Postharvest Biology and Technology 158 (2019) 110999

Contents lists available at ScienceDirect

Postharvest Biology and Technology

journal homepage: www.elsevier.com/locate/postharvbio

Exogenous procyanidin treatment delays senescence of harvested banana T

fruit by enhancing antioxidant responses and in vivo procyanidin content
⁎
Jiao Chena, Fenfang Lia, Yixing Lia, Yaosong Wangb, Chaozheng Wangc, Debao Yuana,d, ,
Yueming Jiangd
a
Hainan Key Laboratory of Banana Genetic Improvement, Key Laboratory of Hainan Province for Postharvest Physiology and Technology of Tropical Horticultural
Products, Haikou Experimental Station, Chinese Academy of Tropical Agricultural Sciences, Haikou 571101, China
b
College of Light Industry Science and Engineering, Nanjing Forestry University, Nanjing 210037, China
c
Inspection and Quarantine Technology Center of Hainan Entry-Exit Inspection and Quarantine Bureau, Haikou, 570311, China
d
South China Botanical Garden, Chinese Academy of Sciences, Guangzhou, 510650, China

A R T I C LE I N FO A B S T R A C T

Keywords: Banana fruit has high nutritional value and is consumed worldwide. However, rapid senescence shortens the
Banana fruit storage time of harvested banana fruit after ripening. Procyanidins (PAs) are excellent antioxidants, but their
Senescence effects on harvested fruit are obscure. Here, we explored the effects of exogenous PAs on senescence in banana
Procyanidins fruit. Notably, a 1% PA solution delayed senescence of banana fruit, as demonstrated by reduced decrease in
Anti-oxidation
pulp firmness, peel color changes, and total soluble solids accumulation in pulp. Reactive oxygen species levels,
Anthocyanidin reductase
malondialdehyde content, and relative conductivity rates in peels were significantly decreased, whereas su-
peroxide dismutase, catalase, and peroxidase activity and expression were enhanced by PA treatment. The
DPPH% scavenging activity in peels of PA-treated fruit was also enhanced, and in vivo PA contents in the peel and
pulp were induced by PA treatment. Overall, PA-dependent delayed senescence could help maintain the
freshness of harvested banana fruit.

1. Introduction lysophosphatidylethanolamine (LPE) plus lecithin (Ahmed and Palta,

2016) or phenylurea plus gibberellin (Huang et al., 2014), edible
As one of the most popular tropical-subtropical fruit, Banana is coatings containing chitosan gallate (Awad et al., 2017; Hosseini et al.,
consumed worldwide owing to its high nutritional value (Yuan et al., 2018) or shellac plus gelatin (Soradech et al., 2017), hot water treat-
2017). For this climacteric type fruit, ethylene is critical to ripening ment (Ummarat et al., 2011), or 1-methylcyclopropene (1-MCP) treat-
process (Ahmed and Palta, 2016). Banana fruit is harvested at green- ment following ethylene-induced ripening (Zhu et al., 2015) or post-
mature stages, followed by ethylene-induced ripening before or after ripening nitrogen treatment (Klieber et al., 2002). The mechanisms
distribution and/or sale. However, rapid senescence, as manifested by through which these treatments prolong storage life generally involve
softening, peel spotting, and fungal decay, will inevitably occur fol- decreases in respiration rates and ethylene production, inhibition of
lowing the ripening process (Ahmed and Palta, 2016; Hailu et al., phospholipase D activity, maintaining the balance between the pro-
2013). This rapid senescence shortens the shelf-life of harvested banana duction of reactive oxygen species (ROS) and the defense of the anti-
fruit after ripening (Bapat et al., 2010; Xiao et al., 2013). oxidant, and inhibition of enzyme catalyzed-phenolic oxidation. These
The investigation of methods to increase the banana-fruit storage effects decrease lipid peroxidation, resulting in maintenance of mem-
life was performed with many postharvest treatments. Improvement of brane integrity and increased storage time.
storage life can be achieved by chemical dips in As one of the most consumed polyphenols in our diet and being also

Abbreviation: PAs, Procyanidins; LPE, lysophosphatidylethanolamine; 1-MCP, 1-methylcyclopropene; ROS, reactive oxygen species; FW, fresh weight; MDA,
malondialdehyde; SOD, superoxide dismutase; CAT, catalase; POD, peroxidase; NBT, nitroblue tetrazolium; DW, dry weight; LAR, leucoanthocyanidin reductase;
ANR, anthocyanidin reductase; RT-qPCR, reverse transcription real-time quantitative polymerase chain reaction; SEMs, standard errors of the means; PPO, poly-
phenol oxidase; ABA, abscisic acid
⁎
Corresponding author at: Hainan Key Laboratory of Banana Genetic Improvement, Key Laboratory of Hainan Province for Postharvest Physiology and Technology
of Tropical Horticultural Products, Haikou Experimental Station, Chinese Academy of Tropical Agricultural Sciences, Haikou 571101, China.
E-mail address: yuandebao@163.com (D. Yuan).

https://doi.org/10.1016/j.postharvbio.2019.110999
Received 30 April 2019; Received in revised form 16 August 2019; Accepted 24 August 2019
Available online 03 September 2019
0925-5214/ © 2019 Elsevier B.V. All rights reserved.
J. Chen, et al. Postharvest Biology and Technology 158 (2019) 110999

