Food Chemistry A Laboratory Manual 2nd Edition

www.ajpdf.
com
Food Chemistry
A Laboratory Manual
Second Edition
Dennis D. Miller
Cornell University
Ithaca, USA
C. K. Yeung
California Polytechnic State University
San Luis Obispo, USA
www.ajpdf.com
This edition first published 2022

© 2022 John Wiley & Sons, inc.
Edition History
John Wiley & Sons, Inc. ( I e, 1998)
All rights reserved. No part of this publication may be reproduced, stored in a retrieval system, or transmitted, in
any form or by any means, electronic, mechanical, photocopying, recording or otherwise, except as permjtted by
law. Advice on how to obtain permission to reuse material from this title is available at
http://www.wiley.com/go/permissions.
The right of Dennis D. Miller and C. K. Yeung to be identified as the authors of this work has been asserted in
accordance with law.
Registered Office
Jolm Wiley & Sons, inc., 111 River Street, Hoboken, NJ 07030, USA
Editorial Office
111 River Street, Hoboken, NJ 07030, USA
For details of our global editorial offices, customer services, and more information about Wiley products visit us
at www.wiley.com.
Wiley also publishes its books in a variety of electronic formats and by print-on-demand. Some content that
appears in standard print versions of this book may not be available in other formats.
Limit of Liability/Disclaimer of Warranty
In view of ongoing research, equipment modifications, changes in governmental regulations, and the constant
flow of information relating to the use of experimental reagents, equipment, and devices, the reader is urged to
review and evaluate the information provided in the package insert or instructions for each chemical, piece of
equipment, reagent, or device for, among other things, any changes in the instructions or indication of usage and
for added warnings and precautions. While the publisher and authors have used their best efforts in preparing
this work, they make no representations or warranties with respect to the accuracy or completeness of the
contents of trus work and specifically disclaim all warranties, including without limitation any implied
warranties of merchantability or fitness for a particular purpose. No warranty may be created or extended by
sales representatives, written sales materials or promotional statements for this work. The fact that an
organization, website, or product is referred to in this work as a citation and/or potential source of further
information does not mean that the publisher and authors endorse the information or services the organization,
website, or product may provide or recommendations it may make. This work is sold with the understanding that
the publisher is not engaged in rendering professional services. The advice and strategies contained herein may
not be suitable for your situation. You should consult with a specialist where appropriate. Further, readers should
be aware that websites listed in this work may have changed or disappeared between when this work was written
and when it is read. Neither the publisher nor authors shall be liable for any loss of profit or any other
commercial damages, including but not limited to special, incidental, consequential, or other damages.
Libra,y of Congress Cataloging-in-Publication Data
Names: Miller, Dennis D., 1945- author. I Yeung, C. K., author.

Title: Food chemistry : a laboratory manual / Dennis D. Miller, Cornell University, lthaka, USA, C. K. Yeung,
California Polytechnic State University San Luis Obispo, USA.
Description: Second edition. I Hoboken, NJ : John Wiley & Sons, lnc., 2022. I includes bibliographical
references and index.
Identifiers: LCCN 2021034580 (print) I LCCN 202103458 l (ebook) I ISBN 9780470639313 (paperback) I ISBN
97811 I 9714583 {adobe pdf) I ISBN 978 I 1 I 9714606 ( epub)
Subjects: LCSH: Food-Analysis-Laboratory manuals. I Food-Composition-Laboratory manuals.
Classification: LCC TX541 .M49 2022 (print) I LCC TX541 (ebook) I DOC 664/.07-dc23
LC record available at https://lccn.loc.gov/2021034580
LC ebook record available at https://Iccn.loc.gov/2021034581
C pyr,0 I d 1 • I
www.ajpdf.com
www.ajpdf.com
Contents
Preface to the Second Edition xv

Preface to the First Edition xvi
Acknowledgments xvii
About the Companion Website xix
1 Acids, Bases, and Buffers 1

1.1 Learning Outcomes
1.2 Introduction
1.2.1 Acids
1.2.1.1 Food Acidulants
1.2.1.2 Reactions of Food Acids
1.2.2 Bases
1.2.3 Buffers
1.3 Apparatus and Instruments
1.4 Reagents and Materials
1.5 Procedures
1.5.1 Determining the pH of a Solid Food
1.5.2 Preparation of a Buffer and Determination of Buffer Capacity
1.6 Problem Set
1.7 References
1.8 Suggested Reading
Answers to Problem Set
2 Chemical Leavening Agents 7

2.2 Introduction
2.2.1 Chemical Leavening Agents
2.2.1.1 Baking Soda
2.2.1.2 Baking Powders
2.2.2 Neutralizing Values
2.2.3 Leavening Rates
2.2.4 Effect of Leavening Acid on Dough Rheology
www.ajpdf.com
vi Contents

2.5 Procedures
2.5.1 Determination of Leavening Rates
2.5.1.1 The Apparatus
2.5.1.2 Experimental Treatments and Controls
2.5.1.3 Protocol
2.5.1.4 Data Analysis
2.5.2 Chemically Leavened Biscuits
2.5.2.1 Biscuit Formula
2.5.2.2 Treatments
2.5.2.3 Protocol
2.5.2.4 Volume Determination of Biscuits
2.6 Problem Set
2.7 Useful Formulas and Values
2.8 References
2.9 Suggested Reading Answers
to Problem Set
3 Properties of Sugars 27
3.2 Introduction
3.5 Procedures
3.6 Study Questions References
3.8
4 Nonenzymatic Browning 33
4.2 Introduction
4.2.1 Caramelization
4.2.2 The Maillard Reaction
4.2.2.1 Sugar
4.2.2.2 Amine
4.2.2.3 Temperature
4.2.2.4 Concentration
4.2.2.5 pH
4.4.1 Reagents to Be Prepared by the Student
4.4.2 Reagents to Be Prepared by the Teaching Staff
4.5 Procedures
4.5.1 Preparation of a Glucose/Glycine Model System
4.5.2 Heating Experiment
4.5.3 Measurement of Extent of Browning
www.ajpdf.com
Contents vii
4.5.4 Browning in Nonfat Dry Milk (Demonstration)

4.5.5 Role of Milk in Crust Color of Bread (Demonstration)
4.5.6 Browning in Cookies
4.5.6.1 Sugar Cookie Formula
4.5.6.2 Baking Directions
4.6 Problem Set
4.7 Study Questions
4.8 References
5 Food Hydrocolloids 49
5.2 Introduction
5.2.1 Alginate
5.2.2 Alginate Gels
5.2.3 Carrageenan
5.2.4 Locust Bean Gum and Guar Gum
5.2.5 Xanthan Gum
5.5 Procedures
5.5.1 Effect of Heat Treatment on Gelation
5.5.2 Effect of Concentration on Viscosity
5.5.3 Emulsion Stability
5.5.4 Diffusion Setting and Internal Setting Alginate Gels
5.5.4.1 Diffusion Setting Gel
5.5.4.2 Internal Setting Gel
5.6 Study Questions
5.7 References
6 Functional Properties of Proteins 65

6.2 Introduction
6.2.1 Soybean Processing: Soy Milk, Tofu, and Soybean Protein Isolate
6.2.2 Assaying Protein Concentration
6.5 Procedures
6.5.1 Standard Curve for the Bradford Protein Assay
6.5.2 Effect of pH on Protein Solubility
6.5.2.1 Preparation of Protein Extracts
6.5.2.2 Measurement of Protein Concentration in the Extracts
6.5.3 Preparation of Soy Protein Isolate and Tofu
6.5.3.1 Extraction
www.ajpdf.com
viii Contents
6.5.3.2 Soy Protein Isolation

6.5.3.3 Production of Tofu
6.6 Problem Set
6.8 Suggested Reading Answers
to Problem Set
6.9
7 Lactose 77
Introduction
7.2
7.2.1 Lactose Assay
7.5 Procedures
7.5.1 Lactose and D-galactose Assay Protocol
7.5.2 Lactase Assay
7.6 Experimental Design
7.7 Study Questions
7.8 References
8 Enzymatic Browning: Kinetics of Polyphenoloxidase 87

8.2 Introduction
8.2.1 Enzyme Kinetics
8.2.2 PPO Assay
8.2.3 Control of Enzymatic Browning
8.5 Procedures
8.5.1 Preparation of Crude Enzyme Extract
8.5.2 Enzyme Assay
8.5.3 Data Treatment
8.5.4 Required Notebook Entries
8.6 Problem Set
8.8 Answers to Problem Set
9 Blanching Effectiveness 102

9.2 Introduction
9.5 Procedures
9.6 Study Questions
www.ajpdf.com
Contents ix
9.7 References
10 Lipid Oxidation 109

10.2 Introduction
10.2.1 The Chemistry of Lipid Oxidation
10.2.2 Control of Lipid Oxidation
10.2.2.1 Elimination of Oxygen
10.2.2.2 Scavenging of Free Radicals
10.2.2.3 Chelation of Metal Ions
10.2.3 Measurement of Lipid Oxidation in Foods
10.2.3.1 Thiobarbituric Acid Test (TBA Test)
10.2.3.2 Peroxide Value
10.2.3.3 Conjugated Diene Methods
10.2.3.4 Oxygen Bomb Test
10.2.3.5 Total and Volatile Carbonyl Compounds
10.2.3.6 Anisidine Value Test
10.5 Procedures: Lipid Oxidation in Turkey Meat
10.6 Problem Set: Calculation of TBARS
10.7 Study Questions
10.8 References
11 Ascorbic Acid: Stability and Leachability 127

11.2 Introduction
11.2.1 Chemistry
11.2.2 Functions of Ascorbic Acid in Foods
11.2.2.1 Oxygen Scavenger
11.2.2.2 Free Radical Scavenger
11.2.2.3 Control of Enzymatic Browning
86 11.2.2.4 Dough Improver
11.2.3 Stability of Ascorbic Acid
11.2.4 Rationale for the Experiment
11.5 Procedures
11.5.1 Ascorbic Acid Standard Curve
11.5.2 Effect of pH on Ascorbic Acid Stability
11.5.3 Effects of Temperature, pH, and Cu2+ on the Stability of Ascorbic Acid
11.5.4 Effect of Cooking on the Ascorbic Acid Content of Cabbage
11.6 Problem Set
www.ajpdf.com
x Contents
11.8 References
12 Hydrolytic Rancidity in Milk 138

12.2 Introduction
12.2.1 The Copper Soap Solvent Extraction Method
12.5 Treatments and Controls
12.6 Procedures
12.6.1 Standard Curve
12.6.2 Free Fatty Acids in Milk
12.6.3 Calculations
12.7 Problem Set
12.9 References
13 Caffeine in Beverages 149

13.2 Introduction
13.5 Operation of the HPLC
13.6 Procedures
13.6.2 Caffeine in Soda and Energy Drinks
13.6.3 Caffeine in Coffee
13.6.4 Caffeine in Tea
13.7 Data Analysis
13.8 References
14 Color Additives 156

14.2 Introduction
14.2.1 Binding to Wool
14.2.2 Removal from Wool
14.2.3 Solid-Phase Extraction (SPE)
14.2.4 Separation and Identification
14.5 Procedures
14.5.1 Qualitative Identification of Artificial Colors from Food Products
14.5.2 Separation and Identification of the Extracted Colors
www.ajpdf.com
Contents xi
14.5.3 Quantitative Analysis of FD&C Red Dye # 40 in Cranberry Juice

14.7 References
15 Plant Pigments 176

15.2 Introduction
15.5 Procedures
15.5.1 Extraction and Separation of Lipid Soluble Plant Pigments
15.5.2 Extraction of Water Soluble Plant Pigments
15.5.3 Effect of pH on the Color of Water Soluble Plant Pigments
15.5.4 Demonstration
15.7 References
16 Meat Pigments 191

16.2 Introduction
16.2.1 Meat Curing
16.2.2 Effect of Cooking on Meat Color
16.5 Procedures
16.5.1 Preparation and Spectral Analysis of Myoglobin, Oxymyoglobin,
and Metmyoglobin
16.5.2 Preparation and Spectral Analysis of Nitric Oxide Myoglobin
16.5.3 Concentration of Metmyoglobin, Myoglobin, and Oxymyoglobin
16.7 References
17 Meat Tenderizers 204

17.2 Introduction
17.5 Procedures
17.5.1 Preparation of Samples and Standards
17.5.1.1 Sample Treatments
17.5.1.2 Protein Extraction and Preparation for Electrophoresis
17.5.1.3 Preparation of SDS-PAGE Standards for Electrophoresis
17.5.2 Electrophoresis
www.ajpdf.com
xii Contents
17.5.2.1 Loading and Running the Gel

17.5.2.2 Staining the Gel
17.7 References
18 Detection of Genetically Engineered Maize Varieties 212

18.2 Introduction
18.2.1 Detection of a GE Protein by Immunoassay
18.2.2 Detection of a Trans Gene by PCR
18.5 Procedures
18.7 References
19 Food Emulsions and Surfactants 230

19.2 Introduction
19.2.1 Emulsions
19.2.2 Surfactants
19.2.3 Surfactants in Food Systems
19.3 Part I – Butter Churning (Phase Inversion)
19.3.1 Materials and Methods
19.3.1.1 Materials for Buttermaking
19.3.1.2 Buttermaking Procedure
19.3.2 Study Questions
19.4 Part II – Margarine Manufacture (Use of Surfactant for Semi-solid Foods)
19.4.1.1 Materials for Margarine Manufacture
19.4.1.2 Manufacture Procedure
19.5 Part III – Dispersion of Eugenol in Water (Surfactant Solubilization Capacity)
19.5.1.1 Materials for Dispersion Experiment
19.5.1.2 Experimental Procedure
19.6 Part IV – Mayonnaise Stability
19.6.1.1 Materials for Mayonnaise Experiment
19.7 References
www.ajpdf.com
Contents xiii
Appendix I 254
Conversion Factors
Appendix II 256
Concentration
Definition
Suggested Reading
Appendix III 258

Acids, Bases, Buffers, and pH Measurement
Review of pH and Acid–Base Equilibria
Acids and Bases
Acid/Base Equilibria
The pH Scale
pK
Buffers: Functions and Uses
Problems
Choosing a Buffer System
Preparation of Buffers
Activity and Ionic Strength
pH Measurement
Making pH Measurements
References
Suggested Reading
Appendix IV 282
Spectrophotometry
Introduction
Operation of a Spectrophotometer
Notes for Operators
Problem Set
References
Appendix V 289
Chromatography
What Is Chromatography?
Chromatography Terminology
Types of Chromatography
Adsorption Chromatography (AC)
Liquid–Liquid Partition Chromatography (LLPC)
Bonded Phase Chromatography (BPC)
Ion-Exchange Chromatography (IEC)
Gel Permeation Chromatography (GPC)
High-Performance Liquid Chromatography
The HPLC System
References
Suggested Reading
www.ajpdf.com
xiv Contents
Appendix VI 301
Electrophoresis
Introduction References
Suggested Reading
Appendix VII 310

Glossary
www.ajpdf.com
List of Tables
Chapter 1
Table 1.1 Acids common in foods: structures and
pKa values.
Table 1.2 Approximate pH values for some
common foodsa.
Chapter 2
Table 2.1 Neutralizing values for some common
leavening acidsa.
Chapter 4
Table 4.1 Effects of storage on skim milk
,b
powdera .
Chapter 5
Table 5.1 Some functional properties of food
hydrocolloidsa.
www.ajpdf.com
Table 5.2 Functional properties of xanthan gum

[4].
Chapter 8
Table 8.1 Volumes of buffer, substrate, and
enzyme extract for PPO assays.
Chapter 10
Table 10.1 Volumes, concentrations, and
absorbance values for standards in t…
Table 10.2 Data for TBARS assay on raw and
cooked turkey samples.
Chapter 11
Table 11.1 Functions of naturally occurring and
added ascorbic acid (or its …
Table 11.2 Chemical and physical properties of
ascorbic acid.
Table 11.3 Data for ascorbic acid (AA) standard
curve.
Table 11.4 Data from ascorbic acid titration
experiment.
Chapter 12
Table 12.1 Fatty acid composition of bovine milk
fat [2].
Chapter 13
Table 13.1 Caffeine content in a typical serving of
some common beverages [5…
Chapter 14
Table 14.1 FDA “certified” synthetic color food
additives [4].
Table 14.2 Rf valuesa × 100 for synthetic food
colors chromatographed on TLC plat…
Chapter 15
www.ajpdf.com
Table 15.1 FDA approved “color additives exempt

from batch certification” fo…
Chapter 19
Table 19.1 Common food emulsions and their
typical oil and water contents [1…
Table 19.2 Applications of surfactants based on
HLB values [3].
Appendix II
Table II.1 Common expressions of concentration.
Appendix III
Table III.1 pKa values for some common
biological buffers [3].
Table III.2 Some standard buffers, pH ranges
where they are effective buffer…
Table III.3 Stock solutions and formulas for
mixing buffers.
Table III.4 Values for x (see Tables III.2 and III.3)
to make up various buf…
Table III.5 Values for activity coefficients of some
ions at different conce…
Appendix IV
Table IV.1 Classification of electromagnetic
radiation and effects of radiat…
List of Illustrations
Chapter 2
Figure 2.1 Rates of CO2 production from mixtures
of SALP and MCP‐H2O, SAPP‐4…
Figure 2.2 Apparatus for collecting and
quantifying the volume of gas releas…
Chapter 3
www.ajpdf.com
Figure 3.1 Three representations of the structure

of glucose, a polyhydroxyl…
Figure 3.2 Balanced equation showing the
nucleophilic attack of the C‐5 hydr…
Figure 3.3 The formation of sucrose, a 1,2‐
glycoside, from glucose and fruct…
Chapter 4
Figure 4.1 Fisher projection formulas showing
the reaction of glucose with a…
Figure 4.2 The Amadori rearrangement of
glucosyl amine to an amino‐deoxy‐ket…
Figure 4.3 Fisher projection (top) and Haworth
formulas showing the structur…
Figure 4.4 Structure of a generic protein showing
amino groups that are avai…
Figure 4.5 The effect of pH on the protonation of
free amino groups in a pro…
Chapter 5
Figure 5.1 Two polymers of equal molecular
weight tumbling in solution. Note…
Figure 5.2 Conformation of linkages between
guluronate and mannuronate resid…
Figure 5.3 The unique conformation of the
guluronate linkages in alginate al…
Figure 5.4 Structures of the three principal
carrageenans [6]. Note differen…
Figure 5.5 A representative structure of
galactomannan. The backbone chain i…
Figure 5.6 Structure of xanthan gum. Note the
cellulose backbone and the tri…
Chapter 7
www.ajpdf.com
Figure 7.1 Lactose (conformational

representation) is a disaccharide compose…
Figure 7.2 Hydrolysis of lactose to D‐galactose
and D‐glucose (Haworth repre…
Figure 7.3 Bacterial cultures in fermented dairy
products convert galactose …
Figure 7.4 Absorption spectra of NAD+ (solid line)
and NADH (dashed line)….
Figure 7.5 The oxidation of β‐D‐galactose by
NAD+, generating NADH. The reac…
Figure 7.6 The equilibrium of α‐ and β‐D‐
galactose in solution. The attainme…
Chapter 8
Figure 8.1 The action of polyphenoloxidase (PPO)
on phenolic compounds.
Figure 8.2 Examples of PPO substrates found in
foods. Note that they are pol…
Figure 8.3 The action of PPO on tyrosine to
produce indol‐5,6‐quinone [4].
Figure 8.4 The change in absorbance with time in
an enzyme assay. The assay …
Figure 8.5 A plot of velocity versus substrate
concentration for an enzyme t…
Figure 8.6 A Lineweaver‐Burk plot for an enzyme
that obeys Michaelis–Menten …
Chapter 9
Figure 9.1 D‐values for the thermal inactivation of
selected enzymes at vari…
Figure 9.2 The oxidation of guaiacol by hydrogen
peroxide to form a guaiacol…
Figure 9.3 Possible reactions of guaiacol‐free
radicals that yield the red/b…
www.ajpdf.com
Chapter 10
Figure 10.1 The reaction of linoleic acid with
singlet oxygen to form a hydr…
Figure 10.2 Reaction of linoleic acid with a
hydroxyl radical and triplet ox…
Figure 10.3 The decomposition of linoleic acid
hydroperoxide (decomposition …
Figure 10.4 Reactions in lipid oxidation. RH is an
unsaturated fatty acid. R
Chapter 11
Figure 11.1 Structures of ascorbic acid
stereoisomers.
Figure 11.2 The dissociation of ascorbic acid to
form ascorbate ion and a pr…
Figure 11.3 The reaction of ascorbic acid with
molecular oxygen.
Figure 11.4 The hydrolysis of dehydroascorbic
acid to diketogulonic acid.
Figure 11.5 The mechanism for free radical
scavenging by ascorbate. TO·is to…
Figure 11.6 Inhibition of enzymatic browning by
ascorbic acid. PPO = polyphe…
Figure 11.7 Reactions showing how ascorbic acid
functions as a dough improve…
Figure 11.8 Reaction describing the redox
titration of ascorbic acid with 2,…
Chapter 12
Figure 12.1 The lipase‐catalyzed hydrolysis of a
triacylglycerol (1‐stearoyl…
Figure 12.2 The formation of a copper soap in an
aqueous system when Cu2+ is…
www.ajpdf.com
Figure 12.3 Cu2+ combines with

diethyldithiocarbamate to form a complex that…
Chapter 13
Figure 13.1 Caffeine is an alkaloid belonging to
the class of methylxanthine…
Chapter 14
Figure 14.1 Chemical structures of FDA certified
FD&C food colorants [5].
Figure 14.2 Structure of a C‐18 bonded silica
packing material. Note that th…
Chapter 15
Figure 15.1 The structure of β‐carotene, an
example of a molecule containing…
Figure 15.2 Generalized structure of an
anthocyanin. G is a glucose residue….
Figure 15.3 Color of cyanin, an anthocyanin, at
various pHs. G is a glucose …
Figure 15.4 Conversion of chlorophyll to
pheophytin. Chlorophyll is called a…
Figure 15.5 Structures of selected carotenes. Note
the conjugated double bon…
Figure 15.6 Structures of selected xanthophylls.
Note the presence of oxygen…
Chapter 16
Figure 16.1 Heme. Heme is formed when an iron
ion binds at the center of a p…
Figure 16.2 Structures of myoglobin and
oxymyoglobin showing iron binding to…
Figure 16.3 Spectral curves of myoglobin,
oxymyoglobin, and metmyoglobin. Re…
Figure 16.4 The three main forms of myoglobin
pigments in meat, their relati…
www.ajpdf.com
Chapter 18
Figure 18.1 Trends in the adoption of genetically
engineered crops by farmer…
Figure 18.2 Steps in the shikimate pathway for
the synthesis of aromatic ami…
Figure 18.3 Structures of phosphoenol pyruvate
(PEP) and glyphosate. Notice …
Figure 18.4 Diagram showing the structure of a
typical lateral flow device (…
Chapter 19
Figure 19.1 Structures of common LMW
surfactants. (a) phosphatidylcholine (o…
Appendix III
Figure III.1 Titration of a weak monoprotic acid,
HA (pKa = 5.00) with a str…
Figure III.2 Effect of ionic strength on activity
coefficients. Modified fro…
Appendix IV
Figure IV.1 Schematic diagram of the basic
components of a spectrophotometer…
Figure IV.2 A typical standard curve obtained in
quantitative spectrophotome…
Appendix V
Figure V.1 Structure of silica gel, showing the
hydroxyl groups on the surfa…
Figure V.2 Structures of stationary phase packing
material with silica gel a…
Figure V.3 A schematic representation of reverse
phase and normal phase chro…
Figure V.4 A schematic representation of an HPLC
system (Scott Langston, per…
Appendix VI
www.ajpdf.com
Figure VI.1 The formation of polyacrylamide from

acrylamide and bis‐acrylami…
Figure VI.2 Gel electrophoresis apparatus. To
operate, samples are applied t…
Figure VI.3 Cleavage of the disulfide bond by
dithiothreitol.
Figure VI.4 Binding of sodium dodecyl sulfate
(SDS) to a protein molecule. T…
Figure VI.5 A calibration plot of molecular weight
standards run on SDS PAGE…
www.ajpdf.com
Preface to the Second Edition

Food Chemistry: A Laboratory Manual, first edition, has
been adopted by dozens of universities in the United States
and internationally since it was published in 1998. The
second edition has been extensively revised and with new
chapters added. I was extremely fortunate to have
Professor C.K. (Vincent) Yeung join me as a coauthor for
the second edition. Dr. Yeung holds a B.S. in chemistry from
the Chinese University of Hong Kong, an M.S. in dairy
products technology from California Polytechnic State
University, and a Ph.D. in food science and technology from
Cornell University. He is currently Associate Professor of
Dairy Science at California Polytechnic State University in
San Luis Obispo, California. Dr. Yeung’s knowledge and
insights gained from his strong educational background
and his years of teaching dairy chemistry laboratory
classes were invaluable in making improvements in
existing exercises and in developing new ones.
Our overarching goal in designing the laboratory exercises
in the manual was to help students develop an in‐depth
understanding of the fundamental chemical principles that
underlie relationships between the composition of foods
and food ingredients and their functional, nutritional, and
sensory properties. In addition, students who complete the
laboratory exercises will learn and practice many methods
and techniques common in food chemistry research and
food product development. We recommend the manual for
a 2‐credit food chemistry laboratory course although it
contains many more exercises (19) than can be reasonably
completed in a 1‐semester course. This should allow
instructors to select exercises that most closely provide the
learning outcomes they wish to achieve.
Each chapter includes introductory summaries of key
concepts and principles that are important for
understanding the methods used and interpreting the
results obtained from the experiments. In writing and
www.ajpdf.com
revising these summaries, we relied heavily on two widely

adopted food chemistry textbooks: Introductory Food
Chemistry by John W. Brady, Cornell University Press, 2013,
and Fennema’s Food Chemistry, 5th edition, S. Damodaran
and K. L. Parkin, editors, CRC Press Taylor & Francis Group,
2017. We encourage students to read relevant sections in
these and/or other food chemistry textbooks in addition to
the introductory material in the manual for a more
rigorous discussion of the relevant topics.
Dennis D. Miller
Professor Emeritus
Department of Food Science, Cornell University
October 2021
www.ajpdf.com
Preface to the First Edition

Food chemistry is a broad discipline that draws on
principles of physical, organic, and biological chemistry.
Advances in food chemistry over the past century have had
a dramatic impact on our understanding of all aspects of
food science and technology and have played a major role
in the improvement of the quality, quantity, and availability
of the food supply.
This manual is designed for a one‐semester laboratory
course in food chemistry. Emphasis is placed on
understanding fundamental chemical principles that
underlie relationships between the composition of foods
and functional, nutritional, and organoleptic properties. In
addition, many laboratory techniques that are common in
basic and applied research in food chemistry are
introduced.
Students should have a background in general, organic, and
biochemistry as well as a concurrent lecture course in food
chemistry. Each experiment is preceded by an introduction
of the principles necessary for understanding and
interpreting the data. Students are encouraged to
supplement the introductory material by reading selected
sections in a comprehensive food chemistry textbook in
addition to the references cited at the end of each
experiment.
Many students have successfully performed the
experiments described in the manual. I have tried
diligently to eliminate errors and provide clear instructions
for students and instructors. Nevertheless, errors and
unclear writing have a way of creeping in. I would
appreciate hearing from students and instructors when
they find errors.
Dennis D. Miller
Ithaca, New York
www.ajpdf.com
Acknowledgments
This manual is the product of the efforts of many people
over a period of more than 40 years. First and foremost, we
thank the students at Cornell University who enrolled in
the Food Chemistry Laboratory course in the Department
of Food Science over the 40 years it was offered as part of
the Institute of Food Technologists‐approved curriculum
for Food Science majors. Their enthusiasm, lab reports,
presentations, questions, and gentle criticisms were an
immense help in developing and refining the experiments
in the manual. Another group of students who contributed
enormously were the graduate and undergraduate
teaching assistants who set up the laboratories, assisted
students during the lab periods, graded lab reports, and
offered suggestions for improving the exercises. In recent
years, Aaron Jacobsen, Teaching Support Specialist at
Cornell, has worked tirelessly to streamline the lab
exercises and identify errors in the procedures. We also
thank our colleagues at Cornell and Cal Poly for their
comments, suggestions, and continual intellectual
stimulation. We thank Drs. Alicia Orta Ramirez and Motoko
Mukai who both took their turns in teaching the Food
Chemistry Lab course at Cornell. We are especially grateful
to Professors John Brady and Chang Lee for their
friendship, encouragement, and support. Last but not least,
we thank our editors at Wiley for their expert advice and
support.
www.ajpdf.com
About the Companion Website

This book is accompanied by a companion website.
www.wiley.com/go/Miller/foodchemistry2
This website includes:
Preparations and solutions for all chapters

www.ajpdf.com
Acids, Bases, and Buffers
After completing this exercise, students will be able to:

1) Explain the roles of acids and bases in food products.
2) Measure the pH of selected food products.
3) Prepare and evaluate a buffer system.
4) Measure the buffering capacity of a common beverage.
1.2 Introduction
Many food components may be classified as acids or bases due to their capacity to donate or accept
protons (hydrogen ions). These components perform numerous important functions including fla-
vor enhancement, control of microbial growth, inhibition of browning, alteration of texture, pre-
vention of lipid oxidation, and pH control.
Acids and bases are key metabolites in living plant and animal organisms, for example as inter-
mediates in the TCA cycle, and are mostly retained when the plant is harvested or the animal is
slaughtered so they are naturally present in foods. They may also be added during processing or
synthesized during fermentation to produce desired characteristics in the final food product.
The concentration and relative proportion of acids and bases determine the pH of a food, an
extremely important characteristic. pH can affect the flavor, color, texture, stability, and behavior
in food processing situations. For example, commercial sterilization of acid foods (pH less
than 4.6) [1] can be achieved under milder processing conditions than in foods with a higher pH.
1.2.1 Acids
Acids serve a variety of functions in foods including flavor enhancement, control of microbial
growth, protein coagulation, emulsification, control of browning, buffering action, and metal
chelation (to control lipid oxidation). All acids have a sour taste but different acids produce
Food Chemistry: A Laboratory Manual, Second Edition. Dennis D. Miller and C. K. Yeung.
© 2022 John Wiley & Sons, Inc. Published 2022 by John Wiley & Sons, Inc.
Companion website: www.wiley.com/go/Miller/foodchemistry2
1
www.ajpdf.com
2 1 Acids, Bases, and Buffers
Table 1.1 Acids common in foods: structures and pKa values.
Substance Structure pKa Food found in
Acetic acid CH3COOH pK = 4.75 Vinegar, figs
Adipic acid HOOC(CH2)4COOH pK1 = 4.43 Beets

pK2 = 5.62
Butyric acid CH3(CH2)2COOH pK = 4.82 Cheese, butter
Citric acid CH2COOH pK1 = 3.06 Oranges, lemons, apricots, tomatoes

pK2 = 4.74
HO C COOH
pK3 = 5.40
CH2COOH
Lactic acid CH3CHCOOH pK = 3.83 Yogurt, buttermilk, cheese, beer

OH
Malic acid HOOCCH2CHCOOH pK1 = 3.40 Apples, apricots, grapes, oranges,

pK2 = 5.05 tomatoes
OH
Oxalic acid COOH pK1 = 1.27 Spinach, potatoes, tomatoes

COOH pK2 = 4.27
Phosphoric acid OH pK1 = 2.12 Tomatoes, acidulant used in soft

pK2 = 7.21 drinks
OH
P pK3 = 12.32
O OH
Tartaric acid OH pK1 = 2.98 Grapes

HOOCCHCHCOOH pK2 = 4.34
OH
Sodium hydrogen O O pK = 1.99 Acidulant. Lowers pH without

sulfate or sodium acid imparting acid taste. May be added to
sulfate S process water to enhance chlorine
HO O– Na+ activity
distinctively different sour flavors. Thus, it is not enough to simply add any acid when attempting
to produce a characteristic sour flavor in a food. Table 1.1 gives structures and pK values of some
common food acids.
1.2.1.1 Food Acidulants

In the food industry, food additives that have acidic properties are commonly known as food acidu-
lants. There are many approved food acidulants, but only a few are in wide use. They include
organic acids like acetic acid, citric acid, fumaric acid, lactic acid, malic acid, and tartaric acid as
well as the mineral acids phosphoric acid and sodium hydrogen sulfate. (See [2] for guidance in
selecting food acidulants.)
2
www.ajpdf.com
1.3 Apparatus and Instrument 3
1.2.1.2 Reactions of Food Acids

Most naturally occurring food acids are carboxylic acids. Carboxylic acids are weak acids com-
pared with mineral acids such as HCl and H2SO4. Important reactions of carboxylic acids include
the following:
Ionization:
O O
+ H2O + H 3 O+
C H C
H3C O H3C O–
Acetic acid Acetate ion
Reaction with alcohols to form esters:

O O
+ CH3OH + H2O
C H C CH3
H3C O H3C O
Acetic acid Methanol Methyl acetate
1.2.2 Bases
Bases are also common food additives and are added for a variety of purposes. They may be added
to modify the flavor, color, and texture, enhance browning, induce chemical peeling, and produce
CO2. Examples of bases used as food additives include dilute NaOH (to induce chemical peeling in
fruits and vegetables, enhance browning, de-bitter olives, solubilize proteins), phosphate salts (to
prevent protein coagulation in evaporated and condensed milks, produce a smooth texture in pro-
cessed cheese), and NaHCO3 (to give chocolate a darker color, produce CO2 in leavening systems).
1.2.3 Buffers
Buffers stabilize the pH in foods. They are also used to neutralize foods which are too acidic. By
using the salt of the acid already present, acidity is reduced without adding neutralization flavors.
Many buffers are present naturally in foods. Animal products are usually buffered by amino acids,
proteins, and phosphate salts. In plants, organic acids (such as citric, malic, oxalic, and tartaric) in
conjunction with phosphate salts are the primary buffers. Table 1.2 shows the pHs of some com-
mon foods. Notice that most foods are buffered in the acidic range (pH < 7).
See Appendix III or your chemistry and biochemistry textbooks for a review of acid and base
chemistry.
1) pH meter equipped with a pH electrode

2) Analytical balance
3) Household blender
4) Centrifuge
5) Centrifuge tubes
3
www.ajpdf.com
Table 1.2 Approximate pH values for some common foodsa.
Food pH Food pH
Lime juice 2.0 Yogurt 4.0–4.5

Lemon juice 2.2 Cheddar cheese 5.1–5.5
Vinegar 2.6 Beef, fresh 5.5–5.0
Rhubarb 3.0 Pork, fresh 5.6–6.9
Grape juice 3.1–3.2 Turkey, fresh 5.7–6.1
Wines 2.9–3.9 Tuna 6.0
Apple juice 3.5–3.9 Carrots, fresh 5.7–6.1
Strawberries 3.2–3.4 Potatoes, fresh 6.1
Peaches 3.8 Green beans, fresh 6.5–6.7
Pears 3.9 Milk, fresh 6.6
Grapefruit juice 4.0 Sweet corn, fresh 6.7
Orange juice 4.2 Egg yolk 6.0–6.9
Tomato juice 3.8–4.7 Egg white (pH increases as egg ages) 7.6–9.2
a
Modified from [3] and [4].
6) Pipette and pipette bulb, 10 ml

7) Volumetric flask, 200 ml
8) Beakers, 150 ml
9) Burette, 25 or 50 ml
10) Burette holder and stand
11) Thermometer
12) Funnel
13) Graduated cylinder, 100 ml
14) Squeeze bottle for deionized water
15) Tissue
16) Weighing paper
17) Spatula
18) Stirring hot plate with stirring bars
1) Citric acid, monohydrate. MW = 210 g mole−1

2) KOH, 0.5 N
3) HCl, 0.5 N
4) HCl, 0.001 N
5) Sprite® (Coca Cola Company) or comparable lemon-flavored soda
6) Selected vegetables, e.g. fresh and canned tomatoes
7) Calibration buffers, pH 2 and 4
4
www.ajpdf.com
1.6 Problem Se 5
1.5 Procedures
1.5.1 Determining the pH of a Solid Food [5]

1) Cut a fresh tomato into small cubes and blend in a blender until a uniform slurry is formed,
measure the temperature of the slurry.
2) Calibrate your pH meter.
3) Measure the pH of the slurry.
4) Centrifuge an aliquot of the slurry for 10 minutes at maximum speed.
5) Measure the pH of the supernatant.
6) Repeat Steps 1 through 5 using canned tomatoes.
1.5.2 Preparation of a Buffer and Determination of Buffer Capacity

1) Calculate the amounts of citric acid monohydrate and 0.5 N KOH required to prepare 200 ml of
0.05 M citrate buffer, pH 3. Note: Even though citric acid is a triprotic acid, calculations for this
pH range are made using pKa = 3.06.
2) Prepare 200 ml of the buffer.
3) Measure the pH of your buffer. Is it 3.0? If not, can you explain why?
4) Determine the buffer capacity of your buffer in the alkaline direction by titrating a 100 ml ali-
quot with 0.5 N KOH. Express buffer capacity as the number of moles of OH− required to
increase the pH of 1 l of the buffer by 1 pH unit.
5) Repeat Step 4 using 0.001 N HCl in place of the citrate buffer, i.e. determine the buffer capacity
of 0.001 N HCl.
6) Determine the buffer capacity of your buffer and 0.001 N HCl by calculation. Compare your
experimental results with your calculated answers. Explain any discrepancies between experi-
mental and calculated values.
7) Determine the buffer capacity of Sprite® in the same way you did for your citrate buffer
(Step 4 above).
1.6 Problem Set
1 The Ka for the weak acid HA is 4.0 × 10−6. What is the pH of a 0.01 M solution of this acid? What
is its pKa?
2 How many grams of acetic acid and sodium acetate are required to prepare 1.0 l of 0.5 M acetate
buffer, pH 4.5? The pKa for acetic acid is 4.75.
3 Explain carefully how to prepare 1.0 l of 0.05 M phosphate buffer, pH 7.0 from NaH2PO4.H2O
and 1.0 N NaOH or 1.0 N HCl. The molecular weight of sodium phosphate monohydrate
monobasic is 138 g mole−1. The pKa2 for H3PO4 is 7.21. Hint: To determine whether you will
need to add NaOH or HCl, you need to calculate the pH of a 0.05 M solution of NaH2PO4.
4 Preparation of buffers using published tables.

a) Using Tables III.2a, III.2b, and III.2c in Appendix III, describe carefully how you would
prepare 1 l of 0.1 M acetate buffer, pH 5.2 and 1 l of 1/15 M phosphate buffer, pH 7.6.
5
www.ajpdf.com
b) Using the Henderson–Hasselbalch equation (shown below), calculate the theoretical pH of

these 2 buffers. Explain why the calculated pHs are not exactly the same as the pHs shown
in the Appendix table.
A
pH pK a log
HA
1.7 References
1 FDA (2019). Acidified & low-acid canned foods guidance documents & regulatory information
[Internet]. FDA [cited 2020 Mar 5]. http://www.fda.gov/food/guidance-documents-regulatory-
information-topic-food-and-dietary-supplements/acidified-low-acid-canned-foods-guidance-
documents-regulatory-information (accessed 5 March 2020).
2 Bartek Ingredients, Inc (2020). Self teaching guide for food acidulants -Google search [Internet].
[cited 2020 Mar 5] p. 37. https://www.google.com/search?q=Self+teaching+guide+for+food+acidu
lants&rlz=1C1EJFC_enUS825US876&oq=Self+teaching+guide+for+food+acidulants&aqs=chrom
e..69i57j69i60.2887j0j4&sourceid=chrome&ie=UTF-8 (accessed 5 March 2020).
3 USDA ARS (2020). pH of selected foods [Internet]. [cited 2020 Mar 5]. https://pmp.errc.ars.usda.
gov/phOfSelectedFoods.aspx (accessed 5 March 2020).
4 Bennion, M. (1980). The Science of Food. San Francisco: Harper & Row. 598 p.
5 AOAC Official Method 981.12 (1982). pH of Acidified Foods. AOAC International.
Lindsay, R.C. (2017). Food additives. In: Fennema’s Food Chemistry, 5e (eds. S. Damodaran and
K.L. Parkin), 803–864. Boca Raton: CRC Press, Taylor & Francis Group.
Segel, I.H. (1976). Biochemical Calculations: How to Solve Mathematical Problems in General
Biochemistry, 2e. New York: Wiley. 441 p.
1 pH = 3.7; pKa = 5.4.
2 14.68 g sodium acetate; 19.26 g acetic acid.
3 Use NaOH to adjust pH; dissolve 6 g NaH2PO4 (or 6.9 g NaH2PO4·H2O) in water (~900 ml);
using pH meter, titrate to pH 7.0 with 1.0 N NaOH; transfer to a volumetric flask and dilute to 1 l.
4 a) pH 5.2 acetate buffer: mix 768 ml 0.1 M sodium acetate and 232 ml acetic acid. pH 7.6 phos-
phate buffer: mix 128 ml 1/15 M KH2PO4 and 872 ml 1/15 M Na2HPO4.
b) Calculated pHs: Acetate buffer = 5.27; Phosphate buffer = 8.04.
6
www.ajpdf.com
2
Chemical Leavening Agents

1. Write balanced chemical equations showing the

production of CO2 in various chemical leavening
systems.
2. Determine, experimentally, the rates of CO2 release
from selected leavening systems.
3. Select a chemical leavening system suitable for making
biscuits, muffins, and other baked products.
4. Use the ideal gas law to calculate the volume of
available CO2 in a leavening system.
5. Calculate the weight of a given leavening acid required
to neutralize a given amount of NaHCO3.
2.2 Introduction
Leavening is derived from the Latin word levo which means
raising or making light. Batters and doughs containing
wheat or rye flour may be leavened by incorporating gases
into them. Five gases, either alone or in combination, may
be used for leavening: carbon dioxide, water vapor, ethanol
vapor, air, and ammonia.
The incorporation of leavening gas into baked goods is
most frequently accomplished by either yeast fermentation
or chemical leavening:
1. Yeast fermentation of sugars:

(1)
7
www.ajpdf.com
2. Chemical leavening:
a. Decomposition of salts:
(2)
b. Reaction of acids or acidic salts (HA) with sodium

bicarbonate:
(3)
In yeast leavened products, the CO2 is produced slowly,

inflating air bubbles that have been previously
incorporated into the dough during mixing. In contrast,
chemical leavening provides some of the initial nucleating
gas and provides a much faster means of inflating existing
air bubbles during mixing and baking. When heated, the
expanded dough “sets” forming the desired texture and
lightness. Although seemingly simple in principle, a basic
knowledge of chemical leavening is necessary in order to
obtain the correct rate and amount of CO2 release for a
specific application.
2.2.1 Chemical Leavening Agents

2.2.1.1 Baking Soda
Baking soda (also known as bicarbonate of soda) is pure
sodium bicarbonate (NaHCO3). It releases CO2 on reaction
with acids (Eq. 3). It is commonly used in batters for
muffins, pancakes, and cookies, in combination with a
baking powder (see below). The source of acid in these
batters may be sour milk (lactic acid), cultured buttermilk
(lactic acid), molasses (various organic acids including
acetic, propionic, and aconitic), lemon juice (citric acid),
etc.
2.2.1.2 Baking Powders
8
www.ajpdf.com
Generally, baking powders contain three materials: (i) a

CO2 source, (ii) one or more leavening acids, and (iii) a
diluent or filler.
CO2 Source: Sodium bicarbonate is the most commonly

used source of CO2 (Eq. 3). Ammonium bicarbonate is
sometimes used in cookies and crackers; however,
care must be taken to remove any residual NH3 gas
formed during decomposition in order to alleviate off‐
flavors (Eq. 2). Sodium bicarbonate dissolves almost
instantly but requires some form of acid to release the
CO2 (Eq. 3). Thus, the rate and degree of dissolution of
the acid in baking powders governs the rate of CO2
release. Thermal decomposition of sodium
bicarbonate does not occur to any large extent, except
under conditions of excess soda and/or very high
temperatures.
Leavening Acids: Leavening acids that react with
bicarbonate to release CO2 rapidly when water or milk
is added are called “fast‐acting.” “Slow‐acting” acids
react more slowly because they dissolve slowly at
room temperature. Little CO2 is liberated by slow‐
acting acids until the system is heated. Heating
increases the rate of dissolution thereby increasing
the rate of CO2 generation [1]. A description of some
common leavening acids used in baking powders
follows:
i. Monocalcium phosphate monohydrate (MCP‐H2O):
Ca(H2PO4)2 .H2O. This leavening acid is used in
most household baking powders. It is “fast‐
acting.” In solution, it dissociates to form Ca2+ and
H2PO4 −. The pKa of H2PO4 − is 7.21 while the pKa
of HCO3 − is 10.33. Thus, H2PO4 − is a much
stronger acid than HCO3 − and readily donates a
proton to HCO3 − which, in this case, acts as a
base:
9
www.ajpdf.com
(4)
One advantage of monocalcium phosphate over

some other leavening acids is that it does not
contain sodium.
ii. Sodium Aluminum Sulfate (SAS): Na2SO4‐
Al2(SO4)3. SAS is frequently used in combination
with MCP‐H2O in household baking powders to
produce a so‐called “double‐acting” baking
powder. SAS releases CO2 from soda only at
elevated temperatures. Excess SAS may adversely
affect the flour gluten causing finished products
to have a dull color and slightly bitter taste [1].
Acid is produced when Al2(SO4)3 reacts with
water to form sulfuric acid:
(5)
Once formed, sulfuric acid, a strong mineral acid,

reacts rapidly with bicarbonate to generate CO2.
iii. Potassium Hydrogen Tartrate (Cream of Tartar):
KHC4H4O6. Cream of tartar, a fast leavening acid,
is not widely used in commercial baking powder
formulations. It may be used in angel food cakes.
Tartaric acid itself (H2C4H4O6) is a fast‐acting
acid and may be used in combination with the
tartrate salt.
iv. Coated Anhydrous Monocalcium Phosphate.
Coating MCP with slightly soluble compounds
converts it to a slow‐acting acid. Coatings may
include slightly soluble calcium and aluminum
phosphates.
v. Glucono‐delta‐lactone (GDL). This is a slow‐acting
acid and is stable in refrigerated and frozen
doughs. Lactones are cyclic esters formed when
10
www.ajpdf.com
alcohol and carboxylic acid groups on the same

molecule react. GDL hydrolyzes slowly in water to
yield gluconic acid.
(6)
vi. Sodium Acid Pyrophosphate (SAPP): Na2H2P2O7.

