 W/G G G B W absent Absent S
36 Gr Gr Gr Gr Gr absent Absent S
37 G G Y G B absent Absent ND
43 G NG G R R absent R S
47 G G G W G absent Absent F
48 G G G G G absent Absent S
50 G G G W G absent Absent RA
77 Gr Gr Gr/G Gr Gr absent Absent S
83 Gr Gr Gr Gr Gr absent Absent S
84 Gr G Gr Gr Gr absent Absent S
95 G G G G Gr absent Absent S
103 Y W Y Y Y absent Absent F
107 Y W Y Y Y absent Absent ND
AP G G G R R absent R S
S spiral; F flexous; RA retinaculiaperti; ND not determined; NG no growth; G gray; Y: yellow; R red, W white; B beige; Br brown; Gr green

123
1852 World J Microbiol Biotechnol (2010) 26:1847–1856

The 18 isolates that produced antibacterial metabolites

were fermented in two different liquid media: ISP2 and SC
broth. Only eight isolates were able to grow in liquid media
and showed antibacterial activity. The others grew in liquid
culture, but were unable to produce bioactive metabolites.
SC broth seemed to be the most favorable medium for
development and antibiotic production for most of this
isolates, even though for isolate 1S the the best results were
obtained in ISP2 medium (Table 4). Isolates 48 and 50,
when grown on SC medium, showed the best haloes among
all the isolates. This two isolates showed a very good
activity against Enterococcus hirae, S. aureus (MRSA) and
Fig. 1 Amplification products generated with the pair of primers S. galactiae. However, isolate 1S, when grown in ISP2
StrepB/StrepF digested with restriction enzyme XhoII. (1) Molecular
weight marker Ladder 100 pb, (2) Streptomyces rochei positive medium, was able to inhibit all Gram-negative strains
control (3) isolate 1S, (4) isolate 2S, (5) isolate 8S, (6) isolate 28, (7) tested in this assay, and most of the Gram-positive bacteria
isolate 37, (8) isolate 48, (9) isolate 50, (10) isolate 77 (Table 4). So, due to the promising results obtained in the
first screening and in submerged culture Streptomyces sp.
the Streptomyces isolates that showed antibacterial activity, 1S strain was selected for taxonomic study. Microscopic
all of them inhibited the growth of Gram-positive bacteria, examination of the selected isolate revealed that aerial
and 55.6% inhibited Gram-negative bacteria. mycelia produced branched spiral spore chains with hairy
The percentage of Streptomyces isolates that inhibited surfaces (Fig. 2). The spore mass was gray and the reverse
Gram-positive bacteria varied from 8 to 68% and a much red. A soluble red pigment was produced in all media used.
lower percentage, 4–44%, were able to inhibit Gram-neg- For the physiological studies 36 tests were considered.
ative bacteria. Of the 16 Gram-negative bacteria tested, 10 Isolate 1S was able to use L-arabinose, D-fructose,
were inhibited by only one isolate. Antifungal activity was D-galactose, D-glucose, D-lactose, D-manose, cellobiose,
detected in 36% of the Streptomyces isolates. C. D-maltose, L-rhamnose, D-xylose, D-salicin, mesoinositol,
Of the isolates that showed antimicrobial activity, eight threalose, D-mannitol, D-raffinose, as sole carbon sources but
(40%) showed a wide spectrum of antibacterial activity. On did not use adonitol. As nitrogen sources arginine, histidine,
the other hand, only one isolate showed a wide spectrum serine, threonine and valine were used but not phenylalanine
against fungi (Table 3). One isolate Streptomyces spp. 1S, and methionine. Extracellular enzyme production showed
showed a broad spectrum of activity, inhibiting 46 strains cellulase, lipase, Tween-80, gelatin liquefaction and the H2S
of the 53 test organisms used in this study, including production. However, there was a negative response for
bacteria and fungi. Each Streptomyces isolate showed a esculin and starch hydrolysis, milk coagulation, nitrate
particular spectrum of antimicrobial activity. These results reduction and urease production. This isolate grew in a range
indicated the high physiological and metabolic diversity of of temperatures from 20 to 37°C and a weak growth occured
these isolates. in the presence of 7, 10 and 13% (w/v) NaCl.
The partial 16S rDNA sequence (641 nucleotides) of
strain 1S was determined The sequence obtained was
Table 3 Streptomyces isolates that showed a broad spectrum of aligned with all available Streptomyces references avail-
activity in the antimicrobial assay against 53 test organisms able in the GenBank database. The results confirmed that
Isolates Gram- Gram- Yeasts Filamentous Test strain 1S belongs to the genus Streptomyces. Analyses
positive negative (n = 5) fungi organisms based on 16S rDNA sequence similarities showed that
bacteria bacteria (n = 15) inhibited strain 1S shows 96% similarity with Streptomyces dia-
(n = 17) (n = 16)
staticus. The physiological properties that distinguished
1S 14 16 4 12 46 strain 1S from the strain S. diastaticus are summarized in
2S 16 5 0 0 21 Table 5.
3S 16 3 1 0 20 In the assay for antiviral activity, only four crude
29 11 1 0 0 12 extracts were able to inhibit the appearance of a cytopathic
48 17 3 0 0 20 effect caused by the growth of BoHV-1 in MDBK cells.
50 17 2 0 0 19 Two of these extracts were obtained from the growth of
8S 15 3 0 0 18 isolates on SC broth, and the other two from growth in
AP 16 3 0 1 20 ISP2 medium. One isolate grown on SC was able to inhibit
the cytopathic effect with 10 and 100 CCID50, and the