called condensed tannins, procyanidins (PAs) are derived from the analyzer (TA.XT.PLUS; Stable Microsystems Texture Technologies Inc.,
condensation of the widely distributed flavan-3-ol in the plant (Santos- UK) with a 2-mm-diameter flat probe, and the parameters of 10-mm
Buelga and Scalbert, 2000). PAs or PA-containing extracts have been penetration depth, and 1 mm s−1 test speed, and the firmness was ex-
reported to have various beneficial effects, including cardioprotective, pressed as N. Pulp tissues were homogenized in a grinder. The homo-
anti-aging, neuroprotective, and anticancer effects (Santos-Buelga and genate was left briefly to settle, and the upper-layer solution was
Scalbert, 2000; Xiao et al., 2018). Many of these biological effects are sampled to measure the contents of TSS. TSS content was expressed as
related to the ability of PAs to form stable complexes with metal ions/ %. TSS was assayed with a hand refractometer (MASTER 53T; Atago
proteins and/or induce antioxidative mechanisms (Santos-Buelga and Co. Ltd., Japan).
Scalbert, 2000). The antioxidant properties of PAs in vitro are primarily
related to their free radical (O2−%, hydroxyl, and DPPH%) scavenging 2.3. Measurements of the rate of respiration and ethylene production
activity, metal chelating properties, and suppression of hydroperoxide
formation (Toro-Uribe et al., 2018). Recently, PAs have been reported Five fingers from each replicate were sealed in a 4.2-L glass jar at
−
to have protective effects against oxidative stress in vivo (Midttun et al., 25 °C for 2 h to detect the rate of ethylene production (ng kg−1 s 1 with
2018; Wu et al., 2018; Xiao et al., 2018). The mechanisms may involve a fresh weight (FW) basis). One milliliter headspace gas withdrawn
reducing ROS signaling (Chen et al., 2018), regulating gene expression from the jar was sampled and analyzed with a gas chromatograph (GC-
(Wu et al., 2018), suppressing metabolic pathway activation (Xiao 2010; Shimadzu, Japan). Measurement of respiration rate was con-
et al., 2018), and modulating transcriptional pathway activation ducted following the method described by Li et al. (2019). Three fingers
(Midttun et al., 2018). The oxidative reaction characterizes the process randomly selected from each replicate were then put inside a sealed
of senescence of the fruit (Marangoni et al., 1996; Tian et al., 2013; 4.2-L glass container at 20 °C for 2 h. After that, 1 mL headspace gas
Yang et al., 2008). One of the major mechanisms underlying the fruit from the jars was analyzed with a gas chromatograph (GC-9A; Shi-
−
natural senescence is the membrane-lipid or protein oxidative damage madzu, Kyoto, Japan). Respiration rate was recorded as μg kg−1 s 1 on
induced by ROS (Tian et al., 2013). However, little information about a FW basis.
the relationship between PAs and the senescence process of harvested
banana fruit is available. 2.4. Analysis of electrolyte leakage, ROS levels, and malondialdehyde
Therefore, in this study, the possible relationship between PAs and (MDA) content
the senescence of banana fruit during the storage at ambient tem-
perature after harvest was investigated. The results will benefit the Electrolyte leakage rates were detected according to the method
extension of storage life of banana fruit in a new way. developed by Wang et al. (2013). Discs of peels (n = 20) were excised
with a stainless 10-mm steel borer from the equatorial part of six ba-
2. Materials and methods nana fingers for each replicate, and then distilled water was adopted to
clean them three times, and absorbent paper was used to dry them. The
2.1. Sampling cleaned discs were then put into a test tube filled with 20 mL distilled
water and hold in a water bath shaker at 25 °C for 30 min. A con-
The banana fruit (Musa spp., AAA group cv. “Brazil”) fingers with ductivity meter (Model DDS-307A; Shanghai Scientific Instruments Co.,
same shape and weight, and no visual defects, were collected at green Ltd., China) was used to detect the electrical conductivity (L0). Then the
mature stage (75–85% maturity) from a farm near Haikou, China. temperature of the tubes were raised to 100 °C for 20 min and then
Fingers (n = 300) were randomly separated into two lots (n = 150), sharply decreased to room temperature. The electrical conductivity of
control and PA group. For each group, there are three replicates the tubes was measured again as L1. The electrolyte leakage rate was
(n = 50). In the initial study, the fruit were firstly treated with PA so- quantified according to the following equation: electrolyte leakage (%)
lution (0%, 0.5%, 1%, or 2%) and then by 100 μL L−1 ethylene for 24 h, = (L0 / L1) × 100%.
after that they were kept at 23 ± 2 °C for 7 days. It was revealed that The O2−· production rate was measured as described by Zhang et al.
1% PA solution showed the best effects on delaying banana fruit se- (2018). Two grams of frozen peel samples were homogenized with 5 mL
nescence. In the first lot, fruit were firstly immersed in the 1% PA so- of 50 mM phosphate buffer solution (1 mM ethylene diamine (w/v),
lution stored in a sealed 30-L vacuum container with 5-min low pres- 0.3% Triton X-100, pH 7.8). The mixture was then centrifuged at 4 °C
sure (−0.05 M Pa) infiltration, and then incubated at atmospheric and 10,000×g for 15 min. The upper layer was used to assess the
−
pressure for 3 min in the solution. As the control, in the second lot 1% production rate of O2−% (nmol min−1 g 1 FW), which was calculated
PA solution was replaced with sterile deionized water. After air drying with a standard curve generated from sodium nitrite. H2O2 content
for 2 h, 100 μL L−1 ethylene was used to treat the banana fruit sealed in (mmol kg−1 peel FW) was spectrophotometrically measured with a
the jars at 23 ± 2 °C and 80–90% relative humidity for 24 h. After the hydrogen peroxide measuring kit (Jiancheng Bioengineering Co., Ltd.,
treatment, all fingers were stored in low density polyethylene bags China) according to the manual.
(0.01 mm in thickness) at 23 ± 2 °C for 7 d. Sampling was performed The content of MDA content was detected following the modified
at 1, 3, 5, and 7 d of storage. Ten fingers from each replicate was methods described by Chen et al. (2008). Homogenization of frozen
sampled to measure color, firmness, total soluble solids (TSS), electro- peel samples (2.0 g) was carried out in 8 mL phosphate buffer (50 mM,
lyte leakage, the rates of respiration and ethylene production. The pH 7.8). After the centrifugation at 4 °C and 12,000xg for 20 min, 1 mL
samples for subsequent analysis were prepared by firstly cutting the upper-layer solution was mixed with 3 mL of the 0.5% thiobarbitur-
peels and pulps of 10 banana fingers into pieces which were then liquid- icacid (w/v) and the mixture was kept in a boiling water bath for
nitrogen frozen and last kept at −80 °C. Before analysis, they were 15 min, and then it was cooled quickly. The absorbance at 450, 532 and
thoroughly homogenized. 600 nm for the mixture was recorded after being centrifuged at 12,000
× g for 10 min. The content of MDA (mmol kg−1 peel FW) was assessed
2.2. Quality evaluation following the equation: 6.453 × (A532 – A600) – 0.563 × A450.

Measurement of peel color of each finger and firmness of each 2.5. Enzyme activity analysis
peeled banana finger pulp were carried out at four and three locations,
respectively, around the equatorial region. The peel color was mea- To assess the activities of different enzymes, the buffers used to
sured with a chromameter (Konica Minolta, CR-400; Japan) and re- homogenize the frozen peel powders (2 g) were as follows: for the en-
corded as hue angles (h). Firmness was measured with a texture zymes of SOD (EC 1.15.1.1) and CAT (EC 1.11.1.6), 10 mL of sodium

2
J. Chen, et al. Postharvest Biology and Technology 158 (2019) 110999

Table 1
Primers used for real time quantitative PCR analysis.
Name Accession number Forward primer (5＇-3＇) Reverse primer (5＇-3＇) Product (bp)