SAPP is available in several grades produced by
varying manufacturing conditions. The different
grades are identified by numbers which are
related to rates of reaction with sodium
bicarbonate at room temperature. For example,
SAPP‐21, SAPP‐28, and SAPP‐40 represent grades
with increasing reaction rates. SAPP‐21 is used
when there is a delay between mixing and baking,
for example in refrigerated biscuits [2].
vii. Sodium Aluminum Phosphate (SALP).
NaAl3H14(PO4)8 .4H2O. A slow‐acting acid, SALP
has replaced by SAPP in some applications
because SAPP residual salts may impart an off‐
flavor.
viii. Other Food Ingredients. Sour milk, cultured
buttermilk, molasses, and ionic flour proteins are
all acidic and therefore can act as leavening acids.
Diluents: Diluents are added to baking powders to
prevent premature reaction of the sodium bicarbonate
and acid, i.e. to provide physical separation of soda
and acid, and to increase the bulk which makes
measuring small quantities of sodium bicarbonate and
leavening acid easier. Corn starch is the most common
diluent. FDA requires that baking powders yield at
least 12 g of CO2 for every 100 g of powder. In order to
11
www.ajpdf.com
achieve this, most formulations contain 26–30%

sodium bicarbonate [3–5].
2.2.2 Neutralizing Values

Neutralizing values (NV) of leavening acids are used to
compare the available acidity of the acids and to calculate
the amount of acid needed in a given formulation of
chemically leavened product. Neutralizing value is defined
as the weight of NaHCO3 that can be neutralized by 100
parts of the leavening acid. For example, if 100 g of an acid
will neutralize 50 g of NaHCO3, the neutralizing value of the
acid is 50. NV are determined by titrating to a specific pH
endpoint [6]. The formula for NV is:
(7)
whereb = wt of NaHCO3 neutralized;

a = wt of acid required to neutralize b.
See Table 2.1 for NV for some common leavening acids.
12
www.ajpdf.com
Table 2.1 Neutralizing values for some common leavening

acidsa.
Leavening acid Molecular Neutralizing Reaction
weight value rateb
Monocalcium 252 80 Fast
phosphate
monohydrate (MCP)
Delayed anhydrous 234 82 Slow
monocalcium
phosphate (AMCP)
Sodium acid 222 72 Slow
pyrophosphate
(SAPP)
Sodium aluminum 950 100 Slow
phosphate (SALP)
Dicalcium phosphate 172 33 Slow
dihydrate (DCP)
Sodium aluminum 484 104 Slow
sulfate (SAS)
Fumaric acid 116 145 Fast
Potassium acid 188 50 Medium
tartrate
Glucono‐delta‐ 178 45 Slow
lactone
a Adapted from [4] and [7].
b Rate of reaction with NaHCO at room temperature.

3
NV are used to determine the amount of acid needed to

neutralize a given amount of NaHCO3. For example, if a
formula specifies 20 kg of NaHCO3, the amount of SAS (NV
= 104) required would be:
(8)
13
www.ajpdf.com
Baking powders and recipes are generally formulated to

give baked products with near‐neutral pHs. There are,
however, some exceptions to this:
i. Devil’s Food Chocolate Cake. Excess sodium

bicarbonate is added to give an alkaline pH in order
for the chocolate to form the characteristic deep red
color.
ii. Buttermilk products. Excess acid (in the form of
buttermilk) is added to give the characteristic flavor.
iii. Pretzels and Gingerbread. Alkaline pHs are produced
to accelerate nonenzymatic browning reactions which
are important for the deep brown color.
2.2.3 Leavening Rates

The rates at which doughs are leavened are important
determinants of the quality of baked products. Leavening
rates in dough systems are influenced by a variety of
factors including the types and concentrations of the
leavening agents, temperature, the availability of water,
and pressure [8].
Leavening rates may be measured by trapping evolved CO2
and plotting CO2 volume versus time. The amount of CO2
produced is usually expressed as a percentage of the total
amount of CO2 that would be released if all of the sodium
bicarbonate were converted to CO2 and H2O. When
measured in a dough system, leavening rates are called
“dough reaction rates.” Typical dough reaction rates for
some leavening acids are shown in Figure 2.1.
14
www.ajpdf.com
Figure 2.1 Rates of CO2 production from mixtures of SALP

and MCP‐H2O, SAPP‐40, or SAS. Evolved CO2 is expressed
as a percentage of “available” CO2 in the NaHCO3.
Source: Adapted from [9].
Measurement of leavening rates must be carefully

standardized with respect to temperature, time, agitation,
and ingredients so that comparisons between laboratories
and experiments will be valid [10]. The examples of
leavening rates given above serve to illustrate the fact that
rates differ considerably among leavening systems. It
should be remembered that leavening rates for a given
leavening acid can be manipulated by applying coatings
and changing particle size. Also, other ingredients in the
batter or dough may affect leavening rates. Thus, when
purchasing leavening acids from suppliers, it is important
to specify the leavening rate needed for a particular
application.
2.2.4 Effect of Leavening Acid on Dough

Rheology
Cations and anions from chemical leaveners may alter the
elastic and viscous properties of the dough and the texture
and resiliency of the crumb. Calcium and aluminum ions
15
www.ajpdf.com
can prevent coalescence of air bubbles into larger cells so

that the structure of the finished product remains fine.
Thus, two leavening acids with similar leavening rates may
produce products with different textures.

1. Filter flask, 125 ml
2. Rubber tubing
3. Rubber stopper
4. Graduated cylinders, 100 and 500 ml
5. Ring stand with holder
6. Magnetic stirrer and stir bars
7. Shallow pan
8. pH meter and pH standard buffers
9. Baking oven set at 218 °C (420 °F)
10. Water bath, 60–70 °C
11. Burettes
12. Electric mixer
13. Thermometer

1. Sodium bicarbonate
2. Monocalcium phosphate monohydrate (MCP)
3. Sodium aluminum sulfate (SAS)
4. Commercial double‐acting baking powder
5. All‐purpose flour
6. Sugar
7. Salt
8. Skim milk
16
www.ajpdf.com
9. Vegetable oil
10. Millet seeds
2.5 Procedures
2.5.1 Determination of Leavening Rates
2.5.1.1 The Apparatus
Set up CO2 measuring apparatus as shown in Figure 2.2.
Figure 2.2 Apparatus for collecting and quantifying the

volume of gas released.
2.5.1.2 Experimental Treatments and Controls

Note: When there is more than one ingredient, mix them
together thoroughly before adding to the flask.
1. Control (no leavening agent)

2. Sodium bicarbonate (0.34 g)
3. Sodium bicarbonate (0.34 g) + MCP‐H2O (0.42 g)
4. Sodium bicarbonate (0.34 g) + SAS (0.33 g)
5. Baking powder (1.21 g). Note: this assumes that
baking powder is 28% NaHCO3.
2.5.1.3 Protocol
17
www.ajpdf.com
Note: This is a standard protocol for measuring leavening

rates in a model system.
1. Add 60 ml distilled water and a magnetic stir bar to a

filter flask.
2. Fill a 100 ml graduated cylinder with tap water and
invert it in a pan of water as shown in Figure 2.2 (take
care to avoid allowing air to get into the cylinder).
3. Weigh out the specified amounts of each of the
leavening agents (see Section 2.5.1.2).
4. With the stirrer running on low speed, transfer the
leavening agent to the flask and stopper immediately.
(Note: The rate of stirring will affect the rate of the
reaction, so always use the same setting on the
stirrer.)
5. Record the volume of displaced water in the cylinder
every 30 seconds for five minutes.
6. Now, set the flask in a water bath held at 65 °C and
continue recording the volume for an additional five
minutes. (Note: Temperature can have a marked effect
on CO2 generation, so regulate the temperature
carefully.)
7. Measure the final pH of the solution in the filter flask.
2.5.1.4 Data Analysis

Note: A spreadsheet program will save you time on this
exercise.
1. For each data point, subtract the control value from

the treatment value.
2. Determine the total available CO2 in each of the
treatments (express as moles of CO2). Assume that the
baking powder contains 28% sodium bicarbonate.
3. Determine the moles of CO2 evolved at each time
point. (You will need to use the ideal gas law to
18
www.ajpdf.com
calculate the moles of CO2.) Transform your data to %

of total available CO2.
4. Plot %CO2 evolved vs time for each of the treatments.
Your plot should be similar to Figure 2.1. Be sure to
indicate on your plot the point where you put the flask
into the 65 °C bath.
2.5.2 Chemically Leavened Biscuits

2.5.2.1 Biscuit Formula
Ingredients Amount
All‐purpose flour 100 g
Sugar 6g
Sodium bicarbonate 1 g
Leavening acid To be calculateda
Salt 1.5 g
Oil 23 g
Skim milk 80 ml
a Use the appropriate neutralizing values to calculate the amount.
2.5.2.2 Treatments
1. Control 1 (no leavening acid and no sodium

bicarbonate)
2. Control 2 (1 g sodium bicarbonate but no leavening
acid)
3. Fast‐acting leavening acid (use monocalcium
phosphate monohydrate)
4. Slow‐acting leavening acid (use sodium aluminum
sulfate)
5. Double‐acting leavening acid (use a 50 : 50 mixture of
MCP monohydrate and SAS).
6. Baking powder (3.8 g), no sodium bicarbonate.
19
www.ajpdf.com
2.5.2.3 Protocol
1. Mix the dry ingredients thoroughly in a mixing bowl.

2. Add the milk, and oil and mix thoroughly (use 16
strokes) with a rubber spatula.
3. Measure out 65 g aliquots of the dough and place on a
baking sheet. Make sure there is 1‐inch separation
between each biscuit.
4. Bake at 218 °C (420 °F) for 15 minutes.
5. Cool down.
6. Compare volumes (see below) and textures of the
various treatments.
7. Calculate the density of each biscuit.
2.5.2.4 Volume Determination of Biscuits
1. Select a plastic container (e.g. margarine tub or yogurt

carton) slightly larger than the biscuit.
2. Fill the container level full with fine seeds (rapeseed
or millet).
3. Pour seeds in the container into a graduated cylinder
and record volume.
4. Place the biscuit in the empty container and refill with
seeds.
5. Measure the volume of the seeds and calculate the
volume of the biscuit by difference.
2.6 Problem Set

Note: These problems are designed to help you review
concepts from introductory chemistry. Consult your
introductory chemistry textbook for review.
1. Calculate the volume (at 25 °C and 1 atmosphere) of

available CO2 contained in 0.34 g NaHCO3.
20
www.ajpdf.com
2. Explain why leavening rates differ between leavening

acids.
3. The bicarbonate ion contains a proton and yet
bicarbonate acts as a base in most leavening systems.
Explain why this is so.
4. Why are double‐acting baking powders more effective
in many baking applications than single‐acting baking
powders?
5. The recipe for a large batch of pancake batter specifies
1 pound of baking soda and MCP as the leaving acid.
How much MCP should be used?
6. Vinegar contains about 5% acetic acid (wt/vol).
Calculate the normality of vinegar. What volume of
vinegar would be required to neutralize 100 ml of 0.1
N sodium hydroxide?
7. You are baking a batch of biscuits and are out of
baking powder. You decide to improvise and use
vinegar and baking soda. You decide to add 2
teaspoons of baking soda to your dough. What volume
of vinegar will you use? Assume that 1 mole of acetic
acid will neutralize 1 mole of baking soda. One
teaspoon of baking soda weighs 5 g.
8. The published neutralizing value of monocalcium
phosphate monohydrate (MCP) is 80. Calculate the
expected NV of monocalcium phosphate monohydrate
based on stoichiometric relationships. Assume that
the MCP is behaving as a monoprotic acid in this
system. Does your result agree with the measured
value of 80? If not, give a possible explanation. Note:
To solve this problem, you will need to write balanced
equations for the reactions between MCP and sodium
bicarbonate (one with MCP acting as a monoprotic
acid and the other with MCP acting as a diprotic acid).
9. What volume of CO2 would be produced from the
complete neutralization of 5 g sodium bicarbonate at
80 °C?
21
www.ajpdf.com
10. Draw the structure of potassium acid tartrate. Write

an equation to show why it is a leavening acid.
11. What is the main leavening acid in cultured
buttermilk? Draw its structure.
12. What is the main leavening acid in lemon juice? Draw
its structure.
13. Explain how glucono‐delta‐lactone can act as a
leavening acid.
14. What is the minimum percentage of sodium
bicarbonate in baking powder necessary to yield 12 g
of CO2 per 100 g of powder? (Assume that all of the
bicarbonate is converted to CO2 and H2O.)
15. What volume of 1.0 molar sulfuric acid would be
required to neutralize 100 ml of 1.0 molar sodium
hydroxide?
2.7 Useful Formulas and Values

1. Ideal gas law:PV = nRT
where: P = pressure in atmospheres (atm)
V = volume in liters (l)
n = number of moles of gas
R = 0.0821 (l) (atm) (mol−1) (K−1)
T = temperature in K
2. Volume of 1 mole of CO2 under standard conditions =
22.40 l.
3. Standard temperature and pressure for gases: T = 273
K; P = 1 atm.
4. Baking soda content of baking powder: 28% NaHCO3
(w/w).
5. Formula weight of NaHCO3 = 84.01.
6. Molecular weight of CO2 = 44.0.
22
www.ajpdf.com
2.8 References
1 Van Wazer, J.R. and Arvan, P.G. (1954). Chemistry of
leavening. Milling Production February–March: 3–7.
2 Heidolph, B.B. (1996). Designing chemical leavening
systems. Cereal Foods World 41 (3): 118–126.
3 Gardner, W.H. (1966). Food Acidulants . Allied Chemical.
185 p.
4 Lindsay, R.C. (2017). Food additives. In: Fennema’s Food
Chemistry , 5e (eds. S. Damodaran and K.L. Parkin ),
803–864. Boca Raton: CRC Press,Taylor & Francis
Group.
5 McGee, H. (2004). On Food and Cooking: The Science and
Lore of the Kitchen . Completely rev. and updated. New
York: Scribner. 884 p.
6 AACC method 2‐32 A (1995). Neutralizing value of acid‐
reacting materials. In: Approved Methods of the AACC ,
9e. St. Paul, MN: The American Association of Cereal
Chemists.
7 Book, S.L. and Waniska, R.D. (2015). Leavening in flour
tortillas. In: Tortillas (eds. L.W. Rooney and S.O. Serna‐
Saldivar ), 159–183. St. Paul, MN: AACC International
Press.
8 Bellido, G.G., Scanlon, M.G., Sapirstein, H.D., and Page, J.H.
(2008). Use of a pressuremeter to measure the kinetics
of carbon dioxide evolution in chemically leavened
wheat flour dough. Journal of Agricultural and Food
Chemistry 56 (21): 9855–9861.
9 Kichline, T.P. and Conn, T.F. (1970). Some fundamental
aspects of leavening agents. Bakers Digest 44 (4): 36–40.
10 Conn, J.F. (1981). Chemical leavening systems in flour
products. Cereal Foods World 26 (3): 119–123.
23
www.ajpdf.com
11 Penfield, M.P. and Campbell, A.M. (1990). Experimental

Food Science , 3e. San Diego: Academic Press. 541 p.
(Food science and technology).

Labaw, G.D. (1982). Chemical leavening agents and their
use in bakery products. Bakers Digest. 56 (1): 16.
Robinson, J.K., McMurry, J., and Fay, R.C. (2019). Chemistry ,
8e. Hoboken, NJ: Pearson Education, Inc. 1200 p.

1. Volume of CO2 = 99 ml
2. Fast‐acting acids dissolve rapidly, slow‐acting acids
dissolve more slowly.
3. Bicarbonate has a high pKa, which means it will not
dissociate until the pH is high.
4. Double‐acting powders allow release of some CO2
prior to baking which helps improve batter viscosity.
5. 1.25 lb MCP.
6. Normality of vinegar = 0.833 N. It will take 12 ml
vinegar to neutralize 100 ml of 0.1 N NaOH.
7. 143 ml vinegar.
8. Two equations may be written:
Monoprotic:
Diprotic:
24
www.ajpdf.com
The published value of 80 lies between 67 and 133.

This suggests that the sodium bicarbonate reacts
nearly completely with the first H on the H2PO4 − but
only partially with the second, i.e. the diprotic
reaction above does not go to completion.
9. 1.72 l CO2.
10.
11.
25
www.ajpdf.com
12.
13. A lactone is an ester formed from the reaction of a
carboxyl group and an alcohol group on the same
molecule. Glucono‐delta‐lactone slowly hydrolyzes in
water to form gluconic acid.
14. 22.9%.
15. 50 ml.
26
www.ajpdf.com
3
Properties of Sugars

1. Draw structures of common reducing and

nonreducing sugars.
2. Explain the difference between a hemiacetal and an
acetal.
3. Distinguish between reducing and nonreducing sugars
experimentally.
3.2 Introduction
Sugars are polyhydroxylated aldehydes or
polyhydroxylated ketones (Figure 3.1). Thus, they
participate in reactions characteristic of alcohols and
aldehydes or ketones. Please review the sections in your
organic chemistry textbook that describe reactions for
alcohols, aldehydes, and ketones.
Recall that alcohols react reversibly with aldehydes or
ketones to form hemiacetals or hemiketals. When the
alcohol and carbonyl groups are on the same molecule, as
is the case with sugars, a cyclic or ring structure is formed
(Figure 3.2).
Note that hemiacetals contain a carbon atom bonded to an
–OH group and an –O–R group. Hemiacetals are relatively
unstable. In aqueous solution, the open and closed ring
forms are both present in equilibrium. Thus, sugars like
glucose participate in reactions characteristic of aldehydes
even though the predominant form is the hemiacetal.
Sugars containing the hemiacetal group are called reducing
sugars because they are capable of reducing various
27
www.ajpdf.com
oxidizing agents. Several well‐known assays, based on this

tendency to oxidize, have been developed for detecting
reducing sugars. These include the Tollen’s test (sugars are
mixed with Ag+ in aqueous ammonia solution), the
Fehling’s test (sugars are mixed with Cu2+ in aqueous
tartrate solution), and the Benedict’s test (sugars are
mixed with Cu2+ in aqueous citrate solution). When mixed
with these solutions, reducing sugars are oxidized causing
a reduction in the valence of the metal ion. In the Tollen’s
test, a shiny mirror of elemental silver (Ag0) forms on the
inside surface of the test tube. In the Fehling’s and
Benedict’s tests, Cu2+ is reduced to Cu1+ which reacts with
water to form reddish brown cuprous oxide. Benedict’s
reagent is used in some of the “sugar sticks” diabetics use
to test their urine for spilled sugar. The following chemical
equation describes the Benedict’s test [1]:
Figure 3.1 Three representations of the structure of

glucose, a polyhydroxylated aldehyde.
28
www.ajpdf.com
Figure 3.2 Balanced equation showing the nucleophilic

attack of the C‐5 hydroxyl oxygen of glucose on the
carbonyl carbon of the same molecule to form a
hemiacetal.
When conditions are right, hemiacetals can react with
alcohols to form acetals. For example, glucose in the
hemiacetal form might react with fructose to form the
acetal better known as sucrose (Figure 3.3). Carbohydrate
acetals are called glycosides.
Recall that acetals contain a carbon bonded to two –O–R
groups. Unlike hemiacetals, acetals are relatively stable in
aqueous solution and do not readily split into the
hemiacetal and alcohol forms. However, they may be split
into the alcohol and hemiacetal by acid‐catalyzed
hydrolysis.

1. Test tubes
2. Volumetric flasks, 50 ml
3. Hot plate
4. Large beaker, 600 ml
5. Water bath, 37 °C
6. Water bath, boiling
29
www.ajpdf.com
Figure 3.3 The formation of sucrose, a 1,2‐glycoside, from

glucose and fructose.

1. Crystalline glucose, fructose, sucrose, lactose, and
sorbitol
2. HCl, 0.5 N
3. NaOH, 1.0 N
4. Benedict’s solution (CuSO4 in citrate/carbonate
buffer) [2].
To prepare Benedict’s solution: Dissolve, with
stirring, 17.3 g sodium citrate and 10 g Na2CO3 in 80
ml distilled water. Dissolve 1.73 g CuSO4 .5H2O in 10
ml water. Add the CuSO4 solution to the
citrate/carbonate solution. Transfer to a 100 ml
volumetric flask. Dilute to 100 ml and mix well.
5. Starch solution (3% soluble starch in water)
6. Amylase solution (~1% amylase in water)
3.5 Procedures
1. Transfer 3 ml starch solution to each of two test tubes.
2. Add 5 drops of amylase solution to one of the tubes
from Step 1 and incubate both tubes for 15 minutes in
a 37 °C water bath.
3. Prepare solutions of glucose, fructose, sucrose, lactose,
and sorbitol (50 ml of each, 0.1 mol l−1, in water).
4. Prepare 50 ml of 0.1 mol l−1 sucrose in 0.5 N HCl.
30
www.ajpdf.com
5. Transfer 5‐ml aliquots of the sucrose‐HCl solutions

(from Step 4) to two test tubes.
6. Heat one of the test tubes from Step 5 in a boiling
water bath for 10 minutes, cool. Keep the other at
room temperature. Neutralize the HCl in the tubes by
adding 1 ml of 1.0 N NaOH to each tube.
7. Transfer 3 ml of each of the solutions, including the
starch solutions and the heated and unheated sucrose
solutions, into separate test tubes.
8. Add 8 drops of Benedict’s solution to each tube
(including the starch solutions and a water blank). Mix
well.
9. Place tubes in boiling water bath for three minutes.
10. Remove tubes from bath and observe color and
appearance of solutions.
3.6 Study Questions

1. Draw the structure of each of the sugars you tested.
Label them reducing or nonreducing.
2. What structure is characteristic of reducing sugars?
Explain.
3. Compare your results from the 3 sucrose solutions (in
water, in HCl, in HCl with heating). Explain any
differences.
4. Compare the structures of glucose and sorbitol (a
sugar alcohol).
5. Fructose is not an aldose, yet it is a reducing sugar.
Explain. (Hint: Remember that tests for reducing
sugars are conducted in alkaline solution and recall
the concept of keto‐enol tautomerism.)
6. Name and draw the structures of 5 glycosides that
may be present in foods.
7. Are all disaccharides nonreducing sugars? Explain.
31
www.ajpdf.com
8. Is starch reducing? Explain. Is starch treated with

amylase reducing? Explain.
3.7 References
1 Huber, K.C. and BeMiller, J.N. (2017). Carbohydrates. In:
Fennema’s Food Chemistry , 5e (eds. S. Damodaran and
K.L. Parkin ), 91–169. Boca Raton: CRC Press,Taylor &
Francis Group.
2 Benedict, S.R. (1909). A reagent for the detection of
reducing sugars. Journal of Biological Chemistry 5: 485–
487.

Brady, J.W. (2013). Introductory Food Chemistry . Ithaca:
Comstock Publishing Associates. 638 p.
32
www.ajpdf.com
4
Nonenzymatic Browning

1. Prepare buffers and other solutions.

2. Assess and/or predict the extent of browning in a food
or beverage based on such factors as type of
carbohydrate, protein content, pH, and processing and
storage temperatures.
3. Develop formulations of bakery products that
optimize nonenzymatic browning.
4.2 Introduction
Brown colors often develop during the processing, storage,
and preparation of foods and food ingredients. Some
reactions which produce brown colors are enzyme
catalyzed. These reactions usually involve oxidation of food
components. Other browning reactions are nonenzymatic.
These include caramelization of sugars and the Maillard
reaction. This laboratory exercise will focus on
nonenzymatic browning.
4.2.1 Caramelization
Heating sugars to high temperature causes them to
undergo a series of complex decomposition reactions.
Products of these reactions include brown‐colored
polymers and numerous flavor compounds. One of these
products, caramel, is widely used to color a variety of
beverages and foods including cola, beer, whiskey, bakery
goods, and confectionary. In the commercial production of
caramels, a sugar, usually sucrose, is mixed with catalytic
33
www.ajpdf.com
amounts of food‐grade acids, bases, or salts. The choice of

catalyst influences the charge, color, and other attributes of
the final product [1].
Caramel compounds may be either positively or negatively
charged. The charge on the caramel molecules is important
because the wrong charge may result in precipitation in
the food being colored. For example, caramels used to color
soft drinks should be negatively charged so they would not
combine with phosphates to cause precipitation. These
caramels are produced by heating sucrose in the presence
of ammonium bisulfate [2]. The caramel color used in
bakery products, beer, and confectionaries are often
positively charged [3]. It is produced by adding ammonium
salts such as ammonium carbonate or ammonium
phosphate [1].
4.2.2 The Maillard Reaction

The reaction between sugars and amines is known as the
Maillard reaction (after the French chemist who studied it).
The brown color in Maillard browning is due to the
formation of melanoidins which are complex large‐
molecular‐weight molecules. The initial reaction is
between an aldehyde or ketone group on a sugar molecule
and a free amino group on a protein, peptide, or amino acid
molecule, hence the often used term “sugar‐amine
reaction.” The reaction may be desirable (e.g. the chocolate
flavor which develops when cocoa beans are roasted is the
result of browning) or undesirable (e.g. the objectionable
dark brown color that sometimes develops in potato chips
during frying). The initial steps in the reaction between a
sugar and an amine are shown in Figure 4.1.
34
www.ajpdf.com
Figure 4.1 Fisher projection formulas showing the

reaction of glucose with an amine to form glucosyl amine,
an early product of the Maillard reaction. Reducing sugars
and proteins or amino acids are common substrates for the
Maillard reaction in foods.
The glycosyl amines formed as shown in Figure 4.1 then
undergo an Amadori rearrangement to form an amino keto
sugar (Figure 4.2).
Figure 4.2 The Amadori rearrangement of glucosyl amine

to an amino‐deoxy‐ketose.
Amadori products are unstable to heat and undergo a
complex series of reactions that ultimately produce
35
www.ajpdf.com
hundreds of flavor and aroma compounds and high

molecular‐weight brown pigments called melanoidins.
Several factors influence the extent of Maillard browning in
a food. First, either an aldehyde or a ketone (reducing
sugars are the most important in food systems) and an
amine (protein is by far the most important) must be
present. Other factors include temperature, concentrations
of the sugars and amines, pH, and the type of sugar [1].
4.2.2.1 Sugar
Both stereochemical configuration and size of sugar
molecules affect the rate of the Maillard reaction [4]. In
general, smaller sugar molecules react faster than larger
ones. Pentoses react faster than hexoses and hexoses react
faster than disaccharides. Not all hexoses react at the same
rate. Galactose seems to be the most reactive among the
common hexoses. Fructose reacts more rapidly than
glucose in the initial stages but as the reaction proceeds,
the rates are reversed [1]. In foods, the sugars most
important for Maillard browning are glucose, fructose,
maltose, and lactose [5]. In meats, ribose may be
significantly involved. See Figure 4.3 for structures of these
common sugars.
36
www.ajpdf.com
Figure 4.3 Fisher projection (top) and Haworth formulas

showing the structure of some common sugars that
participate in Maillard browning in foods. Note that they all
have free aldehyde or keto groups.
4.2.2.2 Amine
As mentioned above, proteins, peptides, and free amino
acids can participate in the Maillard reaction. N‐terminal
amino acids in proteins and peptides have a free α‐amino
group that can react with sugars but the concentration of
these is usually low in most foods because proteins are
high molecular‐weight molecules and there is only one N‐
terminal amino acid residue per protein molecule. Amino
groups tied up in peptide bonds do not react with sugars.
Therefore, the ε‐amino group on lysine residues in proteins
and peptides is generally the available amino group in
foods present in the highest concentration. See Figure 4.4
for the structures of some amino acid residues in a protein.
37
www.ajpdf.com
Figure 4.4 Structure of a generic protein showing amino

groups that are available for reacting with aldehydes in
Maillard browning. Most proteins contain more than 100
amino acid residues, so n will be greater than 100 in most
cases. In this example the α‐amino group on the amino
terminal alanine and the ε‐amino group on the lysine
residue are available for reaction with sugars.
4.2.2.3 Temperature
According to Adrian [4], the reaction rate is measurable at
37 °C provided several days of reaction time are allowed,
rapid at 100 °C, and violent at 150 °C.
4.2.2.4 Concentration
The reaction is extremely slow in very dry foods and in
highly dilute solutions [4]. Maximum rates of browning
reactions occur in foods containing about 10–15%
moisture. This is because some water is necessary for the
reactants to interact but in very dilute solutions, the
reactants would be relatively widely separated. Water may
also act as an inhibitor of the reaction since several of the
steps in the complex series of reactions are dehydrations
and an excess of water, a product of dehydration reactions,
could be expected to inhibit the reaction.
4.2.2.5 pH
The major effect of pH is related to the protonation of
amino groups. At low pH, more of the amine groups would
38
www.ajpdf.com
be protonated and fewer would be available for reaction

(Figure 4.5).
Figure 4.5 The effect of pH on the protonation of free

amino groups in a protein, in this case with an amino
terminal lysine residue. In proteins, the pKa for the
terminal α‐amino group is around 7.8 while it is
approximately 10.2 for the ε‐amino group on a lysine
residue.
Maillard browning is a common problem in stored nonfat
dried milk because of its high lactose content and its
reactive protein. Storage of milk powders under
unfavorable conditions can result in serious deterioration
in quality. Table 4.1 shows a comparison of fresh and
stored milk powder.
39
www.ajpdf.com
a,b
Table 4.1 Effects of storage on skim milk powder .
Fresh Stored
powder powder
pH of reconstituted milk 6.73 6.50
Reducing power (ferricyanide 0.9 16.0
value)
Free amino‐N content (% 100 36
initial value)
Biological value (protein) 84.5 67.5
Biological value with added 76.4 80.1
lysine
Flavor of reconstituted milk Palatable Nauseating
a Storage conditions: 60 days, 37 °C, 7.3% moisture.
b Modified from [4].

1. pH meter
2. Pipettes, 10 ml
3. Volumetric flasks, 50 and 100 ml
4. Beakers, 50, 100, 250, and 600 ml
5. Glass stirring rods
6. Test tubes
7. Test tube racks
8. Permanent marker
9. Hot plate
11. Pasteur pipettes
12. Vortex mixer
13. Top loading balance
40
www.ajpdf.com
14. Spectrophotometer
16. Aluminum weighing dishes
17. Household bread machine
18. Oven, set at 125 °C for nonfat dry milk, and at 190 °C
for cookies
19. Cookie sheets
20. Mixing bowls and utensils for baking

1. Crystalline glucose
2. Crystalline glycine
3. KH2PO4, 1/15 M
4. Na2HPO4, 1/15 M
5. Nonfat dry milk
6. Ingredients for yeast bread (flour, water, sugar, salt,
and yeast)
7. Ingredients for cookies (flour, shortening, baking soda,
baking powder, egg, sucrose)
8. High fructose corn syrup
9. Corn syrup
4.4.1 Reagents to Be Prepared by the Student
1. Phosphate buffer, 1/15 M, pH 5 and 8 (see Appendix

III for buffer tables)
2. Glucose, 0.5 M, in phosphate buffer, pH 5 and 8
3. Glycine, 0.5 M, in phosphate buffer, pH 5 and 8
4.4.2 Reagents to Be Prepared by the Teaching

Staff
41
www.ajpdf.com
1. Fructose, 0.25 M + 0.25 M glycine in 1/15 M phosphate

buffer, pH 5 and 8
2. Sucrose, 0.25 M + 0.25 M glycine in 1/15 M phosphate
buffer, pH 5 and 8
3. Lactose, 0.25 M + 0.25 M glycine in 1/15 M phosphate
buffer, pH 5 and 8
4. Glucose, 0.25 M in 1/15 M phosphate buffer, pH 5 and
8
5. Fructose, 0.25 M in 1/15 M phosphate buffer, pH 5 and
8
6. Sucrose, 0.25 M in 1/15 M phosphate buffer, pH 5 and
8
7. Lactose, 0.25 M in 1/15 M phosphate buffer, pH 5 and
8
8. Glycine, 0.25 M in 1/15 M phosphate buffer, pH 5 and
8
4.5 Procedures
4.5.1 Preparation of a Glucose/Glycine Model
System
Note: The objective here is to prepare buffered
glucose/glycine solutions with identical concentrations but
varying pHs.
1. Prepare 100 ml of 1/15 M phosphate buffer, pH 5.0

and 100 ml of 1/15 M phosphate buffer, pH 8.0
(prepare from 1/15 M KH2PO4 and 1/15 M Na2HPO4).
See Appendix for volumes to mix.
2. Prepare 50 ml of 0.5 M glucose solutions in each of the
phosphate buffers. (The M.W. of the glucose is 180.16
g mole−1.) Add the glucose a little at a time with
stirring to about 30 ml of the buffer in a beaker,
transfer to a volumetric flask, and dilute to volume
with buffer.
42
www.ajpdf.com
3. Prepare 50 ml of 0.5 M glycine solution in each of the

phosphate buffers.
(The M.W. of glycine is 75 g mole−1.)
4. In a test tube, mix 5 ml of the glucose solution with 5
ml of the glycine solution to form a glucose‐glycine
solution. What are the molar concentrations of glucose
and glycine in this solution? Do this for both pH 5 and
8.
5. Heat the solutions in a 95 °C water bath for 30
minutes (see Section 4.5.2).
4.5.2 Heating Experiment
1. Label 18 test tubes with the treatments shown below

and place them in plastic test tube racks. Transfer 10
ml aliquots of the solutions listed below to the test
tubes and cap them loosely.
Treatment at pH 5 Treatment at pH 8
Glucose Glucose
Fructose Fructose
Sucrose Sucrose
Lactose Lactose
Glycine Glycine
Glucose/glycine Glucose/glycine
Fructose/glycine Fructose/glycine
Sucrose/glycine Sucrose/glycine
Lactose/glycine Lactose/glycine
2. Place all tubes in a 95 °C water bath for 30 minutes.
4.5.3 Measurement of Extent of Browning
1. After the tubes from the 95 °C water bath have cooled,

measure the pH in each tube.
2. Turn on your spectrophotometer and allow it to warm
up. Turn the wavelength selector to 430 nm. Use water
43
www.ajpdf.com
to set 0 absorbance.
3. Measure the absorbance of each of your solutions. You
may have to dilute (with water) the darker solutions
to keep them on scale. To calculate the absorbance of
the original undiluted solutions, multiply the
absorbance of the diluted solution by the dilution
factor.
4.5.4 Browning in Nonfat Dry Milk

(Demonstration)
1. Cover the bottom of 5 aluminum weighing dishes with

nonfat dry milk.
2. Place 4 of the samples in a 125 °C oven.
3. Remove one sample at 10, 20, 30, and 60 minutes.
4. Compare all samples and describe the color of the
samples.
4.5.5 Role of Milk in Crust Color of Bread

(Demonstration)
Many recipes for bread call for the addition of nonfat dry
milk to promote Maillard browning in the crust. In this
experiment, we will test the hypothesis that the crust color
of bread is darker when bread is made with a small amount
of nonfat dry milk compared with bread made without
milk. The basic formula for yeast bread is flour, water,
sugar, salt, and yeast. Small amounts of fat and milk may
also be added. Most commercial breads contain anti‐staling
agents such as mono or di‐glycerides and mold‐inhibiting
preservatives such as sodium or potassium propionate.
A household bread machine will be used to bake the bread.
Add the ingredients to the bread pan in the amounts and
order specified in the manual provided by the
manufacturer of the bread machine. Start the machine. Do
not open the lid on the machine until the cycle is complete.
When the baking cycle is complete, remove the pan from
44
www.ajpdf.com
the machine (use oven mitts) and remove the loaf from the
pan.
Compare the crust color of loaves prepared with and
without the added nonfat milk powder. Slice the bread and
compare the crumb structure of the breads.
4.5.6 Browning in Cookies

Most cookies contain high concentrations of sugar, usually
sucrose. The type and concentration of sugar in cookies
affects cookie spread during baking, surface cracking, and
browning, among other quality factors. In this experiment,
we will make sugar cookies using a standard recipe and
then substitute either high‐fructose corn syrup or regular
corn syrup for a portion of the sucrose. (In the cookie
formula below, reduce the sucrose to 65 g and add 10 g of
either high‐fructose corn syrup or regular corn syrup.)
4.5.6.1 Sugar Cookie Formula

Ingredients Amount
Flour (g) 85
Shortening (g) 55
Sucrose (g) 75
Baking soda (g) 1
Baking powder (g) 0.6
Egg ¼ egg
Source: From http://allrecipes.com/recipe/easy‐sugar‐cookies/?
scale=12&ismetric=0.
4.5.6.2 Baking Directions
1. Preheat oven to 375 °F (190 °C). In a small bowl, stir

together flour, baking soda, and baking powder. Set
aside.
2. In a large bowl, cream together the butter and sugar
until smooth. Beat in egg and vanilla. Gradually blend
in the dry ingredients. Roll rounded teaspoonfuls of
45
www.ajpdf.com
dough into balls, and place onto an ungreased cookie

sheet.
3. Bake 8–10 minutes in the preheated oven, or until
golden. Let stand on the cookie sheet for two minutes
before removing to cool on wire racks.
Prepare three batches:
Control: As above with 75 g sucrose
High‐fructose corn syrup: 65 g sucrose, 10 g HFCS
Corn syrup: 65 g sucrose, 10 g corn syrup
Source: From http://allrecipes.com/recipe/easy‐
sugar‐cookies/?scale=12&ismetric=0.
4.6 Problem Set

1. Describe carefully how you would prepare 1 l of 1/15
M phosphate buffer, pH 8 from crystalline, anhydrous
KH2PO4 and Na2HPO4. You may use the tables for
buffer preparation in Appendix III.
2. Describe how you would prepare 100 ml of a solution
containing 0.25 M glucose and 0.25 M glycine in water.
3. Nonfat fluid milk contains approximately 2.7 g of
lysine (2.37 g lysine residues) per liter, almost all of
which is present as amino acid residues in casein and
whey protein. (Note: the molecular weight of lysine is
146 but the molecular weight of a lysine residue is
128. Can you explain the difference?) Assuming that
the pH of milk is 6.6, calculate the concentration of un‐
protonated ε‐amino groups in milk. Recall that the pKa
for lysine residues in a protein is approximately 10.2.
Hint: use the Henderson–Hasselbalch equation. Based
on your answer, would you expect lysine residues in
milk protein to participate in Maillard browning? Why
or why not?
4.7 Study Questions
46
www.ajpdf.com
1. Explain the difference in browning that you observed

between the glucose/glycine and the sucrose/glycine
model systems.
2. Explain the effect of pH on Maillard browning.
3. If you were to manufacture a formulated food product
containing added sugar, what (a) ingredients, (b)
processing techniques, and (c) storage conditions
would you use to minimize nonenzymatic browning?
How might you enhance nonenzymatic browning?
4. Give three examples each of desirable and undesirable
nonenzymatic browning reactions in food systems.
4.8 References
1 Huber, K.C. and BeMiller, J.N. (2017). Carbohydrates. In:
K.L. Parkin ), 91–169. Boca Raton: CRC Press, Taylor &
Francis Group.
2 Myers, D.V. and Howell, J.C. (1992). Characterization and
specifications of caramel colours: an overview. Food and
Chemical Toxicology 30 (5): 359–363.
3 Wong, D. (2017). Mechanism and Theory in Food
Chemistry , 2e. New York, NY: Springer Science+Business
Media. 450 p.
4 Adrian, J. (1982). The Maillard reaction. In: Handbook of
Nutritive Value of Processed Food Volume 1 Food for
Human Use (ed. M. Rechcígl ), 592–608. Boca Raton, FL:
CRC Press.
5 Sikorski, Z.E., Pokorny, J., and Damodaran, S. (2008).
Physical and chemical interactions of components in
food systems. In: Fennema’s Food Chemistry , 4e (eds. S.
Damodaran, K. Parkin and O.R. Fennema ), 849–883.
Boca Raton: CRC Press/Taylor & Francis.
47
www.ajpdf.com
Belitz, H.‐D., Grosch, W., and Schieberle, P. (2009). Food

Chemistry , 4e. Berlin: Springer. 1070 p.
BeMiller, J.N. and Whistler, R.L. (eds.) (2009). Starch:
Chemistry and Technology , 3e. London: Academic Press.
879 p. (Food science and technology).
Brady, J.W. (2013). Introductory Food Chemistry . Ithaca:
Buffer Reference Center (2020). Sigma‐Aldrich [Internet].
https://www.sigmaaldrich.com/life‐science/core‐
bioreagents/biological‐buffers/learning‐center/buffer‐
reference‐center.html (accessed 10 February 2020.
Reyes, F.G.R., Poocharoen, B., and Wrolstad, R.E. (1982).
Maillard browning reaction of sugar‐glycine model
systems: changes in sugar concentration, color and
appearance. Journal of Food Science 47 (4): 1376–1377.
Sapers, G.M. (1993). Browning of foods: control by sulfites,
antioxidants, and other means. Food Technology 47 (10):
75–84.
Shallenberger, R.S. and Birch, G.G. (1975). Sugar Chemistry .
Westport, CT: Avi Pub. Co. 221 p.