123
World J Microbiol Biotechnol (2010) 26:1847–1856 1853

Table 4 Isolates that grew in SC and ISP2 media, in submerge culture condition, and showed inhibitory activity against test bacteria
Culture media SC/ISP2
Streptomyces iolates 1S 2S 3S 8S 48 50 83 AP
Test organisms Inhibition zone (mm)

B. stearothermophilus ATCC 12980 NI/14 33/30 34/NI 15/NI 38/39 35/35 12/NI 17/NI
B. subtilis ATCC 19659 NI/21 13/26 15/NI NI/NI 15/NI 15/NI NI/NI 22/NI
E. hirae ATCC 10541 NI/NI 29/NI 24/NI 25/NI 29/27 27/31 NI/NI 21/NI
L. monocytogenes ATCC 1644 NI/15 13/NI NI/17 NI/NI 22/NI 21/NI NI/NI 21/NI
S. aureus ATCC 25923 12/25 20/29 26/NI 20/NI 21/NI 25/NI NI/NI 22/NI
S. pyogenes ATCC 8668 NI/19 23/25 NI/NI NI/NI 22/NI 25/NI NI/NI 21/NI
S. agalactiae ATCC 17153 NI/NI 21/19 24/NI 19/NI 20/33 13/34 NI/NI 21/NI
S. aureus -MRSA NI/11 16/17 25/NI 26/NI 29/29 29/NI NI/NI 22/NI
P. polymyxa ATCC 842 11/13 24/19 27/NI NI/NI 26/NI 25/NI NI/NI 14/NI
S. enteritidis SE 86 NI/15 NI/NI NI/NI NI/NI NI/NI NI/NI NI/NI 24/NI
R. solanacearum NI/14 NI/NI NI/NI NI/NI NI/NI NI/NI NI/NI NI/NI
E. coli ATCC 25922 NI/11 NI/NI NI/NI NI/NI NI/NI NI/NI NI/NI NI/NI
K. pneumoniae ATCC 13883 NI/13 NI/NI NI/NI NI/NI NI/NI NI/NI NI/NI NI/NI
P. aeruginosa ATCC 15422 NI/11 15/NI NI/NI NI NI NI/NI NI/NI NI/NI NI/NI
X. axonopodis pv Citri NI/20 27/NI 17/NI 24/NI 29/NI 32/NI NI/NI 23/11
The inhibition zone was measured and determined by the media of the repeations
NI no inhibitory activity