MaSOD-1 XP_009392732 GGGCAATTGACACAGACTTTG CTAACCACACCCATCCAGATC 96

MaCAT HM061079.1 TACTACTCCGACGACAAGATG TGAAGGGAAGTAATCGACCT 186
MaPOD-1 XP_009392193 GGAGAAAGATGGAGTTGGGAG TGTTGCCATGCTCGTTGTAG 180
MaANR XP_018677429 CAACTTCCGATACTGATCCGAG GTACTTGAACCCCATCTCTTCC 90
MaCAC HQ853240 CTCCTATGTTGCTCGCTTATG GGCTACTACTTCGGTTCTTTC 146

phosphate buffer (100 mM, pH 7.5, 5% (w/v) polyvinypyrrolidone, enzymes, 5 PA-specific pathway genes (2 genes of LAR encoding leu-
5 mM dithiothreitol); for the enzyme of POD (EC 1.11.1.7), 8 mL of coanthocyanidin reductase and 3 genes of ANR encoding anthocyanidin
sodium phosphate buffer (50 mmol L−1, pH 6.8, 5% (w/v) poly- reductase) were selected from banana genome. Reverse transcription
vinylpyrrolidone). All the buffers were precooled to 4 °C before using. real-time quantitative polymerase chain reaction (RT-qPCR) was used
The inhibition degree of the photoreduction of nitroblue tetrazolium to analyze the expression levels of the genes mentioned above. And the
(NBT) at 560 nm in absorbance by the enzyme was use to assess its SOD expression levels of several genes (1 gene of SOD, POD or CAT in ba-
activity. 50% NBT reduction represents one unit (U) of SOD activity. nana peel, 1 gene of ANR both in banana peel and pulp) were modu-
The decomposing capacity for H2O2 was used to assess CAT activity lated by exogenous PA treatment. These genes were named MaSOD-1,
which can be detected at 240 nm. The 1 nmol decomposing of H2O2 per MaPOD-1, MaCAT and MaANR respectively. Among them, only MaCAT
min was regarded as one unit (U) of CAT activity. The generation of was reported and related to chilling tolerance of banana fruit (Wu et al.,
tetraguaiacol from guaiacol cause by H2O2 was used to evaluate the 2014). Frozen peel or pulp powders (0.1 g) were mixed thoroughly with
POD activity, which can be detected at 470 nm. The increase of 0.01 in liquid nitrogen. TRNzol RNA Reagent kit (Invitrogen, Shanghai, China)
absorbance at 470 nm per min was regarded as one unit (U) of POD was used to extract total RNA following the manual. A reverse tran-
activity. All enzyme activities are recorded as U g-1 peel FW. scription kit (PrimeScript RT Master Mix, Takara, Kyoto, Japan) was
used for cDNA synthesis from the total RNA. Quantitative PCR (qPCR)
2.6. Nonenzymatic antioxidant activity assay (DPPH %scavenging activity) was carried out in ABI StepOne Real-Time PCR System with SYBR
Premix Ex Taq (Takara, Kyoto, Japan). The PCR was performed with an
Homogenization of the frozen peel powders (3 g) was performed in initial denaturation at 95 °C for 5 min, and then 40 cycles of 15 s at
20 mL methanol (containing 0.5% sodium metabisulfite) and the mix- 95 °C, 30 s at 55 °C and 30 s at 72 °C. MaCAC was used as an internal
ture was centrifuged at 4 °C and 4000 ×g for 20 min. Four layers of reference gene (Chen et al., 2011). Cycle threshold (Ct) values of the
cheesecloth were used to filter the upper-layer solution and the filtered reference gene were used to normalize the gene expression results from
solution was stored at −80 °C in the sealed brown vials. DPPH% RT-qPCR. The formula 2−△△Ct descrived by Livak and Schmittgen
scavenging activity was assessed with the modified method described (2001) was used to assess the relative expression levels of the target
by Duan et al. (2011). The mixture of 20 μL extract and 3 mL of 0.1 mM genes. Three replications of the experiments were performed. RT-qPCR
DPPH% in methanol were incubated at 25 °C for 30 min in the dark. was carried out with the primers showed in Table 1.
After that, the absorbance of the mixture was measured at 517 nm. In
the control, the methanol extract was replaced with methanol and
DPPH% solution was replaced with the blank contained methanol. 2.9. Statistical analysis
DPPH% scavenging activity (%) was evaluated according to the fol-
lowing equations: DPPH% scavenging activity (%) = (1 – [absorbance of Statistical analysis was conducted with the software of SPSS (ver-
sample – absorbance of blank]) × 100%. sion 16.0, SPSS, Inc., Chicago, IL, USA). The means was compared in
independent t tests. All values are described as means ± standard er-
2.7. In vivo PA content measurement rors of the means (SEMs). There is significant difference between two
values when the P value was less than 0.05.
Extraction and measurement of in vivo PAs was conducted fol-
lowing the procedure described by Ghag et al. (2015). Two grams of
frozen banana peel or pulp powders was added to 100 mL aqueous 3. Results
acetone (70:30, v/v), and the mixture was hold at 50 °C and 150×rmp
for 20 min through heating magnetic stirrer (RCT basic; IKA Co., Ltd., 3.1. Peel color, pulp firmness, and TSS content
Germany) and then centrifuged at 2000 × g for 10 min. PA contents in
banana peels or pulp were determined using the butanol−HCl method. As shown in Fig. 1A, PA-treated fruit faded and then became colored
The chemicals firstly added to the 20 mL supernatant included 3.0 mL more slowly than control fruit, indicating the delayed senescence effect
butanol−HCl reagent which was made from the mixing of butanol and of PA treatment. Moreover, senescence was also markedly delayed, as
HCl with the ratio of 19:1 (v/v), 300 μL aqueous acetone, 0.1 mL of 2% demonstrated by the reduced number of brown spots (also called “sugar
(w/v) ammonium ferric sulfate solution and 2 N HCl. Subsequently, the spots”) on the treated fruit surface on day 7 compared with that on the
mixture was mixed by vortexing and in a boiling water bath for 1 h. control fruit (Fig. 1A). The h value, which indicates color change, was
After that, the temperature of the mixture was decreased at room decreased during storage. As shown in Fig. 1B, the h value dropped
temperature and it was chromatographically assessed at 550 nm. The sharply from 118.21 to 92.46 for control fruit on day 7 and from 118.21
standard substance (PA; CAS number: 4852-22-6) was purchased from to 102.08 for treated fruit. As shown in Fig. 1C, decreased firmness in
BSZH Co., Ltd. China and adopted to develop a standard curve. PA treated fruit was delayed by about two days compared with that in
content (g kg−1) was calculated based on the dry weight (DW). Three control fruit. The firmness in the control or treated fruit dropped
replications were performed. sharply from 47.7 to 5.3 or 12.5 N on day 7. Contrary to the rapid
decline in pulp firmness, TSS content increased sharply and then re-
2.8. Gene expression analysis mained stable (Fig. 1D). TSS content in control fruit was significantly
higher than that in treated fruit on days 3 and 5.
In this study, 24 genes of SOD, POD or CAT encoding antioxidant

3
J. Chen, et al. Postharvest Biology and Technology 158 (2019) 110999

Fig. 1. Changes in appearance (A), hue angles (B), firmness (C), and TSS contents (D) in ‘Brazil’ banana fruit treated with 1% PA or water (control) during 7 days of
storage at 23 ± 2 °C. Vertical bars represent SEMs of three replicates. Asterisks indicate that values are significantly different between control and PA-treated fruit at
the same storage time. *P < 0.05.

3.2. Ethylene production and respiration rate production (Fig. 2B).

It was indicated that the production of ethylene was significantly 3.3. Membrane leakage rate, MDA content, and ROS production
inhibited on days 3 and 5 by PA treatment (Fig. 2A). A peak at 1.35 ng
− −
kg−1 s 1 on day 3 for control fruit and at 1.12 ng kg−1 s 1 on day 5 for Membrane damage of banana fruit was evaluated by the electrolyte
treated fruit was identified, respectively (Fig. 2A). The inhibition of the leakage and MDA content. Gradual increases of relative electrolyte
respiration rate by PA treatment was also identified as ethylene leakage and MDA content were observed both in the control and in the

Fig. 2. Changes in ethylene production (A) and respiration rates (B) in ‘Brazil’ banana fruit treated with 1% PA or water (control) for 7 days at 23 ± 2 °C. Vertical
bars represent SEMs of three replicate assays. *P < 0.05 compared with the control at the same time.