1. Dissolve 3.74 g KH2PO4 and 5.56 g Na2HPO4 and bring
the volume to 1 l in a volumetric flask.
2. Dissolve 4.5 g glucose and 1.89 g glycine and bring the
volume to 100 ml in a volumetric flask.
3. Concentration of un‐protonated ε‐amino groups in
milk = 0.005 mmol L−1.
48
www.ajpdf.com
5
Food Hydrocolloids

1. Describe the chemistry related to the functional

proprieties of selected food hydrocolloids.
2. Prepare dispersions of food hydrocolloids in aqueous
systems.
3. Measure the viscosity of food hydrocolloid
dispersions.
4. Compare the properties of different food gums under
conditions that may be present in foods.
5. Select an appropriate hydrocolloid for a specific food
application.
5.2 Introduction
Hydrocolloids are polymers that can be dissolved or
dispersed in water and that produce thickening or gelling.
Most food hydrocolloids are polysaccharides although
some proteins (e.g. gelatin) also fit the definition.
Hydrocolloid is the scientifically preferred term for these
materials but gum is a common synonym and mucilage is
also used. Hydrocolloids are used extensively as food
additives to perform a variety of functions (Table 5.1).
49
www.ajpdf.com
Table 5.1 Some functional properties of food

hydrocolloidsa.
Function Examples of food applications
Fat replacer Low‐fat ice creams, fat‐free cream
cheese, reduced‐fat salad dressings
Adding body Low‐calorie beverages
Inhibition of Ice cream, syrups
sugar
crystallization
Clarification Beer, wine
Clouding Fruit drinks
Dietary fiber Breakfast cereals
Emulsification Salad dressings, sauces
Gelling Puddings
Stabilization Salad dressings, ice cream
Particle Chocolate milk
suspension
Thickening Jams, pie fillings, sauces
a Modified from [1].
The basis for many of the functional properties of

hydrocolloids is their remarkable capacity to increase
viscosity (thicken) and form gels in aqueous systems at low
concentrations. Polysaccharide hydrocolloids vary in
molecular weight, chain branching, charge, and hydrogen
bond‐forming groups. The effectiveness of hydrocolloids in
providing functionality to foods varies with the
hydrocolloid and the food. Thus, food technologists must
be able to select the right hydrocolloid for a specific
application.
Polysaccharide hydrocolloids may be linear or branched. In
general, thickening power increases with molecular weight
and decreases with chain branching. This is because
extended straight‐chain molecules “sweep” out a larger
volume as they tumble in solution than branched‐chain
50
www.ajpdf.com
molecules which are more compact. Thus, large linear

polymers with their associated water collide more
frequently with each other than branched and lower
molecular‐weight molecules (Figure 5.1). These collisions
create friction which impedes the flow of the solution and
causes an increase in viscosity.
Figure 5.1 Two polymers of equal molecular weight

tumbling in solution. Note how the branched‐chain
polymer occupies less space in solution.
Most hydrocolloids tend to form clumps when the
powdered hydrocolloid is mixed with water. Since
hydrocolloids must be in solution in order to provide
desired functionalities, it is imperative that mixing with
water is done properly. Gradual addition of powders to
water with high‐shear mixing is one way to avoid
clumping. Another is to mix the dry hydrocolloid with a
liquid “non‐solvent” such as vegetable oil, alcohol, or corn
syrup before mixing with water [2].
Alginate, carrageenan, locust bean gum (LBG), guar gum,
and xanthan gum are hydrocolloids that are widely used in
foods. A brief description of their structures and properties
follows. See references by Glicksman [1, 3], King [2], and
Pettitt [4] for an in‐depth discussion of the chemistry,
properties, and food applications of hydrocolloids.
5.2.1 Alginate
51
www.ajpdf.com
Alginates are salts of alginic acid. They are polysaccharides

composed primarily of mannuronic and guluronic acids
joined by 1 → 4 linkages. Alginates occur naturally in
brown seaweeds where they are present as insoluble
mixed salts of calcium, magnesium, sodium, and potassium
[2]. Sodium and potassium salts of alginic acid are water
soluble. Thus, alginates may be extracted from seaweeds
with dilute alkali.
The uronic acid residues are arranged in blocks of
mannuronic acid, guluronic acid, and alternating
mannuronic/guluronic residues: ‐M‐M‐M‐M‐, ‐G‐G‐G‐G‐,
and ‐M‐G‐M‐G‐M‐G‐. The polymers are unbranched.
Mannuronic acid residues are linked β‐1,4 while guluronic
residues are linked α‐1,4 (Figure 5.2).
Figure 5.2 Conformation of linkages between guluronate

and mannuronate residues in alginate.
Alginates are available commercially in the form of
ammonium, calcium, sodium or potassium salts of alginic
acid, or as propylene glycol alginate. The viscosity of
alginate solutions is affected by the type of cation present
in the solution. Viscosity is relatively low when monovalent
cations like Na+ and K+ are present but increases in the
presence of di‐ and trivalent cations. Most noticeably,
alginate solutions form an irreversible gel with calcium in
cold water, provided calcium availability is controlled to
avoid precipitation. Alginates are noted for their gelling
and thickening properties as well as their ability to
stabilize emulsions and inhibit syneresis. Sodium alginate,
52
www.ajpdf.com
when added to a wheat starch suspension at 2% w/w, has

also been shown to significantly retard retrogradation
making it capable of potentially extending the shelf life of
wheat‐based foods [5]. Alginates are used in salad
dressings, pie fillings, structured fruit pieces, and many
bakery and dairy products.
5.2.2 Alginate Gels

Alginates are very versatile gelling agents and may be used
to form gels in many different kinds of foods. Alginates will
form gels over a wide range of pH values and gelling occurs
readily without heating. Calcium is required for gel
formation. Control of the free calcium concentration is key
to successful gelation. If soluble calcium salts such as CaCl2
are added too rapidly to a solution of alginate, precipitates
rather than gels will form. A proposed model for explaining
how Ca2+ produces gels with alginate is the so‐called egg
box structure shown in Figure 5.3.
53
www.ajpdf.com
Figure 5.3 The unique conformation of the guluronate

linkages in alginate allows for efficient cross linking with
polyvalent cations such as Ca2+. The resulting complexes
are commonly called “egg box” structures since schematic
representations resemble an egg box as shown in the
upper part of the figure [6].
Two approaches to forming alginate gels are known as
“diffusion setting” and “internal setting” [2]. Diffusion
setting involves mixing solutions of calcium and alginate.
When the calcium from the calcium solution contacts the
alginate, gel formation is very rapid at the interface of the
two solutions. Gel strength increases with time as more
calcium diffuses into the interior of the gel. The diffusion
setting method is used to make extruded foods such as
onion rings, pimento strips for olives, and artificial fruit
pieces. It is also used to coat foods with alginate films to
prevent freezer burn and moisture loss. Internal setting, as
the name implies, involves the controlled release of
calcium from calcium complexes dispersed in the alginate
solution. Gels formed by internal setting are more uniform
than gels prepared by the diffusion setting method. They
may be formed by thoroughly mixing all dry ingredients
including the alginate and a calcium source and then
adding the mixture to water. Calcium release into solution
54
www.ajpdf.com
is controlled either by using a slowly soluble calcium salt

or by using calcium sequestrants. The rate of calcium
release may be manipulated by raising the temperature or
lowering the pH. Rates of solubilization increase with
increasing temperature while lowering the pH causes
dissociation of calcium from complexes, thereby freeing it
to interact with the alginate.
5.2.3 Carrageenan
Carrageenans are a family of sulfated linear
polysaccharides that occur naturally in marine red algae, a
common seaweed in the North Atlantic. They are polymers
of D‐galactose and 3,6‐anhydro‐D‐galactose. Members of
the family differ in the degree and location of the sulfate
ester groups and the relative proportions of D‐galactose
and 3,6‐anhydro‐D‐galactose. Sulfate content varies from
18 to 40% [3]. The three principal fractions of carrageenan
are kappa (gelling), iota (gelling), and lambda (non‐gelling)
(Figure 5.4). Carrageenan gels are thermo‐reversible, an
important property in some food applications.
55
www.ajpdf.com
Figure 5.4 Structures of the three principal carrageenans

[6]. Note differences in the extent and position of the
sulfation.
Carrageenans are widely used as food additives in dairy
products and sauces to improve texture and viscosity. In
addition to food applications, durable superabsorbent
hydrogels prepared from aqueous solutions containing 4–
5% kappa‐carrageenan [7] could potentially be used as soil
conditioners and carriers for nutrient release [8].
5.2.4 Locust Bean Gum and Guar Gum

LBG is a water extract of the endosperm of seeds (locust
beans) of the carob tree. Thus, LBG is also known as carob
bean gum. These leguminous trees have been cultivated for
56
www.ajpdf.com
centuries along the coast of the Mediterranean Sea. It is

believed that one of the first uses of LBG was to bind
together the cloths used to wrap mummies in ancient
Egypt. LBG is a galactomannan. It consists of a long
backbone chain composed of repeating mannose units
linked by β‐1,4‐glycosidic bonds with galactose side chains
linked to mannose residues by an α‐1,6‐bond (Figure 5.5)
[9]. Another common galactomannan is guar gum, which is
extracted from guar beans and has a lower mannose to
galactose ratio compared with LBG.
Figure 5.5 A representative structure of galactomannan.

The backbone chain is composed of repeating mannose
residues linked by β‐1,4‐glycosidic bonds. The side chains
are single galactose units linked to the backbone by α‐1,6‐
bonds.
Galactomannans are often included in food formulations as
stabilizers. For example, LBG has been shown to reduce the
melting rate of ice‐cream [10] and improve the hardness
and adhesiveness of spreadable ricotta cheese [11].
5.2.5 Xanthan Gum

Xanthan gum is an extracellular polysaccharide produced
by the bacterium Xanthomonas campestris. X. campestris
was originally isolated from rutabaga plants. It is now
grown in pure culture for the express purpose of producing
xanthan gums for food and industrial uses. Xanthan gum
57
www.ajpdf.com
has a straight‐chain backbone identical to cellulose (β‐1,4

linked glucose residues). It differs from cellulose in that it
contains trisaccharide branches on the number 3 carbon of
alternating glucose residues in the backbone chain (Figure
5.6).
Figure 5.6 Structure of xanthan gum. Note the cellulose

backbone and the trisaccharide side chain. The sugars in
the side chain are mannose‐glucuronic acid‐mannose. The
first mannose is esterified to acetic acid on C‐6. The end
mannose is linked to pyruvic acid by a ketal linkage at C‐4
and C‐6 [6].
The negatively charged branches on the backbone chain
lend rigidity to the polymers which have a very high
molecular weight estimated to be about 15 million [4]. This
structure explains some of the unique properties of
xanthan gums, summarized in Table 5.2. These properties
make xanthan gums very attractive for sauces and salad
dressings because the high viscosity prevents
sedimentation of particulates and creaming of oils while
the shear thinning ensures pourability.
58
www.ajpdf.com
Table 5.2 Functional properties of xanthan gum [4].
High solubility in cold and hot water

Soluble and stable over a wide pH range
Stable to heat
Imparts high viscosity to aqueous systems at low
concentrations
Undergoes shear thinning when a shear stress is
applied, e.g. when a salad dressing is poured
Viscosities are uniform over the temperature range of
0–100 °C
Compatible with most salts present in foods, e.g. does
not gel in the presence of Ca2+

1. Brookfield viscometer (LVF) (spindle no. 3, 60 rpm)
2. Hot plate with magnetic stirrer and stir bars
3. Balances and weighing paper
4. Beakers, 250 and 600 ml
6. Household mixer
7. Stirring rod
8. Watch glass
9. Screw‐top test tubes and caps
10. Thermometer

1. Hydrocolloids: sodium alginate, LBG, and xanthan
gum. Note: TIC Gums Pretested colloid 488 T powder
59
www.ajpdf.com
(sodium alginate) works well.

2. Glycerol
3. Sodium hexametaphosphate (powder)
4. Calcium hydrogen phosphate, anhydrous (CaHPO4)
5. CaCl2 .2H2O
6. Food coloring
5.5 Procedures
Note: Do not discard the gum solutions until the entire
exercise is completed.
5.5.1 Effect of Heat Treatment on Gelation
1. Prepare 2 solutions of pre‐hydrated LBG and pre‐

hydrated xanthan gum as follows:
a. Transfer 100 ml distilled water to each of two
250 ml beakers. Begin stirring gently on a stir
plate and, while stirring, add 0.25 g of LBG to
each beaker. Repeat the step with 0.25 g xanthan
gum.
b. Cover one of the beakers with a watch glass and
heat to boiling on a hot plate while stirring gently.
c. Place both solutions in the refrigerator.
2. After two hours, observe the consistency of both
solutions.
5.5.2 Effect of Concentration on Viscosity
1. Prepare 800 ml of 10 mmol l−1 CaCl2 .2H2O in

deionized water and transfer to a mixing bowl.
2. Weigh out 6.0 g of sodium alginate powder.
3. Mix the sodium alginate with 30 ml glycerol.
4. Turn on the mixer at low to medium speed.
60
www.ajpdf.com
5. With the mixer running, pour the gum/glycerol

mixture slowly into the CaCl2 solution and continue
mixing until all of the gum is hydrated.
6. Transfer 400, 266, and 133 ml of the alginate solution
to separate 600 ml beakers. Bring the total volume in
each beaker to 400 ml with distilled water. (What are
the resulting gum concentrations?)
7. Measure the viscosity of each solution with a
Brookfield viscometer using a no. 3 spindle and record
the results.
8. Add 4 g of sodium hexametaphosphate to each of the
sodium‐calcium alginate solutions, mix, and repeat the
viscosity measurement. (Sodium hexametaphosphate
is a calcium sequestering agent.)
9. Repeat Steps 1 through 6 using xanthan gum.
10. Make plots of viscosity (cP) versus concentration (%
gum, w/v).
5.5.3 Emulsion Stability
1. Mark 3 test tubes at the 5 ml level.

2. Pour 5 ml of each of the following into separate test
tubes: water, 0.5% sodium alginate, and 0.5% xanthan.
3. Add 5 ml of vegetable oil to each test tube.
4. Shake each test tube vigorously for 30 seconds.
5. Record time required for the water phase and the oil
phases to separate.
5.5.4 Diffusion Setting and Internal Setting

Alginate Gels
This procedure was adapted from King [2].
5.5.4.1 Diffusion Setting Gel
1. Transfer 236 ml cold water to a 400 ml beaker.

Thoroughly mix 45 g fine granulated sugar and 1.7 g
61
www.ajpdf.com
low‐residual‐calcium sodium alginate. Gradually add

the dry ingredients, stirring constantly, to the water.
2. When the dry ingredients are completely dissolved,
add 5 drops of food coloring and 1.0 ml 2.6 M CaCl2
(0.1 g calcium) to the solution. Stir for one minute.
Cover the beaker and leave at room temperature
overnight.
5.5.4.2 Internal Setting Gel
1. Transfer 236 ml cold water to a 400 ml beaker and

add 5 drops of food coloring. Combine 45 g fine
granulated sugar, 1.7 g low‐residual‐calcium sodium
alginate, 1.6 g food‐grade adipic acid, 1.9 g sodium
citrate, and 0.18 g anhydrous calcium hydrogen
phosphate (CaHPO4) (0.18 g CaHPO4 contains 0.1 g
calcium). Mix thoroughly.
2. Add the dry ingredients to the water and stir briskly
for one minute. Cover the beaker and leave at room
temperature overnight.
Compare the appearance, strength, and texture of the two

gels.
5.6 Study Questions

1. Define the term viscosity and explain why it is an
important property of foods.
2. Describe the operation of a Brookfield viscometer and
explain how readings from the instrument are
converted to units of viscosity (cps).
3. Xanthan gum is not considered an emulsifying agent,
yet it is very effective at stabilizing salad dressings.
Explain.
4. Alginate is a calcium‐sensitive hydrocolloid. What
does this mean and why, given its structure, might you
expect it to be calcium sensitive?
62
www.ajpdf.com
5.7 References
1 Glicksman, M. (1982). Origins and classification of
hydrocolloids. In: Food Hydrocolloids (ed. M. Glicksman
), 4–18. Boca Raton, FL: CRC Press.
2 King, A.H. (1982). Brown seaweed extracts (alginates).
In: Food Hydrocolloids (ed. M. Glicksman ), 116–181.
Boca Raton, FL: CRC Press.
3 Glicksman, M. (1982). Red seaweed extracts (agar,
carrageenans, furcellaran). In: Food Hydrocolloids (ed.
M. Glicksman ), 83–107. Boca Raton, FL: CRC Press.
4 Pettitt, D.J. (1982). Xanthan gum. In: Food Hydrocolloids
(ed. M. Glicksman ), 128–146. Boca Raton, FL: CRC
Press.
5 Yu, Z., Wang, Y.‐S., Chen, H.‐H. et al. (2018). The
gelatinization and retrogradation properties of wheat
starch with the addition of stearic acid and sodium
alginate. Food Hydrocolloids 81: 77–86.
6 Brady, J.W. (2013). Introductory Food Chemistry . Ithaca:
7 Berton, S.B.R., de Jesus, G.A.M., Sabino, R.M. et al. (2020).
Properties of a commercial κ‐carrageenan food
ingredient and its durable superabsorbent hydrogels.
Carbohydrate Research 487: 107883.
8 Guilherme, M.R., Aouada, F.A., Fajardo, A.R. et al. (2015).
Superabsorbent hydrogels based on polysaccharides for
application in agriculture as soil conditioner and
nutrient carrier: a review. European Polymer Journal 72:
365–385.
9 McClements, D.J. and Decker, E.A. (2017). Lipids. In:
Francis Group.
63
www.ajpdf.com
10 Cropper, S.L., Kocaoglu‐Vurma, N.A., Tharp, B.W., and

Harper, W.J. (2013). Effects of locust bean gum and
mono‐ and diglyceride concentrations on particle size
and melting rates of ice cream. Journal of Food Science
78 (6): C811–C816.
11 Rubel, I.A., Iraporda, C., Gallo, A. et al. (2019).
Spreadable ricotta cheese with hydrocolloids: effect on
physicochemical and rheological properties.
International Dairy Journal 94: 7–15.

Belitz, H.‐D., Grosch, W., and Schieberle, P. (2009). Food
Dziezak, J.D. (1991). A focus on gums. Food Technology 45
(3): 116–132.
Phillips, G.O. and Williams, P.A. (eds.) (2009). Handbook of
Hydrocolloids , 2e. Cambridge: Woodhead Publishing.
924 p.
64
www.ajpdf.com
6
Functional Properties of Proteins

1. Assess the effects of pH on protein solubility.

2. Describe the role of divalent calcium ions in the
gelation of soy proteins in solution.
3. Prepare soy protein extracts from basic materials such
as defatted soy flour.
4. Produce soy‐based products (i.e. tofu and soy protein
isolate) in laboratory settings.
5. Use a dye‐binding assay to measure protein
concentration in solution.
6.2 Introduction
Proteins are an intrinsic component of most foods. They
are also added in purified form during processing to
perform certain desirable functions. From the perspective
of a food scientist, the functional properties of proteins are
those that influence food quality and appeal. These
properties are determined by the primary, secondary,
tertiary, and quaternary structures of proteins and vary
widely among proteins. Heating, changes in pH, whipping,
drying, and other treatments may alter the functional
properties of proteins.
Some functions of proteins in foods include gelation,
thickening, foaming, water holding, emulsification, coloring
(e.g. myoglobin, Maillard browning products), cohesion,
dough formation, and texturization. Thus, proteins are
highly versatile food ingredients and are used in a wide
range of products.
65
www.ajpdf.com
Protein functionality is difficult to study in complex food

systems. Therefore, much of the research on protein
functionality has been done in model systems where
purified proteins are studied under carefully defined
conditions.
Biochemists have invested years of research into
developing techniques for purifying, identifying,
quantifying, and characterizing proteins. Food scientists
have applied many of these techniques to better
understand the functions of proteins in foods and to
develop processes for concentrating and isolating proteins
for food use. For example, processes for producing high‐
quality food‐grade soy protein concentrates and isolates
from soybeans are widely used in the food industry.
Moreover, results of protein research have helped us to
better understand some traditional food processing
operations that depend on the functional properties of
proteins. Cheese making and tofu manufacturing are two
prominent examples.
A key property of proteins is solubility. Many of the
functions of proteins depend on solubility. For example,
proteins must be in solution in order to form gels. Protein
solubility is affected by pH, ionic strength, divalent cations,
temperature, and the amino acid composition and
sequence of the protein.
Proteins are large molecules that have strong tendencies to
interact with other protein molecules, metal ions, water
molecules, lipids, and carbohydrates. Thus, proteins can
have marked and sometimes unpredictable effects on
foods.
In this exercise, we will study the effects of pH and calcium
ions on protein solubility. At low pH, soy protein has a net
positive charge due to protonation of the carboxylate and
amino groups. At high pH, soy protein has a net negative
charge because of deprotonation of these same groups.
When the proteins have a net positive or net negative
charge, the individual molecules have a tendency to repel
each other. This repulsion increases their solubility
66
www.ajpdf.com
because they are more likely to interact with water than

with other protein molecules. At the isoelectric point (pI),
defined as the pH at which the net charge on a protein is
zero, the number of positively charged side chains (e.g.
protonated lysine residues) is equal to the number of
negatively charged side chains (e.g. aspartate residues).
Without a net positive or negative charge, protein
molecules may associate, forming gels or precipitates.
Thus, it is often possible to either solubilize protein
powders or precipitate or gel dissolved protein by simply
manipulating the pH. Cheese making relies, in part, on pH
manipulation to form a protein gel.
Protein–protein associations may also be enhanced by
adding multivalent ions. This approach is used in the
production of tofu. This age‐old product is made by
solubilizing soy protein in water, heating to denature the
protein to expose charged amino acid residues, and adding
a calcium salt to cross‐link the protein molecules.
6.2.1 Soybean Processing: Soy Milk, Tofu, and

Soybean Protein Isolate
Soybeans have been consumed by humans for centuries.
Raw mature soybean seeds are rich sources of protein (36
g/100 g), fat (20 g/100 g mostly polyunsaturated), fiber (9
g/100 g), calcium (277 mg/100 g), and iron (15 mg/100 g)
among other nutrients [1]. The United States is the first or
second leading producer of soybeans globally, but most of
the soybeans grown in the United States are defatted and
fed to animals. Soybean oil, produced by defatting whole
soybeans, is the most widely consumed vegetable oil in the
United States and is second only to palm oil globally [2].
Soy milk and tofu are two widely consumed manufactured
foods made from soybeans. Soy milk is becoming
increasingly popular in the United States as consumers are
looking for alternatives to dairy milk. It is made by soaking
whole mature soybeans in water, grinding the soaked
beans into a slurry, boiling the slurry to denature proteins
and deactivate trypsin inhibitors, and filtering or
67
www.ajpdf.com
centrifuging to remove fibrous material called okara [3].

Tofu is made by coagulating the protein in soy milk. The
protein can be coagulated by adding salts of divalent
cations. Calcium sulfate (gypsum) or a mixture of calcium
chloride and magnesium chloride (nigari) are commonly
used. The protein can also be coagulated by acidifying the
soy milk. Glucono‐delta‐lactone is a commonly used
acidulant in the manufacture of tofu. After coagulation, the
tofu is pressed to remove water, and the tofu is cut into
pieces for packaging.
Another important soybean product is soy protein isolate.
It is used as an ingredient in many manufactured foods. Soy
protein isolate contains over 90% protein. Soy protein
isolate is manufactured from dehulled, defatted, edible‐
grade soybean flakes (or flour). Protein is extracted from
the flakes with an aqueous alkaline solution with a pH
slightly higher than 7. Most proteins in soybeans are
soluble at alkaline pHs, so the extract contains protein,
soluble sugars and oligosaccharides, and other substances,
leaving behind most polysaccharides. Once the proteins
have been solubilized, the extract is clarified by
centrifugation. The supernatant is then acidified to pH 4–5,
which is within the isoelectric range for most of the
proteins. This causes the proteins to precipitate into a curd
leaving the sugars and oligosaccharides in solution. The
supernatant is removed and the curd is spray dried to yield
a soy protein isolate powder. The curd may be neutralized
to pH 6.5–7.0 prior to drying [4].
6.2.2 Assaying Protein Concentration

Several assays are available for determining the
concentration of protein in solution. One of the simplest of
these assays is the so‐called dye‐binding assay developed
by Bradford [5, 6]. As the name implies, a dye added to a
protein solution binds to the available protein producing a
dye–protein complex. The acidic dye Coomassie® Brilliant
Blue G‐250 is used. It has an absorbance maximum of 465
nm when free in solution. When it binds to protein,
however, the absorbance maximum shifts to 595 nm. Thus,
68
www.ajpdf.com
the absorbance at 595 nm is proportional to the

concentration of the protein.
Protein concentration in samples is determined by
comparing the absorbance of samples to a standard curve.
Unfortunately, the extent of dye binding varies from
protein to protein since the dye binds primarily to basic
and aromatic amino acids and the proportion of these
amino acids varies from protein to protein. Thus, unless
the standard is made from the protein being measured, the
assay provides a relative rather than an absolute measure
of the protein present in the sample. Bovine serum
albumin (BSA) is routinely used for the standard because it
readily dissolves in water and it is available in purified
form.
Several laboratory supply companies have developed kits
for this assay, making the assay even simpler. A kit supplied
by Bio‐Rad Laboratories called the Bio‐Rad Protein Assay
is widely used. For details on the principles of dye‐binding
protein assays and a protocol for measuring protein
concentrations using the assay, see the booklet titled Bio‐
Rad Protein Assay [7].

1. Heat/stir plate and magnetic stir bars
2. Spectrophotometer and cuvettes
3. Centrifuge
4. pH meter and pH standards
5. Electronic top‐loading balance
6. Centrifuge tubes with caps (10 per group)
7. Plastic centrifuge tubes with caps (50 ml capacity)
9. Graduated cylinders
10. Test tubes (20 per group)
69
www.ajpdf.com
11. Pipettes
12. Pasteur pipettes & bulbs
13. Funnel
14. Filter paper
15. Parafilm®

1. Defatted soy flour (10 g per group)
2. NaOH, 0.1 N
3. HCl, 1.0 N
4. CaCl2, 5 M
5. Bradford reagent (0.004% Brilliant Blue G in 10%
phosphoric acid/4% methanol. Handle with gloves
and eye protection. Dispose in waste bottle).
6. Bovine serum albumin (BSA) – 1.0 mg ml−1 in H2O
6.5 Procedures
Note: Complete instructions and background information
for the Bio‐Rad Bradford Protein assay are available online
at: https://www.bio‐
rad.com/webroot/web/pdf/lsr/literature/LIT33.pdf
6.5.1 Standard Curve for the Bradford Protein

Assay
1. Prepare a series of standard solutions of BSA in water
consisting of the following concentrations: 0.25, 0.5,
0.75, and 1.0 mg ml−1. Prepare 1 ml of each solution by
making appropriate dilutions of the 1.0 mg ml−1 BSA
solution.
2. Transfer, in duplicate, 50 μl of each standard to clean,
dry test tubes.
70
www.ajpdf.com
3. Add 2.5 ml of the Bio‐Rad dye reagent to each tube.

4. Cover tubes with Parafilm® and mix by inverting
several times.
5. Incubate at room temperature for at least five minutes
but no longer than one hour.
6. Read absorbance at 595 nm against the reagent blank,
i.e. zero the spectrophotometer with the reagent
blank. (The reagent blank should be identical to the
standards except that it should contain no protein.)
7. Plot a standard curve (absorbance versus BSA
concentration).
6.5.2 Effect of pH on Protein Solubility

6.5.2.1 Preparation of Protein Extracts
Note: Proteins will be extracted from soy flour dispersed in
water and adjusted to a range of pH values (2.5, 3.0, 3.5,
4.0, 4.5, 5.0, 5.5, 6.0, 6.5, 7.0, 7.5, 8.0, and 8.5). Each group
will extract at one (or two) pH.
1. Prepare a 1 : 15 soy flour/water mixture by adding 10

g of soy flour to 150 ml distilled H2O and stirring on a
magnetic stir plate to form a uniform suspension.
2. Transfer a 15 ml aliquot of the suspension to a 50 ml
beaker (remove the aliquot with the stirrer running to
prevent insolubles from settling).
3. Adjust to your assigned pH with 1.0 N HCl or 0.1 N
NaOH (you will be assigned a pH at the beginning of
class). Add distilled water to bring total volume to 20
ml (the graduations on the beaker are sufficient for
this volume adjustment).
4. Stir on a stir plate for 20 minutes at room
temperature.
5. Transfer 10 ml to a screw‐capped centrifuge tube and
centrifuge at full speed for 10 minutes in a bench‐top
centrifuge. Be sure you balance your tubes.
71
www.ajpdf.com
6. Decant supernatant into a clean tube.
6.5.2.2 Measurement of Protein Concentration in the

Extracts
1. Make a 1 to 50 dilution of the supernatant from the

protein extraction above (0.1 ml supernatant + 4.9 ml
dH2O) for the samples with pH values of below 4.0
and above 5.0. For pH values of 4.0, 4.5, and 5.0, make
a 1 to 10 dilution.
2. Determine the protein concentration in the diluted
supernatant using the Bradford protein assay and the
standard curve you constructed in Section 6.5.1. (Read
against a reagent blank as you did for the standard
curve). Follow the same protocol you used in
preparing the standard curve (50 μl sample, 2.5 ml
Bio‐Rad dye reagent). Note: Your absorbance reading
should be greater than 0.1. If it is less than 0.1, your
sample is too dilute and you should take another
aliquot of the supernatant, dilute it less, and re‐run
the assay.
3. Calculate the amount (in g) of soluble protein in the
soy flour extract. Be sure to account for the dilutions
you made.
4. Calculate the solubility of the protein in the soy flour
(express as a percentage of the protein in the flour).
Assume the soy flour is 50% protein. Remember that a
15 ml aliquot of the original mixture contains 1 g soy
flour.
5. Using your data and data from the rest of the class,
construct a plot of protein solubility versus pH.
6.5.3 Preparation of Soy Protein Isolate and

Tofu
6.5.3.1 Extraction
72
www.ajpdf.com
1. Transfer 100 ml of the 1 : 15 soy flour/water mixture

from Step 1 in Section 6.5.2.1 to a beaker (be sure to
mix well before transferring). Stir on a magnetic
stirrer.
2. Adjust to pH 8 with 0.1 N NaOH.
3. Stir at this pH for 20 minutes at room temperature.
4. Transfer the suspension to two 50‐ml centrifuge
tubes. Centrifuge at approximately 10,000 × g for 20
minutes. Pool the supernatants into one beaker.
5. Determine the protein concentration in the
supernatant.
6. Divide the pooled supernatants into two 25 ml
aliquots in 50 ml beakers.
6.5.3.2 Soy Protein Isolation
1. Measure the pH of one of the 25 ml aliquots of the

above extract (it should be near pH 8).
2. Add one drop of 1.0 N HCl without stirring and record
what happens.
3. Begin stirring on a stir plate and adjust to pH 4.5 with
1.0 N HCl. Record your observations.
4. Filter the mixture from Step 3 and collect the filtrate.
The residue on the filter paper is the soy protein
isolate.
5. Determine the protein concentration of the filtrate
with the dye‐binding assay (remember to dilute
before measuring the protein concentration).
6. Calculate protein yield in the isolate (the percentage of
the protein in the flour that was recovered in the
isolate). Note that you are measuring the amount of
protein that was not recovered, so you will determine
recovered protein by difference.
6.5.3.3 Production of Tofu
73
www.ajpdf.com
1. Stir the other 25 ml aliquot from Section 6.5.3.1 and

heat to boiling. (Remove from the heat as soon as
boiling begins.)
2. Add a drop of 5 M CaCl2 to the extract while it is still
hot and record what happens.
3. Add a few more drops and stir with a glass stirring
rod.
4. Pick out a clump of the “tofu” and feel the texture.
(Compare the texture with the pH 4.5 isolate.)
6.6 Problem Set

1. A food chemistry student completed the work
outlined above and obtained the following data:
Standard curve: Absorbances at 595 nm for the BSA
standards: 0.20, 0.43, 0.65, and 0.90 for 0.25, 0.5,
0.75, and 1.0 mg BSA ml−1, respectively.
Supernatant absorbance: The absorbance in the dye‐
binding assay for the diluted supernatant was 0.35.
a. Construct a standard curve (absorbance versus
protein concentration in the standards).
b. Calculate the concentration of protein in the
diluted supernatant and the supernatant prior to
dilution.
c. Calculate the amount of soluble protein (in g) in
the extract.
d. Calculate the solubility of the protein (express as
a percentage of the protein in the soy flour).
Assume the soy flour was 50% protein (w/w).
6.7 Study Questions

1. Draw the structure of the following peptide: ala‐asp‐
gly‐lys‐ser‐glu‐val‐arg‐his‐gly. What would the net
charge on this peptide be at pH 2.0? At pH 8.0? (See
74
www.ajpdf.com
[8] or a biochemistry textbook for amino acid

structures and pKa values).
2. Explain, showing partial structures, how calcium ions
cause soy protein to gel.
3. Why do proteins form precipitates under some
conditions and gels under others?
6.8 References
1 USDA (2020). FoodData central [Internet].
https://fdc.nal.usda.gov/ (accessed 11 February 2020).
2 Statista (2020). Global vegetable oil consumption,
2018/19 [Internet].
https://www.statista.com/statistics/263937/vegetable
‐oils‐global‐consumption/ (accessed 11 February
2020).
3 McHugh, T. (2016). How tofu is processed. Food
Technology 70 (2): 72–74.
4 Lusas, E.W. and Riaz, M.N. (1995). Soy protein products:
processing and use. The Journal of Nutrition 125
(suppl_3): 573S–580S.
5 Bradford, M.M. (1976). A rapid and sensitive method for
the quantitation of microgram quantities of protein
utilizing the principle of protein‐dye binding. Analytical
Biochemistry 72 (1–2): 248–254.
6 Kruger, N.J. (1994). The Bradford method for protein
quantification. In: Basic protein and peptide protocols
(ed. J.M. Walker ), 9–16. Totowa, N.J: Humana Press.
(Methods in molecular biology).
7 Bio‐Rad (2020). Bio‐Rad protein assay | Life Science
Research | Bio‐Rad [Internet]. https://www.bio‐
rad.com/en‐us/product/bio‐rad‐protein‐assay?
ID=d4d4169a‐12e8‐4819‐8b3e‐ccab019c6e13
(accessed 11 February 2020).
75
www.ajpdf.com
8 Damodaran, S. (2017). Amino acids, peptides, and

proteins. In: Fennema’s Food Chemistry , 5e (eds. S.
Damodaran and K.L. Parkin ), 235–356. Boca Raton: CRC
Press, Taylor & Francis Group.

Fukushima, D. (1991). Recent progress of soybean protein
foods: chemistry, technology, and nutrition. Food
Reviews International 7 (3): 323–351.
Smith, A.K. and Circle, S.J. (1978). Soybeans: Chemistry and
Technology (Volume I ‐ Proteins) . Westport, CT: Avi
Publishing Company,Inc.