other three isolates showed an inhibitory effect only with It has been estimated that the genus Streptomyces might
10 CCID50. However, a viricidal effect was not observed, produce at least 1,000,000 new compounds of biological
as tested by incubation with serial dilutions of the virus and interest (Watve et al. 2001). Screening, isolation, and
the crude extracts of these bacteria incubated before being characterization of promising strains of actinomycetes
overlaid on cell monolayers (data not shown). producing potential antibiotics has been a major area of
research of many groups for many years (Forar et al. 2006,
2007; Hacène et al. 2000). A very wide variation in the
Discussion percentages of active isolates and activity spectra has been
observed. These variations result from the great metabolic
On the basis of their morphological and chemical proper- diversity of these isolates and the methodology used for the
ties, the 25 isolates from this study were all classified in the screening activity. In this study, antimicrobial activity was
genus Streptomyces. The characterization of Streptomyces observed in 80% of the isolates. Similar results have been
species is mainly based on the color of aerial and substrate obtained by different authors, and the numbers of isolates
mycelia, the soluble pigment, and the shape and orna- with antimicrobial activity ranged from 45.9 to 96% of the
mentation of the spore surface, because of their stability isolates (Ndonde and Semu 2000; Sahin and Ugur 2003).
(Shirling and Gottlieb 1966; Williams et al. 1983). Since In this study, 40% of the isolates were able to inhibit
phenotypic properties often provide insufficient taxonomic Gram-negative bacteria, among them Pseudomonas spp.
resolution at species level, synonymies among species and E. coli. These two strains are usually among the test
names exist. The classification of streptomycetes has organisms used in screening projects, and are the least
become clearer since the application of genotypic approa- susceptible to different kinds of metabolites (Barakate et al.
ches, but in practical terms, the large number of validly 2002; Basilio et al. 2003). In this study, the Streptomyces
described species in the genus remains the main obstacle in isolates showed a low spectrum of activity against Gram-
Streptomyces taxonomy. For the genus confirmation of all negative bacteria. Only strain, Streptomyces 1S, showed a
isolates primers Strep B/Strep F associated with the broad activity spectrum, inhibiting all the Gram-negative
restriction enzyme BstYI was used. In this work the test organisms.
enzyme XhoII (an isoschizomer of BstYI), was used instead It has been reported by many workers that Streptomyces
and the results confirmed a pattern of two fragments (567 isolates show a higher antibacterial than antifungal activity.
and 507 bp) for all 25 isolates, as described by Rintala These results might result from the higher frequency of use
et al. (2001). of bacteria as test organisms than of fungi. Basilio et al.