4
J. Chen, et al. Postharvest Biology and Technology 158 (2019) 110999

Fig. 3. Changes in relative leakage rates (A), O2−% production rates (B), H2O2 contents (C), and MDA contents (D) in peels of ‘Brazil’ bananas treated with 1% PA or
water (control) for 7 days at 23 ± 2 °C. Vertical bars represent SEMs of three replicate assays. *P < 0.05 compared with the control at the same time.

treatment during the storage. However, the increases were considerably sharply, peaking on the fifth day and then decreasing steadily (Fig. 4E).
delayed by PA treatment (Fig. 3A and B). On days 5 and 7, relative rates MaPOD expression in the treatment showed trends similar to those of
of the electrolyte leakage in control were approximately 16.00% and POD activity (Fig. 4F); expression was four times higher on day 5 in
16.70% higher than those in the treatment, respectively (Fig. 3A). With treated fruit (Fig. 4F).
regard to MDA content on days 5 and 7, the control was approximately
22.47% and 28.37% higher than the treatment, respectively (Fig. 3B). 3.5. DPPH %scavenging activity
The production rate of O2−% in all situation increased firstly and
then decreased during storage. However, it was observed that the ac- The DPPH% scavenging activity in banana peel tissues tended to
cumulation of O2−% and H2O2 content were obviously reduced by PA decrease as storage time increased (Fig. 5). PA treatment increased
(Figs. 3C and D). On the third day, the O2−% production rate and H2O2 DPPH% scavenging activity throughout storage, and the activity in the
content in the control was about 36.71% and 49.43% higher than those treatment was 4% higher than that in the control fruit on the seventh
in the treatment, respectively (Figs. 3C and D). day (Fig. 5).

3.4. Antioxidant enzyme activities and related gene expression 3.6. In vivo PA content and ANR expression

During storage, SOD activity and MaSOD-1 gene expression in- In vivo PA content in peels decreased during storage for all fruit,
creased sharply with the peak on the third day and then decreasing for whereas exogenous PA treatment effectively delayed the decline in PA
all fruit (Fig. 4A and B). Treated fruit showed significantly higher ac- content (Fig. 6A). PA contents in peels for control and treated fruit on
tivities or expression levels than the control from days 3 to 7 (Fig. 4A day 1 were approximately 3.84 and 4.18 g kg−1, respectively, on a DW
and 4B). basis, whereas those on day 7 were 0.52 and 0.74 g kg−1, respectively
The increased expression of MaCAT in the control was observed on (Fig. 6A). PA contents in the treatment were 20.53% and 140.24%
days 3–7, consistent with changes in CAT activity (Fig. 4C and D). higher than those in the control on days 3 and 5, respectively (Fig. 6A).
During storage, the activity changes in the treatment were significantly Expression of the ANR gene, which is involved in the PA synthesis
higher than those in the control, which further supports the higher pathway (Xie et al., 2003), decreased steadily in peels of control and
MaCAT expression in the treatment (Fig. 4C and D). treated fruit during storage (Fig. 6B), and markedly higher MaANR
During most of the storage period, POD activities and MaPOD-1 mRNA levels in peel were observed in the PA-treated group during
expression levels were identified significantly higher in the treatment storage, consistent with changes in PA contents (Fig. 6A and B).
than in the control (Fig. 4E and F). POD activity in all fruit increased PA contents in pulp peaked on day 3 at 2.92 and 3.36 g kg−1 DW in

5
J. Chen, et al. Postharvest Biology and Technology 158 (2019) 110999

Fig. 4. Effects of PA treatment on SOD activity (A), MaSOD-1 expression (B), CAT activity (C), MaCAT expression (D), POD activity (E), and MaPOD-1 expression (F)
in peels of ‘Brazil’ banana fruit treated with 1% PA or water (control) for 7 days at 23 ± 2 °C. The MaCAC gene was used as a reference to normalize gene expression,
and expression levels at different time points were expressed as a ratio relative to the harvest time (0 days in the control), which was set at 1. Vertical bars represent
SEMs of three replicate assays. *P < 0.05 compared with the control at the same time.

the control and the treatment, respectively (Fig. 6C). PA contents were 4. Discusion
higher in the treatment than in the control during storage (Fig. 6C). For
example, PA contents in treated fruit on days 3 and 5 were 1.15 and Climacteric fruit, including banana, exhibit rapid senescence. After
1.35 times higher than those in the control, respectively (Fig. 6C). ripening is initiated by ethylene, major physiological and biochemical
Relative MaANR expression was consistent with the PA content for all changes occur in fruit (Xu et al., 2007). Chloroplasts in banana fruit
fruit. PA treatment induced MaANR expression throughout storage, peel degrade, the color turns yellow, and firmness is reduced (Xu et al.,
resulting in 1.54 and 1.84 times higher expression in the treatment than 2007). In the current study, PA pretreatment effectively suppressed
in the control on days 3 and 5, respectively (Fig. 6D). senescence in banana fruit during storage under ambient conditions,
and these findings were supported by reversal of decreases in h values
and pulp firmness and reduced TSS accumulation in PA-treated banana

6
J. Chen, et al. Postharvest Biology and Technology 158 (2019) 110999

results of our study. Exogenous chlorogenic acid pretreatment by in-

filtration under vacuum has obvious effects on delaying the senescence
of nectarines (Xi et al., 2017). Moreover, oxalic acid exhibited the same
effect as exogenous chlorogenic acid on banana fruit (Huang et al.,
2013). The combination of LPE and lecithin also inhibits the formation
of “sugar spots” in banana fruit without side effects, thereby extending
the storage time of banana fruit by 2–3 d (Ahmed and Palta, 2016),
consistent with our findings.
In accordance with the results of Jiang et al. (1999), ethylene pro-
duction and respiration rate peaks occurred at the same time for banana
fruit during storage in our study (Fig. 2). For climacteric fruit, once
ethylene production increased, rapid aging occurred, resulting in de-
creased quality after ripening (Xi et al., 2017). Increased respiration
rates enhance the aging and senescence of perishable commodities
(Kader, 1986). Therefore, the reduced ethylene production and re-
spiration rate in PA treatment may extend the storage life to a certain
extent. Inhibition of ethylene production and respiration rates in rela-
tion to extended storage life has been reported in melatonin- or salicylic
Fig. 5. Changes in DPPH% scavenging activity in peels of ‘Brazil’ banana fruit acid-treated banana fruit and chlorogenic acid-treated nectarines (Hu
treated with 1% PAs or water (control) for 7 days at 23 ± 2 °C. Vertical bars et al., 2017; Xi et al., 2017). Additionally, Li et al. (2019) also reported
represent SEMs of three replicate assays. *P < 0.05 compared with the control that respiration rates and pericarp browning in litchi fruit were sig-
at the same time. nificantly inhibited by sodium para-aminosalicylate (0.3 g L−1).
The increased rate of membrane leakage revealed that the loss of the
fruit (Fig. 1). Apple and tea polyphenols, which are rich in PAs, show integrity and function of the cellular membrane contribute to the fruit
excellent effects on retaining freshness after harvest in litchi pericarp senescence. Membrane lipid peroxidation is a characteristic of truly
(Chen et al., 2014; Zhang et al., 2015), which is in accordance with the senescing tissues. MDA is a lipid oxidation end product, and oxidative