1. a. Equation for standard curve: y = 0.928x − 0.035; R
2 = 0.9993
b. 0.415 mg ml−1 (diluted); 27.67 mg ml−1

(undiluted)
c. 4.15 g
d. 83%
76
www.ajpdf.com
7
Lactose

1. Explain what lactose intolerance is and why it affects

some people and not others.
2. Design an experiment to test the hypothesis that live
cultures in yogurt aid in the digestion of lactose in the
small intestine.
3. Measure the lactose content of fluid milk and yogurt
samples.
4. Measure the lactase activity in regular and Greek
yogurts under simulated intestinal conditions.
7.2 Introduction
Lactose (milk sugar) is a disaccharide composed of
galactose and glucose linked by a β‐(1,4)‐galactosidic bond.
As shown in Figure 7.1, glucose provides the alcohol group
and galactose provides the glycosyl group to form the
disaccharide. According to convention, the glucose is called
an aglycon when it is part of lactose.
77
www.ajpdf.com
Figure 7.1 Lactose (conformational representation) is a

disaccharide composed of galactose and glucose linked by
a β‐(1,4)‐galactosidic bond.
Lactose cannot be absorbed intact from the
gastrointestinal tract. It must first be hydrolyzed to glucose
and galactose, a reaction that is very slow unless catalyzed
by lactase, a β‐galactosidase (Figure 7.2). Most mammals,
with the exception of humans whose ancestry includes
northern Europeans and some populations from Africa and
India, lose the ability to digest lactose after they reach
weaning age. It has been estimated that the prevalence of
lactase deficiency in non‐white adults is as high as 50–
75%. When unabsorbed lactose passes into the colon, it
may draw water into the lumen of the colon causing
diarrhea or be fermented by the colonic microflora
producing gas, which causes bloating and flatulence.
People who exhibit these symptoms following
consumption of dairy products are commonly diagnosed as
lactose intolerant. People who are lactose intolerant may
avoid dairy products since their consumption may cause
unpleasant gastrointestinal symptoms.
Figure 7.2 Hydrolysis of lactose to D‐galactose and D‐

glucose (Haworth representation). This reaction is
catalyzed by lactase (β‐galactosidase).
78
www.ajpdf.com
The principal dietary source of lactose in the United States

is bovine milk, which contains slightly less than 5% (w/w)
of the sugar. Other dairy products contain varying amounts
of lactose, depending on processing, and storage
conditions.
Fermentation has been used for centuries as a method for
preserving milk. Cheeses and other fermented dairy
products are well known and widely consumed. Bacterial
cultures used for these fermentations produce β‐
galactosidases, which can significantly reduce the lactose
content of the product through hydrolysis and subsequent
lactic acid fermentation (Figure 7.3).
Figure 7.3 Bacterial cultures in fermented dairy products

convert galactose and glucose into pyruvic acid via the
glycolytic pathway. Pyruvic acid undergoes lactic acid
fermentation to produce lactic acid, which lowers the pH of
the product.
Hard cheeses generally contain very little lactose and are
well tolerated by lactose‐intolerant individuals. Yogurts, on
the other hand, may contain concentrations of lactose
similar to or only slightly lower than that in milk since
most yogurt mixes are formulated to contain nonfat dry
milk powder in addition to fluid milk. Nonfat milk powder
contains approximately 50% lactose (w/w). Moreover,
lactase activity is pH sensitive and decreases as the pH falls
during fermentation. This further explains why lactose
concentrations in yogurt are relatively high. Even so, many
lactose‐intolerant individuals claim they can consume
yogurt without the symptoms they experience when
drinking milk. This has led to the hypothesis that the
enzymes produced by the cultures used in yogurt
manufacture (Lactobacillus bulgaricus and Streptococcus
thermophilus) may still be active in the guts of yogurt
79
www.ajpdf.com
consumers and may aid in the digestion of lactose. Kolars

et al. [1] have reported convincing evidence in support of
this hypothesis.
A more recent approach to lactose reduction in dairy foods
is the addition of lactase to the product by either the
processer or the consumer. LACTAID® is a commercially
available preparation of lactase that may be added to milk
and other dairy products during processing or ingested by
consumers as a dietary supplement. Manufacturers
recommend that lactose intolerant individuals take a
LACTAID® supplement (available as chewables or caplets)
just before consuming a lactose‐containing product
(https://www.lactaid.com/). The fact that consuming
LACTAID® prior to eating a dairy product prevents
symptoms is a strong evidence that ingested lactase
survives the acid stomach and is active in the small
intestine.
7.2.1 Lactose Assay

Concentrations of many compounds in solution may be
determined by measuring the absorbance of the solution
with a spectrophotometer. However, this works only if the
compound in question has a unique absorption maximum,
i.e. it must absorb at a wavelength at which no other
compound in the solution absorbs. Lactose does not have a
distinct absorption maximum and therefore cannot be
measured directly by spectrophotometry. Fortunately,
lactose and many other compounds can be measured
indirectly by taking advantage of coupled reactions with
other compounds that do have distinct absorption maxima.
A coupled reaction with NAD+ or NADP+ is commonly used
in biochemical assays. Reactions of NAD+ or NADP+ with
various substrates are enzyme catalyzed and thus allow for
highly specific assays if a purified form of a suitable
enzyme is available. NAD+ and NADH+ are oxidizing agents
and react stoichiometrically with reduced substrates (such
as reducing sugars) to produce an oxidized substrate (e.g.
galactonic acid from the oxidation of galactose) and NADH
or NADPH. NAD+ (or NADP+) and NADH (or NADPH) have
80
www.ajpdf.com
distinctly different absorption spectra (NADH absorbs at

340 nm, whereas NAD+ does not) (Figure 7.4). Therefore,
the conversion of NAD+ to NADH in a solution can be
monitored by measuring the absorbance at 340 nm.
Figure 7.4 Absorption spectra of NAD+ (solid line) and

NADH (dashed line).
Source: From [2].
Commercial kits are available for measuring lactose in

various dairy products. Megazyme (Bray, Ireland) markets
one such kit. Detailed instructions for using the Megazyme
kit to measure lactose in milk and yogurt are described in a
booklet authored by Megazyme [3].
The first step in the enzymatic assay for lactose is to
hydrolyze the lactose to form glucose plus galactose. This is
accomplished by adding lactase to the sample containing
the lactose (Figure 7.2). The next step is to oxidize the
galactose to D‐galactonic acid using NAD+ as the oxidizing
agent and β‐galactose dehydrogenase as a catalyst as
shown in Figure 7.5. Note that the number of moles of
NADH produced is stoichiometric with the number of
moles of galactose, which is stoichiometric with the
number of moles of lactose in the sample.
81
www.ajpdf.com
Figure 7.5 The oxidation of β‐D‐galactose by NAD+,

generating NADH. The reaction is catalyzed by β‐galactose
dehydrogenase.
Note that β‐galactose dehydrogenase is specific for β‐D‐
galactose. It does not catalyze the oxidation of α‐D‐
galactose. Galactose, like lactose and glucose, is a reducing
sugar. Therefore, it exists in solution in two forms in
equilibrium: α‐D‐galactose and β‐D‐galactose (Figure 7.6).
As the β‐galactose is oxidized, the equilibrium shifts,
generating more β‐D‐galactose, but this conversion is
rather slow and results in a “creeping” reaction, i.e. the
absorbance at 340 nm increases gradually over time. Thus,
it takes a long time (several hours) for the complete
oxidation of all of the galactose in the solution. This makes
for a less than ideal assay. Fortunately, there is an enzyme
that dramatically speeds up this conversion. It is called
galactose mutarotase (Figure 7.6).
Figure 7.6 The equilibrium of α‐ and β‐D‐galactose in

solution. The attainment of the equilibrium is rather slow.
In the presence of the enzyme galactose mutarotase;
however, the conversion is quite rapid and for that reason,
it is often used in lactose assays.
82
www.ajpdf.com
The equipment you will need for this exercise will vary
somewhat depending on the assay kits you choose. Most
will require the following:
1. UV‐spectrophotometer or micro‐plate reader

2. Water bath
3. Cuvettes (or micro‐plates)
4. Test tubes
5. Vortex mixer
6. Timer

1. Pasteurized skim milk
2. Pasteurized LACTAID® skim milk
3. Plain low‐fat (or nonfat) yogurt
4. Plain low‐fat yogurt Greek style
5. Commercial assay kit for measuring concentrations of
lactose and galactose in dairy products. Suitable kit:
Megazyme: Lactose Assay Kit – Sequential/High
Sensitivity [3]
6. Commercial assay kit for measuring beta‐
galactosidase activity in yogurts. Suitable kit:
ThermoFisher Scientific: Yeast beta‐Galactosidase
Assay Kit [4]
7.5 Procedures
7.5.1 Lactose and D‐galactose Assay Protocol
The protocol for this assay will vary somewhat depending
on the supplier of the kit. Follow the directions that come
with the kit you will use for this assay.
83
www.ajpdf.com
7.5.2 Lactase Assay

A common method for measuring lactase activity is to
incubate a lactase‐containing food or tissue with a
compound that acts as a substrate for the enzyme. One
such compound is o‐nitrophenyl‐β‐D‐galactopyranoside
(ONPG). Lactase catalyzes the hydrolysis of ONPG to o‐
nitrophenol and galactose. ONPG is colorless, but o‐
nitrophenol is yellow and can be quantified in solution by
measuring the absorbance at 420 nm. ThermoFisher
Scientific (Waltham, MA) offers a kit using ONPG for
measuring β‐galactosidase in yeast. It will also work for
measuring lactase activity in yogurt.
7.6 Experimental Design

For this experiment, each student or lab group should
develop their own experimental design for determining the
concentration of lactose in various dairy products and for
testing the hypothesis that live cultures in yogurt aid in the
digestion of lactose in the small intestine. Recall that the
pH of the small intestine is about 7, while the pH of many
yogurts is below 5. To test this hypothesis, you will need to
adjust the pH of the yogurt to around 7 and incubate at 37
°C for 30 minutes to one hour. Acids in digesta that enter
our small intestines from the stomach are neutralized by
pancreatic juice. The base in pancreatic juice is sodium
bicarbonate, so we recommend using a solution of sodium
bicarbonate (0.5 mol l−1 should work) to raise the pH of the
yogurt to 7. We suggest using a plain yogurt with live and
active cultures and without added sugar. Other yogurts
(e.g. Greek style or drinkable) may be used as well.
7.7 Study Questions

1. Compare the lactose content of all of your samples.
How do they compare with literature values for
similar samples?
84
www.ajpdf.com
2. Did adjusting the pH of your yogurt samples to 7 and

incubating affect the lactose content of the yogurt?
3. In addition to the live bacteria present in yogurt, what
other attributes of yogurt might help the digestion of
lactose in the gastrointestinal environment?
4. Would you recommend to a friend who is lactose
intolerant and who avoids all dairy products that she
should try eating yogurt?
7.8 References
1 Kolars, J.C., Levitt, M.D., Aouji, M., and Savaiano, D.A.
(1984). Yogurt—an autodigesting source of lactose. New
England Journal of Medicine 310 (1): 1–3.
2 Switzer, R.L. and Garrity, L.F. (1999). Experimental
Biochemistry , 3e. New York: W. H. Freeman and Co. 451
p.
3 Megazyme (2020). Lactose assay kit [Internet].
https://www.megazyme.com/lactose‐assay‐kit
(accessed 11 February 2020).
4 ThermoFisher (2020). Yeast beta‐galactosidase assay kit
[Internet].
http://www.thermofisher.com/order/catalog/product/
75768 (accessed 11 February 2020).

Chandan, R.C. (2017). An overview on yogurt production
and composition. In: Yogurt in Health and Disease
Prevention (ed. N.P. Shah ), 31–47. London: Academic
Press, an imprint of Elsevier.
Lu, Y., Ishikawa, H., Kwon, Y. et al. (2018). Real‐time
monitoring of chemical changes in three kinds of
fermented milk products during fermentation using
quantitative difference nuclear magnetic resonance
85
www.ajpdf.com
spectroscopy. Journal of Agricultural and Food Chemistry

66 (6): 1479–1487.
Lynch, J.M., Barbano, D.M., and Fleming, J.R. (2007).
Determination of the lactose content of fluid milk by
spectrophotometric enzymatic analysis using weight
additions and path length adjustment: collaborative
study. Journal of AOAC International 90 (1): 196–216.
Pochart, P., Dewit, O., Desjeux, J.F., and Bourlioux, P. (1989).
Viable starter culture, beta‐galactosidase activity, and
lactose in duodenum after yogurt ingestion in lactase‐
deficient humans. The American Journal of Clinical
Nutrition 49 (5): 828–831.
Savaiano, D.A. (2014). Lactose digestion from yogurt:
mechanism and relevance. The American Journal of
Clinical Nutrition 99 (5): 1251S–1255S.
Zimmerman, T., Ibrahim, M., Gyawali, R., and Ibrahim, S.A.
(2019). Linking biochemistry concepts to food safety
using yogurt as a model. Journal of Food Science
Education 18 (1): 4–10.
86
www.ajpdf.com
8
Enzymatic Browning: Kinetics of
Polyphenoloxidase

1. Prepare a crude enzyme extract from a natural source.

2. Perform an enzyme assay.
3. Determine KM and Vmax for an enzyme using data
obtained in an enzyme assay.
8.2 Introduction
The browning that develops when cut or bruised surfaces
of fruits, vegetables, and shellfish are exposed to air is
called enzymatic browning because the initial reactions
involved are enzyme catalyzed [1]. The enzyme responsible
for the initiation of this browning reaction has several
common names including phenolase, phenoloxidase,
tyrosinase, polyphenoloxidase (PPO), and catecholase [2].
These oxidases are present in both plant and animal
tissues. In animals, the enzyme is usually called tyrosinase
(because tyrosine is one of its substrates). An important
function of tyrosinase is to catalyze the formation of brown
melanin pigments, which impart color to skin, hair, and
eyes. In plants, the enzyme is more commonly called PPO,
suggesting that its primary substrates are polyphenolic
compounds. The function of the enzyme in plants is
unknown, but it is responsible for significant color changes
(both beneficial and detrimental) in many foods. In intact
plant tissue, PPO and its phenolic substrates are separated
by cell structures and browning does not occur. Cutting,
bruising, or otherwise damaging the integrity of plant
87
www.ajpdf.com
tissues often allows the enzyme and its substrate to come

into contact. A generalized reaction sequence for
enzymatic browning is shown in Figure 8.1.
Figure 8.1 The action of polyphenoloxidase (PPO) on

phenolic compounds.
Common substrates for PPO in plant tissues include the

amino acid tyrosine and polyphenolic compound such as
catechin, caffeic acid, and chlorogenic acid (Figure 8.2).
Tyrosine, being a monophenol, is first hydroxylated to 3,4‐
dihydroxyphenylalanine (dopa) and then is oxidized to a
quinone (Figure 8.3).
Figure 8.2 Examples of PPO substrates found in foods.

Note that they are polyphenols.
88
www.ajpdf.com
Figure 8.3 The action of PPO on tyrosine to produce indol‐

5,6‐quinone [4].
8.2.1 Enzyme Kinetics

Please refer to your food chemistry or biochemistry
textbook for a detailed discussion of enzyme kinetics.
The rates of reactions catalyzed by specific enzymes are
called enzyme activities. Enzyme activities may be
determined by measuring the rate of disappearance of
substrates or the rate of appearance of products. PPO,
therefore, could conceivably be assayed by measuring
oxygen uptake, disappearance of phenolic compounds,
brown color formation, or the formation of an intermediate
in the reaction such as a specific quinone. Indole‐5,6‐
quinone, a product of the PPO‐catalyzed oxidation of 3,4‐
dihydroxyphenylalanine, is a convenient product to follow
since it absorbs light at a wavelength where other
substances present do not interfere.
In many situations, the actual concentration of an enzyme
in a tissue extract is unknown. Therefore, enzyme activity
rather than concentration or weight is used to quantify the
amount present. Activity is usually expressed as the rate or
velocity of the reaction catalyzed by the enzyme. Rate and
velocity are really the same thing but are expressed in
different units (see below). Enzyme activities are
determined with enzyme assays where the enzyme and its
substrate(s) are mixed together and the progress of the
reaction is monitored over time. When the substrate is
89
www.ajpdf.com
present in excess and temperature and pH are properly

controlled, velocity is proportional to enzyme
concentration, i.e. the higher the enzyme concentration, the
faster the reaction.
In this experiment, rate is defined as the change in
absorbance of the assay mixture per unit time, i.e. it is
equal to the slope of the linear portion of a plot of
absorbance versus time (Figure 8.4).
Figure 8.4 The change in absorbance with time in an

enzyme assay. The assay mixture contains the enzyme and
its substrate. Absorbance is a measure of product
concentration, which increases with time. The initial rate of
the reaction is equal to the slope of the linear portion of the
line.
It is important to measure the initial rate in an enzyme
assay because the rate will slow as the reaction proceeds.
This is because reaction rate is dependent on substrate
concentration and substrate concentration decreases with
time. Also, in some reactions, product inhibition will slow
the reaction.
90
www.ajpdf.com
Velocity is defined at the change in concentration of a

reactant or product with time. In the case where dopa is
oxidized in a reaction catalyzed by PPO, absorbance (A) is
directly proportional to the concentration of indole‐5,6‐
quinone (IQ), a product of the reaction. Thus, we can
calculate velocity from the rate if we know the relationship
between absorbance and concentration. Absorbance is
related to concentration by the Beer‐Lampert Law:
where
ε = absorbancy coefficient (5.012 l mmol−1 cm−1 for

IQ)
b = length of light path (1.0 cm)
c = concentration (mmol l−1)
We have defined velocity as:
Substituting with the formula for the Beer‐Lampert law, we

have:
The velocities of many enzyme catalyzed reactions exhibit

a hyperbolic relationship to substrate concentration as
shown in Figure 8.5. Enzymes that exhibit this relationship
are said to obey Michaelis–Menten kinetics.
91
www.ajpdf.com
Figure 8.5 A plot of velocity versus substrate

concentration for an enzyme that obeys Michaelis–Menten
kinetics.
Notice that at low substrate concentrations, velocity is
nearly linearly related to substrate concentration, while at
high substrate concentrations velocity is almost unaffected
by changes in substrate concentration. Michaelis and
Menten proposed a model to explain this hyperbolic
relationship. They suggested that an enzyme (E) forms a
complex (ES) with a substrate (S) and that the substrate in
the complex can either dissociate unchanged from the
enzyme or it can be converted to a product (P) and then
dissociate. Their model can be summarized as follows:
Velocity of the reaction shown in the above model is equal

to a rate constant times the concentration of the enzyme–
substrate complex:
Clearly, when the substrate concentration is high enough to

saturate all active sites on the enzyme, further increases in
substrate concentration will not affect velocity since at
92
www.ajpdf.com
high substrate concentrations, the concentration of ES is

limited by enzyme concentration, not substrate
concentration.
Vmax is the maximal rate attained when all the active sites
of an enzyme are saturated with substrate. It reveals the
turnover number of the enzyme, i.e. the number of
substrate molecules converted to product per unit time.
Michaelis and Menten defined another constant, which
they called KM:
KM equals the concentration of substrate at which the

reaction rate is half its maximal value. It is a measure of the
affinity of the enzyme for its substrate. A large KM indicates
weak binding, and a small KM strong binding.
KM and Vmax can be determined from reaction velocities
measured at different substrate concentrations providing
the enzyme follows Michaelis–Menten kinetics. The
Michaelis–Menten equation describes the kinetics of
enzymes, which fit the Michaelis–Menten model:
The reciprocal of the Michaelis–Menten equation describes

a straight line:
Thus, we would expect a plot of 1/V versus 1/[S] to be a

straight line. Figure 8.6 shows a plot of l/V vs l/[S]. It is
commonly referred to as a Lineweaver‐Burk plot. The y‐
intercept is l/Vmax and the slope is KM/Vmax. The x‐
intercept is −l/KM.
93
www.ajpdf.com
Figure 8.6 A Lineweaver‐Burk plot for an enzyme that

obeys Michaelis–Menten kinetics. V = velocity of the
reaction; [S] = substrate concentration.
8.2.2 PPO Assay

In this experiment, PPO will be extracted from potatoes
and assayed using 3,4‐dihydroxyphenylalanine (dopa) as
the substrate. The progress of the reaction will be followed
by monitoring the formation of indole‐5,6‐quinone, an
early product of the oxidation. Indole‐5,6‐quinone absorbs
strongly at 475 nm, thus absorbance at 475 nm will be
used to quantitate the production of indole‐5,6‐quinone.
The assay will be set up to generate data that will allow
calculation of Vmax and KM. In addition, we will study the
effects of an inhibitor and of the enzyme concentration on
the rate of the reaction.
8.2.3 Control of Enzymatic Browning

Enzymatic browning of foods is often, but not always, an
adverse change because it reduces the acceptability of the
food. Thus, a large body of literature on safe and effective
methods for preventing enzymatic browning exists.
Three components must be present for enzymatic
browning to occur: active PPO, oxygen, and a suitable
substrate. Elimination of any of these will prevent the
94
www.ajpdf.com
reaction from occurring. In addition, reducing agents

capable of converting o‐quinones back to phenolic
compounds may effectively reduce browning.
Several different methods based on one or more of the
above considerations have been used for the control of
enzymatic browning in foods [3]. A brief summary of these
methods follows:
1. Inactivation of PPO with heat. This approach is often

used with vegetables that will ultimately be cooked
before consumption. Heating to temperatures
required for inactivation of PPO may not be suitable
for fruits since it can impart undesirable cooked
flavors and/or soft textures.
2. Chemical inhibition of PPO. Several strategies are
used. Sulfites are extremely effective inhibitors of PPO,
but the FDA restricts their use because they can cause
life–threatening allergic reactions in some people.
Acidulants such as citric acid inhibit the enzyme by
lowering the pH below the optimum range. Chelating
or sequestering agents such as EDTA and citric acid
may inhibit the enzyme by binding copper, an
essential cofactor.
3. Reducing agents. Agents that reduce o‐quinones to
phenolic compounds inhibit enzymatic browning.
Ascorbic and erythorbic (D‐isoascorbic) acids have
been used to prevent browning of fresh‐cut fruits for
more than 50 years. Sulfites, in addition to directly
inhibiting PPO, are also effective reducing agents but,
again, FDA regulations limit their use in foods.
4. Exclusion of oxygen. Frozen peach slices are packed in
evacuated, sealed containers to prevent exposure to
oxygen. Sugar syrups are often used in fruit packs to
exclude oxygen. Fruit pieces may be coated with an
edible oxygen‐impermeable edible film made from
xanthan or other gums.
5. Proteolytic enzymes. Proteolytic enzymes that attack
PPO and inactivate it have been proposed but are not
95
www.ajpdf.com
yet widely used.

6. Treatment with honey. Honey apparently contains
inhibitors of PPO, and research has shown it is
effective on cut fruits. It is not widely used.

1. Visible spectrophotometer
2. Pipettes, 2 and 5 ml
3. Pipettor, 250–1,000 μl
4. Cuvettes
5. Test tubes
6. Parafilm®
7. Small blenders
8. Whatman No. 1 filter paper
9. Knife
10. Ice bucket
11. Erlenmeyer flask
13. Graduated cylinder, 50 ml
14. Paper towels
15. Forceps
16. Hot plate

1. Small potatoes (held in refrigerator overnight)
2. Ice in an ice bucket
3. Buffer A: Sodium phosphate buffer, 0.1 M, pH 6.8,
containing 0.1 M NaF (prepared by lab assistants)
96
www.ajpdf.com
4. Buffer B: Sodium phosphate buffer, 0.1 M, pH 6.8

(prepared by lab assistants)
5. Sulfite solution: 0.5% (wt/vol) NaHSO3 in 0.1 M
sodium phosphate buffer, pH 6.8
6. Dopa (DL‐3,4‐Dihydroxyphenylalanine). 4 mg ml−1 in
buffer B. Freshly prepared by lab assistants. Note: It is
difficult to dissolve dopa in pH 6.8 buffer. To facilitate
solution, dissolve 400 mg of dopa in 10 ml of 0.1 N
HCl, add 80 ml buffer B, adjust pH to 6.8 with 1.0 N
KOH, dilute to 100 ml with buffer B. It may be
necessary to heat slightly to effect solution in the 0.1 N
HCl. Heat gently on a hot plate with constant stirring.
Heat only until the dopa dissolves.
8.5 Procedures
Note: This procedure is an adaptation of a method
described by Boyer [4].
8.5.1 Preparation of Crude Enzyme Extract
1. Peel a cooled potato and cut into small pieces.

2. Rapidly weigh about 10 g of potato and mix with 50 ml
of ice cold buffer A.
3. Grind the mixture thoroughly in a blender until
puréed.
4. Filter the mixture with Whatman No. 1 paper into an
iced 125 ml Erlenmeyer flask and hold on ice until
needed.
8.5.2 Enzyme Assay
1. Transfer the volumes of buffer B, sulfite solution, and

dopa solution shown in Table 8.1 to cuvettes labeled 1
through 12 taking care to pipette as accurately as
possible.
97
www.ajpdf.com
2. Set the wavelength on the spectrophotometer to 475

nm and select the enzyme assay method (if your
spectrophotometer is equipped with an enzyme assay
function). Zero the instrument against buffer B.
3. When everything is set, initiate the reaction by adding
the enzyme extract to the cuvette and inverting to mix.
Immediately place the cuvette in the
spectrophotometer and begin recording data. Collect
data for two minutes. Repeat with the next sample.
Table 8.1 Volumes of buffer, substrate, and enzyme extract

for PPO assays.
Reagent Cuvette numbera
1 2 3 4 5 6 7 8 9 10 11 12
Buffer Bb 2.5 2.4 2.35 2.3 2.2 2.1 2.0 1.9 0.8 0.7 0.6 —
Sulfitec — — — — — — — — — — — 2.0
Dopa — 0.1 0.15 0.2 0.3 0.4 0.5 0.6 2.0 2.0 2.0 0.5
solutiond
Enzyme 0.5 0.5 0.5 0.5 0.5 0.5 0.5 0.5 0.2 0.3 0.4 0.5
extract
a All volumes are in ml. Total volume in each cuvette should equal 3.0 ml.
b 0.1 M phosphate buffer, pH 6.8.
c NaHSO in buffer B, 0.5% (w/v).

3
d 4 mg dopa per ml buffer B, pH 6.8.
8.5.3 Data Treatment

1. Make a plot of absorbance versus time for each
cuvette. Estimate the rate of reaction in each cuvette
from the linear portion of the absorbance versus time
curve.
2. Determine reaction velocities for cuvettes 2 through 8.
Express reaction velocity as mmol IQ l−1 min−1.
3. Construct a plot of velocity versus [S] for cuvettes 2
through 8.
98
www.ajpdf.com
4. Construct a Lineweaver‐Burk plot from data for

cuvettes 2 through 8. Determine KM and Vmax for your
enzyme.
5. Determine the enzyme activities (rates) for cuvettes 9,
10, and 11. Plot activity vs. volume of enzyme extract
used. Is your plot linear? If it is, is this what you
expected? Why? If it is not, what might be a plausible
explanation?
6. Compare the activity in cuvette 12 with that in cuvette
7. Are they different? Explain.
8.5.4 Required Notebook Entries
1. A plot of absorbance vs. time for each cuvette.

2. A table showing all data from the PPO assay. For each
cuvette, you should record rate, velocity, 1/V, [S], and
1/[S]. Be sure to include units for each variable.
3. A plot of velocity vs. [S] for your PPO data.
4. A Lineweaver‐Burk plot for your PPO data.
5. Calculations for Vmax and KM for PPO.
6. A plot of enzyme velocity vs. volume of enzyme extract
for PPO data.
8.6 Problem Set

1. A crude extract of PPO was prepared by blending a
small potato in buffer. The activity of the extract was
assayed according to the protocol outlined above.
Dopa (2.0 mmol l−1 in the final assay mixture) was
used as the substrate. The following absorbance
values (measured at 475 nm) were obtained:
Absorbance data from a PPO assay of a potato
extract using dopa as the substrate
Time 0 0.25 0.5 0.75 1.0 1.25 1.5 1.75 2.0
(min)
99
www.ajpdf.com
Absorbance data from a PPO assay of a potato

extract using dopa as the substrate
Time 0 0.25 0.5 0.75 1.0 1.25 1.5 1.75 2.0
(min)
A (475 0 0.1 0.2 0.3 0.39 0.47 0.54 0.60 0.65
nm)
a. Determine the initial rate of the reaction.
b. Calculate the velocity of the reaction.
2. A series of assays using varying substrate
concentrations were conducted on the potato extract
described in Problem 1 above. The following data
were obtained:
Reaction velocities of the oxidation of dopa by
PPO at varying substrate concentrations.
[S] 1/[S] (l V (mmol l−1 1/V (l min
(mmol mmol−1) min−1) mmol−1)
l−1)
1.0 0.050
1.5 0.069
2.0 0.085
2.5 0.099
3.0 0.111
3.5 0.125
4.0 0.132
a. Make a plot of velocity versus substrate
concentration. Is it linear? Why or why not?
b. Construct a Lineweaver‐Burk plot for the data.
Determine the KM and Vmax for the extract.
c. Values for Vmax often vary considerably between
potato extracts. Can you think of an explanation?
(Hint: the efficiency of enzyme extraction varies
with blending times, temperature, and ratio of
potato to buffer).
100
www.ajpdf.com
8.7 Study Questions

1. Is your Lineweaver‐Burk plot linear? If not, what is
your explanation?
2. What does your value for KM indicate?
3. Is bisulfite an effective inhibitor?
4. Does enzyme concentration affect velocity? Would it
affect KM and Vmax as they were determined in this
experiment?
8.8 References
1 Singh, B., Suri, K., Shevkani, K. et al. (2018). Enzymatic
browning of fruit and vegetables: a review. In: Enzymes
in Food Technology: Improvements and Innovations (ed.
M. Kuddus ), 63–78. Singapore: Springer.
2 Parkin, K.L. (2017). Enzymes. In: Fennema’s Food
357–465. Boca Raton: CRC Press, Taylor & Francis
Group.
3 Sapers, G.M. (1993). Browning of foods: control by
sulfites, antioxidants, and other means. Food Technology
47 (10): 75–84.
4 Boyer, R.F. (1977). Spectrophotometric assay of
polyphenoloxidase activity. A special project in enzyme
characterization. Journal of Chemical Education 54 (9):
585.

1. a. 0.4 absorbance units min−1
b. 0.08 mmol l−1 min−1
2. b) KM = 5.22 mmol l−1; Vmax = 0.31 mmol l−1 min−1
101
www.ajpdf.com
9
Blanching Effectiveness

1. Test fruits and vegetables for blanching effectiveness.

2. Describe the biochemistry underlying the guaiacol test
for blanching effectiveness.
9.2 Introduction
Fresh fruits and vegetables contain many active enzymes
that cause postharvest deterioration in quality and
nutritional value. This deterioration occurs even when the
products are frozen. Thus, fruits and vegetables are usually
blanched prior to freezing or canning in an attempt to
inactivate these enzymes. Blanching may also kill some
microorganisms that may be present in the fresh produce.
The thermal stabilities of enzymes vary widely as shown in
Figure 9.1. Notice that it takes longer at a given
temperature to inactivate peroxidase than, for example
polyphenol oxidase. Therefore, blanching conditions need
to be targeted to the most heat‐resistant enzymes.
102
www.ajpdf.com
Figure 9.1 D‐values for the thermal inactivation of selected

enzymes at various temperatures. D‐value is the time, at a
given temperature, required to inactivate 90% of enzyme
activity.
Peroxidases are ubiquitous in plant tissues and are among

the most heat stable enzymes in plants [2]. Thus, they are
good indicators for blanching adequacy since heat
treatments sufficient to inactivate peroxidase also
inactivate most other enzymes.
Peroxidases are oxidoreductases, i.e. they are members of
the group of enzymes that catalyze oxidation–reduction
reactions. As the name implies, one of the substrates of
peroxidase is a peroxide. Several different peroxides may
be present in plant tissues, including hydrogen peroxide
and lipid hydroperoxides. Substrates capable of donating
hydrogen atoms can reduce peroxides as shown in the
following peroxidase‐catalyzed reaction:
103
www.ajpdf.com
In the above reaction, AH, a hydrogen donor, is oxidized by

a peroxide, H2O2. Many peroxidases have low specificity, i.e.
they catalyze the oxidation of many different hydrogen
donors. Phenolic and other aromatic compounds are
common substrates. Moreover, either a lipid hydroperoxide
or hydrogen peroxide can function as the oxidizing agent.
Peroxidases have several functions in plant tissues
including removal of hydrogen peroxide, defense against
pathogens and pests, and degradation of lignin [2].
Guaiacol (o‐methoxyphenol), in a reaction catalyzed by
peroxidase, is oxidized by hydrogen peroxide to form free
radicals (Figure 9.2).
Figure 9.2 The oxidation of guaiacol by hydrogen peroxide

to form a guaiacol‐free radical. The reaction is catalyzed by
peroxidase.
The free radicals generated in the above reaction react to
form compounds that have a reddish brown color and this
is the basis for the peroxidase assay [2]. The structures of
these compounds are in dispute, and it is likely that several
different compounds form when guaiacol free radicals
react with each other. Figure 9.3 shows one possible
reaction sequence that yields 3,3′‐dimethoxy‐4,4′‐
biphenoquinone. Given the multiple conjugated double
bonds in the structure, we would expect it to be a colored
compound.
104
www.ajpdf.com
Figure 9.3 Possible reactions of guaiacol‐free radicals that

yield the red/brown color typical of a positive guaiacol test
for blanching adequacy.
Source: Adapted from Doerge et al. [3] and Hwang et al. [4].
The guaiacol peroxidase assay has been in use for decades

and appears to be a reliable assay for blanching
effectiveness even if there remains some doubt about the
structure of the compound or compounds responsible for
the red/brown color.
The above reactions provide a convenient, qualitative assay
for blanching adequacy. The substrates, hydrogen peroxide
and guaiacol, are mixed with macerated vegetables or
fruits and incubated for a brief period. If a reddish brown
color develops, then active peroxidase is present indicating
inadequate blanching.
This blanching effectiveness assay does have its drawbacks.
The primary objective of blanching is to inactivate enzymes
that cause quality deterioration in the food. Peroxidases
are not a major factor in quality deterioration, so heating to
inactivate them may result in a more severe heat treatment
than is necessary to prevent quality deterioration [1].
105
www.ajpdf.com

1. Beakers, 600 ml
2. Slotted spoon
3. Knife
4. Mortar and pestle
6. Pipettes, 1 ml
7. Test tubes
8. Small beakers
9. Hot plate

1. Fresh potatoes and apples
2. Guaiacol (1% v/v in 95% ethanol)
3. Hydrogen peroxide (0.5% v/v)
4. Sand
9.5 Procedures
The following procedure is adapted from the method
described by Masure and Campbell [5].
1. Blanch a few pieces of potato and apple as follows:

Bring 300 ml distilled water to boiling in a 600 ml
beaker. Submerge pieces of each sample in the boiling
water for two minutes. Remove and submerge in cold
water to cool. Place on a paper towel.
2. Assay the potato and the apple before and after
blanching as follows:
a. Cut a piece of sample weighing about 5 g into
small pieces.
106
www.ajpdf.com
b. Transfer the sample to a mortar containing a

small quantity of sand. Add about 5 ml distilled
water and grind for two to three minutes.
c. Add another 5 ml water, mix, and transfer
contents to a small beaker.
d. Add 1 ml of 1.0% guaiacol solution (in 95%
ethanol) and 1 ml 0.5% hydrogen peroxide. Mix
by gently swirling the beaker.
e. Peroxidase activity is indicated by the
development of a reddish color. If no color
develops in 3.5 min, consider the product
adequately blanched.
9.6 Study Questions

1. Why are some enzymes more stable to thermal
treatment than others?
2. Name three enzymes that cause problems in frozen
vegetables if they are not inactivated. Describe the
reactions involved.
9.7 References
1 Belitz, H.‐D., Grosch, W., and Schieberle, P. (2009). Food
2 Parkin, K.L. (2017). Enzymes. In: Fennema’s Food
Group.
3 Doerge, D.R., Divi, R.L., and Churchwell, M.I. (1997).
Identification of the colored guaiacol oxidation product
produced by peroxidases. Analytical Biochemistry 250
(1): 10–17.
4 Hwang, S., Lee, C.‐H., and Ahn, I.‐S. (2008). Product
identification of guaiacol oxidation catalyzed by
107
www.ajpdf.com
manganese peroxidase. Journal of Industrial and

Engineering Chemistry 14 (4): 487–492.
5 Masure, M.P. and Campbell, C. (1944). Rapid estimation
of peroxidase in vegetable extracts ‐ an index of
blanching adequacy for frozen vegetables. Fruit
Products Journal and American Food Manufacturer 23
(12): 369–374.