123
1854 World J Microbiol Biotechnol (2010) 26:1847–1856

these microorganisms. The broad spectrum of activity

detected in some of the Streptomyces isolates in this study
could be due to different antimicrobial compounds produced
by the isolates, each one with a species- or group-specific
activity, as previously reported by Wang et al. (2006); and/or
to the presence of more than one compound with a broad
spectrum of action, such as the antibiotic daptomycin, which
is able to inhibit different Gram-positive bacteria (Kern
2006), and meroparamycin, which is active against Gram-
positive bacteria, yeasts, and filamentous fungi (El-Naggar
et al. 2006), among others.
The Streptomyces isolates in this study showed 20 dif-
ferent patterns of activity. This means that each isolate has
its own spectrum of antimicrobial activity, again demon-
strating the physiological and morphological diversity of
Fig. 2 Spore surface ornamentation of isolate Streptomyces spp. 1S these isolates. Taddei et al. (2006) evaluated the diversity
of metabolites produced by 71 Streptomyces isolates, and
(2003) detected antibacterial and antifungal activity in 67 found only two isolates that showed the same pattern.
and 52% of isolates tested, respectively: on the other hand The strain 1S was characterized by cultural and micro-
Kitouni et al. (2005), observed a very low number of iso- morphological characteristics that are consistent with the
lates with bioactive metabolites: only 8% of the isolates assignment to the genus Streptomyces. The 16S rDNA
showed activity against fungi. In our work, 36% of the sequence of strain 1S was compared to those of other
isolates inhibited the test fungi, which is a promising result. Streptomyces species; it showed a sequence similarity of
The active isolates, when subjected to submerged culture, 96%, with S. diastaticus the most closely related species. In
showed different activity from that found in the primary spite of the relative high molecular similarity of the two
screening in agar medium. Of the 18 active antibacterial organisms (strain 1S and S. diastaticus) both strains
isolates, only 44.5% of the isolates were active in liquid showed similar patterns for carbohydrate assimilation but
media. For all selected isolates, the antimicrobial activity also there were some interesting physiological differences
was more significant in solid than in liquid media. It has been
established that solid medium is more appropriate for the
development of isolates and the production of antibiotics
Table 5 Physiological characteristics that distinguish strain 1S from
(Iwai and Omura 1982; Badji et al. 2005). Similar results the most closely related species
with submerged cultures were observed by other authors
(Ilic et al. 2007; Aniboun et al. 2008; Thakur et al. 2007). Characteristics Streptomyces sp. S. diastaticus
1S
Besides their antibacterial and antifungal activities, the Spiral Spiral-rectin
crude extracts of four isolates also showed antiviral activity flexous
at non-toxic dilutions. These results indicate that the bio-
Production of melanoid – ?
active compounds were not able to directly inactivate the pigment
virus particles, which would lead to an impairment of the
Diffusible red pigment ? –
first steps of virus multiplication, such as adsorption and/or
Degradation activity
penetration. Similar results were found in previous studies of
Starch – –
the antiviral activity of purified Streptomyces metabolite
Casein – ?
(Sacramento et al. 2004). An inhibitory effect on the repli-
Esculin – ?
cation of human herpesvirus type 1 (HHV-1) and of type A
Gelatin – ?
influenza virus was also observed in a previous study on the
Growth at:
production and activity of proteolytic inhibitors isolated
NaCl 7% ? –
from different strains of Streptomyces (Serkedjieva and I-
NaCl 10% ? –
vanova 1997).
NaCl 13% ? –
The genus Streptomyces shows great morphological,
Histidine ? –
physiological, metabolic, and genetic diversity. This diver-
sity can also be observed in the diverse array of antibiotics, Valine ? –
including aminoglycosides, macrolides, b-lactams, pep- Nitrate reduction – ?
tides, polyenes, polyether, and tetracyclines produced by Urease – ?