Fig. 6. Effects of PA treatment on endogenous PA contents (A) and MaANR expression (B) in peels and endogenous PA contents (C) and MaANR expression (D) in
pulp of ‘Brazil’ banana fruit treated with 1% PA or water (control) for 7 days at 23 ± 2 °C. The MaCAC gene was used as a reference to normalize MaANR expression
under identical conditions, and expression levels at different time points were expressed as ratios relative to the harvest time (0 day in the control), which was set at
1. Vertical bars represent SEMs of three replicate assays. *P < 0.05 compared with the control at the same time.

7
J. Chen, et al. Postharvest Biology and Technology 158 (2019) 110999

damage degree to membranes may be directly reflected by its level. expression reduced PA content (Ghag et al., 2015), whereas PA levels
Membrane lipid peroxidation and deterioration can be triggered by were increased by the overexpression of Vitis ANR and Medicago genes
ROS, including O2−% and H2O2, through targeting the side chains of the in tobacco (Bogs et al., 2005; Han et al., 2012; Xie et al., 2003). Si-
unsaturated membrane-lipid fatty acid and catalyzing the oxidative milarly, the accumulation of endogenous melatonin and the expression
reactions. Oxidative stress induced by the free radical contributes to the of associated genes were promoted by the exogenous melatonin (Ma
fruit senescence (Tian et al., 2013). Loss of membrane integrity and et al., 2016; Liu et al., 2018; Tan et al., 2019). Additionally, endogenous
enhancement of MDA levels in banana fruit under oxidative stress melatonin has been shown to act as an antisenescence signaling mole-
during storage have also been identified associated with excessive ROS cule which regulates the enzymatic antioxidant and nonenzymatic ca-
accumulation (Cheng et al., 2008; Duan et al., 2011; Huang et al., pacities (Gao et al., 2016; Tan et al., 2019; Zhang et al., 2016, 2018).
2013). In the present study, during storage PA treatment markedly Interestingly, exogenous melatonin application inhibits abscisic acid
suppressed increases in relative leakage rates and production of H2O2, (ABA) biosynthesis and signaling, resulting in delayed senescence
O2−%and MDA in banana fruit (Fig. 3), which indicates that membrane (Zhang et al., 2017). Furthermore, the application of exogenous mela-
oxidative damage reducing could be the underlying mechanism of PAs tonin delays leaf senescence in Chinese flowering cabbage, partly
to delay senescence. It have been reported that delayed quality dete- through the reduction of the production of endogenous ABA and the
rioration could be resulted from the inhibition of oxidative stress in inhibition of the degradation of chlorophyll due to at least three tran-
melatonin-treated peaches (Gao et al., 2016) and litchi fruit (Zhang scription factors associated with ABA signaling (Tan et al., 2019). The
et al., 2018), and oxalic acid-treated banana fruit (Huang et al., 2013). effects of exogenous PAs against oxidative stress have also been verified
ROS was quenched and redox homeostasis in the cell was main- in animal or human cells via various mechanisms (Chen et al., 2018;
tained by the antioxidant systems, thereby influencing the senescence Midttun et al., 2018; Wu et al., 2018; Xiao et al., 2018). However, it
in fruit. SOD, POD and CAT are the key antioxidase involved in ROS remains unclear that whether in vivo PAs in plants function depends
scavenging (Xu et al., 2009). SOD dismutates O2−% to H2O2, and then only on the antioxidant capacity of PAs or also on the increasing other
CAT rapidly decomposes H2O2 to H2O and O2, and POD catalyzes the nonenzymatic antioxidant accumulation. Accordingly, more studies are
decomposition of H2O2 (Xu et al., 2009). Higher activity of POD pro- necessary to assess the role of in vivo PAs in redox metabolism in ba-
motes conditions that can delay senescence in fruit (Zhou et al., 2011). nana fruit during storage and to examine whether in vivo PAs function
The simultaneous enhancement of SOD, CAT, and POD expression and as antisenescence signaling molecules.
activity in PA-treated banana fruit suggested that excessive ROS was
effectively scavenged by the PA treatment through the increased ac- 5. Conclusion
tivity of the antioxidase via upregulation of gene expression, thereby
alleviating lipid peroxidation and delaying senescence (Fig. 4). In conclusion, treatment with 1% PA solution effectively delayed
The activities of reducing lipid peroxidation and delaying the se- senescence in banana fruit. These effects may include the reduced rates
nescence conferred by these antioxidant enzymes have been reported in of the ethylene production and respiration and the effects of PAs on
many crops, including banana (Huang et al., 2013), strawberry (Xu alleviation of oxidative damage to membranes. Antioxidant enzyme
et al., 2014), litchi (Zhang et al., 2015), and peach (Huan et al., 2018). activity and nonenzymatic antioxidant content were also increased by
Additionally, the expression of antioxidant genes enhances stress tol- PA treatment which upregulated genes encoding antioxidant enzyme,
erance in banana (Wu et al., 2014), kiwi (Xia et al., 2016), tomato (Mou and thereby contributed to maintenance the redox homeostasis in ba-
et al., 2015), peach (Spadoni et al., 2014), and Prunus persica fruit nana fruit cells. Endogenous PAs were synthesized in peels and pulps of
(Manganaris et al., 2017). POD also serves as a browning-related en- banana fruit after exposure to exogenous PAs via upregulation of the
zyme, together with polyphenol oxidase (PPO). The relatively higher MaANR gene. Thus, it was proposed that exogenous PAs initiate en-
activities of POD and PPO (data not shown) in treated fruit were in dogenous PA signaling and/or other molecular signaling pathways,
accordance with the results of Huang et al. (2013), suggesting that PA resulting in delayed senescence. Accordingly, PAs may be promising
significantly delays cell death-associate protein degradation and/or natural agents for increasing the storage life of banana fruit. More work
dysfunction. in the future is needed to unravel the molecular regulatory mechanism
Nonenzymatic antioxidants also play important roles in reducing of PA-dependent delayed senescence.
the oxidative damage caused by ROS to cells during senescence. DPPH%
scavenging capacity indirectly reflects the activities of nonenzymatic Declaration of Competing Interest
antioxidants. Banana peel extracts have a high capacity to scavenge
DPPH% and these were also good lipid peroxidation inhibitors The authors declare no conflicts of interest.
(González-Montelongo et al., 2010). In our study, the DPPH% scaven-
ging capacity of banana peels also decreased during storage, with re- Acknowledgments
latively higher activities in PA-treated fruit (Fig. 5). Ummarat et al.
(2011) reported that hot water treatment enhanced antioxidant capa- The authors are grateful to the Hainan Natural Science Foundation
city through increasing free phenolics and flavonoids at the beginning of China (project no. 318QN288), Key R&D projects of Hainan Province
of banana fruit development, thereby affecting the storage life. (Grant Nos. ZDYF2019208 and ZDYF2018147) and the Fund of the
Banana fruit, particularly young fruit, are rich in PAs (Mura and Chinese Academy of Tropical Agricultural Sciences (project
Tanimura, 2003; Tanaka et al., 2000). In the present study, the initial no.1630092018006).
amount of PAs in banana peels was higher than that in banana pulp,
supporting the results of Ghag et al. (2015). Further, in vivo PA content References
in banana fruit was affected by storage time, and the changes in peels
and pulp were different (Fig. 6). During ripening, PAs synthesized in Ahmed, Z.F.R., Palta, J.P., 2016. Postharvest dip treatment with a natural lysopho-
banana fruit peels moved to the pulp (Ghag et al., 2015). Therefore, spholipid plus soy lecithin extended the shelf life of banana fruit. Postharvest Biol.
Technol. 113, 58–65. https://doi.org/10.1016/j.postharvbio.2015.10.016.
accumulation of PAs in pulp may be partly related to supply from the Awad, M.A., Al-Qurashi, A.D., Mohamed, S.A., El-Shishtawy, R.M., Ali, M.A., 2017.
peel in our study. Inhibition of decreases in PA content in treated fruit Postharvest chitosan, gallic acid and chitosan gallate treatments effects on shelf life
may be associated with delayed senescence induced by exogenous PA quality, antioxidant compounds, free radical scavenging capacity and enzymes ac-
tivities of ‘Sukkari’ bananas. J. Food Sci. Tech. 54, 447–457. https://doi.org/10.
treatment; however, increased PA levels after exogenous PA treatment 1007/s13197- 016-2481-8.
may be attributed to upregulation of the MaANR gene (Fig. 6). Indeed, Bapat, V.A., Trivedi, P.K., Ghosh, A., Sane, V.A., Ganapathi, T.R., Nath, P., 2010. Ripening
in a previous study on transgenic banana plants, silencing of MusaANR1 of fleshy fruit: molecular insight and the role of ethylene. Biotechnol. Adv. 28,