Burnette, F.S. (1977). Peroxidase and its relationship to
food flavor and quality: a review. Journal of Food Science
42 (1): 1–6.
Xiao, H.‐W., Pan, Z., Deng, L.‐Z. et al. (2017). Recent
developments and trends in thermal blanching – a
comprehensive review. Information Processing in
Agriculture 4 (2): 101–127.
108
www.ajpdf.com
10
Lipid Oxidation

After completing this exercise, students will be able to
1. Describe the chemical processes involved in lipid

oxidation in foods.
2. Use the thiobarbituric acid (TBA) test to analyze a
food product for evidence of lipid oxidation.
3. Quantify the extent of lipid oxidation in a food from
data generated in the TBA test and express as
malondialdehyde (MDA) equivalents per gram of food
(e.g. μg MDA g−1 meat).
4. Explain mechanisms responsible for warmed‐over
flavor development in meat.
10.2 Introduction
The oxidation of lipids in foods is a major cause of quality
deterioration. Lipid oxidation (or peroxidation) causes off‐
flavors and odors, destroys sensitive vitamins, and may
generate toxic compounds. It can affect most foods, even
foods low in fat, if the conditions are right. The off‐flavors
and odors produced are frequently characterized as rancid,
and hence the term oxidative rancidity.
Polyunsaturated fatty acids are especially susceptible to
lipid peroxidation due to the double bonds in their
hydrocarbon chains. This is because lipid peroxidation
proceeds by a free radical mechanism, and unsaturated
fatty acids are particularly susceptible to attack by free
radicals.
10.2.1 The Chemistry of Lipid Oxidation
109
www.ajpdf.com
See Brady [1] or McClements and Decker [2] for in‐depth

discussions of lipid oxidation in foods and Dominguez et al.
[3] for a review of lipid oxidation in meat and meat
products.
To begin the process of lipid oxidation, a free radical must
be generated. Hydroxyl, peroxyl, and hydroperoxyl radicals
are among the most important initiator radicals in foods
[4]. Hydroxyl radicals may be generated in foods in a
number of ways including the Fenton reaction where
ferrous iron reacts with hydrogen peroxide to form a
hydroxyl radical:
Peroxyl, alkoxyl, and hydroxyl radicals are formed when

hydroperoxides decompose (Figure 10.1).
Figure 10.1 The reaction of linoleic acid with singlet

oxygen to form a hydroperoxide and the subsequent
decomposition of the hydroperoxide (initiation phase).
Hydroperoxides may form when singlet oxygen (1O2)
attacks the double bond in an unsaturated fatty acid as
shown in Figure 10.1. Atmospheric oxygen is called
“ground state” oxygen because it is in the lowest energy
110
www.ajpdf.com
state and is quite unreactive at ambient temperatures. It is

classified as triplet oxygen (3O2) because its two outermost
unpaired electrons have parallel spins. Triplet oxygen will
not react with unsaturated fatty acids because of its spin
state. However, triplet oxygen is a free radical (it has not
one but two unpaired electrons in its outer shell) and
therefore will readily react with other free radicals. Singlet
oxygen may be formed in foods by photosensitization,
which can occur when foods are exposed to light. Foods
that contain light‐absorbing pigments such as riboflavin
and carotenoids are particularly susceptible to
photosensitization.
Once a lipid‐free radical forms in a food, lipid oxidation can

begin. Lipid oxidation is a complex chain reaction, i.e.
products in the reaction are recycled so that the reaction is
self‐perpetuating. Using the example of linoleic acid, we
see that hydrogen abstraction from carbon 11 yields a free
radical (Figure 10.2). Polyunsaturated fatty acids like
linoleic acid are particularly susceptible to free radical
attack because the alkyl free radical that forms is stabilized
by resonance. Triplet oxygen (3O2), unlike singlet oxygen,
will not attack a double bond but reacts readily with free
radicals to form peroxyl radicals. The peroxyl radical in
turn can abstract a hydrogen from another linoleic acid
molecule, thereby regenerating the alkyl free radical (R.).
111
www.ajpdf.com
Figure 10.2 Reaction of linoleic acid with a hydroxyl

radical and triplet oxygen to form a hydroperoxide
(propagation phase).
Lipid oxidation is often characterized as having four stages:
initiation, propagation, decomposition, and termination.
Lipid hydroperoxides are unstable molecules and are
prone to undergo scissions of carbon–carbon bonds. Figure
10.3 shows scission products of a linoleic acid
hydroperoxide. Some scission products, hexanal, for
example, are volatile compounds and their concentrations
in a headspace, determined using gas chromatography, can
be used as indicators of the extent of lipid oxidation in
foods.
112
www.ajpdf.com
Figure 10.3 The decomposition of linoleic acid

hydroperoxide (decomposition phase). Note that some
scission products including hexanal and pentane are
volatile compounds. Concentrations of these compounds in
the headspace above a packaged food may be used to
assess the extent of lipid oxidation.
Termination of the chain reaction occurs when two free
radicals combine to form a single bond. A summary of the
reactions believed to be involved in lipid oxidation is given
in Figure 10.4.
113
www.ajpdf.com
Figure 10.4 Reactions in lipid oxidation. RH is an

unsaturated fatty acid. R ● is an alkyl free radical, ROO ● is
an alkoxyl free radical, and ROOH is a lipid hydroperoxide.
Hydroperoxides are the initial products of lipid oxidation.
As shown above, they decompose to aldehydes, ketones,
alcohols, alkenes, and/or hydroxy acids. Such products
frequently have unpleasant odors and flavors [1].
Off‐flavors in meat and meat products arise in several
ways. Frozen raw meat develops oxidative rancidity after
several months of storage. Refrigerated cooked meats, on
the other hand, often exhibit a “stale, painty, rancid” flavor
and aroma upon reheating. This characteristic becomes
evident after a few days storage at refrigeration
temperatures and is known as “warmed‐over flavor
(WOF)” [5].
WOF has been associated with lipid oxidation. The greater
the unsaturation of fatty acids in muscle tissue the greater
the susceptibility to oxidative deterioration [6]. In general,
pork and poultry contain more polyunsaturated lipids than
114
www.ajpdf.com
meat from ruminants and, as a result, are more susceptible

to lipid oxidation.
10.2.2 Control of Lipid Oxidation

It should be clear from the preceding sections that lipid
peroxidation requires oxygen and free radicals. It is also
known that transition metal ions such as iron and copper
may initiate and accelerate lipid peroxidation by catalyzing
the formation of new free radicals. Light may initiate
peroxidation transforming triplet oxygen into singlet
oxygen, thereby allowing the formation of lipid
hydroperoxides, which can decompose to form free
radicals. How then might lipid peroxidation in foods be
controlled? Several strategies are available.
10.2.2.1 Elimination of Oxygen

Oxygen is required for lipid peroxidation. Therefore,
elimination of oxygen should prevent peroxidation. This
strategy is used in many food products, for example potato
chips. It is accomplished by flushing away oxygen with
nitrogen gas and sealing the food in packages that are
impermeable to oxygen.
10.2.2.2 Scavenging of Free Radicals

Given that oxidation in foods proceeds by a free radical
mechanism, it stands to reason that removal of free
radicals would prevent or slow oxidation. In fact many of
the most effective antioxidants in foods are free radical
scavengers. To understand how free radical scavengers
work, let’s take phenol as an example. The hydrogen in the
hydroxyl group of phenolic compounds is relatively easily
abstracted. Thus, phenolic compounds will donate a
hydrogen atom to free radicals converting them to non‐
radicals:
We still have a free radical, PhO•. However, phenolic free

radicals are relatively stable and are incapable of
115
www.ajpdf.com
abstracting a hydrogen from another unsaturated fatty

acid. Thus, the chain is broken, and lipid oxidation is
slowed. Phenolic radicals are stable because of resonance
around the aromatic ring:
Although phenol itself is toxic and cannot be added to

foods, many phenolic compounds (derivatives of phenol)
are present naturally in foods. Vitamin E is an important
antioxidant in blood and cell membranes. It is a phenolic
compound:
Also, the widely used synthetic food additives BHT, BHA,

TBHQ, and propyl gallate (PG) are phenolic compounds.
10.2.2.3 Chelation of Metal Ions

Since transition metal ions catalyze the formation of free
radicals, we might expect that removal of metal ions would
reduce oxidation. However, it is not possible or practical to
remove them from foods. Iron and copper are both
essential nutrients. Moreover, iron deficiency is a
widespread nutritional problem. Therefore, even if it were
possible to remove these metals from foods, it would be
unwise to do so. In fact, iron is added to many foods in
order to insure adequate intakes by individuals in the
population. Therefore, chelating agents capable of
complexing metals in foods are often added to reduce the
prooxidant effects of metals. EDTA and citric acid are
common chelating agents added to foods.
116
www.ajpdf.com
10.2.3 Measurement of Lipid Oxidation in

Foods
Chemical and physical tests for measuring lipid oxidation
are based on the determination of hydroperoxides or their
decomposition products [7, 8]. While sensory evaluation is
the ultimate test for consumer acceptance of a product [9],
it is a time‐consuming procedure involving trained
panelists and results are often variable. Chemical methods
are more objective although interferences and poor
reproducibility are frequent problems. Most chemical
methods are highly empirical. Different methods assess
different stages of the oxidative process, so correlations
with sensory data may differ depending on the chemical
method chosen [10]. The use of advanced instrumental
analysis such as GC‐MS has been very promising in
identifying volatile flavor compounds generated from lipid
oxidation and linking them to sensory attributes [11, 12].
Chemical methods are based on the disappearance of
reactants or the appearance of products [2, 10, 13].
10.2.3.1 Thiobarbituric Acid Test (TBA Test)

Malondialdehyde (MDA) (CHOCH2CHO) is believed to be
one of the products formed when hydroperoxides
decompose. It reacts with TBA to form a pink‐colored
chromogen, which absorbs at 450, 530, and 538 nm. This is
one of the more widely used tests and will be used for this
laboratory experiment. The reaction between TBA and
MDA is shown below:
Since other aldehydes besides MDA may also react with

TBA to give a pink color, the values obtained in the assay
are frequently expressed as TBARS (ThioBarbituric Acid
Reactive Substances) or as MDA equivalents (e.g. μg MDA
117
www.ajpdf.com
g−1 meat). An important caveat is that the TBA reaction is

somewhat nonspecific, so results need to be interpreted
with caution. An advantage of the TBA test is that it is
relatively simple and inexpensive. Also, when used
properly, it provides useful information about lipid
oxidation not only in foods but in blood samples from
humans and experimental animals.
10.2.3.2 Peroxide Value

This test measures the concentration of peroxides. Because
peroxides may decompose to other products prior to
measurement, caution must be exercised in the
interpretation of peroxide value data.
10.2.3.3 Conjugated Diene Methods

Polyunsaturated fatty acids have a 1,4‐pentadiene
structure (R‐CH=CHCH2‐CH=CH‐R). When one of the
methylene hydrogens is abstracted to form a free radical,
the double bonds can rearrange to form conjugated double
bonds (R‐CH‐CH=CH‐CH=CH‐R) (see Figure 10.3).
Conjugated dienes absorb ultraviolet light more strongly
than nonconjugated dienes. Therefore, in the early stages
of oxidation, ultraviolet absorbance increases.
Subsequently, it decreases as hydroperoxides containing
the conjugated double bonds decompose.
10.2.3.4 Oxygen Bomb Test

This test measures oxygen disappearance from a system.
10.2.3.5 Total and Volatile Carbonyl Compounds

This method measures compounds that are responsible for
off‐flavors and odors. Several analytical methods have been
used. Interferences from hydroperoxides may be a
problem.
10.2.3.6 Anisidine Value Test

The anisidine value test is particularly useful for abused
oils with low peroxide values such as frying oils [7]. The
118
www.ajpdf.com
test involves a condensation reaction between the

conjugated dienals or alk‐2‐enals in the sample and p‐
anisidine reagent in iso‐octane solution followed by
spectrophotometric measurement at 350 nm.

Note: It is a good idea to acid‐wash all glassware to avoid
contamination from trace metal ions, which can catalyze
lipid oxidation during the assay giving variable results.
1. Screw‐capped test tubes (30)

2. Glass pipettes & bulb, 1, 5, and 10 ml
3. Beakers, 250 ml, tall form
5. Plastic funnels
6. Erlenmeyer flasks, 250 ml
7. Filter paper, Whatman #1, 18 cm diameter
8. Spectrophotometer and cuvettes
9. Hand‐held blender
10. Vortex mixer

1. Fresh, raw (red muscle) ground turkey
2. Cooked (red muscle) ground turkey, stored 48 hours
at 4 °C
3. TBA reagent (0.02 M in dH2O)
4. Extracting solution = 10% TCA in 0.2 M H3PO4, w/v
5. 1,1,3,3‐Tetraethoxypropane (TEP) standard solution,
10−2 M
6. TEP, 10 μM
119
www.ajpdf.com
7. TEP, 25 μM
8. BHT, 0.2 mg ml−1
10.5 Procedures: Lipid Oxidation in

Turkey Meat
Note: The following procedure applies to the analyses of
both raw (fresh) and cooked (stored) ground turkey
samples. Two additional samples (1 raw and 1 cooked) will
be spiked with TEP in order to assess recovery of TBARS.
1. Weigh 5 g of raw turkey into each of three 400 ml glass

beakers. Repeat with 5 g samples of cooked turkey.
Weights need not be exactly 5 g but record exact
weights for all six turkey samples.
2. Add 1 ml BHT (0.2 mg ml−1) to each of your 6 pre‐
weighed turkey samples. To 1 raw and 1 cooked
sample, add 12 ml of 10 μM TEP.
3. Add 33.5 ml TCA/H3PO4 to each of the TEP‐spiked
samples, bringing the total volume to 50 ml (assume
moisture content of all turkey samples is 70% or 3.5
ml H2O in 5 g). Add 45.5 ml TCA/H3PO4 to each of the
four remaining beakers.
4. Blend the contents of each beaker for 30 seconds on
HIGH using a hand‐held blender until thoroughly
blended. CAUTION! Start blending at a low speed and
gradually increase speed to prevent splashing. Shake
off liquid and any meat pieces before blending next
sample. Rinse blender in a large beaker of dH2O
between samples.
5. Filter each blended meat mixture through Whatman
#1 filter paper, collecting filtrate in pre‐labeled 250 ml
Erlenmeyer flasks. Proceed to Step 6 while samples
are filtering.
6. Prepare standards for a standard curve as follows:
120
www.ajpdf.com
a. Prepare a table like the one in Section 10.6 on the

following page to keep the concentrations in your
standards straight.
b. Pipette aliquots of 0, 0.5, 1.0, 1.5, and 2.0 ml of 25
μM TEP into screw‐cap test tubes, in duplicate.
c. Bring total volume of each tube to 5 ml with
TCA/H3PO4 solution.
d. Add 5 ml of TBA reagent to each tube, cap, mix,
and set aside.
7. Remove funnels from flasks in Step 5, swirl each flask
to mix. Pipette two 5 ml aliquots of each filtrate into 2
separate screw‐cap test tubes.
a. To one aliquot, add 5 ml TBA Reagent. (This is
your test sample).
b. To the second aliquot, add 5 ml dH2O. (This is
your sample blank).
8. Prepare a reagent blank by pipetting 5 ml of the
extracting solution and 5 ml of the TBA reagent into a
test tube.
9. Cap tubes, vortex to mix, and place all tubes in a dark
cabinet for 15–20 hours.
10. Read absorbances at 530 nm against the reagent
blank. Subtract sample blank absorbances from
sample readings only. It may be necessary to dilute
cooked turkey samples so that absorbances lie in the
linear range of the standard curve.
11. Construct a standard curve by plotting Absorbance vs.
concentration of MDA (as nmol MDA ml−1).
12. Compute MDA recovery (express as a percentage).
13. Determine the concentration of TBARS in the meat
samples (as μg MDA per g of meat). Assume recovery
of TBARS is the same as for MDA and make the
appropriate correction.
121
www.ajpdf.com
14. Calculate means and standard deviations for TBARS in

the meat samples from class data.
10.6 Problem Set: Calculation of

TBARS
TBARS are often expressed as the “TBA Number.” The TBA
number for meat samples is equal to μg MDA g−1 tissue.
The TBA number for samples is derived from absorbance
readings and a standard curve. The standard curve is
constructed from absorbance data from a series of
standards (see Step 6 in Section 10.5).
Since MDA is a volatile substance and therefore difficult to
handle, a nonvolatile precursor is used. We will use 1,1,3,3‐
tetraethoxypropane (TEP) as the precursor. TEP is a liquid
at room temperature with a boiling point of 220 °C. TEP
decomposes to MDA as follows:
Given the following data shown in Tables 10.1 and 10.2,

calculate TBA numbers for raw and cooked turkey meat.
Assume that the protocol outlined above was followed.
Hint: For the turkey samples, first calculate the
concentration of MDA in the TCA/H3PO4 extract. Then
determine the total amount of MDA in the extract. This is
equal to the total amount of MDA in the sample of meat
that was extracted. Express the TBA number as μg MDA g−1
meat. Don’t forget to correct your TBA numbers for
recovery. Recall that 1 μmole = 1,000 nmole.
122
www.ajpdf.com
Table 10.1 Volumes, concentrations, and absorbance

values for standards in the TBARS assay. The TEP
standards were added to tubes, diluted to a volume of 5.0
ml with TCA/H3PO4 solution, mixed with 5.0 ml TBA
reagent, and held for 15–20 hours before reading
absorbances.
TEP MDA (nmol [MDA] (nmol Absorbance
(ml) tube−1) ml−1)a (530 nm)
0.0 0 0 0.00
0.5 12.5 2.5 0.19
1.0 25.0 5.0 0.41
1.5 37.5 7.5 0.59
2.0 50.0 10.0 0.81
a nmol ml−1 in the diluted standards before addition of TBA reagent.
Table 10.2 Data for TBARS assay on raw and cooked

turkey samples.
Sample Sample Absorbance at [MDA] in [MDA] in
Wt (g) 530 nm extract meat
Blank Test Test – nmol nmol μg in μg
(no (+ blank ml−1 50 sample g−1
TBA) TBA) ml−1
Raw 5.1 0.01 0.1 0.09
Turkey
Raw + 5 0.02 0.29 0.27
TEP
Cooked 4.9 0.01 0.50 0.49
Turkey
Cooked 5 0.01 0.65 0.64
+ TEP

1. Why was BHT added prior to blending?
123
www.ajpdf.com
2. What was the purpose of TCA and H3PO4 in the

extracting solution?
3. Why is the x‐axis on the standard curve labeled as
MDA ml−1 rather than TEP?
4. Which samples had the highest TBA numbers, raw or
cooked? Explain why one was higher than the other.
10.8 References
1 Brady, J.W. (2013). Introductory Food Chemistry . Ithaca:
2 McClements, D.J. and Decker, E.A. (2017). Lipids. In:
Francis Group.
3 Domínguez, R., Pateiro, M., Gagaoua, M. et al. (2019). A
comprehensive review on lipid oxidation in meat and
meat products. Antioxidants 8 (10): 429.
4 Laguerre, M., Lecomte, J., and Villeneuve, P. (2007).
Evaluation of the ability of antioxidants to counteract
lipid oxidation: existing methods, new trends and
challenges. Progress in Lipid Research 46 (5): 244–282.
5 St. Angelo, A.J. (1987). Preface. In: Warmed‐Over Flavor of
Meat [Internet] (eds. A.J. St. Angelo and M.E. Bailey ), vii–
viii. Orlando, FL: Academic Press
http://qut.eblib.com.au/patron/FullRecord.aspx?
p=1180688.
6 Cross, H.R. and Overby, A.J. (eds.) (1988). Meat Science,
Milk Science, and Technology . Amsterdam; New York:
Elsevier Science Publishers. 458 p. (World animal
science).
7 Robards, K., Kerr, A.F., and Patsalides, E. (1988). Rancidity
and its measurement in edible oils and snack foods. A
review. Analyst 113 (2): 213–224.
124
www.ajpdf.com
8 Moon, J.‐K. and Shibamoto, T. (2009). Antioxidant assays

for plant and food components. Journal of Agricultural
and Food Chemistry 57 (5): 1655–1666.
9 Arroyo, C., Eslami, S., Brunton, N.P. et al. (2015). An
assessment of the impact of pulsed electric fields
processing factors on oxidation, color, texture, and
sensory attributes of turkey breast meat. Poultry Science
94 (5): 1088–1095.
10 Gray, J.I. (1978). Measurement of lipid oxidation: a
review. Journal of the American Oil Chemists’ Society 55
(6): 539–546.
11 Tikk, K., Haugen, J.‐E., Andersen, H.J., and Aaslyng, M.D.
(2008). Monitoring of warmed‐over flavour in pork
using the electronic nose – correlation to sensory
attributes and secondary lipid oxidation products. Meat
Science 80 (4): 1254–1263.
12 Chen, C., Husny, J., and Rabe, S. (2018). Predicting
fishiness off‐flavour and identifying compounds of lipid
oxidation in dairy powders by SPME‐GC/MS and
machine learning. International Dairy Journal 77: 19–28.
13 Melton, S.L. (1983). Methodology for following lipid
oxidation in muscle foods. Food Technology (USA) 37
(7): 105–116.

Byrne, D.V., O’Sullivan, M.G., Dijksterhuis, G.B. et al. (2001).
Sensory panel consistency during development of a
vocabulary for warmed‐over flavour. Food Quality and
Preference 12 (3): 171–187.
Jackson, V. and Penumetcha, M. (2019). Dietary oxidised
lipids, health consequences and novel food technologies
that thwart food lipid oxidation: an update.
International Journal of Food Science & Technology 54
(6): 1981–1988.
125
www.ajpdf.com
Wilson, B.R., Pearson, A.M., and Shorland, F.B. (1976).

Effect of total lipids and phospholipids on warmed‐over
flavor in red and white muscle from several species as
measured by thiobarbituric acid analysis. Journal of
Agricultural and Food Chemistry 24 (1): 7–11.
Zhang, Y., Holman, B.W.B., Ponnampalam, E.N. et al. (2019).
Understanding beef flavour and overall liking traits
using two different methods for determination of
thiobarbituric acid reactive substance (TBARS). Meat
Science 149: 114–119.

Equation for standard curve: y = 0.081x − 0.004, R 2 =
1.00.
Recovery = 93.5 and 72% for raw and cooked,
respectively.
TBA no. (uncorrected) = 0.82 and 4.48 μg g−1 for raw
and cooked turkey, respectively.
TBA no. (corrected) = 0.88 and 6.22 μg g−1 for raw and
cooked turkey, respectively.
126
www.ajpdf.com
11
Ascorbic Acid: Stability and Leachability

1. Describe functions of ascorbic acid as a food additive.

2. Measure the concentration of ascorbic acid in a food product using a redox
titrimetric procedure.
3. Determine the stability of ascorbic acid under various conditions.
4. Determine leaching losses in a common cooking method.
11.2 Introduction
L‐Ascorbic acid (vitamin C) is an essential nutrient for humans. Low intakes
cause a nutrient deficiency disease known as scurvy. The Recommended Dietary
Allowance (RDA) for ascorbic acid is 90 mg day−1 for adult males and 75 mg
day−1 for adult females [1]. About 10 mg day−1 will prevent scurvy, but higher
intakes have health benefits beyond the prevention of scurvy [2].
Ascorbic acid is present naturally in many fruits and vegetables. Synthetic
ascorbic acid is classified by FDA as a GRAS (generally recognized as safe) food
additive. It is added to a wide variety of foods for both nutritional and technical
reasons (Table 11.1).
127
www.ajpdf.com
Table 11.1 Functions of naturally occurring and added ascorbic acid (or its
isomers and derivatives) in foods.
Function Food application

Essential nutrient Fruit juices, fruit drinks, breakfast cereals
Antioxidant (controls Apples, peaches, apricots, potatoes, cauliflower,
oxidative rancidity and/or mushrooms, olives, nuts, tomatoes, peanut butter,
prevents enzymatic potato chips, soft drinks, fruit drinks
browning)
Antioxidant (added as Vegetable oils (acts synergistically with phenolic
ascorbyl palmitate) antioxidants such as tocopherols, BHA, and BHT
to prevent oxidative rancidity)
Inhibition of can corrosion Soft drinks
Protection of taste, flavor, Wines
clarity
Prevention of black spots Shrimp
Inhibition of nitrosamine Bacon
formation
Color development in cured Bacon, ham, hot dogs, sausages
meats
Dough improver Wheat flours for baked goods
Color stability in packaged Fresh pork (Stabilizes the reddish color. Not
meat permitted in other meats because it may mislead
the consumer)
11.2.1 Chemistry
Naturally occurring ascorbic acid is designated as L‐ascorbic acid. As shown in
Figure 11.1, there are four stereoisomers of ascorbic acid. D‐ascorbic acid has
1/10 the vitamin activity of L‐ascorbic acid and the isoascorbic acids have only
1/20 the activity. The FDA requires that the isoascorbic acids be listed by their
common name, “erythorbic acid,” to avoid misunderstanding by the consumer
[3].
128
www.ajpdf.com
Figure 11.1 Structures of ascorbic acid stereoisomers.

Ascorbic acid is quite acidic even though it has no free carboxyl groups like most
other organic acids found in foods. The hydrogen on the hydroxyl on carbon 3 is
the acidic hydrogen as shown in Figure 11.2.
Figure 11.2 The dissociation of ascorbic acid to form ascorbate ion and a
proton. The pKa of the C‐3 hydroxyl group is 4.04.
Another interesting aspect of ascorbic acid is that it is an unusually stable
lactone. Recall that a lactone is an ester where both the carboxyl and hydroxyl
groups that form the ester are on the same molecule. This stability is lost when
ascorbic acid is oxidized to dehydroascorbic acid (Figure 11.3). Dehydroascorbic
acid readily hydrolyses to diketogulonic acid (Figure 11.4). Other properties of
ascorbic acid are listed in Table 11.2.
129
www.ajpdf.com
Figure 11.3 The reaction of ascorbic acid with molecular oxygen.
Figure 11.4 The hydrolysis of dehydroascorbic acid to diketogulonic acid.

Table 11.2 Chemical and physical properties of ascorbic acid.
Strong reducing agent, effective antioxidant
Molecular weight = 176
Water solubility: 33% wt/v at 25 °C
Essential nutrient – prevents scurvy; RDA = 90 mg for men, 75 mg for women
Weak acid: pka1 = 4.2; pka2 = 11.8
11.2.2 Functions of Ascorbic Acid in Foods [3, 5, 6]

11.2.2.1 Oxygen Scavenger
One mechanism for the antioxidant activity of ascorbic acid in foods is oxygen
scavenging. When foods are bottled or canned, they often contain residual
molecular oxygen, which could react with various food molecules to cause
rancidity, loss of color, etc. Added ascorbic acid can remove or scavenge this
oxygen as shown in Figure 11.3.
11.2.2.2 Free Radical Scavenger

Ascorbate ion scavenges free radicals by donating hydrogen atoms to other free
radicals such as a tocopherol radical as shown in Figure 11.5. Thus, ascorbate
acts synergistically with vitamin E and other phenolic antioxidants such as BHA
and BHT. It is frequently added to foods along with phenolic antioxidants.
130
www.ajpdf.com
Figure 11.5 The mechanism for free radical scavenging by ascorbate. TO·is
tocopherol radical, TOH is tocopherol. The ascorbate radical is stabilized by
resonance as shown.
11.2.2.3 Control of Enzymatic Browning

Ascorbic acid is widely used to control enzymatic browning. This is
accomplished by reducing quinones formed by the polyphenol oxidase‐
catalyzed oxidation of polyphenolics in foods as shown in Figure 11.6.
Figure 11.6 Inhibition of enzymatic browning by ascorbic acid. PPO =

polyphenol oxidase, AA = ascorbic acid, DHAA = dehydroascorbic acid.
11.2.2.4 Dough Improver

Ascorbic acid is widely used as a dough improver in bread baking. Dough
improvers are added to flour to strengthen the gluten and increase bread
volume. Presumably, dough improvers function by preventing the reduction of
disulfide bridges that cross link gluten proteins. Disulfide bonds may be broken
by reactions known as disulfide interchanges where low‐molecular‐weight‐free
thiol groups react with disulfide bonds in the gluten proteins:
This reaction reduces protein–protein interactions and thereby softens or

weakens the dough. It follows that reducing the concentration of R‐SH will slow
the above reaction, and this will prevent or reduce dough softening. Glutathione,
a tripeptide containing the amino acid cysteine, is one source of free thiol
groups in bread flour, so any reaction that might reduce the concentration of
glutathione may be expected to improve dough. Since thiol groups are easily
oxidized, we might expect that oxidizing agents may improve doughs, and this,
in fact, is the case. Two oxidants commonly used as flour additives are KBrO3
and KIO3. Ascorbic acid is also used, but it is an antioxidant, not an oxidant. How
then can it be a dough improver? The explanation lies in its conversion to
131
www.ajpdf.com
dehydroascorbic acid by ascorbic acid oxidase which is naturally present in

wheat flour. Dehydroascorbic acid is the oxidized form of ascorbic acid and
therefore is an oxidizing agent, capable of oxidizing other compounds. Figure
11.7 summarizes the reactions that are presumably involved in the dough
improving action of ascorbic acid.
Figure 11.7 Reactions showing how ascorbic acid functions as a dough

improver. Ascorbic acid is oxidized to dehydroascorbic acid in a reaction
catalyzed by ascorbic acid oxidase. Dehydroascobic acid reacts with glutathione
(G‐SH) to form reduced glutathione (G‐S‐S‐G). This reduces the concentration of
G‐SH, thereby reducing the breakage of disulfide bridges in the gluten proteins
as shown at the far right in the figure.
Source: Redrawn from [8].
11.2.3 Stability of Ascorbic Acid

The effectiveness of ascorbic acid as a food additive depends on its oxidation to
dehydroascorbic acid. Dehydroascorbic acid still has vitamin C activity and is
the active agent in the dough improving function of ascorbic acid.
Dehydroascorbic acid is a lactone but, unlike ascorbic acid, is readily hydrolyzed
(Figure 11.4).
Diketogulonic acid has no vitamin activity and no antioxidant activity. Thus,
oxidation of ascorbic acid effectively destroys ascorbic acid. Since it is so readily
oxidized, we might expect ascorbic acid to be an unstable vitamin. It is in fact
quite unstable and is frequently called the most unstable vitamin.
Ascorbic acid may degrade via a number of different mechanisms. Anaerobic as
well as aerobic pathways have been identified but when oxygen is present,
oxidative degradation predominates. Factors, which may influence the rate of
ascorbic acid degradation, include temperature, salt and sugar concentration,
pH, oxygen concentration, metal catalysts (mainly iron and copper ions), and
enzymes.
11.2.4 Rationale for the Experiment

In this experiment, we will use a model system (an aqueous solution of ascorbic
acid) to study the stability of ascorbic acid under different conditions.
Chemical degradation of ascorbic acid is only one route of loss from foods.
Ascorbic acid is very soluble in water (0.3 g ml−1) and, as a result, leaching
losses may be substantial. We will study the loss of ascorbic acid in cooked
cabbage.
There are several assays available for the determination of ascorbic acid. Many
of them are based on the strong reducing capacity of the vitamin. In this
experiment, ascorbic acid will be determined by titrating with 2,6‐
dichloroindophenol (DIP) [9]. The reaction of DIP with L‐ascorbic acid is shown
in Figure 11.8.
132
www.ajpdf.com
Figure 11.8 Reaction describing the redox titration of ascorbic acid with 2,6‐
dichloroindophenol.
When titrating an acid solution of ascorbic acid against blue DIP, the blue
reagent will turn colorless when it is reduced by the ascorbic acid. When all the
ascorbic acid has been oxidized, excess DIP will turn the solution pink, thereby
showing the endpoint.

1. Test tubes
2. Burettes
3. Beakers, 250 ml
4. Erlenmeyer flasks, 50 ml
6. Pipettes, 1, 5, and 10 ml
7. Stirring plate
9. pH meter
10. pH paper
11. Whatman No. 1 filter paper
12. Funnel
13. Sand
14. Mortar and pestle

1. Ascorbic acid solution, 0.5 mg ml−1
133
www.ajpdf.com
2. Ascorbic acid solution, 10.0 mg ml−1

3. Oxalic acid solution, 0.25 M
4. 2,6‐dichloroindophenol (DIP): 250 mg 2,6‐dichloroindophenol (Na salt)
plus 210 mg NaHCO3 per liter. Note: Dissolve the NaHCO3 first, then add the
dye. Vigorous shaking may be required to dissolve the dye. Store in amber
bottle.
5. Cupric sulfate solution, 0.1 M (prepare using CuSO4 .5H2O and distilled
water)
6. Glycine buffer, 0.1 M, pH 2
7. Phosphate buffer, 0.1 M, pH 8
8. HCl, 1.0 N
9. Fresh green cabbage
11.5 Procedures
11.5.1 Ascorbic Acid Standard Curve
1. Transfer approximately 9 ml of oxalic acid solution and 1 ml of 1.0 N HCl to

each of four 50 ml Erlenmeyer flasks. Add 0.5, 1.0, 1.5, and 2.0 ml of
ascorbic acid solution (0.5 mg ml−1) to each flask, respectively
2. Titrate each flask rapidly with dye solution until a light but distinct rose‐
pink color persists for at least five seconds.
3. Plot volume of dye versus mg ascorbic acid. The plot should be linear. If not,
repeat Steps 1 and 2. Note: Make plot before proceeding to Section 11.5.2.
11.5.2 Effect of pH on Ascorbic Acid Stability
1. Prepare in advance two ascorbic acid solutions, A and B:

Solution A: 1.0 mg ml−1 ascorbic acid in 0.1 M glycine buffer, pH 2
Solution B: 1.0 mg ml−1 ascorbic acid in 0.1 M phosphate buffer, pH 8
Stir the solutions gently on a magnetic stir plate for 24 hours at room
temperature. (Note: this step will be done by the teaching assistants.)
2. Using the procedure described in Section 11.5.1, determine the ascorbic
acid concentration of Solutions A and B. The amount of ascorbic acid
actually titrated should fall within the range of ascorbic acid used to
construct the standard curve. Since the concentrations of ascorbic acid in
Solutions A and B are unknown, you may need to do more than one
titration before determining an appropriate amount to add. Try 1.0 ml of A
and 4.0 ml of B to start.
11.5.3 Effects of Temperature, pH, and Cu2+ on the Stability of

Ascorbic Acid
1. Prepare* 10 ml (in duplicate, in test tubes) of each of the following

solutions:
134
www.ajpdf.com
a. Ascorbic acid in glycine buffer (pH 2)

b. Ascorbic acid in phosphate buffer (pH 8)
c. Ascorbic acid in glycine buffer (pH 2) + CuSO4
d. Ascorbic acid in phosphate buffer (pH 8) + CuSO4
*To prepare the above solutions, add 1 ml ascorbic acid (10 mg ml−1), 0.5
ml of 0.1 M CuSO4 (where indicated) and sufficient buffer (pH 2 or pH 8) to
bring the total volume to 10 ml. Mix well.
2. Measure and record the pH (use pH paper or pH meter) of each of your
solutions. Cover or cap to reduce evaporation. Transfer tubes to a 95 °C
water bath. Heat for 15 minutes, carefully remove tubes from the bath, and
cool.
3. Using the procedure described in Section 11.5.1, determine (in duplicate)
the ascorbic acid concentration in a 1 ml aliquot of solutions a–d.
11.5.4 Effect of Cooking on the Ascorbic Acid Content of

Cabbage
1. Bring 100 ml distilled water to boiling in a 250 ml beaker. Add 5 g fresh
cabbage and boil gently for 15 minutes. Remove the cabbage and place it on
a paper towel to cool and drain. Measure volume of cooking water
remaining in the beaker.
2. Transfer 5 g of fresh cabbage to a mortar. Add 10 ml of the oxalic acid
solution. Add a pinch of sand. Macerate thoroughly (about three minutes).
Add an additional 10 ml of the oxalic acid solution and again macerate. This
is the extract. What is the total volume of your extract? (Assume that fresh
and cooked cabbage are 92% water.)
3. Filter the macerated mixture through Whatman #1 filter paper. Collect the
filtrate in a test tube.
4. Transfer 5 ml of the filtrate to a 50 ml Erlenmeyer flask. Add 9 ml oxalic
acid solution plus 1 ml 1.0 N HCl. Titrate (in duplicate) to determine the
ascorbic acid concentration.
5. Repeat Steps 2, 3, and 4 with the cooked cabbage. (Blot cooked cabbage
with a paper towel, weigh, then macerate.)
6. Transfer 5 ml of the cooking water to a 50 ml Erlenmeyer flask. Add 9 ml of
the oxalic acid solution plus 1 ml of 1.0 N HCl. Titrate (in duplicate) to
determine the ascorbic acid concentration. Calculate the total amount of
ascorbic acid in the cooking water.
11.6 Problem Set

1. Ascorbic acid standards were titrated according to the protocol described
above. Given the following data (Table 11.3), plot the standard curve. Label
the y‐axis dichloroindophenol (DIP) (ml) and the x‐axis ascorbic acid (mg).
135
www.ajpdf.com
Table 11.3 Data for ascorbic acid (AA) standard curve.

Vol. AA (0.5 mg ml−1) titrated Wt. AA titrated Vol DIP at endpoint
(ml) (mg) (ml)
0.5 0.25 1.9
1.0 0.5 4.1
1.5 0.75 5.8
2.0 1.0 8.2
2. Samples of cooked and raw cabbage were analyzed for ascorbic acid
content according to the protocol described above. Data are shown in Table
11.4. Using the standard curve you constructed in Problem 1, calculate the
concentration of ascorbic acid in the raw cabbage. Express your answer as
mg AA/100 g cabbage. Hint: First determine the weight of ascorbic acid
present in the 5.0 ml of filtrate that was titrated. Then calculate the total
volume of the extract (the sum of the volumes of oxalic acid solution added
to the cabbage plus the volume of water in the cabbage). Finally, calculate
the weight of ascorbic acid in the cabbage you extracted and then, using
proportions, calculate the weight of ascorbic acid in 100 g of cabbage. Also
calculate the amount of ascorbic acid that leached into the cooking water
and the percentage of ascorbic acid in the raw cabbage that was in the
cooked cabbage and the cooking water. Note that the weight of the cooked
cabbage is less than 5 g. This is likely due to leaching of soluble components
into the cooking water.
Table 11.4 Data from ascorbic acid titration experiment.
Sample Wt or Extract Aliquot DIP at AA in AA in AA in AA as
vol of vol titrated endpoint aliquot total cab. % of
Sample (ml) (ml) (mg) sample (mg/100 AA in
(mg) g) raw
Raw 5.0 g 5.0 5.5 100%
cab.
Cooked 4.5 g 5.0 2.0
cab.
Cook 50 ml 10.0 1.5
water

1. Based on your data, what was the route of greatest loss in the cooked
cabbage, leaching or chemical degradation? Did you expect these results?
Why or why not?
2. Is dehydroascorbic acid detected by this method? Why or why not? What
effect might this have on the results that you obtained?
3. How do your values for ascorbic acid content of raw and cooked cabbage
compare to handbook values? Give a possible reason for any discrepancies.
11.8 References
136
www.ajpdf.com
1 Otten, J.J., Hellwig, J.P., and Meyers, L.D. (eds.) (2006). DRI, Dietary Reference
Intakes: The Essential Guide to Nutrient Requirements . Washington, DC:
National Academies Press. 543 p.
2 Lykkesfeldt, J., Michels, A.J., and Frei, B. (2014). Vitamin C. Advances in
Nutrition 5 (1): 16–18.
3 Newsome, R.L. (1987). Use of vitamins as additives in processed foods. Food
Technology 41 (9): 163–168.
4 Gregory, J.F. III (2017). Vitamins. In: Fennema’s Food Chemistry , 5e (eds. S.
Damodaran and K.L. Parkin ), 543–626. Boca Raton: CRC Press, Taylor &
Francis Group.
5 Borenstein, B. (1987). The role of ascorbic acid in foods. Food Technology 41
(11): 98–99.
6 Chauhan, A.S., Ramteke, R.S., and Eipeson, W.E. (1998). Properties of ascorbic
acid and its applications in food processing: a critical appraisal. Journal of
Food Science and Technology 35 (5): 381–392.
7 Njus, D. and Kelley, P.M. (1991). Vitamins C and E donate single hydrogen
atoms in vivo. FEBS Letters 284 (2): 147–151.
8 Belitz, H.‐D., Grosch, W., and Schieberle, P. (2009). Food Chemistry , 4e. Berlin:
Springer. 1070 p.
9 AOAC Official Method 967.21 (1968). Ascorbic Acid in Vitamin Preparations
and Juices: 2,6‐dichloroindophenol Titrimetric Method . AOAC International.

1. Equation for standard curve: y = 8.24x − 0.15; R 2 = 0.996.
2. Concentration of ascorbic acid in raw cabbage = 67.4 mg AA/100 g cabbage;
Concentration of ascorbic acid in cooked cabbage = 28 mg AA/100 g
cabbage;
Amount of ascorbic acid in cooking water = 1 mg AA;
Total ascorbic acid in cooked cabbage + cooking water = 2.26 mg AA;
Amount of ascorbic acid that was destroyed (oxidized) = 3.37 mg − 2.26 mg
= 1.11 mg or 33%.
137
www.ajpdf.com
12
Hydrolytic Rancidity in Milk

1. Draw structures of triacylglycerols.

2. Define hydrolytic rancidity and distinguish it from
oxidative rancidity.
3. Explain the chemistry involved in the development of
hydrolytic rancidity in milk.
4. Describe the copper soap method for measuring the
concentration of free fatty acids in milk.
5. Measure the extent of hydrolytic rancidity in milk
samples that have been subjected to various forms of
abuse.
12.2 Introduction
Hydrolytic rancidity in milk develops when lipases attack
triacylglycerols in fat globules to produce free fatty acids
(Figure 12.1) [1]. In freshly drawn milk, triacylglycerols are
protected from lipases by the milk fat globule membrane.
Conditions or processes that damage this membrane
expose the triacylglycerols and may lead to lipolysis
catalyzed by lipases naturally present in milk.
Pasteurization inactivates these lipases, but bacteria
growing in pasteurized milk may produce other active
lipases. This explains why pasteurized milk stored in the
refrigerator too long may become rancid. Temperature
fluctuations in stored milk; agitation of raw milk at the
farm, during transportation or in the processing plant; and
contamination of pasteurized, homogenized milk with raw
milk may lead to excessive lipolysis.
138
www.ajpdf.com
Figure 12.1 The lipase‐catalyzed hydrolysis of a

triacylglycerol (1‐stearoyl‐2‐palmitoleoyl‐3‐butyroyl‐
glycerol) to yield free fatty acids plus glycerol.
Milk fat has a unique fatty acid composition with
significant amounts of short chain fatty acids (Table 12.1).
It is these short‐chain fatty acids that cause milk to become
rancid upon hydrolysis. Unlike long‐chain fatty acids like
stearic and linoleic acids, short‐chain fatty acids like
butyric acid are volatile and therefore have a sensory
impact when free in solution [3].
139
www.ajpdf.com
Table 12.1 Fatty acid composition of bovine milk fat [2].

Fatty acid (FA) Weight % of FA in milk fat
Butyric C4:0 4.8
Caproic C6:0 2.1
Caprylic C8:0 1.2
Capric C10:0 2.5
Lauric C12:0 3.2
Myristic C14:0 10.5
Myristoleic C14:1 1.1
Palmitic C16:0 29.9
Palmitelaidic C16:1 (trans) 0.3
Palmitoleic C16:1 2.0
Stearic C18:0 11.4
Elaidic C18:1 (trans) 1.4
Oleic C18:1 23.2
Linoleic C18:2 2.9
Linolenic C18:3 0.4
Total 96.9a
a The total weight % shown is not 100% because there are many other fatty
acids (about 400) present in milk fat at very low concentrations.
This laboratory exercise is designed to study the effects of

these factors on rancidity development in raw and
processed milk. The degree of rancidity development will
be measured using a method developed by Shipe et al. [4].
The method measures free fatty acid concentration by
extracting copper soaps of the free fatty acids into
chloroform‐heptane‐methanol with subsequent
spectrophotometric measurement of the copper
concentration in the extract.
12.2.1 The Copper Soap Solvent Extraction

Method
140
www.ajpdf.com
A very sensitive assay is required since low concentrations

of free fatty acids in milk have a marked impact on milk
flavor. Moreover, milk is a very complex mixture so the
assay must be quite specific for free fatty acids or other
components may interfere. The assay we will use in this
laboratory exercise is capable of detecting free fatty acids
in milk at concentrations as low as 10 mg l−1.
The Shipe assay doesn’t measure individual fatty acids but
rather provides an index of the extent of hydrolysis that
has occurred by measuring free fatty acids (fatty acids not
esterified to glycerol). Since it is difficult to measure free
fatty acids directly, this assay takes advantage of the
capacity of free fatty acids to form insoluble soaps with
copper ions. These soaps along with their associated
copper are extracted into a nonpolar solvent and the
concentration of copper is determined. By using a standard
curve, we can estimate the amount of free fatty acids
present in the milk samples. The chemistry involved in the
assay is summarized below.
In the first step, copper soaps of free fatty acids are formed
by mixing Cu2+ with the milk (Figure 12.2). Copper is
added as a complex with triethanolamine. The
triethanolamine prevents the copper from precipitating in
the milk.
141
www.ajpdf.com
Figure 12.2 The formation of a copper soap in an aqueous

system when Cu2+ is added to the solution. Note that there
is a stoichiometric relationship between the Cu2+ and the
fatty acid in the sample.
The next step is to extract the copper soap with an organic
solvent. Copper soaps are insoluble in water but soluble in
nonpolar organic solvents. Shipe and his group determined
through careful experimentation that a mixture of
chloroform:heptane:methanol (CHM) in a ratio of 49:49:2
works best.
The final step is to measure the concentration of the
copper (Cu2+) in the CHM extract. Notice in Figure 12.2
that the relationship between the free fatty acids and the
copper in the copper soap is stoichiometric (1 copper ion
combines with 2 fatty acid molecules). Thus, if we know
the concentration of copper in the extract, we also know
the relative concentration of free fatty acids present. In
order to make the determination of copper more sensitive,
a color reagent is added, which combines with the copper
to produce a yellow color that absorbs at 440 nm. The
color reagent we will use is diethyldithiocarbamate (Figure
12.3).
142
www.ajpdf.com
Figure 12.3 Cu2+ combines with diethyldithiocarbamate to

form a complex that absorbs at 440 nm.
A standard curve is used to convert absorbances to free
fatty acid concentrations.