123
World J Microbiol Biotechnol (2010) 26:1847–1856 1855

among them (Table 5). This may also suggest that strain 1S Iwai Y, Omura S (1982) Culture conditions for screening of new
is novel. antibiotics. J Antibiot 35:123–141
Kern WV (2006) Daptomycin: first in a new class of antibiotics for
The results obtained from this study are promising and complicated skin and soft-tissue infections. Int J Clin Pract
hence merit further studies concerning purification, char- 63:370–378
acterization, and identification of active secondary metab- Kitouni M, Boudemagh A, Oulmi L, Reghiova S, Boughachiche F,
olites. Also, a further study should be carried out to identify Zerizer H, Hamdiken H, Couble A, Mouniee D, Boulahrouf A,
Boiron P (2005) Isolation of actinomycetes producing bioactive
the species of the isolates. substances from water, soil and tree bark samples of the north-
east of Algeria. J Mycol Médicale 15:45–51
Acknowledgments We are grateful to the Coordenação e Aper- Lechevalier HA, Lechevalier MD (1967) Biology of actinomycetes.
feiçoamento Pessoal de Ensino Superior (CAPES/PROF) for financial Annu Rev Microbiol 21:71–100
support for this work and a scholarship for the student. We thank Dr. Li J, Zhao GZ, Chen HH, Wang HB, Qin S, Zhu WY, Xu LH, Jiang
Maria Lúcia Scroferneker for kindly providing some samples of fil- CL, Li WJ (2008) Antitumour and antimicrobial activities of
amentous fungi. endophytic streptomycetes from pharmaceutical plants in rain-
forest. Lett Appl Microbiol 47:574–580
Miranda MMFS, Almeida AP, Costa SS, Santos MGM, Lagrota
MHC, Wigg MD (1997) In vitro activity of extracts of Persea
References americana leaves on acyclovir-resistant and phosphonoacetic
resistant herpes simplex virus. Phytomedicine 4:347–352
Anderson AS, Wellington EMH (2001) The taxonomy of Streptomy- Ndonde MJM, Semu E (2000) Preliminary characterization of some
ces and related genera. Int J Syst Evol Microbiol 51:797–814 Streptomyces species from four Tanzanian soils and their
Aniboun M, Chait A, Zyad A, Taourirt M, Ouhdouch Y (2008) antimicrobial potential against selected plant and pathogenic
Actinomycetes from Moroccan habitats: isolation and screening for bacteria. World J Microbiol Biotechnol 16:595–599
cytotoxic activities. World J Microbiol Biotechnol 24:2019–2025 Reed LJ, Muench H (1938) A simple method for estimating fifty per
Badji B, Riba A, Mathieu F, Lebrihi A, Sabaou N (2005) Activité cent end points. Am J Hyg 27:493–498
antifongique d’une souche d’Actinomadura d’origine saharienne Rintala H, Nevalainen A, Rönka E, Suutari M (2001) PCR primers
sur divers champignons pathogènes et toxinogènes. J Mycol Med targeting the 16S rDNA gene for specific detection of strepto-
15:211–219 mycetes. Mol Cell Probes 15:337–347
Barakate M, Ouhdouch Y, Oufdou KH, Beauliev C (2002) Charac- Saadoun I, Gharaibeh R (2003) The Streptomycetes flora of Badia
terization of rhizospheric soil streptomycetes from Moroccan region of Jordan and its potential as a source of antibiotics active
habitats and their antimicrobial activities. World J Microbiol against antibiotic-resistant bacteria. J Arid Environ 53:365–371
Biotechnol 18:49–54 Sacramento DR, Coelho RRR, Wigg MD, Linhares LFTL, Santos
Basilio A, Gonzalez I, Vicente MF, Gorrochategui J, Cabello A, MGM, Semedo LTAS, Silva AJR (2004) Antimicrobial and
Gonzalez A, Genilloud O (2003) Patterns of antimicrobial antiviral activities of actinomycetes (Streptomyces sp.) isolated
activities from soil actinomycetes isolated under different from a Brazilian tropical forest soil. World J Microbiol
conditions of pH and salinity. J Appl Microbiol 95:814–823 Biotechnol 20:225–229
D’Arce RCF, Almeida RS, Silva TC, Franco AC, Spilki FR, Roehe Sahin N, Ugur A (2003) Investigation of the antimicrobial activity of
PM, Arns CW (2002) Restriction endonuclease and monoclonal some Streptomyces isolates. Turk J Biol 27:79–84
antibody analysis of Brazilian isolates of bovine herpesviruses Serkedjieva J, Ivanova E (1997) Combined protective effect of an
types 1 and 5. Vet Microbiol 88:315–324 immunostimulatory bacterial preparation and rimantadine hydro-
Edwards U, Rogall T, Blöcker H, Emde M, Böttger E (1989) Isolation chloride in experimental influenza A virus infection. Acta Virol
and direct complete nucleotide determination of entire genes. 41:65–70
Characterization of a gene coding for 16S ribosomal RNA. Nucl Shiomi K, Hatae K, Hataro H, Matsumob A, Takahashi Y, Jiang CL,
Acid Res 17:7843–7853 Tomoda H, Kobayashi S, Tanaka H, Omura S (2005) A new
El-Naggar MY, El-Assar SA, Abdul-Gawad S (2006) Meroparamycin antibiotic, actinomycin A9 produced by Streptomyces sp. K01–
production by newly isolated Streptomyces sp. Strain MAR01: 0031. J Antibiot 58:74–78
taxonomy, fermentation, purification and structural elucidation. Shirling EB, Gottlieb D (1966) Methods for characterization of
J Microbiol 44:432–438 Streptomyces species. Int J Syst Bacteriol 13:313–340
Forar LR, Amany K, Ali E, Bengraa CH (2006) Taxonomy Shirling EB, Gottlieb D (1972) Cooperative description of type
identification and biological activities of a novel isolate of cultures of Streptomyces. V. Additional description. Int J Syst
Streptomyces tendae. Arab J Biotechnol 9:427–436 Bacteriol 22:265–394
Forar LR, Ali E, Mahmoud S, Bengraa CH, Hacene H (2007) Stackebrandt E, Witt D, Kemmerling C, Kroppenstedt R, Liesack W
Screening, isolation and characterization of a novel antimicrobial (1991) Designation of Streptomycete 16S and 23S rRNA-based
producing actinomycete, strain RAF10. Biotechnology 4: target regions for oligonucleotide probes. Appl Environ Micro-
489–496 biol 57:1468–1477
Gottieb D (1961) An evalution of criteria and procedures used in the Taddei A, Valderrama M, Giarrrizzo J, Rey-Maikahl C (2006)
description and characterization of Streptomyces. A co-operative Chemical screening: a simple approach to visualizing Strepto-
study. Appl Microbiol 9:55–60 myces diversity for drug discovery and further research. Res
Hacène H, Daoudi-Hamdad F, Bhatnagar T, Baratti JC, Lefebvre G Microbiol 157:291–297
(2000) H107 a new aminoglycoside anti-Pseudomonas antibiotic Thakur D, Yadav A, Gogoi BK, Bora TC (2007) Isolation and
produced by a new strain of Spirillospora. Microbios 102:69–77 screening of Streptomyces in soil of protected forest areas from
Ilic SB, Konstantinovic SS, Todorovic ZB, Lazic ML, Veljkovic VB, the states of Assam and Tripura, India, for antimicrobial
Jokovic N, Radovanovic BC (2007) Characterization and metabolites. J Mycol Médicale 17:242–249
antimicrobial activity of the bioactive metabolites in streptomy- Waksman SA, Henrici AT (1943) The nomenclature and classifica-
cete isolates. Microbiology 76:421–428 tion of the actinomycetes. J Bacteriol 46:337–341