8
J. Chen, et al. Postharvest Biology and Technology 158 (2019) 110999

94–107. https://doi.org/10.1016/j.biotechadv.2009.10.002. https://doi.org/10.1111/jpi.12325.

Bogs, J., Downey, M.O., Harvey, J.S., Ashton, A.R., Tanner, G.J., Robinson, S.P., 2005. Manganaris, G.A., Drogoudi, P., Goulas, V., Tanou, G., Georgiadou, E.C., Pantelidis, G.E.,
Proanthocyanidin synthesis and expression of genes encoding leucoanthocyanidin Paschalidis, K.A., Fotopoulos, V., Manganaris, A., 2017. Deciphering the interplay
reductase and anthocyanidin reductase in developing grape berries and grapevine among genotype, maturity stage and low-temperature storage on phytochemical
leaves. Plant Physiol. 139, 652–663. https://doi.org/10.1016/j.biotechadv.2009.10. composition and transcript levels of enzymatic antioxidants in Prunus persica fruit.
002. Plant Physiol. Biochem. 119, 189–199. https://doi.org/10.1016/j.plaphy.2017.08.
Chen, J.Y., He, L.H., Jiang, Y.M., Wang, Y., Joyce, D.C., Ji, Z.L., Lu, W.J., 2008. Role of 022.
phenylalanine ammonialyase in heat pretreatment-induced chilling tolerance in ba- Marangoni, A.G., Palma, T., Stanley, D.W., 1996. Membrane effects in postharvest phy-
nana fruit. Physiol. Plant. 132, 318–328. https://doi.org/10.1111/j.1399-3054.2007. siology. Postharvest Biol. Technol. 7, 193–217. https://doi.org/10.1016/0925-5214
01013.x. (95)00042-9.
Chen, L., You, Q., Hu, L., Gao, J., Meng, Q.Q., Liu, W.T., Wu, X.F., Xu, Q., 2018. The Mou, W.S., Li, D.D., Luo, Z.S., Mao, L.C., Ying, T.J., 2015. Transcriptomic analysis reveals
Antioxidant procyanidin reduces reactive oxygen species signaling in macrophages possible influences of ABA on secondary metabolism of pigments, flavonoids and
and ameliorates experimental colitis in mice. Front. Immunol. 8, 1910 10.33 89/ antioxidants in tomato fruit during ripening. PLoS One 10, e0129598. https://doi.
fimmu.2017.01910. org/10.1371/journal.pone.0129598.
Chen, L., Zhong, H.Y., Kuang, J.F., Li, J.G., Lu, W.J., Chen, J.Y., 2011. Validation of Midttun, H.L.E., Ramsay, A., Mueller-Harvey, I., Williams, A.R., 2018. Cocoa procyani-
reference genes for RT-qPCR studies of gene expression in banana fruit under dif- dins modulate transcriptional pathways linked to inflammation and metabolism in
ferent experimental conditions. Planta 234, 377–390. https://doi.org/10.1007/ human dendritic cells. Food Funct. 9, 2883–2890. https://doi.org/10.1039/
s00425-011-1410-3. C8FO00387D.
Chen, W.R., Zhang, Z.Z., Shen, Y.W., Duan, X.W., Jiang, Y.M., 2014. Effect of tea poly- Mura, K., Tanimura, W., 2003. Change of polyphenol compounds in banana pulp during
phenols on lipid peroxidation and antioxidant activity of litchi (Litchi chinensis Sonn.) ripening. Food Preserv. Sci. 29, 347–351. https://doi.org/10.5891/jafps.29.347.
fruit during cold storage. Molecules 19, 16837–16850 10.3390/ molecules Santos-Buelga, C., Scalbert, A., 2000. Proanthocyanidins and tannin-like compounds–-
191016837. nature, occurrence, dietary intake and effects on nutrition and health. J. Sci. Food
Cheng, G.P., Duan, X.W., Shi, J., Lu, W.J., Luo, Y.B., Jiang, W.B., Jiang, Y.M., 2008. Agric. 80, 1094–1117. https://doi.org/10.1002/(SICI)1097-0010(20000515)80:73.
Effects of reactive oxygen species on cellular wall disassembly of banana fruit during 0.CO; 2-1.
ripening. Food Chem. 109, 319–324. https://doi.org/10.1016/j.foodchem.2007.12. Soradech, S., Nunthanid, J., Limmatvapirat, S., Luangtana-anan, M., 2017. Utilization of
041. shellac and gelatin composite film for coating to extend the shelf life of banana. Food
Duan, X.W., Liu, T., Zhang, D.D., Su, X.G., Lin, H.T., Jiang, Y.M., 2011. Effect of pure Control 73, 1310–1317. https://doi.org/10.1016/j.foodcont.2016.10.059.
oxygen atmosphere on antioxidant enzyme and antioxidant activity of harvested Spadoni, A., Guidarelli, M., Sanzani, S.M., Ippolito, A., Mari, M., 2014. Influence of hot
litchi fruit during storage. Food Res. Int. 44, 1905–1911. https://doi.org/10.1016/j. water treatment on brown rot of peach and rapid fruit response to heat stress.
foodres.20 10.10.027. Postharvest Biol. Technol. 94, 66–73. https://doi.org/10.1016/j.postharvbio.2014.
González-Montelongo, R., Lobo, M.G., González, M., 2010. Antioxidant activity in banana 03.006.
peel extracts: Testing extraction conditions and related bioactive compounds. Food Tan, X.L., Fan, Z.Q., Kuang, J.F., Lu, W.J., Reiter, R.J., Lakshmanan, P., Su, X.G., Zhou, J.,
Chem. 119, 1030–1039. https://doi.org/10.1016/j.foodchem.2009.08.012. Chen, J.Y., Shan, W., 2019. Melatonin delays leaf senescence of Chinese flowering
Gao, H., Zhang, Z.K., Chai, H.K., Cheng, N., Yang, Y., Wang, D.N., Yang, T., Cao, W., cabbage by suppressing ABFs-mediated abscisic acid biosynthesis and chlorophyll
2016. Melatonin treatment delays postharvest senescence and regulates reactive degradation. J. Pineal Res. 67, e12570. https://doi.org/10.1111/jpi.12570.
oxygen species metabolism in peach fruit. Postharvest Biol. Technol. 118, 103–110. Tanaka, T., Kondou, K., Kouno, I., 2000. Oxidation and epimerization of epigallocatechin
https://doi.org/10.1016/j.postharvbio.2016.03.006. in banana fruits. Phytochemistry 53 (99), 311–316. https://doi.org/10.1016/S0031-
Ghag, S.B., Shekhawat, U.K.S., Ganapathi, T.R., 2015. Silencing of MusaANR1 gene re- 9422. 00 533-6.
duces proanthocyanidin content in transgenic banana plants. Plant Cell Tissue Organ Tian, S.P., Qin, G.Z., Li, B.Q., 2013. Reactive oxygen species involved in regulating fruit
Cult. 121, 693–702. https://doi.org/10.1007/s11240-015-0739-x. senescence and fungal pathogenicity. Plant Mol. Biol. 82, 593–602. https://doi.org/
Hailu, M., Workneh, T.S., Belew, D., 2013. Review on postharvest technology of banana 10.1007/s11103-013-0035-2.
fruit. Afr. J. Biotechnol. 12, 635–647. https://doi.org/10.5897/AJBX12.020. Toro-Uribe, S., Lopez-Giraldo, L.J., Decker, E.A., 2018. Relationship between the phy-
Han, Y.P., Vimolmangkang, S., Soria-Guerra, R.E., Korban, S.S., 2012. Introduction of siochemical properties of 1 cocoa procyanidins and their ability to inhibit lipid oxi-
apple ANR genes into tobacco inhibits expression of both CHI and DFR genes in dation in liposomes. J. Agric. Food Chem. 66, 4490–4502. https://doi.org/10.1021/