1. Blender
2. Flatbed reciprocating shaker
3. Visible spectrophotometer
4. Centrifuge
5. Vortex Mixer
6. Pipettes: 0.1, 0.5, 2, and 5 ml
7. Glass cuvettes (do not use disposable cuvettes, they
dissolve in CHM).
8. Bottle top dispenser for dispensing CHM
9. Solvent‐resistant screw‐top centrifuge tubes (must be
compatible with CHM).

1. 0.7 N HCl
2. Copper reagent: 5 ml triethanolamine + 10 ml 1.0 M
Cu(NO3)2.3H2O + saturated NaCl to 100 ml. The final
pH should be adjusted to 8.3 with 1 N NaOH. Store in
brown bottle.
3. Chloroform:heptane:methanol (CHM) 49:49:2;
vol:vol:vol (be careful to mix thoroughly after
143
www.ajpdf.com
combining the chloroform, heptane, and methanol).

4. Color reagent: 0.5% sodium diethyldithiocarbamate in
n‐butanol. (Sonicate to dissolve. Protect from light.)
5. Free fatty acid (FFA) standards: 0.4, 0.8, 1.2, and 1.6
mEq FFA l−1 CHM. (Note: FFA standards are a mixture
of palmitic and myristic acids in a 3:2 molar ratio.
Molecular weights are palmitic, 256.4; myristic, 228.4;
recall that a milliequivalent of a fatty acid is equal to a
millimole of the fatty acid since fatty acids are
monoprotic, i.e. there is only one carboxyl group per
molecule.)
6. Full‐fat raw milk
7. Full‐fat pasteurized‐homogenized milk
12.5 Treatments and Controls

Treatment 1. Pasteurized–homogenized milk contaminated
with raw milk. Pasteurized–homogenized milk spiked with
raw milk (96 ml pasteurized–homogenized milk + 4 ml raw
milk) and stored at 5 °C for 30 hours.
Treatment 2. Raw milk exposed to agitation. Raw milk
(100 ml) blended in a food blender for 30 seconds and
stored at 5 °C for 30 hours.
Treatment 3. Pasteurized–homogenized whole milk
exposed to agitation. Pasteurized–homogenized whole
milk (100 ml) blended in a food blender for 30 seconds and
stored at 5 °C for 30 hours.
Control 1. Pasteurized–homogenized milk (100 ml) stored
at 5 °C for 30 hours.
Control 2. Raw milk (100 ml) stored at 5 °C for 30 hours.
12.6 Procedures
144
www.ajpdf.com
Prepare using standards containing palmitic and myristic

acids mixed in a 3:2 molar ratio. Run duplicate samples of
each standard.
1. Obtain 2 ml of each of the four standards (0.4, 0.8, 1.2,

and 1.6 mEq FFA l−1 CHM).
2. Pipette 0.5 ml of distilled water into a 16 × 125 mm
screw top centrifuge tube.
3. Pipette 0.1 ml of 0.7 N HCl into the tube. Mix on vortex
mixer.
4. Pipette 2 ml of copper reagent into the tube and mix
briefly using a vortex mixer.
5. Pipette 0.5 ml of standard into the tube.
6. Add 5.5 ml of CHM solvent and screw on the cap
(Teflon lined); tighten securely.
7. Place tubes horizontally in shaker and shake on slow
setting for 30 minutes. Be sure to place the tubes
parallel to the motion of the shaker to ensure
maximum mixing of the two phases.
8. Remove tubes from shaker and centrifuge for 10
minutes at 6000 rcf.
9. Transfer about 3.5 ml of the solvent layer (the top
layer) to a clean, dry test tube (or directly into a
cuvette). Be extremely careful to avoid getting any of
the bottom layer into the transfer pipette. Even a small
amount of the bottom layer will contain significant
amounts of copper, and this will result in high
readings.
10. Pipette 0.1 ml of color reagent into 3.5 ml from Step 9.
11. Mix and read on a spectrophotometer at 440 nm
against a reagent blank (CHM solvent + color reagent).
Use dry glass cuvettes (do not rinse with water).
12.6.2 Free Fatty Acids in Milk
145
www.ajpdf.com
1. Obtain 2 ml of each treatment and control. Do all

determinations in duplicate.
2. Pipette 0.5 ml of milk sample into a 16 × 125 mm
screw top centrifuge tube.
3. Pipette 0.1 ml of 0.7 N HCl into the test tube. Mix on
vortex mixer.
4. Pipette 2 ml of copper reagent into same test tube and
mix briefly using a Vortex mixer.
5. Add 6 ml of CHM solvent and screw on the cap (Teflon
lined); tighten securely.
6. Place tubes horizontally in the shaker and shake on
slow setting for 30 minutes.
7. Remove tubes from shaker and centrifuge for 10
minutes. After centrifuging, gently transfer the tubes
to a test tube rack. Be careful to avoid mixing the two
layers in the tubes when making this transfer.
8. Transfer about 3.5 ml of the solvent layer (the top
layer) to a clean, dry test tube (or directly into a
cuvette). Be extremely careful to avoid getting any of
the bottom layer into the transfer pipette. Even a small
amount of the bottom layer will contain significant
amounts of copper, and this will result in high
readings.
9. Pipette 0.1 ml of color reagent into 3.5 ml from Step 8.
10. Mix and read on a spectrophotometer at 440 nm
against a reagent blank (CHM solvent + color reagent).
Use dry glass cuvettes (do not rinse with water).
12.6.3 Calculations
Prepare a standard curve by plotting absorbance versus
concentration of FFA in the standards. Express FFA
concentration as mEq l−1.
12.7 Problem Set
146
www.ajpdf.com
1. Given the following data, construct a standard curve

and write the equation for the linear relationship
between concentration and absorbance. Include the R
2 value for the relationship.
Free fatty acids (mEq l−1) Absorbance (440 nm)

0 0
0.4 0.21
0.8 0.35
1.2 0.65
1.6 0.88
2. A milk sample was carried through the copper soap
procedure as described above. The absorbance
reading was 0.55. Using the data for the standard
curve above, what was the concentration of free fatty
acids in the milk, expressed as mEq l−1?

1. What are the implications of your data for possible
problems in the fluid milk industry?
2. Suggest approaches that would be effective in
reducing the dairy industry’s problem with rancid
milk.
3. Suggest mechanisms and/or explanations for the
effects of the various treatments on rancidity
development.
4. Why is pasteurized milk less susceptible to rancidity
development?
12.9 References
1 Santos, M.V., Ma, Y., Caplan, Z., and Barbano, D.M. (2003).
Sensory threshold of off‐flavors caused by proteolysis
and lipolysis in milk. Journal of Dairy Science 86 (5):
1601–1607.
147
www.ajpdf.com
2 Yeung, C.K. (2020). Fatty acid composition of milkfat

from dairy cows. Unpublished data.
3 Alvarez, V. (2009). Fluid milk and cream products. In: The
Sensory Evaluation of Dairy Products , 2e (eds. S. Clark,
M. Costello, M. Drake and F.W. Bodyfelt ), 73–133. New
York, NY: Springer.
4 Shipe, W.F., Senyk, G.F., and Fountain, K.B. (1980).
Modified copper soap solvent extraction method for
measuring free fatty acids in milk. Journal of Dairy
Science 63 (2): 193–198.

Anderson, M. (1983). Milk lipase and off‐flavour
development. International Journal of Dairy Technology
36 (1): 3–7.
Elías‐Argote, X., Laubscher, A., and Jiménez‐Flores, R.
(2013). Dairy ingredients containing milk fat globule
membrane: description, composition, and industrial
potential. In: Advances in Dairy Ingredients (eds. G.W.
Smithers and M.A. Augustin ), 71–98. Ames, Iowa: Wiley
: Institute of Food Technologists. (IFT Press series).
Horn, D.S. (2017). Characteristics of milk. In: Fennema’s
Food Chemistry , 5e (eds. S. Damodaran and K.L. Parkin
), 907–953. Boca Raton: CRC Press, Taylor & Francis
Group.

1. Equation for standard curve: y = 0.55x−0.022; R 2 =
0.99.
2. Concentration of free fatty acids in the milk sample =
1.04 mEq l−1.
148
www.ajpdf.com
13
Caffeine in Beverages

1. Measure the concentration of caffeine in selected

beverages using a high‐performance liquid
chromatograph.
2. Explain the basic principles underlying liquid
chromatographic methods.
13.2 Introduction
A large majority of American adults ingest caffeine on a
daily basis. Most of us get our caffeine from coffee, tea,
soda, and/or energy drinks. Caffeine is a central nervous
system stimulant. It belongs to a class of compounds called
methylxanthines, which are present naturally in over 60
species of plants, including coffee beans, tea leaves, cola
nuts, and cocoa beans. In addition to being present in
varying levels in the products made from these raw
materials, caffeine is added as a flavoring agent in other
foods and beverages, especially soft drinks and energy
drinks. The structure of caffeine is shown in Figure 13.1.
149
www.ajpdf.com
Figure 13.1 Caffeine is an alkaloid belonging to the class of

methylxanthines. It has a slightly bitter taste.
Caffeine produces a range of physiological effects on the
body. It may help keep you awake and enhance
concentration, which is why many people, especially
college students, feel they need their “caffeine fix” every
morning. In addition to being a stimulant, it is a diuretic
and may increase stomach acid secretion. It may increase
blood pressure but the evidence on this is conflicting.
Numerous studies have demonstrated that caffeine
enhances physical performance in a wide variety of athletic
events [1]. Moreover, consumption of caffeine‐containing
beverages, especially coffee, is associated with reduced risk
for some cancers, cardiovascular disease, type 2 diabetes,
all‐cause mortality, and possibly dementia [2]. Intervention
150
www.ajpdf.com
studies on caffeine and physical performance often use

purified caffeine, so the link between caffeine and physical
performance is pretty clear. The health benefits of caffeine‐
containing beverages such as coffee and tea, however, may
be due to polyphenols and other phytochemicals, not
caffeine.
Too much caffeine may cause insomnia, restlessness,
anxiety, diarrhea, headache, and heart palpitations.
Caffeine affects people differently, so the amount
associated with adverse effects will vary depending on a
variety of factors including body weight, age, pregnancy,
breast‐feeding, medications, and sensitivity to caffeine.
Health experts generally recommend limiting caffeine
intake to less than 400 mg a day, which is approximately
the amount in four cups of brewed coffee. The American
Academy of Pediatrics discourages consumption of
caffeine‐containing beverages for children under 12 and
recommends that energy drinks containing caffeine and
other stimulants “have no place in the diet of children and
adolescents” [3]. The concentration of caffeine in energy
drinks and energy shots varies widely, so it is advisable to
check the label before consuming these products.
Because of perceived and real effects of caffeine on health
and athletic performance, there has been a proliferation of
energy drinks that contain high concentrations of caffeine.
The consumption of these caffeinated energy drinks has
been trending upward in adolescents and young adults [4].
Therefore, the concentration of caffeine in common
beverages is an important variable for researchers and
consumers alike. Two of these beverages, coffee and tea,
are complex mixtures of many compounds that dissolve
during the brewing or steeping process. Consequently,
quantitation of a single compound in the mixture requires
a separation step for accurate results. High‐performance
liquid chromatography (HPLC) has become the method of
choice for the analysis of caffeine in beverages. See
Appendix V for a discussion of HPLC theory.
151
www.ajpdf.com
The caffeine contents of several common beverages are

listed in Table 13.1.
Table 13.1 Caffeine content in a typical serving of some
common beverages [5, 6]
Beverage Serving size Caffeine content
(oz) (mg)
Cola 12 30–40
Cola, decaffeinated 12 0
Citrus soft drinks (most 12 0
brands)
Mountain Dew 20 91
Energy drinks 16 90–300
Coffee 8 80–100
Expresso 1 64
Tea, black 8 47
Tea, green 8 28

1. HPLC unit equipped with a variable wavelength UV
detector set at 254 nm
2. Reverse‐phase C18 column
3. Guard column
4. Luer‐lok syringe
5. Luer‐lok filters, 0.45 μm (x10)
6. Vacuum aspirator
7. Sidearm flasks with rubber stoppers, 500 ml (x3)
8. Beakers, 250 ml (x2)
9. Sample vials, 8 ml (2/sample)
10. Sample vials, 4 ml (1/sample)
11. Micropipettes and tips
152
www.ajpdf.com
12. Sample injection syringe, 100 μl

13. Glass stirring rods (x2)
14. Hot plate
15. Flask, 500 ml
16. Gloves or tongs
17. Analytical balance, spatula, and weighing paper
18. Solvent filtering apparatus

1. Caffeine standard solutions: 25–250 ppm, to be
prepared by the teaching staff. KEEP REFRIGERATED
UNTIL READY TO USE!!
2. HPLC mobile phase:
i. HPLC grade methanol, 350 ml
ii. HPLC grade water, 650 ml
iii. Acetic acid, 4 ml
Combine, then filter through a 0.45 um Nylon‐66
filter, and de‐gas for five minutes.
3. Syringe rinse (HPLC grade methanol), in 8 ml sample
vial.
4. Samples for analysis:
i. Diet cola, caffeinated
ii. Diet cola, decaffeinated
iii. Energy drink, caffeinated
iv. Coffee, brewed or instant
v. Coffee, brewed or instant, decaffeinated
vi. Black tea, brewed
vii. Green tea, brewed
153
www.ajpdf.com
13.5 Operation of the HPLC

(Note: the operation parameters will vary depending on
the make and model of the HPLC unit. Carefully follow the
instructions for operation in the manual supplied by the
manufacturer.)
1. Start‐Up
a. Turn on the HPLC unit.
b. Allow to warm up for 30 minutes.
2. Sample Preparation
a. Place a 0.45 μm filter on the Luer‐lok syringe.
Remove the plunger.
b. Pour approximately 3 ml of the sample to be
tested from a sample vial into the syringe, and
replace the plunger.
c. Carefully filter the sample into a small sample
vial.
d. Remove the filter and rinse the syringe with HPLC
grade water. (Install a new filter for each
filtration.)
3. Injection and Run
a. Zero the integrator.
b. Rinse the sample injection syringe five times with
the sample, emptying the syringe into the waste
bucket after each rinse.
c. Rinse the syringe five more times with the sample
by slowly pumping the sample in and out of the
syringe.
d. Carefully fill the syringe to its set volume (70 μl),
making sure no air bubbles are trapped in the
barrel.
e. Adjust the syringe volume to 60 μl, blotting the
tip with a Kim‐wipe.
154
www.ajpdf.com
f. Rotate the injector to the “LOAD” position.

g. Insert the syringe into the injector.
h. Press the plunger quickly and carefully, then turn
the injector to “INJECT” while pressing the
“START” button on the integrator.
i. Remove the syringe from the injector.
j. Rinse the syringe five times with HPLC grade
methanol.
k. After the last peak has eluted from the column,
press the “STOP” button on the integrator.
l. Rinse the injector between samples by injecting,
in the load position, three syringe loads of HPLC
grade methanol.
4. Interpretation of Results
a. The integrator will provide a chromatogram and
a listing of the retention times and areas of the
peaks.
b. Find the caffeine peaks by comparing the
retention times of the samples with those of the
standards.
c. Using the standard curve, compute the
concentration of caffeine in the sample. Express
the results as mg caffeine/6 oz. (180 ml) serving.
5. Shutdown
a. Reduce the flow rate to 0.06 ml min−1.
b. Flush the injector three times with 100% HPLC
grade methanol while it is in the “LOAD” position.
13.6 Procedures
1. A standard curve will be prepared using the caffeine

standards. Plot average peak area vs. caffeine
155
www.ajpdf.com
concentration in mg ml−1. Remember that 1 ppm = 1

mg l−1. The actual standards will be run by the
individual student groups.
13.6.2 Caffeine in Soda and Energy Drinks

1. Place approximately 200 ml of the soda to be tested in
a 500 ml sidearm flask and stopper it.
2. Attach the flask to the vacuum pump and aspirate for
5–10 minutes, or until no more bubbles are present,
while swirling the flask. Remove the hose before
turning off the pump.
3. With a 10 ml pipette, transfer 5 ml de‐gassed soda into
an 8 ml sample vial.
4. Prepare and inject samples as described in Section
13.5. Each sample should be run two times to
minimize error.
13.6.3 Caffeine in Coffee
1. Boil approximately 250 ml dH2O in the 500 ml flask.

2. Place 2.15 g (approximately one rounded teaspoon)
instant coffee in a clean 250 ml beaker.
3. Add 180 ml (6 ounces) boiling water to the beaker.
Mix with a glass stirring rod until dissolved.
4. With a 10 ml pipette, transfer 5 ml coffee into an 8 ml
sample vial. Coffee containing caffeine should be
diluted 1:3 with dH2O (1 part coffee to 2 parts dH2O),
in another 8 ml sample vial. Decaffeinated coffee
should not be diluted.
5. Prepare and inject samples as described in Section
13.5. Each sample should be run two times to
minimize error.
13.6.4 Caffeine in Tea

1. Prepare as with coffee.
156
www.ajpdf.com
13.7 Data Analysis

1. Plot a standard curve using the chromatograms
prepared in class. Plot average peak area vs. caffeine
concentration in mg ml−1.
2. Calculate mg caffeine/6 oz. serving for each beverage
using standard curve results. Remember that the
coffee has been diluted.
3. Assuming that the decaffeinated coffee was originally
identical to the coffee with caffeine, calculate the
percent decaffeination.
13.8 References
1 Pickering, C. and Grgic, J. (2019). Caffeine and exercise:
what next? Sports Medicine 49 (7): 1007–1030.
2 Grosso, G., Godos, J., Galvano, F., and Giovannucci, E.L.
(2017). Coffee, caffeine, and health outcomes: an
umbrella review. Annual Review of Nutrition 37 (1):
131–156.
3 Heckman, M.A., Weil, J., and Mejia, E.G.D. (2010). Caffeine
(1, 3, 7‐trimethylxanthine) in foods: a comprehensive
review on consumption, functionality, safety, and
regulatory matters. Journal of Food Science 75 (3): R77–
R87.
4 Vercammen, K.A., Koma, J.W., and Bleich, S.N. (2019).
Trends in energy drink consumption among U.S.
Adolescents and adults, 2003–2016. American Journal of
Preventive Medicine 56 (6): 827–833.
5 FDA (2019). Spilling the beans: how much caffeine is too
much? [cited 30 April 2020].
https://www.fda.gov/consumers/consumer‐
updates/spilling‐beans‐how‐much‐caffeine‐too‐much
6 Mayo Clinic. How much caffeine is in your cup?
[Internet]. [cited 30 April 2020].
157
www.ajpdf.com
https://www.mayoclinic.org/healthy‐
lifestyle/nutrition‐and‐healthy‐eating/in‐
depth/caffeine/art‐20049372

DiNunzio, J.E. (1985). Determination of caffeine in
beverages by high performance liquid chromatography.
Journal of Chemical Education 62 (5): 446.
Nielsen, S.S. and Talcott, S.T. (2017). High‐performance
liquid chromatography. In: Food Analysis Laboratory
Manual , 3e (ed. S.S. Nielsen ), 77–85. Cham: Springer.
Strohl, A.N. (1985). A study of colas: an HPLC experiment.
158
www.ajpdf.com
14
Color Additives

1. Extract, concentrate, and identify color additives in a

food product.
2. Describe the chemical principles that underlie the
processes in Outcome 1.
3. Use solid‐phase extraction (SPE) to separate red dye
from other colorants in colored beverages and
quantify the amount present.
14.2 Introduction
Color is an important sensory aspect of most foods. We
often use color as an index of freshness, wholesomeness,
and overall quality. Unfortunately, the color of a food may
change during processing, storage, or preparation in ways
that are often perceived as undesirable. Some foods (e.g.
cola drinks and gelatins) are colorless unless a colorant is
added, while other foods may be made more appealing by
enhancing or changing the natural color. Thus controlling,
changing, and/or stabilizing the color of foods is a major
objective for food scientists and technologists.
In the eighteenth and nineteenth centuries, food
manufacturers used many different chemicals to color
foods. Pickles were colored green with copper sulfate.
Candy was colored with salts of copper and lead. Today,
many artificial food colors are chemically synthesized from
organic compounds. These artificial colorants were first
synthesized from by‐products of coal production, hence
the term “coal tar dyes.” Modern synthetic food colorants
are made from purified petrochemicals, so the term “coal
159
www.ajpdf.com
tar dye” is no longer accurate, but the phrase persists in the

popular literature.
Food colorants have been controversial almost since they
were first introduced because they have the reputation of
being potentially toxic, because they may be used to
deceive the consumer, and because their primary function
is to enhance appearance rather than nutritive value, shelf
life, or safety. With the exceptions of riboflavin, beta‐
carotene, and apo‐carotenal, color additives have no
nutritional value.
Today, both natural and synthetic colorants are added to
foods. The natural pigments include annatto extract,
dehydrated beets, β‐carotene, paprika, and many others
[1]. The number of synthetic food colorants approved for
use has declined over the years as government safety
regulations and toxicity testing have advanced. Also, many
food manufacturers are moving away from synthetic
colorants in favor of “natural” colorants to achieve “clean
labels” on their products.
The FDA regulates food color additives under the authority
of the 1960 Color Additives Amendment to the Federal
Food, Drug, and Cosmetic Act of 1938 [2]. Food colorants
are classified by the FDA as either “certified” or “exempt
from batch certification.”
The certified colors are synthetic organic compounds.
Manufacturers must submit a sample from each production
batch to the FDA for certification. Currently, there are nine
certified color additives that may be added to foods (Table
14.1). Most of the certified colorants used in the United
States have been assigned an FD&C number as required by
the Food, Drug and Cosmetic Act. These numbers were
established to avoid confusion between colorants
manufactured for food use and colorants manufactured for
other purposes. The same colorant may be used in both
cases, but the food colorant must be free of toxic
contaminants. Orange B, which is approved for sausage
casings, is FDA certified but has not been used in several
160
www.ajpdf.com
years [3]. Citrus Red No. 2 is also certified, but its use is
restricted to the skins of oranges.
161
www.ajpdf.com
Table 14.1 FDA “certified” synthetic color food additives

[4].
FD&C Common Chemical Characteristics Uses and
number name class restrictions
FD&C Brilliant TPM Stable to heat, Foods
Blue No. blue unstable to light generally
1
FD&C Indigotine Indigoid Stable to light, Foods
Blue No. unstable in generally
2 water
FD&C Fast green TPM Teal green Foods
Green generally
No. 3
FD&C Erythrosine Xanthene Stable to heat, Foods
Red No. unstable to light generally
3
FD&C Allura red Azo Unstable to Foods
Red No. redox agents generally
40
FD&C Tartrazine Azo Good heat and Foods
Yellow light stability generally
No. 5
FD&C Sunset Azo Fair heat and Foods
Yellow yellow light stability generally
No. 6
Orange B Azo Use
restricted to
sausage
casings but
has not
been used in
recent years
162
www.ajpdf.com
FD&C Common Chemical Characteristics Uses and

number name class restrictions
Citrus Red Azo Use
No. 2 restricted to
skins of
oranges
grown in
Florida
Most of the 29 “exempt from batch certification” colors for

foods are extracted from natural sources, usually plants. A
few synthetic dyes that are “nature‐identical,” for example
synthetic β‐carotene, are also exempt (see Chapter 15).
Most of the FD&C colorants are sodium salts of sulfonic
acids. Structures of these colorants are shown in Figure
14.1.
163
www.ajpdf.com
Figure 14.1 Chemical structures of FDA certified FD&C

food colorants [5].
Food colorants are added to foods at low concentrations.
Consequently, it is often necessary to extract and
concentrate the colorants in order to obtain sufficient
amounts for analysis. In many cases, a procedure for
separating and concentrating substances in foods can be
developed from knowledge of the properties imparted by
various functional groups in the molecules of interest. Note
that the colorants shown in Figure 14.1 contain sulfonate
groups, i.e. they are salts of sulfonic acids. Sulfonic acids
are relatively strong acids. Thus, we expect FD&C colorants
will be ionized and carry negative charges at pH values
found in most foods. This ionic character makes them
164
www.ajpdf.com
water soluble and provides a means for separating them

from other components in the food.
In this experiment, extraction will be accomplished two
ways.
1. Binding the colorants to wool and later releasing them

into an aqueous solution. Principles underlying this
extraction are summarized below.
2. Solidphase extraction (SPE). SPE is similar to binding
to wool (both involve binding colorants to a solid
phase) but uses a more sophisticated solid phase.
14.2.1 Binding to Wool

We will take advantage of electrostatic interactions
between the colorant molecules and a protein to separate
and concentrate the colorants. Wool (a strand of wool
yarn) will be used as the protein. Wool protein is a suitable
binding agent for this purpose because it is insoluble and
because its charge can be manipulated by changing the pH.
At low pH, carboxyl and amino groups on the wool protein
will be protonated, giving the wool protein a net positive
charge. The colorant molecules, on the other hand, remain
negatively charged at low pH because they are salts of a
strong acid. Acetic acid, a weak acid, will be used to acidify
the food so that when the wool is added, it will be
protonated. Electrostatic bonding between positively
charged protein molecules and negatively charged colorant
molecules probably accounts for most of the bonding of the
colorant to the wool strand although some hydrogen
bonding and hydrophobic interactions may be involved as
well:
When the colorant molecules are bound to wool under

these conditions, rinsing in cold water does not remove the
165
www.ajpdf.com
color. This indicates a fairly strong interaction between the

colorant and the wool.
14.2.2 Removal from Wool

Gentle boiling of the wool fiber in dilute alkali
deprotonates the amino groups on the wool protein. This
disrupts electrostatic bonding forces, and the color is
released from the strand into solution.
14.2.3 Solid‐Phase Extraction (SPE)

SPE has largely replaced liquid/liquid extraction as a
method for extracting and concentrating solutes in liquid
solutions. In liquid/liquid extractions, a liquid that is
immiscible with the liquid containing the solute (the
sample) is shaken with sample. For example, one might use
hexane, a nonpolar hydrocarbon, to extract a colorant with
some nonpolar character from a fruit juice sample. The
juice and the hexane would be placed in a separatory
funnel. After shaking vigorously, the two immiscible layers
would be allowed to separate by gravity and the lower
aqueous layer would be drained through a valve in the
bottom of the separatory funnel leaving the hexane with
the dissolved colorant behind. This technique requires a
large volume of solvent and the separation is rarely
complete.
In SPE, a solid packing material (usually some form of
silica) to which polar, nonpolar, or ionic molecules are
covalently bound is placed in a column (or a syringe), and
the liquid sample is applied to the top of the packing. There
are three main types of packing: normal phase, reversed
phase, and ion exchange. In normal phase, the packing
material (stationary phase) is polar, and the liquid phase is
nonpolar. In reversed phase, the stationary phase is
nonpolar and the liquid phase is polar. In ion exchange, the
stationary phase contains charged groups and the liquid
phase is usually polar. The wool extraction described above
is an example of an ion exchange SPE. In this experiment,
we will be using reversed‐phase SPE to extract FD&C Red
166
www.ajpdf.com
No. 40 from cranberry juice. The packing material will be

silica to which an 18‐carbon hydrocarbon is covalently
linked, hence the name Bond Elut C‐18 (Figure 14.2).
Figure 14.2 Structure of a C‐18 bonded silica packing

material. Note that the silicon atoms on the surface of the
silica are covalently linked to 18‐carbon hydrocarbon
chains. This material is highly nonpolar and will attract
nonpolar solutes.
14.2.4 Separation and Identification

Separation and identification will be accomplished by thin
layer chromatography (TLC). TLC is a form of adsorption
chromatography. Separation is accomplished by the
differential adsorption of components in the sample on a
stationary phase. Samples and standards are applied at the
bottom of a plate coated with silica gel. The plate is then
placed vertically in a chamber containing a small amount
of solvent in the bottom, taking care that the solvent does
not reach up to the sample. As the solvent system moves up
the plate by capillary action and moves through the
sample, components of the sample, which are soluble in
the solvent, are carried upward with the solvent. Since
some components are adsorbed more strongly than others,
they begin to separate. More polar compounds adsorb
more strongly and remain nearer the origin. Less polar
167
www.ajpdf.com
compounds adsorb only weakly and thus spend more time

in the moving solvent, thus migrating faster. When the
solvent front reaches the top of the plate, the plate is
removed and examined. By comparing the colors and
migration distances of the samples and standards, it is
often possible to definitively identify components present
in the samples. The positions of compounds on a TLC plate
are often described by the Rf value:
where: dcompound = distance traveled by the compound
dsolvent = distance traveled by the solvent front
If identical solvents and stationary phases are used, the Rf

value for a particular compound in that system should
remain constant. Table 14.2 lists Rf values for colorants run
on different silica gel plates. Note that Rf values for the
same compound differ between the plates but that the
order (lowest to highest Rf value) are similar for the plates.
Do you have an explanation?
168
www.ajpdf.com
Table 14.2 Rf valuesa × 100 for synthetic food colors

chromatographed on TLC plates prepared by different
manufacturersb [6].
Colorant FD&C # Rf × 100c Rf × 100d
Allura red Red No. 40 No value 24–38
Tartrazine Yellow No. 5 36–39 17–20
Sunset yellow Yellow No. 6 47–48 32–36
Fast green FCF Green No. 3 29–32 15–16
Brilliant blue Blue No. 1 39–41 20–25
Indigotine Blue No. 2 37–40 26–27
a Measured to the leading edge of the spot.
b Isopropanol/concentrated ammonia (4:1) was the developing solvent.
c Baker‐flex silica gel plates.
d Machinery‐Nagel glass plates coated with silica gel.
Note: The FDA has published methods for quantitative

analysis of certified color additives in food products. In
these methods, the color additives are extracted using
methanol/aqueous ammonium hydroxide as the solvent.
The extracts are analyzed using reversed‐phase liquid
chromatography [7].

1. Beakers, 50, 100, and 200 ml
2. Graduate cylinders, 10 and 50 ml
3. Boiling beads
4. Pipettors with tips
5. Oven set at 95 °C
6. Hot plates
7. Pre‐coated silica gel plastic plates (plates should be
activated by heating for four hours at 50 °C prior to
169
www.ajpdf.com
use). Note: always check manufacturer’s instructions

before using pre‐coated plates.
8. Hair dryer
9. Developing tank
10. C‐18 column (Agilent Bond Elut JR‐C18, 500 mg
cartridge or similar)
11. UV/Vis spectrophotometer
12. Cuvettes
13. Syringes, 10 ml
14. Vials (pre‐weighed), 10 or 20 ml

1. Assorted colored gelatins and canned sodas
2. FD&C Colors for standards: Red No. 3 and 40, Blue No.
1 and 2, Green No. 3, and Yellow No. 5 and 6.
3. White knitting wool yarn (purified in advance by
boiling in 0.01 N NaOH and then boiling in water)
4. Acetic acid, 5 N
5. Ammonium hydroxide, 0.5 N
6. Isopropanol/concentrated ammonia (4:1, v/v)
7. Ethanol, 95%
8. FD&C Red No. 40 stock solutions (ranging 1–15 μg
ml−1) for SPE experiment
9. Commercial cranberry juice containing Red No. 40 or
cranberry juice spiked with Red No. 40
10. 2‐propanol (4 and 5% v/v in water)
11. Acidified methanol (MeOH) (add 1 ml concentrated
HCl to 99 ml methanol)
14.5 Procedures
170
www.ajpdf.com
14.5.1 Qualitative Identification of Artificial

Colors from Food Products
1. Obtain one gelatin sample and one soft drink sample.
2. Transfer a 50 ml aliquot of the soft drink to a 100 ml
beaker and acidify with 1 ml of 5 N acetic acid.
3. Transfer 2.5 g of gelatin to a 100 ml beaker. Dissolve in
50 ml of water and acidify with 1 ml of 5 N acetic acid.
4. Drop a 20 cm strip of white knitting wool (purified in
advance by the instructor) into each acidified sample.
Add boiling beads. Boil the mixtures gently for three to
five minutes. Cool to room temperature.
5. Wash the wool with cold water. Transfer it to a small
beaker. Add boiling beads and about 10 ml of 0.5 N
ammonia. Boil gently until the color is released into
solution.
6. After the color is released, discard the wool and put
the solution in a 95 °C oven until it reaches a state of
near dryness. Alternatively, the water can be
evaporated on a hot plate. (If you choose to use the hot
plate, USE CAUTION. Hot solution may spatter out of
the beaker.)
14.5.2 Separation and Identification of the

Extracted Colors
1. Spot 10–20 μl of each FD&C colorant and your extracts
on silica gel plates. Spots should be at least 2 cm from
the bottom of the plate and no more than 0.5 cm in
diameter. Dry the spots by gently heating with a hair
dryer. Each group will receive one plate, and each
student should spot their sample plus at least two
FD&C food colorants on a plate. That way, everyone
will gain experience in spotting thin layer plates. All
standards must be run on each plate. The food
colorant standards can be spotted directly (5 μl)
without dilution. Use a maximum of nine samples per
plate.
171
www.ajpdf.com
2. When all of the samples and standards have been

spotted on the plate, transfer it to a developing tank
containing the mobile phase
[isopropanol/concentrated ammonia (4:1, v/v)].
Allow the plates to develop until the solvent front is 2–
4 cm from the top of the plate.
3. Calculate Rf values for all spots and compare known
FD&C standards with unknowns in food products for
tentative identification.
4. Compare your Rf values with values in Table 14.2.
14.5.3 Quantitative Analysis of FD&C Red Dye

# 40 in Cranberry Juice
Note: This section was developed and written by Professor
Chang Yong Lee. It was adapted from a procedure
described by Rossi et al. [8].
1. Standard curve: Measure the absorbance of Red No. 40

standards (0, 1 μg, 5 μg, 10 μg, 15 μg ml−1) at 502 nm
and prepare a standard curve (plot absorbance vs.
concentration).
2. Separation and quantification of Red No. 40 using SPE:
a. Condition the column with 5 ml of acidified
methanol. To do this, attach a syringe containing
5 ml methanol to the column and gently force the
methanol through the column by applying
pressure to the syringe plunger.
b. Equilibrate the column with 5 ml of deionized
water.
c. Load the column with 1.0 ml of beverage.
d. Wash the column three times with the reagents
shown below. Combine these three washes in a
pre‐weighed vial.
i. Wash 1: 3 ml of 4% 2‐propanol
ii. Wash 2: 3 ml of 4% 2‐ propanol
172
www.ajpdf.com
iii. Wash 3: 3 ml of 5% 2‐propanol

iv. Weigh the vial and calculate the weight of the
combined washes. Calculate the volume of
the combined washes (since the washes are
> 95% water, we can assume the density of
the solutions is 1 g ml−1).
e. Elute the column with 5 ml of acidified methanol.
Anthocyanins will be washed off the column and
the column is ready for reuse.
f. Measure the absorbance of the washes in the
weighed vial at 502 nm.
g. Calculate the concentration of Red No. 40 in the
original juice.

1. Compare your Rf values (from your standards) with
those in Table 14.2. Are they similar in size? In order?
Explain the differences among the three sets of Rf
values.
2. Rank the pK values for the following acids: acetic,
sulfonic, R‐NH3 + where ‐NH3 + is the ε‐amino group
on a lysine residue in a protein. Explain, on the basis of
this ranking, why the extraction procedure with wool
yarn used in this experiment worked.
3. Explain why the Red No. 40 was eluted from the
column with 3‐propanol, while the anthocyanins were
retained. Why did the acidified methanol elute the
anthocyanins?
14.7 References
1 Sigurdson, G.T., Tang, P., and Giusti, M.M. (2017). Natural
colorants: food colorants from natural sources. Annual
Review of Food Science and Technology 8: 261–280.
173
www.ajpdf.com
2 Schwartz, S.J., Cooperstone, J.L., Cichon, M.J. et al. (2017).

Colorants. In: Fennema’s Food Chemistry , 5e (eds. S.
3 Kobylewski, S. and Jacobson, M.F. (2012). Toxicology of
food dyes. International Journal of Occupational and
Environmental Health 18 (3): 220–246.
4 FDA (2020). Summary of color additives for use in the
United States in foods, drugs, cosmetics, and medical
devices. [cited 17 March 2020].
http://www.fda.gov/industry/color‐additive‐
inventories/summary‐color‐additives‐use‐united‐
states‐foods‐drugs‐cosmetics‐and‐medical‐devices
5 Brady, J.W. (2013). Introductory Food Chemistry , 638.
Ithaca: Comstock Publishing Associates.
6 Dixon, E.A. and Renyk, G. (1982). Isolation, separation
and identification of synthetic food colors. Journal of
Chemical Education 59 (1): 67–69.
7 Petigara Harp, B., Miranda‐Bermudez, E., and Barrows,
J.N. (2013). Determination of seven certified color
additives in food products using liquid chromatography.
Journal of Agricultural and Food Chemistry 61 (15):
3726–3736.
8 Rossi, H.F., Rizzo, J., Zimmerman, D.C., and Usher, K.M.
(2012). Extraction and quantitation of FD&C red dye
#40 from beverages containing cranberry juice: a
college‐level analytical chemistry experiment. Journal of
Chemical Education 89 (12): 1551–1554.

Frick, D. and Huck, P. (1995). Food color terminology.
Cereal Foods World 40 (4): 209–218.
Hallagan, J.B. (1991). The use of certified food color
additives in the United States. Cereal Foods World 36
174
www.ajpdf.com
(11): 945–948.
McKone, H.T. and Nelson, G.J. (1976). Separation and
identification of some FD&C dyes by TLC. An
undergraduate laboratory experiment. Journal of
Chemical Education 53 (11): 722.
Supelco. Guide to solid phase extraction [Internet]. [cited
18 March 2020].
https://www.sigmaaldrich.com/Graphics/Supelco/obje
cts/4600/4538.pdf
175
www.ajpdf.com
15
Plant Pigments

1. Describe the major classes of plant pigments and their

distributions in foods.
2. Extract water soluble and fat soluble pigments from
plants.
3. Separate extracted pigments using thin layer
chromatography (TLC).
15.2 Introduction
The appealing colors of fruits and vegetables are due to
compounds in the plant tissues that absorb light of certain
wavelengths. These pigments make up a large, structurally
diverse group of compounds whose presence and relative
concentrations vary with plant species, degree of ripeness,
and growing conditions. They may be classified into two
groups based on structure: compounds containing
conjugated double bonds and compounds with metal‐
coordinated porphyrin rings (which also contain conjugated
double bonds). Carotenoids and anthocyanins fall into the
first group while chlorophylls belong to the second.
Recall that conjugated double bonds are double bonds
separated by a single bond as shown in Figure 15.1.
176
www.ajpdf.com
Figure 15.1 The structure of β‐carotene, an example of a

molecule containing conjugated double bonds. Note that
single and double bonds alternate in the structure.
Many of the naturally occurring plant pigments are
available in purified, concentrated form for use as color
additives. They fall into the group of colorants classified by
the FDA as “color additives exempt from certification.”
Currently, 29 “color additives exempt from certification”
are approved for use in human foods (Table 15.1). Some of
them, while naturally occurring, are available in synthetic
form. In most cases, the synthetic form is chemically
identical to the naturally occurring form and therefore is
called “nature identical.” In general, naturally occurring
colorants are more expensive and less stable than the
synthetic FD&C colorants. Thus, many of the 29 colorants
in this group are rarely used.
177
www.ajpdf.com
Table 15.1 FDA approved “color additives exempt from

batch certification” for use in human foods [1, 2].
Color additive: Source Uses
color
Annato extract: Seeds of Bixa Cheddar cheese
yellowish‐orange orellana tree and foods
generally
Dehydrated beets: Beets Foods generally
red
Calcium carbonate: Synthesis, or Soft and hard
white naturally occurring candies and
limestone mints
Canthaxanthin: Synthesis, or Foods generally
reddish orange mushrooms and
trout and salmon
Caramel: brown to Heating corn syrup Foods generally
dark brown
β‐apo‐8’‐carotenal: Citrus fruit skin, Foods generally
reddish orange vegetable pulp
β‐carotene: orange Synthesis, or algae Foods generally
Carrot oil: Carrots Foods generally
yellowish orange
Cochineal/carmine: Female cochineal Foods generally
red insect
Sodium copper Chlorophyll Citrus‐based dry
chlorophyllin: extracted from beverage mixes
green alfalfa
Cottonseed flour: Toasted cottonseed Foods generally
brown
Ferrous gluconate: Synthesis from iron Ripe olives
color fixation in and gluconic acid
ripe black olives
Ferrous lactate: Synthesis from iron Ripe olives
color fixation in and lactic acid
ripe black olives
178
www.ajpdf.com

color
Grape color extract: Concord grapes Nonbeverage
reddish purple food
Grape skin extract: Grape skins Beverages,
reddish purple alcoholic
beverages
Iron oxide: yellow, Synthesis Sausage casings,
red, brown and hard and soft
black candy, mints and
chewing gum
Fruit juice: various Variety of fruits Foods generally
color
Vegetable juice: Variety of Foods generally
various color vegetables
Mica‐based Synthesis Cereals,
pearlescent frostings,
pigments: various candies
pearlescent color
effects
Paprika: red‐ Sweet red peppers Foods generally
orange
Paprika oleoresin: Sweet red peppers Foods generally
red‐orange
Riboflavin: yellow Synthesis Foods generally
Saffron: yellow Crocus sativus plant Foods generally
Soy leghemoglobin: Controlled Ground beef
reddish brown fermentation of analogue
genetically products
engineered
yeast,Pichia
pastoris
179
www.ajpdf.com

color
Spirulina extract: Aqueous extraction Candy and
blue of the dried chewing gum,
biomass of frostings, etc.
Arthrospira
platensis
Tomato lycopene Tomato Foods generally
extract; tomato
lycopene
concentrate: red
Titanium dioxide: Ilmenite (a mineral Foods generally
white oxide)
Turmeric: yellow Curcuma longa L. Foods generally
plant
Turmeric oleoresin: C. longa L. plant Foods generally
yellow
Anthocyanins are water soluble compounds ranging in
color from deep purple to orange‐red. They are found
primarily in fruits but are also present in some vegetables,
e.g. radishes, eggplant, red cabbage, and red potatoes.
Anthocyanins are glycosides of anthocyanidins (Figure
15.2).
180
www.ajpdf.com
Figure 15.2 Generalized structure of an anthocyanin. G is a

glucose residue. R1 and R2 groups may be H, OH, or OCH3.
R1 and R2 groups vary among anthocyanins from different
sources. A single fruit or vegetable may contain more than
one form.
The color of an anthocyanins is very sensitive to pH. They
tend to be red in acid, colorless around pH 4, and blue in
the neutral pH range (Figure 15.3).
181
www.ajpdf.com
Figure 15.3 Color of cyanin, an anthocyanin, at various

pHs. G is a glucose residue. Redrawn from [3].
Chlorophylls are green pigments containing a porphyrin
ring complexed with magnesium. The two major
chlorophylls, a and b, differ in that a methyl group in
chlorophyll a is replaced by an aldehyde group in
chlorophyll b (Figure 15.4). Chlorophyll a and b are
degraded to pheophytin a and b, respectively, by the
replacement of magnesium with two protons. This
degradation alters the color of green‐colored plants from
bright green to dull olive brown. Acid conditions produced
during thermal processing often cause this color change,
especially in canning.
182
www.ajpdf.com
Figure 15.4 Conversion of chlorophyll to pheophytin.