123
1856 World J Microbiol Biotechnol (2010) 26:1847–1856

Wang J, Soisson SM, Young K, Shoop W, Kodali S, Galgoci A, Williams ST, Cross T (1971) Isolation, purification, cultivation and
Painter R, Parthasarathy G, Tang YS, Cummings R, Ha S, Dorso preservation of actinomycetes. Methods Microbiol 4:295–333
K, Motyl M, Jayasuriya H, Ondeika J, Herath K, Zhang C, Williams ST, Goodfellow M, Alderson G, Wellington EMH, Sneath
Hernandez L, Allocco J, Basilio A, Tormo JR, Genilloud O, PH, Sackin M (1983) Numerical classification of Streptomyces
Vicent F, Pelaez F, Colwell L, Lee SH, Michael B, Felcetto T, and related genera. J Gen Appl Microbiol 129:1743–1813
Gill C, Silver L, Hermes JD, Bartizal B, Schmatz D, Becker JW, Williams ST, Goodfellow M, Alderson G (1989) Genus Streptomyces.
Cully D, Singh SB (2006) Platensimycin is a selective FabF In: Williams ST, Sharpe ME, Holt JG (eds) Bergey’s manual of
inhibitor with potent antibiotic properties. Nature 441:358–361 systematic bacteriology. Williams & Wilkins, Baltimore, pp
Watve MG, Tickoo R, Jog MM, Bhole BD (2001) How many 241–258
antibiotics are produced by the genus Streptomyces? Arch
Microbiol 176:386–390

123