flowers, leading to loss of anthocyanin. J. Exp. Bot. 63, 2437–2447. https://doi.org/ ac s.jafc.8b01074.
10.1093/jxb/ err415. Ummarat, N., Matsumoto, T.K., Wall, M.M., Seraypheap, K., 2011. Changes in anti-
Hosseini, M.S., Zahedi, S.M., Abadia, J., Karimi, M., 2018. Effects of postharvest treat- oxidants and fruit quality in hot water-treated ‘Hom Thong’ banana fruit during
ments with chitosan and putrescine to maintain quality and extend shelf-life of two storage. Sci. Hortic. 130, 801–807. https://doi.org/10.1016/j.scienta.2011.09.006.
banana cultivars. Food Sci. Nutr. 6, 1328–1337. https://doi.org/10.1002/fsn3.662. Wang, Y.S., Luo, Z.S., Du, R.X., Liu, Y., Ying, T.J., Mao, L.C., 2013. Effect of nitric oxide
Hu, W., Yang, H., Tie, W.W., Yan, Y., Ding, Z.H., Liu, Y., Wu, C.L., Wang, J.S., Reiter, R.J., on antioxidative response and proline metabolism in banana during cold storage. J.
Tan, D.X., Shi, H.T., Xu, B.Y., Jin, Z.Q., 2017. Natural variation in banana varieties Agric. Food Chem. 61, 8880–8887. https://doi.org/10.1021/jf401447y.
highlights the role of melatonin in postharvest ripening and quality. J. Agric. Food Wu, B., Guo, Q., Li, Q.P., Ha, Y.M., Li, X.P., Chen, W.W., 2014. Impact of postharvest
Chem. 65, 9987–9994. https://doi.org/10.1021/acs.jafc.7b03354. nitric oxide treatment on antioxidant enzymes and related genes in banana fruit in
Huan, C., An, X.J., Yu, M.L., Jiang, L., Ma, R.J., Tu, M.G., Yu, Z.F., 2018. Effect of response to chilling tolerance. Postharvest Biol. Technol. 92, 157–163. https://doi.
combined heat and 1-MCP treatment on the quality and antioxidant level of peach org/10.1016/j.postharvbio.2014.01.017.
fruit during storage. Postharvest Biol. Technol. 145, 193–202. https://doi.org/10. Wu, H., Luo, T., Li, Y.M., Gao, Z.P., Zhang, K.Q., Song, J.Y., Xiao, J.S., Cao, Y.P., 2018.
1016/j.postharvbio.2018.07.013. Granny Smith apple procyanidin extract upregulates tight junction protein expression
Huang, H., Jing, G.X., Wang, H., Duan, X.W., Qu, H.X., Jiang, Y.M., 2014. The combined and modulates oxidative stress and inflammation in lipopolysaccharide-induced
effects of phenylurea and gibberellins on quality maintenance and shelf life extension Caco-2 cells. Food Funct. 9, 3321–3329. https://doi.org/10.1039/C8FO00525G.
of banana fruit during storage. Sci. Hortic. 167, 36–42. https://doi.org/10.1016/j. Xi, Y., Fan, X.G., Zhao, H.D., Li, X.H., Cao, J.K., Jiang, W.B., 2017. Postharvest fruit
scienta.2 013.12.028. quality and antioxidants of nectarine fruit as influenced by chlorogenic acid. LWT-
Huang, H., Zhu, Q.Q., Zhang, Z.K., Yang, B., Duan, X.W., Jiang, Y.M., 2013. Effect of Food Sci. Technol. 75, 537–544. https://doi.org/10.1016/j.lwt.2016.10.004.
oxalic acid on antibrowning of banana (Musa spp., AAA group, cv. ‘Brazil’) fruit Xia, Y.X., Chen, T., Qin, G.Z., Li, B.Q., Tian, S.P., 2016. Synergistic action of antioxidative
during storage. Sci. Hortic. 160, 208–212. https://doi.org/10.1016/j.scienta.2013. systems contributes to the alleviation of senescence in kiwifruit. Postharvest Biol.
05.041. Technol. 111, 15–24. https://doi.org/10.1016/j.postharvbio.2015.07.026.
Jiang, Y.M., Joyce, D.C., Macnish, A.J., 1999. Responses of banana fruit to treatment with Xiao, Y., Dong, J.L., Yin, Z.T., Wu, Q.G., Zhou, Y.M., Zhou, X.L., 2018. Procyanidin B2
1- methylcyclopropene. Plant Growth Regul. 28, 77–82. https://doi.org/10.1023/ protects against D-galactose-induced mimetic aging in mice: Metabolites and mi-
A:1006 22 2631666. crobiome analysis. Food Chem. Toxicol. 119, 141–149. https://doi.org/10.1016/j.fct.
Kader, A.A., 1986. Biochemical and physiological basis for effects of controlled and 2018.05.017.
modified atmospheres on fruits and vegetables. Food Technol. 40, 99–104. https:// Xiao, Y.Y., Chen, J.Y., Kuang, J.F., Shan, W., Xie, H., Jiang, Y.M., Lu, W.J., 2013. Banana
doi.org/10.1016/0306-9192(86)90074–6. ethylene response factors are involved in fruit ripening through their interactions
Klieber, A., Bagnato, N., Barrett, R., Sedgley, M., 2002. Effect of post-ripening nitrogen with ethylene biosynthesis genes. J. Exp. Bot. 64, 2499–2510. https://doi.org/10.
atmosphere storage on banana shelf life, visual appearance and aroma. Postharvest 1093/jxb/ ert108.
Biol. Technol. 25, 15–24. https://doi.org/10.1016/S0925-5214(01)00163-6. Xie, D.Y., Sharma, S.B., Paiva, N.L., Ferreira, D., Dixon, R.A., 2003. Role of anthocyanidin
Li, T.T., Shi, D.D., Wu, Q.X., Zhang, Z.K., Qu, H.X., Jiang, Y.M., 2019. Sodium para- reductase, encoded by BANYULS in plant flavonoid biosynthesis. Science 299
aminosalicylate delays pericarp browning of litchi fruit by inhibiting ROS-mediated (396–39), 9. https://doi.org/10.1126/science.1078540.
senescence during postharvest storage. Food Chem. 278, 552–559. https://doi.org/ Xu, F., Shi, L.Y., Chen, W., Cao, S.F., Su, X.G., Yang, Z.F., 2014. Effect of blue light
10.1016/j.foodchem.2018.11.099. treatment on fruit quality, antioxidant enzymes and radical-scavenging activity in
Liu, C.H., Zheng, H.H., Sheng, K.L., Liu, W., Zheng, L., 2018. Effects of melatonin treat- strawberry fruit. Sci. Hortic. 175, 181–186. https://doi.org/10.1016/j.scienta.2014.
ment on the postharvest quality of strawberry fruit. Postharvest Biol.Technol. 139, 06.012.
47–55. https://doi.org/10.1016/j.postharvbio.2018.01.016. Xu, W.T., Huang, K.L., Guo, F., Qu, W., Yang, J.J., Liang, Z.H., Luo, Y.B., 2007.
Livak, K.J., Schmittgen, T.D., 2001. Analysis of relative gene expression data using real- Postharvest grapefruit seed extract and chitosan treatments of table grapes to control
time quantitative PCR and the 2(–Delta Delta C (T)) method. Methods 25, 402–408. Botrytis cinerea. Postharvest Biol. Technol. 46, 86–94. https://doi.org/10.1016/j.
https://doi.org/10.1006/meth.2001.1262. post harvbio.2007.03.019.
Ma, Q.X., Zhang, T., Zhang, P., Wang, Z.Y., 2016. Melatonin attenuates postharvest Xu, W.T., Peng, X., Luo, Y.B., Wang, J., Guo, X., Huang, K.L., 2009. Physiological and
physiological deterioration of cassava storage roots. J. Pineal Res. 60, 424–434. biochemical response of grape fruit seed extract dip on ‘Redglobe’ grape. LWT-Food