Chlorophyll is called a magnesium porphyrin because the
four nitrogen atoms in the porphyrin ring are coordinated
with a magnesium ion. Chlorophylls a and b occur together
in about a 3:1 ratio. Chlorophyll a is blue green, while
chlorophyll b is yellow green. Redrawn from [4].
In the United States, purified chlorophyll is not an allowed
color additive. However, juices from green vegetables are
sometimes used as colorants in pasta (spinach pasta) and
other foods.
Carotenoids form a large group containing hundreds of
related compounds. They are present in photosynthesizing
organisms, but their color is often masked by chlorophyll.
This is most apparent in the fall of the year when
chlorophyll in the leaves of deciduous trees breaks down
revealing the brilliant reds, oranges, and yellows of the
carotenoids that were there all along. Carotenoids may be
divided into two groups: the carotenes that are
hydrocarbons and the xanthophylls that contain oxygen in
addition to hydrogen and carbon (Figures 15.5 and 15.6).
Carotenoids are yellow, orange, or red and are insoluble in
water. Most are fairly stable to heat and pH extremes but
may be destroyed by oxidation. In intact tissue little
oxidation takes place, but in processed foods where tissue
has been disrupted, carotenoids may be oxidized by
atmospheric oxygen. Oxidation rate may be affected by
light, heat, and pro‐ or antioxidants.
183
www.ajpdf.com
Figure 15.5 Structures of selected carotenes. Note the

conjugated double bonds and absence of oxygen atoms.
184
www.ajpdf.com
Figure 15.6 Structures of selected xanthophylls. Note the

presence of oxygen atoms in these structures.
A few carotenoids possess vitamin A activity meaning that
they may be converted into retinol (vitamin A) in the body
[5, 6]. Carotenoids with vitamin A activity include β‐
carotene, α‐carotene, α‐apo‐8‐carotenal, and cryptoxanthin
[7].
Natural extracts and synthetic carotenoids are used to
color margarine, butter, oils, beverages, soups, dairy and
meat products, syrups, and macaroni. Bixin, a carotenoid
present in annatto seeds, is widely used to produce yellow
color in cheeses.
Three synthetic carotenoids currently approved by the FDA
for food use are β‐carotene (yellow to orange), β‐apo‐8‐
carotenal (orange to red), and canthaxanthin (red).
Advantages of synthetic carotenoids include high purity,
better control of concentrations and tolerances, and
freedom from contaminating substances.
185
www.ajpdf.com

1. Top loading balance
2. Blender
3. Test tubes
4. pH meter
5. Hot plate, or water bath at 95 °C
7. Petri dish lid
8. Vortex mixer
9. Pipettors with tips
10. Filter and Whatman # 1 filter paper

1. Raw and canned spinach; raw and cooked red
cabbage; frozen green beans
2. Citrate/phosphate/borate/HCl buffer, pH: 2, 3, 5, and
7
3. Anhydrous sodium sulfate or anhydrous magnesium
sulfate
4. Acetone
5. Silica gel TLC plates
6. Developing solvent: 60% petroleum ether/16%
cyclohexane/10% ethyl acetate/10% acetone/4%
methanol
7. Sand
8. Acetic acid, 0.1 N
9. Sodium bicarbonate, 0.1 M
15.5 Procedures
186
www.ajpdf.com
15.5.1 Extraction and Separation of Lipid

Soluble Plant Pigments (Adapted from [8])
1. Weigh out 1.0 g of raw spinach.

2. Transfer to a mortar. Add 1 g anhydrous magnesium
sulfate and 2 g sand.
3. Grind the mixture for 5–10 minutes until a light green
powder is obtained.
4. Transfer to a test tube and add 4 ml acetone.
5. Mix well on a vortex mixer.
6. Let the mixture stand for 10 minutes.
7. Transfer 1 ml to a clean test tube.
8. On a 5 × 8 cm silica gel TLC plate, draw a line 1 cm
from the bottom of the short edge in pencil. Using a
pipettor, carefully spot, 1 cm apart, a small quantity of
each extract on the line and label each lane.
9. Repeat Steps 1–8 using canned spinach. As long as the
spots aren’t too large, you may spot all treatments on
one TLC plate.
10. Under the fume hood, put about 10 ml of developing
solvent (60% petroleum ether/16% cyclohexane/10%
ethyl acetate/10% acetone/4% methanol) into a 250
ml beaker and cover immediately with a petri dish lid
(the solvent evaporates rapidly).
11. Place the spotted silica gel plate in the beaker, cover,
and allow to develop until the leading edge of the
solvent front is within 1–2 cm of the top of the plate,
about 10 minutes.
12. Observe the bands in each lane.
15.5.2 Extraction of Water Soluble Plant

Pigments
1. Weigh out 100 g of raw red cabbage.
187
www.ajpdf.com
2. Transfer to a blender jar. Add 200 ml distilled water.

Blend for two minutes. Filter through Whatman # 1
filter paper. Save the filtrate.
3. Repeat steps 1–2 using red cabbage boiled in water for
10 minutes.
4. Compare the intensities and shades of colors between
raw and cooked samples.
15.5.3 Effect of pH on the Color of Water

Soluble Plant Pigments
1. Label large test tubes as follows: pH 2, 3, 5, and 7 (2
tubes for each pH). Add 5 ml of the appropriate buffer
to each of the tubes.
2. Transfer 2 ml of your extracts prepared in Section
15.5.2 above to the tubes (do this so that you have
each extract exposed to all 4 pH values.) Measure and
record the pH of each buffer/extract mixture.
3. Observe the color of each solution and record your
observations.
Add 100 ml 0.1 N acetic acid, 100 ml 0.1 M sodium
bicarbonate, and 100 ml distilled water to separate 600 ml
beakers. Bring to boil on hot plates. Add 50 g frozen green
beans to each beaker. Bring back to boiling and boil an
additional five minutes. Observe the color of the green
beans from each treatment.

1. What were the principal pigments extracted from the
spinach? The cabbage?
2. Did heat treatment affect the amount of pigment
extracted?
188
www.ajpdf.com
3. Did pH affect the color of the cabbage extracts?

Explain.
15.7 References
1 Lauro, G.J. (1991). A primer on natural colors. Cereal
Foods World 36 (11): 949–953.
2 FDA (2020). Summary of color additives for use in the
United States in foods, drugs, cosmetics, and medical
devices. [cited 28 February 2020].
http://www.fda.gov/industry/color‐additive‐
inventories/summary‐color‐additives‐use‐united‐
states‐foods‐drugs‐cosmetics‐and‐medical‐devices
3 Belitz, H.‐D., Grosch, W., and Schieberle, P. (2009). Food
Chemistry , 4e, 1070. Berlin: Springer.
4 Brady, J.W. (2013). Introductory Food Chemistry , 638.
5 Tang, G. (2010). Bioconversion of dietary provitamin A
carotenoids to vitamin A in humans. The American
Journal of Clinical Nutrition 91 (5): 1468S–1473S.
6 dela Seña, C., Riedl, K.M., Narayanasamy, S. et al. (2014).
The human enzyme that converts dietary provitamin A
carotenoids to vitamin A is a dioxygenase. The Journal of
Biological Chemistry 289 (19): 13661–13666.
7 Bohn, T. and Provitamin, A. (2012). Carotenoids:
occurrence, intake and bioavailability. In: Vitamin A and
Carotenoids: Chemistry, Analysis, Function and Effects
(ed. V.R. Preedy ), 142–161. Cambridge: Royal Society of
Chemistry. (Food and Nutritional Components in Focus).
8 Quach, H.T., Steeper, R.L., and Griffin, G.W. (2004). An
improved method for the extraction and thin‐layer
chromatography of chlorophyll a and b from spinach.
189
www.ajpdf.com

Frick, D. and Huck, P. (1995). Food color terminology.
Cereal Foods World 40 (4): 209–218.
Schwartz, S.J., Cooperstone, J.L., Cichon, M.J. et al. (2017).
Valverde, J., This, H., and Vignolle, M. (2007). Quantitative
determination of photosynthetic pigments in green
beans using thin‐layer chromatography and a flatbed
scanner as densitometer. Journal of Chemical Education
84 (9): 1505.
190
www.ajpdf.com
16
Meat Pigments

1. Prepare myoglobin and oxymyoglobin starting from a

solution of metmyoglobin.
2. Record a visible spectrum of the various forms of
myoglobin using a scanning spectrophotometer.
3. Use Beer’s Law to calculate the concentrations of each
of the three common forms of myoglobin in a solution.
4. Relate the chemistry of myoglobin to the variations in
surface and interior colors of raw beef products stored
under different conditions and for different times.
5. Explain why cooking changes the color of beef from
red to brown.
16.2 Introduction
Color is an important quality attribute of fresh and
processed meats. The major pigments in meats are
myoglobin and hemoglobin. Myoglobin predominates in
well‐bled muscle tissue [1]. Myoglobin and hemoglobin are
both globular heme‐containing proteins. Myoglobin is
monomeric (it contains a single polypeptide chain) and has
a molecular weight of about 17,600 daltons. It is present in
both skeletal and heart muscle and has the capacity to bind
molecular oxygen within muscle. Hemoglobin is a tetramer
with a molecular weight of about 64,000. The portion of
both molecules that is responsible for meat color is the
heme complex (Figure 16.1).
191
www.ajpdf.com
Figure 16.1 Heme. Heme is formed when an iron ion binds

at the center of a protoporphyrin IX molecule. Iron is hexa‐
coordinate and therefore is capable of forming two
additional coordinate covalent bonds. In oxymyoglobin and
oxyhemoglobin, iron binds to a histidine residue in the
globin chain and to molecular oxygen (see Figure 16.2).
192
www.ajpdf.com
Figure 16.2 Structures of myoglobin and oxymyoglobin

showing iron binding to a histidine residue on the globin
polypeptide chain and to water or oxygen in myoglobin and
oxymyoglobin, respectively. The oxidation state of iron in
myoglobin and oxymyoglobin is +2.
In fresh meat systems, myoglobin may exist either as
myoglobin (sometimes called deoxymyoglobin),
oxymyoglobin, or metmyoglobin. These three forms are
important because they affect the color of the meat.
The iron atom at the center of the heme complex is key to
myoglobin’s function and color. When the oxidation state of
the iron is +2 (ferrous), it is capable of binding molecular
oxygen (O2), nitric oxide (NO), carbon monoxide (CO),
water, and other molecules. In myoglobin, the oxidation
state of iron is +2. In oxymyoglobin, the oxidation state of
iron is also +2 and molecular oxygen is bound to the iron.
In metmyoglobin, the oxidation state of iron is +3 (ferric)
and the ability to bind oxygen is lost. Myoglobin is a deep
purple color; oxymyoglobin is red, and metmyoglobin is
brown. Each of these forms has its own distinct spectrum
(Figure 16.3).
193
www.ajpdf.com
Figure 16.3 Spectral curves of myoglobin, oxymyoglobin,

and metmyoglobin. Redrawn from [2].
The chemical state of meat pigments can be controlled to
some extent by regulating the partial pressure of oxygen in
the meat environment. In fresh meat in the absence of
atmospheric oxygen, myoglobin iron will be in the ferrous
form. This is because normal enzyme activity in the meat
uses up oxygen and provides a reducing environment [1]. If
small amounts of oxygen are allowed to come into contact
with the meat surface, the myoglobin will be oxidized to
metmyoglobin. In the presence of larger amounts of
oxygen, the myoglobin will bind O2 and thereby be
converted to oxymyoglobin. In oxymyoglobin, the ferrous
state is stabilized and is less likely to oxidize to the ferric
form. Consumers prefer fresh meat that is red in color,
especially fresh beef, and tend to pass over cuts that
appear brown because color is often perceived by
consumers as an indicator of meat quality [3].
194
www.ajpdf.com
Experimentally, Fe3+ in metmyoglobin can be reduced to

Fe2+ by various reducing agents. A particularly effective
reducing agent is sodium dithionite (Na2S2O4), also known
as sodium hydrosulfite. Half reactions for the oxidation of
dithionite and the reduction of Fe3+ iron are shown below:
From these reactions, we can see how sodium dithionite

could donate an electron to Fe3+, reducing it to Fe2+.
Ascorbic acid can also donate an electron to Fe3+, reducing
it to Fe2+.
16.2.1 Meat Curing

Meat curing has been used for centuries as a preservation
technique. Both nitrate and nitrite have been used in the
meat curing process, but nitrate must be reduced to nitrite
to be effective. A primary motivation for curing meat is the
characteristic stable pinkish color that it produces. Curing
meat with nitrite produces a unique flavor. It also inhibits
lipid oxidation and retards the growth of spoilage and
pathogenic bacteria [4].
When meat is cured, the myoglobin is converted to nitric
oxide myoglobin (NOMb). This is accomplished by treating
the meat with sodium nitrite and a suitable reducing agent
to generate nitric oxide (NO) and to reduce heme Fe3+ to
Fe2+ [1]. The chemistry of the production of NO from
sodium nitrite is shown below (HRd represents a reducing
agent) [5].
195
www.ajpdf.com
Either ascorbic acid or erythorbic acid is commonly used

as a reducing agent in the meat curing process.
16.2.2 Effect of Cooking on Meat Color

With the exception of nitrite cured meats, cooking causes
meat color to turn brown. This change is due to the
denaturation of the myoglobin and/or the oxidation of
ferrohemochrome to ferrihemochrome (Figure 16.4). [6].
Many consumers and chefs rely on the color of cooked
meat to determine doneness. The USDA recommends that
beef steaks and roasts be cooked to an internal
temperature of 145 °F and ground beef to 160 °F to ensure
the inactivation of pathogenic organisms that may be
present in the raw meat [7]. The recommended
temperature is lower for intact cuts of meat (e.g. steaks and
roasts) because pathogens generally do not penetrate into
the interior of the meat. It is generally assumed that when
the color of the innermost part of ground meat is no longer
pink and the juices run clear, the meat is safe to eat. This
assumption may be unwarranted because, under some
conditions, the loss of pink color may occur before a safe
temperature is reached due to the differences in heat
sensitivity of the three common forms of myoglobin in
meat (Figure 16.4). Deoxymyoglobin is the most stable to
heat, so meats that contain high amounts of this form will
not lose their pink color until a safe temperature is
reached. In contrast, metmyoglobin denatures quickly and,
moreover, metmyoglobin is brown even in raw meat. When
hamburger is stored for long periods of time, the
myoglobin in the interior of the patty will gradually oxidize
to metmyoglobin so that the interior of the patty is no
196
www.ajpdf.com
longer pink even when the meat is raw or the temperature

is well below 160 °F [6]. Also, when meats are stored in
high oxygen conditions to maintain their red color, a high
proportion of the total myoglobin will be in the
oxymyoglobin form. Oxymyoglobin is less stable than
deoxymyoglobin and will denature at lower temperatures,
causing the meat to turn brown at temperatures below the
safe level [6]. Therefore, the USDA strongly recommends
that consumers use a thermometer to determine doneness
rather than relying of the color of the meat [7].
Figure 16.4 The three main forms of myoglobin pigments

in meat, their relative stabilities to heat, and inter
conversions between the forms [6].

2. Test tubes and holders
3. Beakers, 100 ml
197
www.ajpdf.com
4. Parafilm
6. Pipettes
7. Scanning spectrophotometer
8. Cuvettes
9. Knife and cutting boards
10. Vortex mixer

1. Beef steaks packaged in either O2 permeable film or
O2 impermeable film.
2. Buffer, pH 5.2 (23.2 mM citric acid + 53.4 mM
disodium phosphate). De‐aerated.
3. Buffer, pH 7.0 (1/15 M phosphate buffer). De‐aerated.
4. Metmyoglobin (1.0 mg ml−1) in pH 7 buffer. De‐
aerated after mixing.
5. Metmyoglobin (1.0 mg ml−1) in pH 5.2 buffer. De‐
aerated after mixing.
6. Sodium dithionite (Na2S2O4) crystals.
7. Sodium nitrite (NaNO2), 1.0 M in water. De‐aerated.
8. Ascorbic acid, 1.0 M in water. De‐aerated.
16.5 Procedures
16.5.1 Preparation and Spectral Analysis of
Myoglobin, Oxymyoglobin, and Metmyoglobin
1. Mark 4 test tubes at 10.0 ml, label them Tubes 1, 2, 3,
and 4.
198
www.ajpdf.com
2. Obtain (in a 100 ml beaker) 50 ml of de‐aerated

metmyoglobin in pH 7 buffer. (The solutions were de‐
aerated by swirling them gently in a filter flask while
pulling a mild vacuum with a water aspirator. Be
careful not to agitate the metmyoglobin solutions
because agitation will increase O2 uptake from the
air.)
3. Carefully pour 10 ml of the metmyoglobin solution
into each of the four tubes avoiding agitation as much
as possible.
4. Treat each tube as indicated in the table:
Treatment Composition Treatment
name
Tube 1: control Metmyoglobin, 1 mg Gently
ml−1 in phosphate invert tube
buffer, pH 7 2x to mix
Tube 2: control Metmyoglobin, 1 mg Vortex for
+ agitation ml−1 in phosphate 90s to
buffer, pH 7 aerate
Tube 3: Metmyoglobin, 1 mg Cap tube
metmyoglobin ml−1 in phosphate and gently
+ reducing buffer, pH 7, + 10 mg invert 2x to
agent sodium dithionite mix
Tube 4: Metmyoglobin, 1 mg Vortex for
metmyoglobin ml−1 in phosphate 90s to
+ reducing buffer, pH 7, + 10 mg aerate
agent + sodium dithionite
agitation
5. Make careful observations of the color of each
treatment.
6. Using a scanning spectrophotometer, record the
absorption spectrum for each treatment by scanning
between 475 and 650 nm.
7. Place the treated myoglobin solutions in a 95 °C water
bath for 15 minutes. Describe changes that result from
the heat treatment.
199
www.ajpdf.com
16.5.2 Preparation and Spectral Analysis of

Nitric Oxide Myoglobin
1. Mark three test tubes at 10.0 ml and label them Tubes
5, 6, and 7.
2. Transfer 10 ml of the pH 5.2 metmyoglobin solution
into the tubes.
3. Treat each tube as follows:
Treatment Composition Treatment
name
Tube 5: 10 ml metmyoglobin in Cap tube
control pH 5.2 buffer + 2 ml and invert
water gently to
mix
metmyoglobin pH 5.2 buffer + 2 ml 1 M and invert
+ NaNO2 NaNO2 gently to
mix
metmyoglobin pH 5.2 buffer + 1 ml 1 M and invert
+ NaNO2 + NaNO2 + 1 ml 1 M gently to
ascorbic acid ascorbic acid mix
4. Repeat Steps 5 through 7 in Section 16.5.1.
16.5.3 Concentration of Metmyoglobin,

Myoglobin, and Oxymyoglobin
Calculate the concentration in mmol l−1 (mM) of the sum of
all three myoglobin forms in each tube from Section 16.5.1
(assume that all the myoglobin is present in one of these
forms). Recall that the concentration of the metmyoglobin
solution that was prepared for you was 1 mg ml−1 and that
the molecular weight of metmyoglobin is 17,600 mg
mmol−1. Now calculate the concentration of the myoglobin
in Tubes 1, 2, 3, and 4 using your absorbance readings and
Beer’ law. The millimolar extinction coefficient (ε) for
metmyoglobin is 9.84 mM‐1cm‐1 at 503 nm; for myoglobin
200
www.ajpdf.com
is 12.30 mM‐1cm‐1 at 557 nm; and for oxymyoglobin is

14.37 mM‐1 cm‐1 at 582 nm. Note: these extinction
coefficients were taken from Tang et al. [8].
Also recall the equation for Beer’s law: A = εbc where A =
absorbance, ε = the molar extinction coefficient (mM−1
cm−1); b = light path length in the cuvette (1 cm), and c =
concentration in mM.
The above calculations assume that our conversions
between the various forms were 100% complete. Why
might this assumption be invalid?
Fresh beef steaks were wrapped in films of differing
oxygen permeability and stored for 48 hours at 4 °C.
Observe the color of the various samples and explain any
differences you see. Remove the films and observe for a
few minutes. Note any color changes. Cut the steaks and
observe the color of the interior of the meat.

1. Describe the changes that result from the heat
treatment performed in Sections 16.5.1 and 16.5.2.
2. What purpose does the sodium dithionite serve? Is
there another compound that could be used for the
same purpose? If so, suggest one.
3. Explain any pigment differences you see in the steaks
stored in the different films. What are they and why
did they occur?
16.7 References
1 Aberle, E.D., Forrest, J.C., Gerrard, D.E., and Mills, E.W.
(2012). Principles of Meat Science , 5e, 426. Dubuque, IA:
Kendall Hunt Publishing.
201
www.ajpdf.com
2 Clydesdale, F.M. and Francis, F.S. (1976). Pigments. In:

Food Chemistry (ed. O.R. Fennema ), 385–426. New York:
Marcel Dekker.
3 Font‐i‐Furnols, M. and Guerrero, L. (2014). Consumer
preference, behavior and perception about meat and
meat products: an overview. Meat Science 98 (3): 361–
371.
4 Sindelar, J.J. and Milkowski, A.L. (2012). Human safety
controversies surrounding nitrate and nitrite in the diet.
Nitric Oxide 26 (4): 259–266.
5 Pegg, R.B., Shahidi, F., and Fox, J.B. Jr. (1997). Unraveling
the chemical identity of meat pigments. Critical Reviews
in Food Science and Nutrition 37 (6): 561–589.
6 King, J.W., Turner, N.J., and Whyte, R. (2006). Does it look
cooked? A review of factors that influence cooked meat
color. Journal of Food Science 71 (4): R31–R40.
7 USDA FSIS. Beef from farm to table [Internet]. [cited 2
March 2020].
https://www.fsis.usda.gov/wps/portal/fsis/topics/foo
d‐safety‐education/get‐answers/food‐safety‐fact‐
sheets/meat‐preparation/beef‐from‐farm‐to‐
table/ct_index
8 Tang, J., Faustman, C., and Hoagland, T.A. (2004).
Krzywicki revisited: equations for spectrophotometric
determination of myoglobin redox forms in aqueous
meat extracts. Journal of Food Science 69 (9): C717–
C720.

Bowen, W.J. (1949). The absorption spectra and extinction
coefficients of myoglobin. The Journal of Biological
Chemistry 179 (1): 235–245.
Eilert, S.J. (2005). New packaging technologies for the 21st
century. Meat Science 71 (1): 122–127.
202
www.ajpdf.com
Fox, J.B. Jr. (1966). Chemistry of meat pigments. Journal of

Honikel, K.‐O. (2008). The use and control of nitrate and
nitrite for the processing of meat products. Meat Science
78 (1): 68–76.
Livingston, D.J. and Brown, W.D. (1981). The chemistry of
myoglobin and its reactions. Food Technology 35 (5):
244–252.
Mancini, R.A. and Ramanathan, R. (2020). Molecular basis
of meat color. In: Meat Quality Analysis (eds. A.K. Biswas
and P.K. Mandal ), 117–129. Cambridge, MA: Academic
Press.
Millar, S.J., Moss, B.W., and Stevenson, M.H. (1996). Some
observations on the absorption spectra of various
myoglobin derivatives found in meat. Meat Science 42
(3): 277–288.
Schwartz, S.J., Cooperstone, J.L., Cichon, M.J. et al. (2017).
Suman, S.P. and Poulson, J. (2013). Myoglobin chemistry
and meat color. Annual Review of Food Science and
Technology 4: 79–99.
203
www.ajpdf.com
17
Meat Tenderizers

1. Describe the principles underlying the technique of

electrophoresis.
2. Apply electrophoresis to assess the action of meat
tenderizing enzymes.
3. Understand and compare the actions of two meat
tenderizing enzymes.
4. Explain the effects of meat tenderizers on
marshmallows.
17.2 Introduction
Tenderness is an important quality factor in meats. The
perceived tenderness of a meat sample is influenced by a
complex set of factors with muscle proteins playing a
major role. Three classes of protein appear to be involved
in tenderness [1]. They are connective tissue proteins
(collagen and elastin), contractile (myofibrillar) proteins
(actin, myosin, tropomyosin, titin, and nebulin), and
sarcoplasmic proteins (glycolytic and other enzymes and
myoglobin). These proteins may be classified according to
their solubility in various solvents [1]. Connective tissue
proteins are insoluble in water and in concentrated salt
solutions. Contractile proteins are insoluble in water and
dilute salt solutions but are soluble in concentrated salt or
urea solutions. The sarcoplasmic proteins are soluble in
water or dilute salt solutions. Presumably, these proteins
impart toughness to meat because they interact and cross
link to produce large molecular weight structures that are
difficult to break apart by chewing.
204
www.ajpdf.com
A common strategy for tenderizing meat is to marinate in

an acidic marinade prior to cooking. Many marinades
contain vinegar along with other ingredients such as
vegetable oil, soy sauce, spices, and so on. The acetic acid in
the vinegar promotes acid hydrolysis of proteins in the
meat, thereby producing a tenderizing effect.
Proteolytic enzymes capable of partially hydrolyzing
muscle proteins may also be used to tenderize meat. One
strategy to promote hydrolysis of muscle proteins is to
“condition” the meat. Conditioning involves holding
carcasses at chill temperatures for 10–14 days before
cutting. Conditioning is an effective means for enhancing
tenderness. Presumably the improved tenderness is due to
the action of endogenous proteolytic enzymes such as
cathepsin and calpain [1, 2].
Tenderizing meat artificially by adding exogenous
proteolytic enzymes has been in practice for hundreds of
years. Indigenous Peoples of Mexico are known to have
wrapped meat in papaw leaves during cooking [1]. Papaw
leaves contain a proteolytic enzyme called papain. Today,
several enzymes are used commercially and in the home to
tenderize meat. They include the plant‐derived enzymes
ficin (from figs), papain (from papaw leaves), and
bromelain (from pineapple). These enzymes may be added
to the meat post‐slaughter or injected into the blood
stream of the live animal 1–30 minutes before slaughter
[1]. Injecting into the live animal is preferred because it
allows for a more even distribution of the enzyme in the
muscles.
The use of these enzymes is not without problems. As
proteolytic enzymes go, they are relatively nonspecific and
are capable of hydrolyzing many different proteins. This
can lead to over tenderization when hydrolysis is too
extensive [3]. Treatments that disrupt connective tissue
(collagen and elastin) while minimizing hydrolysis of
myofibrillar proteins are preferred [4]. It has been
suggested, therefore, that enzymes that are specific for
collagen and elastin would be preferable to ficin, papain,
and bromelain [3]. Takagi et al. [3] have shown that an
205
www.ajpdf.com
elastase produced by a strain of Bacillus has high

hydrolyzing activity toward collagen and elastin but low
activity toward myofibrillar proteins. They suggest that
this enzyme may be preferable to the commonly used
plant‐derived enzymes for meat tenderization.
In order to understand and monitor the actions of meat
tenderizing enzymes, food scientists have relied on a
powerful technique called electrophoresis. In this
technique, proteins are solubilized by extraction with
appropriate solvents, applied to a gel, and placed in an
apparatus designed to expose the proteins to an electric
field. The electric field causes the charged protein
molecules migrate through the gel. The rate of migration
will be a function of the size of the protein allowing
separation of the mixture of proteins in the sample. The
molecular weight (MW) of unknown proteins may be
determined by comparing their migration rates with
standard proteins of known MW since proteins of similar
MW will travel at the same rate and migrate the same
distance within the gel. See Appendix for a detailed
explanation of the principles and practice of
electrophoresis.
We would expect proteolytic enzymes to reduce the MW of
proteins by cutting them up into smaller peptides. Thus,
electrophoresis should be an ideal technique for studying
the action of meat tenderizers. In this experiment we will
use electrophoresis to study the action of two meat
tenderizers, papain and bromelain, on lean ground beef.
A simpler approach to observing the proteolytic action of
plant‐based enzymes is to apply fresh fruit juices to
marshmallows. The primary ingredients in marshmallows
are sugar (usually a combination of granulated sugar,
confectioners’ sugar, and corn syrup) and unflavored
gelatin [5]. Gelatin is a protein made from collagen. To
make marshmallows, the sugars and corn syrup are mixed
with water and heated to around 115 °C. The hot syrup is
mixed into a gelatin solution and whipped to a stiff foam.
The resulting marshmallows are basically soluble sugars
and dextrins in a protein matrix. The protein matrix is
206
www.ajpdf.com
insoluble in water but will dissolve when the proteins are

hydrolyzed. To perform a qualitative assay of protease
activity, one can simply add solutions of proteolytic
enzymes to marshmallows and see if they dissolve.

1. Balance
2. Test tubes and holders
3. Water bath, boiling
4. Bench‐top centrifuge
5. Small centrifuge tubes
6. Pipettor and Bio‐Rad Prot/elec tips
7. Pre‐cast mini protean mini gel (7.5% single
percentage polyacrylamide gel)
8. Power supply
9. Apparatus for running mini gels
10. Trays for staining and destaining gels
11. Small beakers and watch glasses

1. Lean ground beef (ground round steak)
2. Papain (1 mg ml−1 in water) (2 x crystallized, 80%
protein; Sigma Chemical Co., St Louis)
3. Bromelain (1 mg ml−1 in water) (50% protein, Sigma
Chemical Co., St. Louis)
4. 6 M urea solution containing 2% sodium dodecyl
sulfate (SDS)
5. Sample buffer: 100 mM Tris‐HCl containing 4% SDS,
20% glycerol, 0.1% bromphenol blue, and 5 %
mercaptoethanol.
207
www.ajpdf.com
6. Running buffer: Bio‐Rad 10X Tris‐glycine SDS buffer

diluted 1:10.
7. Coomassie Blue staining solution: 0.25% Coomassie
blue R in methanol:acetic acid:water, 45:10:45.
8. Destaining solution: methanol:acetic acid:water,
45:10:45.
9. Bio‐Rad SDS‐PAGE Standards; broad range: 6.5–200
kdaltons
10. Mini marshmallows
11. Cubes of fresh, uncooked beef steak
12. White vinegar
13. Fresh pineapple juice
14. Canned pineapple juice
17.5 Procedures
The following procedure is adapted from the method of
Kim and Taub [6].
17.5.1 Preparation of Samples and Standards

17.5.1.1 Sample Treatments
1. Transfer 0.8 g of lean ground beef to each of six test

tubes.
2. Add 0.8 ml papain solution to three of the tubes and
0.8 ml bromelain solution to the other three. Mix
thoroughly.
3. Immediately place two of the tubes (one papain and
one bromelain) in a boiling water bath for two
minutes to inactivate the enzymes (0 time treatment).
4. Incubate two of the tubes (one papain and one
bromelain) for 30 minutes at room temperature (30
minutes treatment). Inactivate the enzymes in a
boiling water bath.
208
www.ajpdf.com
5. Incubate the other two tubes for 60 minutes at room

temperature (60 minutes treatment). Inactivate the
enzymes in a boiling water bath.
17.5.1.2 Protein Extraction and Preparation for

Electrophoresis
1. Add 5 ml 6 M urea containing 2% SDS to each of the

tubes in Section 17.5.1.1 above. Mix thoroughly and
allow to stand for 10 minutes. Mix again.
2. Centrifuge at moderate speed in a bench‐top
centrifuge.
3. Mix 1 ml of each supernatant with 1 ml of sample
buffer. Mix thoroughly.
17.5.1.3 Preparation of SDS‐PAGE Standards for

Electrophoresis.
1. Mix 1 ml of the standard solution with 1 ml of sample

buffer.
17.5.2 Electrophoresis
17.5.2.1 Loading and Running the Gel
1. Assemble the electrophoresis apparatus and fill with

the running buffer.
2. Pipet 10 μl of the SDS‐PAGE standard into a sample
well in the middle of the gel. (Use a Bio‐Rad Prot/elec
tip on a pipettor to load the samples on the gel.)
3. Pipet 20 μl of each sample into the other sample wells.
Be certain to record the location of each sample and
standard in your lab notebook.
4. Run the gels at 200 volts for approximately 30
minutes or until the tracking dye (bromphenol blue)
reaches the bottom of the gel.
17.5.2.2 Staining the Gel
209
www.ajpdf.com
1. Remove gels from the apparatus and stain for two

hours in Coomassie blue staining solution.
2. Remove the staining solution and add destaining
solution. After two hours, pour off the destaining
solution and add fresh destaining solution. Leave in
the fresh destaining solution overnight.
3. Observe gels. The proteins will appear as blue bands
on a clear background.
Place a mini marshmallow in each of six small beakers.
Cover the marshmallows with 25 ml of the following
liquids: water, papain solution (1 mg ml−1), bromelain
solution (1 mg ml−1), fresh pineapple juice, canned
pineapple juice, white vinegar. Cover the beakers with
watch glasses and leave to sit overnight at room
temperature. Observe the marshmallows and explain the
differences between the various treatments.
Repeat with 1 cm cubes of fresh, uncooked beef steak.

1. Compare the intensity and location of the protein
bands on your gels. Explain any differences between
incubation times and enzymes.
2. The molecular weight of myosin is about 200 kdaltons.
Is there a protein in your samples with this molecular
weight?
3. Actin has a molecular weight of about 43–48 kdaltons.
Is there a protein in your samples with this molecular
weight?
4. Compare and explain the differences between the
various treatments in the demonstration.
17.7 References
210
www.ajpdf.com
1 Lawrie, R.A. (1991). Meat science , 5e, 293. Oxford,

England; New York, USA: Pergamon Press.
2 Huff‐Lonergan, E., Mitsuhashi, T., Beekman, D.D. et al.
(1996). Proteolysis of specific muscle structural
proteins by μ‐calpain at low pH and temperature is
similar to degradation in postmortem bovine muscle.
Journal of Animal Science 74 (5): 993–1008.
3 Hiroshi, T., Masaaki, K., Tomoaki, H. et al. (1992). Effects
of an alkaline elastase from an alkalophilic Bacillus
strain on the tenderization of beef meat. Journal of
4 Tantamacharik, T., Carne, A., Agyei, D. et al. (2018). Use of
plant proteolytic enzymes for meat processing. In:
Biotechnological Applications of Plant Proteolytic
Enzymes (eds. M.G. Guevara and G.R. Daleo ), 43–67.
Cham: Springer International Publishing.
5 Hartel, R.W. and Hartel, A. (2014). Candy Bites: The
Science of Sweets , 269. New York, NY: Copernicus Books.
6 Kim, H.‐J. and Taub, I.A. (1991). Specific degradation of
myosin in meat by bromelain. Food Chemistry 40 (3):
337–343.