9
J. Chen, et al. Postharvest Biology and Technology 158 (2019) 110999

Sci. Technol. 42, 471–476. https://doi.org/10.1016/j.lwt.2008.09.002. Zhang, Y.Y., Huber, D.J., Hu, M.J., Jiang, G.X., Gao, Z.Y., Xu, X.B., Jiang, Y.M., Zhang,
Yang, S., Su, X.G., Prasad, K.N., Yang, B., Cheng, G.P., Chen, Y., Yang, E., Jiang, Y.M., Z.K., 2018. Delay of postharvest browning in litchi fruit by melatonin via the en-
2008. Oxidation and peroxidation of postharvest banana fruit during softening. Pak. hancing of antioxidative processes and oxidation repair. J. Agric. Food Chem. 66,
J. Bot. 40, 2023–2029. https://doi.org/10.1016/j.jasc.2014.09.060. 7475–7484. https://doi.org/10.1021/acs.jafc.8b01922.
Yuan, Y.F., Zhao, Y.P., Yang, J.L., Jiang, Y.M., Lu, F., Jia, Y.X., Yang, B., 2017. Zhang, Z.K., Huber, D.J., Qu, H.X., Yun, Z., Wang, H., Huang, Z.H., Huang, H., Jiang,
Metabolomic analyses of banana during postharvest senescence by 1H-high resolu- Y.M., 2015. Enzymatic browning and antioxidant activities in harvested litchi fruit as
tion-NMR. Food Chem. 218, 406–412. https://doi.org/10.1016/j.foodchem. 2016. influenced by apple polyphenols. Food Chem. 171, 191–199. https://doi.org/10.
09.080. 1016/j. foodchem.2014.09.001.
Zhang, J., Shi, Y., Zhang, X.Z., Du, H.M., Xu, B., Huang, B.R., 2017. Melatonin suppres- Zhou, R., Li, Y.F., Yan, L.P., Xie, J., 2011. Effect of edible coatings on enzymes, cell
sion of heat-induced leaf senescence involves changes in abscisic acid and cytokinin membrane integrity, and cell-wall constituents in relation to brittleness and firmness
biosynthesis and signaling pathways in perennial ryegrass (Lolium perenne L.). of Huanghua pears (Pyrus pyrifolia Nakai, cv. Huanghua) during storage. Food Chem.
Environ. Exp. Bot. 138, 36–45. https://doi.org/10.1016/j.envexpbot.2017.02.012. 124, 569–575. https://doi.org/10.1016/j.foodchem.2010.06.075.
Zhang, N., Sun, Q.Q., Li, H.F., Li, X.S., Cao, Y.Y., Zhang, H.J., Li, S.T., Zhang, L., Qi, Y., Zhu, X.Y., Shen, L., Fu, D.W., Si, Z.W., Wu, B., Chen, W.X., Li, X.P., 2015. Effects of the
Ren, S.X., Zhao, B., Guo, Y.D., 2016. Melatonin improved anthocyanin accumulation combination treatment of 1-MCP and ethylene on the ripening of harvested banana
by regulating gene expressions and resulted in high reactive oxygen species scaven- fruit. Postharvest Biol. Technol. 107, 23–32. https://doi.org/10.1016/j.postharvbio.
ging capacity in cabbage. Front. Plant Sci. 7, 197. https://doi.org/10.3389/fpls.2016. 2015.04.0 10.
00197.

10