Ha, M., Bekhit, A.E.‐D., Carne, A., and Hopkins, D.L. (2013).
Comparison of the proteolytic activities of new
commercially available bacterial and fungal proteases
toward meat proteins. Journal of Food Science 78 (2):
C170–C177.
Hagar, W.G. and Bullerwell, L.D . Supermarket proteases
[Internet]. NSTA News. [cited 28 February 2020].
https://www.nsta.org/publications/news/story.aspx?
id=48656
211
www.ajpdf.com
18
Detection of Genetically Engineered
Maize Varieties

1. Explain why glyphosate is toxic to most plants.

2. Describe the principles underlying PCR.
3. Describe the principles underlying agarose gel
electrophoresis.
4. Describe the principles underlying lateral flow
technology methods.
5. Determine whether a food sample contains an
ingredient from a genetically engineered crop using
two different methodologies.
18.2 Introduction
Genetically engineered (GE) seeds, commonly known as
GMOs, first became widely available to farmers in the mid‐
1990s. These seeds were enthusiastically received by
farmers due to the beneficial agronomic traits they offer.
These traits include insect resistance (e.g. Bt corn and Bt
cotton), herbicide resistance (HR) (e.g. Roundup Ready®
corn, soybean, cotton, canola, and sugar beet), and virus
resistance (e.g. virus resistant papaya and eggplant). The
rapid rate of adoption of GE corn, cotton, and soybeans by
US farmers is shown in Figure 18.1. Today, more than 75%
of planted acres of these crops are planted with genetically
engineered seeds. Organic foods presumably do not
contain GE ingredients because USDA guidelines for
organically grown crops prohibit the use of GE varieties
[1].
212
www.ajpdf.com
Figure 18.1 Trends in the adoption of genetically

engineered crops by farmers in the United States [2].
Insect‐resistant crops contain a gene that encodes for a
protein that is toxic to certain insects but not to mammals.
When these insects begin chewing on the GE plant, they
quickly die from exposure to the toxic protein. The gene is
present naturally in the soil bacterium Bacillus
thuringiensis (Bt). The gene is inserted into the crop
genome using recombinant DNA technology.
Herbicide tolerant crops are resistant to the herbicide
glyphosate. Glyphosate is an effective herbicide because it
is a potent inhibitor of the enzyme 5‐enolpyruvyl‐
shikimate‐3‐phosphate synthase (EPSPS). EPSPS is a key
enzyme in the shikimate pathway for the synthesis of
aromatic amino acids (phenylalanine, tyrosine, and
tryptophan) in plants. It catalyzes the addition of
phosphoenol pyruvate to shikimate‐3‐phosphate (Figure
18.2). Glyphosate, the active ingredient in Roundup®, is a
widely used herbicide. As shown in Figure 18.3, the
structure of glyphosate is similar to that of phosphoenol
pyruvate. Glyphosate binds irreversibly to the active site of
EPSPS, thereby blocking the synthesis of aromatic amino
213
www.ajpdf.com
acids in the plant [3]. Without these amino acids, the plants
cannot synthesize proteins and therefore they die. Since all
plants rely on EPSPS for the synthesis of aromatic amino
acids, glyphosate will kill virtually all plants it contacts.
This makes it very effective for killing weeds, but it also
kills crop plants and that limited its use until glyphosate‐
resistant (GR) varieties were developed.
214
www.ajpdf.com
215
www.ajpdf.com
Figure 18.2 Steps in the shikimate pathway for the

synthesis of aromatic amino acids in plants. Glyphosate
binds irreversibly to EPSPS blocking the conversion of
shikimic acid‐3‐phosphate to 5‐enolpyruvyl shikimic acid‐
3‐phosphate. Without 5‐enolpyruvyl shikimic acid‐3‐
phosphate, the plant cannot synthesize aromatic amino
acids. Roundup Ready® plants contain a trans gene that
encodes for a glyphosate‐tolerant EPSPS, which makes
them resistant to glyphosate.
Adapted from [4].
Figure 18.3 Structures of phosphoenol pyruvate (PEP) and

glyphosate. Notice that both structures contain a
phosphate group and a carboxylate group, making them
similar.
The discovery of a glyphosate‐resistant EPSPS in
Agrobacterium sp. strain CP4 lead to the development of
transgenic crops that are resistant to glyphosate [4]. This
made it possible to control weeds in fields where these GR
crops were growing by spraying them with glyphosate.
Presumably, CP4 EPSPS is resistant to glyphosate because
of an amino acid substitution in the active site that
prevents the binding of glyphosate by CP4‐EPSPS but does
not prevent the catalytic activity of the enzyme [5].
While these GE seeds were welcomed and rapidly adopted
by farmers, several activist groups began to raise questions
about the safety of foods made from these crops and the
possibility of environmental damage caused by the crops
themselves or by glyphosate. This has led to a growing
concern among consumers about these crops and
campaigns to require food companies to label foods as GE
foods. As a result, it became important to be able to
216
www.ajpdf.com
distinguish between foods that contain genetically

engineered ingredients from those that do not. This can be
achieved either by testing for the presence of the gene that
was inserted into the genome of the plant or by testing for
the specific protein that the inserted DNA encodes.
Polymerase chain reaction (PCR) methods are used to
detect genes. Immunoassays are widely used to detect
specific proteins in complex matrices.
In this experiment, we will test samples of corn meal or
corn flour for the Roundup Ready® gene using two
methods, PCR and immunoassay.
18.2.1 Detection of a GE Protein by

Immunoassay
Immunoassays involve the use of antibodies that are
specific for a given antigen, e.g. a transgenic protein in a
genetically engineered plant. Several companies have used
this technology to develop assays that can rapidly identify
GMO crops in the field. The most widely used of these are
the so‐called lateral flow devices (LFD), also known as test
strips. These devices may be used for either qualitative (a
yes or no answer) or semi‐quantitative determinations.
LFDs are constructed by applying a strip of nitrocellulose
membrane to a plastic backing and adding antibodies
specific for the protein of interest (Figure 18.4).
217
www.ajpdf.com
Figure 18.4 Diagram showing the structure of a typical

lateral flow device (LFD) for the detection of a GMO
protein.
Reproduced from a slide set produced by Romer Labs®.
A sample pad is applied to one end of the strip. This pad

will be dipped in the protein‐containing extract of the
sample. Just above the sample pad is another pad that
contains the antibody that is specific for the GE protein
antigen of interest. This antibody is labeled with a colored
marker, usually colloidal gold, and is mobile, i.e. it will
move up the strip with the extract. The device contains
another antibody specific to the GE protein, but this time it
is immobilized to the strip upstream from the mobile
conjugate pad and is not labeled with the colored marker.
This is called the capture antibody. A second capture
antibody is immobilized in a band above the first capture
antibody. This antibody is specific for the mobile antibody,
not the GE protein. See the paper by Grothaus et al. [6] for
a detailed explanation of how this assay works.
To do the test, the sample, e.g. a corn kernel, is ground, and
the protein is extracted. The bottom of the test strip is
submerged in the sample extract. The extract solution
moves upward by capillary action. As it passes through the
pad containing the gold‐labeled antibody, the GE protein
218
www.ajpdf.com
binds to the antibody and the complex moves upward

along with excess gold‐labeled antibody not complexed
with the GE protein. When the solution reaches the band
containing the capture antibody, the GE protein‐gold‐
labeled antibody complex is trapped and, as it accumulates,
a red‐colored band becomes visible (note that
nanoparticles of gold appear red). Excess gold‐labeled
antibody continues moving up the strip until it reaches the
band containing the immobilized antibody against the
gold‐labeled antibody where it accumulates in a second red
band. The purpose of the second band is to confirm that
the assay is working, i.e. that the gold‐labeled antibody is
moving up the strip. If a colored band appears below the
control line, the test is positive for the GE protein. If there
is no band below the control line, the test is negative. If no
bands appear, the test is invalid and should be repeated.
Note that heating may denature proteins. This often makes
soluble proteins insoluble. Insoluble proteins will not be
extracted and therefore will not be present in the solution
moving up the lateral flow device.
18.2.2 Detection of a Trans Gene by PCR

Polymerase chain reaction (PCR) methods are widely used
in a range of fields for the identification of specific genes.
For example, PCR is used in forensic science to identify
crime suspects, in food science to detect food fraud, in food
microbiology to identify foodborne pathogens, and in many
other applications. In this experiment, we will use PCR to
determine whether samples of corn meal contain a
genetically engineered transgene that confers resistance to
the herbicide glyphosate.
Students should review the basic principles of PCR
methodology that they learned in previous courses. The
reference by Namuth [7] provides a good review.
Basically, PCR methods are used to amplify a DNA fragment
of known sequence from an organism of interest by using a
DNA polymerase enzyme (this has been called molecular
photocopying). Amplification produces billions of copies of
219
www.ajpdf.com
a selected fragment of a gene in a short period of time,

making it possible to identify the presence of the gene in an
organism from a small amount of extracted DNA.
One big advantage of PCR is that all necessary components
of the reaction can be combined in a single tube. These
components include the following:
1. Template DNA (this is the DNA that you extract from

the sample you are analyzing).
2. Primers (a forward primer and a reverse primer).
Primers are short segments of DNA of known
sequence. They are used to identify the region on the
template you wish to copy. Sequences of primers for
detecting the CP4‐EPSPS gene have been published [5]
and are shown below. They are available for purchase
from commercial biotechnology supply companies.
a. (F): 5’‐ATGAATGACCTCGAGTAAGCTTGTTAA‐3’
b. (R): 5’‐AAGAGATAACAGGATCCACTCAAACACT‐3’
3. DNA polymerase. The most commonly used DNA
polymerase is Taq polymerase. Unlike most enzymes,
it is not denatured at temperatures near 100 °C, which
is important since high temperatures are required to
denature the template DNA (see below). Taq
polymerase was originally isolated from a
thermophilic bacterium called Thermus aquaticus. T.
aquaticus is able to grow in hot springs and that is
where it was originally discovered. The optimal
temperature for Taq polymerase activity is around 75
°C, but the enzyme is stable at temperatures
approaching the boiling point of water.
4. Deoxyribonucleotide phosphates (dNTPs): adenine
(A), guanine (G), cytosine (C), and thymine (T). A, G, C,
and T are required for DNA replication.
5. Buffer to maintain a pH that is optimal for Taq
polymerase activity.
220
www.ajpdf.com
6. Water. Molecular biology grade water certified to be

free of DNase and RNase is recommended.
The first step in a PCR analysis is extraction of DNA from

the sample. This can be tricky with plant samples since
they contain substances such as polysaccharides and
polyphenolics that can inhibit the PCR. In addition, since
plant cells have protective cell walls, it can be difficult to
lyse the cells. Kits are available from commercial
companies that contain reagents that facilitate cell lysis
and enable the removal of PCR inhibitors. One such kit is
the DNeasy Plant Pro Kit by QIAGEN [8].
The second step is amplification of a fragment of the gene
that encodes for the trait of interest. The amplification
process involves three steps:
1. Denaturation of the DNA in the sample. This is

accomplished by heating the extracted DNA to a
temperature high enough to break the hydrogen
bonds that hold the strands of double‐stranded DNA
together. Normally, this requires temperature in the
95–100 °C range. The result is single‐stranded DNA.
2. Primer annealing. In this step, the primers bind to
regions of the single‐stranded DNA that contain
sequences that are complementary to the sequence of
the primers. The temperature for this step is lower to
allow the primers to hydrogen bond to the single‐
stranded DNA in the sample. Normally, temperatures
in the range of 45–55 °C are used for this step.
3. DNA extension. In this step, which is carried out at 72
°C, the DNA polymerase enzyme extends the primer in
the 5’ → 3’ direction using the segment of the sample
DNA as the template. The reaction continues until the
DNA strand is extended to the end of the template
region to be copied, producing a new DNA strand that
is complementary to the template DNA sequence.
These reactions are conducted in a thermocycler, which is

an instrument that rapidly cycles the temperature between
221
www.ajpdf.com
the three temperatures selected. Once a cycle of the

reaction is complete, the three‐step process is repeated
over and over, usually 25–35 times. Each cycle doubles the
number of copies of the DNA fragment, so the amplification
proceeds as an exponential rate. After 30 cycles, there will
be 109 copies of the targeted DNA fragment! In our case,
the fragment will contain 108 base pairs (bp). This is
important to know because we will identify the fragment
based on its size.
The final step is to analyze the PCR products using agarose
gel electrophoresis to determine whether our sample
contains a 108 base pair DNA fragment. If it does, our
sample will be positive for the CPR‐EPSPS gene. If it does
not contain a DNA fragment of this size, we will conclude
that our sample is not glyphosate tolerant.
Agarose gel electrophoresis is a very effective method for
separating DNA fragments by size and visualizing them
with a dye that binds to DNA. Agarose is a polysaccharide
isolated from red algae seaweeds. At low concentrations in
water, it forms a gel. A gel is a three‐dimensional network
that forms when the individual polymers associate, usually
via non‐covalent linkages. Gels are porous, and the pore
size is inversely proportional to the concentration of the
polymer (agarose in this case) in the gel. DNA molecules
are negatively charged at neutral pH due to the phosphate
groups in the DNA backbone. Therefore, when an electric
field is applied to a gel containing DNA, it will migrate in
the direction of the anode (which is positively charged).
The charge density (mass/charge ratio) of DNA is uniform
regardless of the size of the molecule. Therefore, in agarose
gel electrophoresis, the rate at which the DNA moves
through the gel is inversely proportional to the size of the
DNA fragment, i.e. small fragments will migrate faster, large
fragments more slowly. Agarose gel electrophoresis can
separate DNA fragments ranging in size from around 100
bp to 25,000 (25 kb) bp [9]. When the electrophoresis run
is complete, DNA fragments will accumulate in bands at
varying distances from the origin. The DNA can be
visualized by staining with a dye that is visible under either
222
www.ajpdf.com
UV or visible light, depending on the dye used. The most

common dye used in DNA electrophoresis is ethidium
bromide. Unfortunately, ethidium bromide is a suspected
carcinogen so we recommend an alternative dye if possible.
One such dye is GelRed®, which is available through VWR
(Radnor, PA) and other suppliers of molecular biology
reagents.

1. Balances
2. Micropipettes
3. Pipette tips
4. Microwave or hot plate
5. PCR thermal cycler
6. PCR tubes
7. Electrophoresis apparatus

1. Corn meal or corn flour samples from Roundup
Ready® and organically grown varieties.
2. Lateral Flow Immunoassay Kit for Detecting CP4
EPSPS in corn. Romer Labs AgraStrip® RUR Bulk
Grain Strip Test – Qualitative Method [10] is
recommended but other kits will also work well.
3. DNeasy Plant Pro Kit by QIAGEN [8] or a similar kit for
DNA extraction.
4. Master mix for PCR amplification (AmpliTaq Gold®
360 PCR Master Mix [Thermo Fisher Scientific,
Waltham, MA] or similar master mix).
5. Forward and reverse primers for CP4 EPSPS gene ([5],
amplicon is 108 bp):
a. (F): 5’‐ATGAATGACCTCGAGTAAGCTTGTTAA‐3’
223
www.ajpdf.com
b. (R): 5’‐AAGAGATAACAGGATCCACTCAAACACT‐3’
Note: Others have used different primers for the
EPSPS gene to yield an amplicon of 256 bp [11]. You
may want to try both to see which works best:
c. (F): ACCGGCCTCATCCTGACGCT
d. (R): CCGAGAGGCGGTCGCTTTCC
6. Master mix with added primers (this will be prepared
by the teaching assistant). Amount for one PCR: 25 μl
AmpliTaq Gold® 360 PCR Master Mix + 5 μl of 1 μmol
l−1 forward primer, 5 μl of 1 μmol l−1 reverse primer +
5 μl water. This should be prepared just before use.
7. Agarose.
8. TAE buffer: 40 mmol l−1 Tris, 20 mmol l−1 acetic acid,
1 mmol l−1 EDTA.
9. Gel loading solution: Pre‐prepared solutions are
commercially available. They may contain sucrose or
glycerol plus a tracking dye. The sucrose or glycerol
increases the density of the solution allowing the
sample to settle to the bottom of the well in the gel.
Bromophenol blue or amaranth are common tracking
dyes. Tracking dyes should migrate ahead of the DNA
fragments during the electrophoresis run, serving as
an indicator for when to stop the run. We recommend
amaranth for this experiment since it is small enough
to run faster than a 100 bp DNA fragment.
10. GelRed® Nucleic Acid Gel Stain, 10,000 X or similar
product
11. 100 bp DNA Ladder (from Invitrogen™ or similar)
18.5 Procedures
Obtain two samples (A and B) of corn meal or corn flour
for analysis. These samples may or may not contain the
CP4 EPSPS gene. It is your job to determine whether or not
they do.
224
www.ajpdf.com
1. Immuno Assay for CP4 EPSPS (based on protocol

described in package insert for the AgraStrip® RUR
Bulk Grain Strip Test – Qualitative Method from Romer
Labs® [10]). Kits supplied by other companies will
also work. The following protocol is general and
specifics may differ depending on the kit. It is best to
follow the directions supplied by the manufacturer of
the kit.
a. Place 20 g of each corn meal sample in separate
tubes.
b. Add 25 ml distilled water and shake to mix.
c. Allow to settle and transfer 500 μl of the
supernatants to clean microcentrifuge tubes.
d. Insert the test strip into the sample so that the
liquid covers the sample pad but does not reach
the conjugate pad.
e. Leave the strip in the tube for five minutes.
f. Remove the strip, photograph it, and ascertain
whether the sample is genetically engineered or
not.
2. Polymerase Chain Reaction
a. Extract DNA from each sample using the DNeasy
Plant Pro Kit by QIAGEN [8] or a similar kit.
b. Transfer 40 μl master mix to a PCR tube.
c. Add DNA extract. Amount will depend on the
efficiency of the extraction. 1–10 μl is usually
sufficient.
d. Program PCR thermal cycler for five minutes at
95 °C to denature DNA; 30 cycles at 95 °C for 30
seconds, 50 °C for 30 seconds, and 72 °C for 30
seconds, and final extension at 72 °C for seven
minutes.
e. Place tubes in thermal cycler and run.
225
www.ajpdf.com
f. Store tubes at −20 °C until you are ready to run

the electrophoresis.
3. Agarose Gel Electrophoresis. The following protocol is
adapted from Swope et al. [5] and Lee et al. [9]
a. Gel preparation (most electrophoresis gel trays
require 100 ml of agarose solution).
i. Make a 2% (wt/vol) solution of agarose in
the TAE buffer. To do this, transfer 4 g
agarose to a 500 ml Erlenmeyer flask and
add 200 ml TAE buffer. Heat in a microwave
or on a hot plate to dissolve the agarose.
Allow to cool for a few minutes and then add
GelRed® Nucleic Acid Gel Stain, 10,000X
according to the manufacturer’s directions.
Once the gel solution is prepared and still a
liquid, pour it into the gel tray of the
electrophoresis apparatus. Be sure to place a
comb in the gel to create wells for loading
samples into the gel. Allow the gel to set and
place the tray in the electrophoresis
chamber. Add running buffer to the chamber
sufficient to cover the gel. The running buffer
should be the same as the buffer used to
dissolve the agarose.
b. Mix your DNA samples from the PCR run with a
gel loading solution in a vol/vol ratio of 9 DNA
sample/1 gel loading solution.
c. Load DNA samples from the PCR into the wells in
the gel using a micropipette. Normally, 10 μl of
the sample should be sufficient. Be sure to
include a DNA ladder (a DNA ladder contains
DNA fragments of known size and is used to
compare with samples to determine the sizes of
DNA fragments).
d. Turn on the power and run for about 45 minutes
or until the amaranth band is near the end of the
gel.
226
www.ajpdf.com
e. Remove and photograph your gel.

1. Which of your samples, A or B, do you believe contains
the Roundup Ready® gene? Recall that one is from
conventionally grown (non‐organic) corn and the
other from organically grown corn. If neither tested
positive for Roundup Ready®, explain why this might
be given that, presumably, one was Roundup Ready®
and the other was organic. If both tested positive,
explain how this might have happened.
2. How many bands were visible in each lane of your
electrophoresis gel? Was one of them 108 bp in
length? If you had more than one band, what might be
the identity of the other bands?
3. Do your results from the lateral flow strip and
PCR/electrophoresis agree? If not, what might be the
explanation?
4. Do you agree with pro‐labeling folks that all packaged
foods that contain an ingredient from a genetically
engineered crop should be labeled “Contains a GMO
ingredient?” Why or why not?
18.7 References
1 USDA AMS. Can GMOs be used in organic products? |
agricultural marketing service [Internet]. [cited 20
February 2020].
https://www.ams.usda.gov/publications/content/can‐
gmos‐be‐used‐organic‐products
2 USDA ERS. Recent trends in GE adoption [Internet]. [cited
20 February 2020]. https://www.ers.usda.gov/data‐
products/adoption‐of‐genetically‐engineered‐crops‐in‐
the‐us/recent‐trends‐in‐ge‐adoption.aspx
227
www.ajpdf.com
3 Duke, S.O. and Powles, S.B. (2008). Glyphosate: a once‐in‐

a‐century herbicide. Pest Management Science 64 (4):
319–325.
4 Pollegioni, L., Schonbrunn, E., and Siehl, D. (2011).
Molecular basis of glyphosate resistance – different
approaches through protein engineering. The FEBS
Journal 278 (16): 2753–2766.
5 Swope, N.K., Fryfogle, P.J., and Sivy, T.L. (2015). Detection
of the cp4 epsps Gene in Maize Line NK603 and
comparison of related protein structures: an advanced
undergraduate experiment. Journal of Chemical
Education 92 (7): 1229–1232.
6 Grothaus, G.D., Bandla, M., Currier, T. et al. (2006).
Immunoassay as an analytical tool in agricultural
biotechnology. Journal of AOAC International 89 (4):
913–928.
7 Namuth, D. (2003). \ [Internet]. Plant & Soil Sciences
eLibrary. https://digitalcommons.unl.edu/passel/98
8 DNeasy plant pro kit – QIAGEN [Internet]. [cited 20
February 2020].
https://www.qiagen.com/us/products/discovery‐and‐
translational‐research/dna‐rna‐purification/dna‐
purification/genomic‐dna/dneasy‐plant‐pro‐
kit/#orderinginformation
9 Lee, P.Y., Costumbrado, J., Hsu, C.‐Y., and Kim, Y.H. (2012).
Agarose Gel electrophoresis for the separation of DNA
fragments. Journal of Visualized Experiments 62: e3923.
10 Romer Labs. AgraStrip® test kits [Internet]. [cited 20
February 2020].
https://www.romerlabs.com/en/products/test‐
kits/gmo/
11 Datukishvili, N., Kutateladze, T., Gabriadze, I. et al.
(2015). New multiplex PCR methods for rapid screening
of genetically modified organisms in foods. Frontiers in
228
www.ajpdf.com
Microbiology [Internet]. [cited 20 February 2020], 6.

https://www.frontiersin.org/articles/10.3389/fmicb.20
15.00757/full

Chang, Y., Peng, Y., Li, P., and Zhuang, Y. (2017). Practices
and exploration on competition of molecular biological
detection technology among students in food quality
and safety major. Biochemistry and Molecular Biology
Education 45 (4): 343–350.
DNA Learning Center. Detecting genetically modified foods
by PCR [Internet]. [cited 20 February 2020].
http://bioinformatics.dnalc.org/gmo/animation/pdf/D
etecting%20GM%20Foods%20by%20PCR.pdf
EnviroLogix. GMO Testing Kits [Internet]. [cited 20
February 2020]. https://www.envirologix.com/gmo‐
testing/crops‐tested/
Roseboro, K . Testing for GMOs [Internet]. The Organic &
Non‐GMO Report. [cited 20 Februry 2020]. https://non‐
gmoreport.com/articles/testing‐for‐gmos/
Ross, J. PCR basics [Internet]. [cited 20 February 2020].
https://www.youtube.com/watch?v=GZBsMxzYacc
229
www.ajpdf.com
19
Food Emulsions and Surfactants

1. Explain the following terms: emulsion, surfactant,

hydrophile–lipophile balance (HLB), amphiphilic.
2. Identify and synthesize common food emulsions.
3. Differentiate between an oil‐in‐water and a water‐in‐
oil emulsion.
4. Apply the Bancroft Rule when choosing surfactants for
food applications.
5. Assess the surfactant solubilization capacity of
different dispersion systems.
19.2 Introduction
19.2.1 Emulsions
An emulsion, in its simplest definition, is a mixture
consisting of droplets of one immiscible liquid dispersed in
a continuous phase of another. In other words, it is a
dispersion system in which both the dispersed phase and
the continuous phase are liquids. Emulsions are common
in foods with oil and water as main components. For
example, whole milk can be considered an oil‐in‐water
emulsion in which droplets of milkfat (known as milkfat
globules and each surrounded by a thin layer of milkfat
globule membrane) are dispersed in the continuous phase
of water. Table 19.1 lists some common food emulsions.
230
www.ajpdf.com
Table 19.1 Common food emulsions and their typical oil

and water contents [1].
Food Oil content Water Emulsion
(%) content (%) type
Milk, whole 3.3 88.1 Oil‐in‐
water
Eggnog 4.2 82.5 Oil‐in‐
water
Cream, heavy 36.1 57.7 Oil‐in‐
whipping water
Ranch salad 44.5 45.7 Oil‐in‐
dressing water
Mayonnaise 74.9 21.7 Oil‐in‐
water
Margarine 80.2 17.1 Water‐in‐
oil
Butter 81.1 16.7 Water‐in‐
oil
Since the two liquids in an emulsion are immiscible, phase
separation would tend to occur spontaneously unless a
surfactant (also called an emulsifier or emulsifying agent)
is present to reduce the interfacial tension. As illustrated in
the concise experiment described in Section 5.5.3, a
temporary emulsion might be created after a 50:50
mixture of water and vegetable oil is shaken vigorously for
30 seconds, but without a surfactant, phase separation
would commence immediately when shaking stops.
19.2.2 Surfactants
Surfactants are amphiphilic molecules that contain both a
nonpolar region and a polar region on the same molecule.
They are called “surface‐active” molecules because of their
tendency to concentrate at the interface between two
immiscible fluids. For example, in an oil and water mixture,
the nonpolar region of the molecule will be attracted to the
oil and the polar region to the water. Nonpolar regions are
231
www.ajpdf.com
mostly lipophilic hydrocarbon chains or rings, whereas

polar regions are hydrophilic functional groups that could
be ionic (anionic, cationic, zwitterionic) or nonionic (e.g. a
hydroxyl group). The hydrophile‐lipophile balance (HLB),
which takes into account the size and strength of the
hydrophilic groups relative to the lipophilic groups within
the molecule [2, 3], is often used for the characterization of
surfactants. HLB values typically range from 1 to 20 with a
high value indicating a surfactant that is more hydrophilic,
and a low value more lipophilic.
Wilder Dwight Bancroft, a chemistry professor at Cornell
University, proposed, in a series of papers published
between 1912 and 1915, that “hydrophile be used for
colloidal solutions in water and hydrophobe for colloidal
solutions in non‐aqueous solutions” [4–9]. This has been
frequently cited as the Bancroft Rule when selecting
surfactants for different applications. Surfactants with high
HLB values of 8–18 (i.e. more hydrophilic) are therefore
suitable for oil‐in‐water emulsions where the continuous
phase is water, while surfactants with low HLB values of 3–
6 (i.e. more lipophilic) are suitable for water‐in‐oil
emulsions. Table 19.2 provides a broad guideline for the
types of surfactant applications based on HLB values [3].
Table 19.2 Applications of surfactants based on HLB
values [3].
HLB value range Application
3.5–6 w/o (water‐in‐oil) emulsifier
7–9 Wetting agent
8–18 o/w (oil‐in‐water) emulsifier
13–15 Detergent
15–18 Solubilizer
19.2.3 Surfactants in Food Systems

Many food emulsion systems are complex structures with
droplets and colloidal particles dispersed in matrices
containing components with different physical‐chemical
232
www.ajpdf.com
properties. Food product developers often include low‐

molecular‐weight (LMW) surfactants in formulations in
order to create final products with desirable textural and
rheological properties. LMW surfactants (e.g. lecithin), in
addition to their surface activity, can interact with food
molecules and polymers through intermolecular forces and
assemble into three‐dimensional gel networks, often
referred as liquid crystals or mesomorphic phases – phases
intermediate between liquid and crystalline solid [10].
LMW surfactants are widely used in formulating semi‐solid
foods such as margarine and other fat spreads that require
specific structural characteristics. Figure 19.1 shows the
structures of some common LMW surfactants. Depending
on the surfactant concentration, the water‐to‐oil ratio, and
the presence of stearic acid as a structural component,
Gaudino et al. [11] were able to create edible gels with
canola oil and water in a network of reverse micellar
bundle fibers formed by soy lecithin. Admittedly, the
resulting water‐in‐oil “emulsion” goes beyond the simple
definition aforementioned, the end‐product, nevertheless,
is a homogeneous blend of canola oil and water with a
spreadable gel structure aided by lecithin and stearic acid.
233
www.ajpdf.com
Figure 19.1 Structures of common LMW surfactants. (a)

phosphatidylcholine (one of the main phospholipids in soy
lecithin); (b) sodium lauryl sulfate; (c)
polyoxyethylenesorbitan monooleate, often known as
polysorbate 80 or by its trade name TWEEN® 80.
Another important use of LMW surfactants in food systems
is the dispersion of lipophilic ingredients in aqueous phase.
High HLB surfactants such as polysorbates at sufficient
concentrations (i.e. above the so‐called critical micellar
concentration) can aggregate into spherical vesicles called
micelles, which are capable of encapsulating lipophilic
ingredients in the center, thereby forming a
thermodynamically stable dispersion in water [12].
Surfactant micelles as a delivery system can improve the
dispersibility and increase the bioavailability of bioactive
compounds [13], making it ideal for new product
developments, as well as novel food processing
applications. For example, plant‐based essential oils with
antimicrobial properties have been encapsulated by high
234
www.ajpdf.com
HLB surfactant micelles and successfully incorporated into

the washing steps for spinach and tomato to reduce
pathogenic bacterial loads [14–17].
It should be noted that surfactants are food additives, and
therefore their usage is regulated in the United States by
the Food and Drug Administration (FDA) [18]. Readers are
strongly encouraged to check out the approved surfactant
concentrations and uses when developing new product
formulations.
235
www.ajpdf.com
19.3 Part I – Butter Churning (Phase

Inversion)
Phospholipids and proteins represent about 90% of the
dry weight of the milkfat globule membrane, which not
only serves as the emulsifying agent for the dispersion of
milkfat globules in the aqueous phase of milk but also
protects the globules from the attacks by the enzyme lipase
[19]. During butter churning, milkfat globules in cream are
physically agitated to disrupt the membrane, leading to the
coalescence of milkfat and the formation of butter grains,
as well as separation from the remaining milk serum called
buttermilk. The butter grains are collected and the post‐
churning working stage further removes remaining
buttermilk until a desired consistency is reached. Butter
should contain not less than 80% milkfat by weight, with
water droplets finely dispersed in the continuous phase of
milkfat. Hence, butter churning may be appreciated as a
phase‐inversion process, as an oil‐in‐water emulsion
(cream) is converted into a water‐in‐oil emulsion (butter).

19.3.1.1 Materials for Buttermaking
1. Glass canning jar with seals and rings, 1‐quart, clean

(2 per group)
2. Heavy whipping cream at room temperature (125 ml)
3. Heavy whipping cream at refrigeration temperature
(125 ml)
4. Teaspoons for kneading butter
5. Bowls for kneading butter
6. Stopwatch
7. Crackers and salt for tasting the butter (optional)
8. Paper plates
9. Plastic knives
236
www.ajpdf.com
10. Conductivity meter
19.3.1.2 Buttermaking Procedure
1. Make sure the jar and its lid are clean. Wash with
warm soapy water and rinse thoroughly with cold tap
water if needed.
2. Transfer 125 ml of the heavy cream at room
temperature into the jar.
3. Close the lid tight and start shaking the jar. Start the
stopwatch.
4. The cream inside the jar will initially be converted into
whipped cream as milkfat starts to clump together
and air is being incorporated. Continue to shake the
jar even if it feels like the whipped cream is not
moving inside the jar.
5. As the agitation continues, the coalescence of milkfat
in the cream will eventually lead to the formation of
the yellowish butter grains and separation from the
remaining milk serum (buttermilk). Stop the
stopwatch when the buttermilk and butter grains
separate. Record the time elapsed.
6. Decant the buttermilk. Replace the lid and shake the
jar a few more times to further separate the remaining
buttermilk still trapped in the butter grains.
7. Transfer the butter grains to a bowl and use a spoon to
gently knead the butter. More buttermilk could be
pressed out and should be drained. Repeat this
process until a consistent butter is achieved. If you
want to taste the butter, transfer a small portion of
butter into a paper plate.
8. Clean the jar and the lid with warm soapy water. Rinse
thoroughly with cold tap water.
9. Repeat Steps 2–8 with the heavy cream at
refrigeration temperature.
10. Store the butter at refrigeration temperature.
237
www.ajpdf.com

1. Weigh the butter and calculate the yield. In other
words, how much milkfat from the cream ends up in
the butter, assuming the butter contains 80% fat? Did
the cream temperature affect the yield? Explain your
answer.
2. Did the cream temperature affect the churning time?
Explain your answer.
3. What cream temperature treatment is the best for
butter churning?
4. Measure the conductivity of cream and butter. Are you
able to conclude what type of emulsions they are (oil‐
in‐water or water‐in‐oil)?
238
www.ajpdf.com
19.4 Part II – Margarine Manufacture

(Use of Surfactant for Semi‐solid
Foods)
Margarine was defined by the US Congress in 1950 (in an
Act to repeal the taxes on margarine) to include “all
substances, mixtures, and compounds, which have a
consistence similar to that of butter and which contain any
edible oils or fats other than milk fat if made in imitation or
semblance of butter.” FDA further set the compositional
standard that “margarine (or oleomargarine) is the food in
plastic form or liquid emulsion, containing not less than
80% fat” [21CFR166.110]. Although fats from animal
origin are allowed, most margarines available in the
marketplace are made from vegetable oils. Specifically,
partially hydrogenated oils (PHOs), a potential source of
harmful trans fats, were common ingredients in
commercial margarines in the last century. Owing to the
increased health concerns of dietary trans fats, FDA
officially banned the use of PHOs in all food products in the
United States starting in June 2018 [20]. The use of
surfactants such as lecithin for the formation of semi‐solid
edible high‐fat gels would allow manufacturers to remove
PHOs from their formulations, and yet retain the structural
characteristics of margarine‐type products.
19.4.1 Materials and Methods (Adapted from

[11])
19.4.1.1 Materials for Margarine Manufacture
1. Canola oil
2. Water
3. Soy lecithin powder
4. Stearic acid flakes
5. Hotplate, large beaker and boiling chips for setting a
boiling water bath
239
www.ajpdf.com
6. Water bath at 55 °C
7. Falcon tubes (or any equivalent plastic tubes)
8. Paper plates
9. Plastic knives
10. Microscope (1000x)
19.4.1.2 Manufacture Procedure
1. Weigh 4 g of lecithin and 4 g of stearic acid.

2. Transfer the lecithin and stearic acid into 32 ml of
canola oil in a Falcon tube.
3. Heat the loosely‐capped tube in a boiling water bath
for 30 minutes to completely dissolve all the
ingredients.
4. Move the tube to a water bath at 55 °C.
5. When the oil mixture reaches 55 °C, add 8 ml of water
that has also been preheated to 55 °C.
6. Tighten the cap. Shake the tube vigorously for at least
one minute.
7. Cool down the tube in a refrigerator. The resulting
mixture is margarine.
8. Compare the spreadability of margarine and butter
samples (adapted from [21]): Spread some of the
sample on fresh bread or a paper plate with a table
knife. Spreadability is to be described by one of the
following five terms: (i) much too soft, (ii) soft but
acceptable, (iii) desirable, (iv) hard but acceptable,
and (v) much too hard.
9. Alternatively, measure spreadability with a texture
analyzer equipped with the TTC Spreadability
Fixture™ (Texture Technologies Corp., Hamilton, MA)
by following the manufacturer’s procedures. Briefly,
the set‐up involves an acrylic 90° cone as the
penetration probe and the corresponding cone cup
sample holders. Samples are first deposited into
240
www.ajpdf.com
sample holders and pre‐cooled at refrigeration

temperature. The maximum peak value in the
resulting force‐time curve is recorded as spreadability.
1. How would you describe the spreadability of the

margarine at refrigeration temperature, as compared
to butter? Assuming both butter and margarine
samples contain 80% fat, what would your results
suggest about the fatty acid composition that lead to
the observed difference in spreadability?
2. What other methods could be used by margarine
manufacturers to by‐pass the use of PHOs in fat
spread products?
3. Observe the structure of margarine under a
microscope. Would you say the margarine is a water‐
in‐oil emulsion? How do you know?
241
www.ajpdf.com
19.5 Part III – Dispersion of Eugenol

in Water (Surfactant Solubilization
Capacity)
The solubilization capacity of a surfactant may be
estimated by determining the maximum additive
concentration (MAC). MAC is the maximum amount of a
lipophilic compound that can be solubilized in a micellar
solution at a given surfactant concentration [14, 15]. The
solubilization capacity is heavily dependent on the
surfactant type and increases with surfactant
concentration [22]. Environmental factors such as pH [14],
temperature [14, 23], and the presence of salt [24] all play
a critical role in micellar structure, stability, and properties,
and thus could lead to significant variations in the MAC of a
surfactant. See the review by Armstrong [25] for a more
thorough discussion.
Eugenol, a plant essential oil extracted from clove oil, has
been shown to have potent antibacterial and antifungal
properties [26, 27]. In this experiment, we will utilize a
visible light spectrophotometer to study the solubilization
capacity of several high‐HLB surfactants when dispersing
eugenol in water. At any given surfactant concentration, the
MAC will be determined by monitoring changes in optical
density (OD) at λ = 632 nm of the surfactant solution with
increasing eugenol concentrations. The eugenol
concentration at which the absorbance of the surfactant
solution starts to deviate from zero, suggesting that no
more eugenol molecules could be encapsulated by the
surfactant micelles, is noted as the MAC [14, 15].
19.5.1 Materials and Methods (Adapted from

[14–16])
19.5.1.1 Materials for Dispersion Experiment
1. Eugenol
2. DI water
242
www.ajpdf.com
3. Polyoxyethylenesorbitan monolaurate or TWEEN®

20; HLB = 16.7
4. Polyoxyethylenesorbitan monooleate or TWEEN® 80;
HLB = 15
5. Sodium lauryl sulfate (also called sodium dodecyl
sulfate or SDS); HLB = 40 (Note: Surfactant HLB
values typically range from 1 to 20. Sodium lauryl
sulfate is atypical with a value of 40, suggesting that it
is very hydrophilic.)
6. Beakers for preparing the surfactant stock solutions
7. Falcon tubes (or any equivalent plastic tubes)
8. Vortex mixer
9. Cuvettes
10. Spectrophotometer for OD632
1. Prepare a 5% w/v surfactant stock solution by

completely dissolving 10 g of surfactant in 190 ml of
DI water. (Note: we use 5% as it is said to be a typical
surfactant concentration for emulsion applications
[14]. Students working in groups are encouraged to
try different surfactant concentrations to examine the
correlation between MAC and surfactant
concentration.)
2. Add eugenol to the surfactant stock solution in tubes
at concentrations shown in the following tables.
For TWEEN® 20 and TWEEN® 80 surfactant solutions:

Eugenol Amount Amount of Total amount
concentration of surfactant of the
(v/v) eugenol solution mixture
(ml) (ml) (ml)
0% 0.00 10.00 10.00
243
www.ajpdf.com

(ml) (ml) (ml)
0.5% 0.05 (= 9.95 10.00
50 μl)
0.6% 0.06 (= 9.94 10.00
60 μl)
0.7% 0.07 (= 9.93 10.00
70 μl)
0.8% 0.08 (= 9.92 10.00
80 μl)
0.9% 0.09 (= 9.91 10.00
90 μl)
1.0% 0.10 (= 9.90 10.00
100 μl)
1.1% 0.11 (= 9.89 10.00
110 μl)
1.2% 0.12 (= 9.88 10.00
120 μl)
1.3% 0.13 (= 9.87 10.00
130 μl)
For SDS surfactant solution:
(ml) (ml) (ml)
0% 0.00 10.00 10.00
0.5% 0.05 (= 9.95 10.00
50 μl)
1.0% 0.10 (= 9.90 10.00
100 μl)
244
www.ajpdf.com

(ml) (ml) (ml)
1.5% 0.15 (= 9.85 10.00
150 μl)
2.0% 0.20 (= 9.80 10.00
200 μl)
2.5% 0.25 (= 9.75 10.00
250 μl)
3.0% 0.30 (= 9.70 10.00
300 μl)
3.5% 0.35 (= 9.65 10.00
350 μl)
4.0% 0.40 (= 9.60 10.00
400 μl)
3. Mix thoroughly the content of the tubes with the help

of a vortex mixer at high setting. You should be able to
see a series of samples ranging from clear to turbid as
the concentration of eugenol increases.
4. Set the wavelength of the spectrophotometer at 632
nm and first adjust the absorbance to zero using
water. Remember to allow time for the
spectrophotometer to warm up before making
measurements.
5. Use the 0% eugenol sample as the reagent blank.
Measure the absorbance of the mixtures at 632 nm.
6. The eugenol concentration at which the absorbance
starts to deviate from zero (absorbance greater than
0.05) is the MAC.
7. Repeat Steps 1–6 for another surfactant.
245
www.ajpdf.com
1. Express the solubilization capacity of the surfactant

on a per g basis, i.e. ml of solubilized eugenol/g of
surfactant. Which surfactant has the highest
solubilization capacity?
2. Is the HLB value a good predictor of the solubilization
capacity of a surfactant? Discuss other factors that
might affect the solubilization capacity.
246
www.ajpdf.com
19.6 Part IV – Mayonnaise Stability

The three basic ingredients for mayonnaise are vegetable
oil, vinegar, and egg yolk (with quite a few additives and
flavorings being optional). Mayonnaise must contain not
less than 65% fat [21CFR169.140], typically 70–75%, but it
is an oil‐in‐water emulsion nonetheless. In other words,
mayonnaise is a bit unusual in the sense that the dispersed
phase (oil) has a higher concentration than the continuous
phase (water). Any emulsifying agents present in the basic
ingredients would have to adequately stabilize a large
amount of oil in the aqueous phase.
Egg yolk can be separated into two main fractions upon
centrifugation: the yellowish liquid plasma and the
insoluble granules. Lipoprotein particles, made up of
proteins, cholesterol, triglycerides, and phospholipids, are
present in both fractions. The plasma fraction on a dry
weight basis contains about 85% low‐density lipoprotein,
while the granules contain about 70% high‐density
lipoprotein [28]. (Note: Densities of lipoproteins vary
depending on the relative concentrations of protein and
lipids. Densities decrease as lipid concentrations increase
and protein concentrations decrease.) Overall, egg yolk
contains about 8.2% phospholipids [29] which are the key
ingredients that maintain the emulsion stability of
mayonnaise.
Salad dressing made with vegetable oil and vinegar is
similar to mayonnaise in that egg yolk also serves as the
key emulsifying agent, but the fat content is lower. Salad
dressing must contain not less than 30% fat
[21CFR169.150], typically 40–45%, and includes a starchy
paste as a required ingredient. Food gums are optional and
often are added by food manufacturers to improve the
textural properties of the final product. See Section 5.5.3
for a demonstration of the emulsifying properties of food
gums. It is worth noting that commercially available
dressings commonly known as salad dressings cannot
legally be called “salad dressing” if they do not meet the
standard of identity mentioned above [21CFR169.150].
247
www.ajpdf.com
These dressings often do not contain eggs. They are

emulsified with gums, often xanthan gum, rather than a
phospholipid or other emulsifier. They have names like
“Balsamic Vinaigrette Dressing.” See the KraftHeinz website
for examples of these types of dressings:
https://www.myfoodandfamily.com/brands/kraft‐
dressing/products/25001/products (accessed 03 March
2020).

19.6.1.1 Materials for Mayonnaise Experiment
1. Vegetable oil
2. Vinegar (5% acetic acid solution)
3. Liquid egg yolk
4. Water
5. Blender
6. Graduated cylinders, 100 ml

Prepare mayonnaise samples at five different egg yolk
concentrations following the basic recipes shown in the
table below.
Mayonnaise ingredients (ml) Egg yolk level
10% 7.5% 5% 2.5 0%
1. Vegetable oil 75 75 75 75 75
2. Vinegar (5% acetic acid) 15 15 15 15 15
3. Liquid egg yolk 10 7.5 5 2.5 0
248
www.ajpdf.com
Mayonnaise ingredients (ml) Egg yolk level

10% 7.5% 5% 2.5 0%
4. Water 0 2.5 5 7.5 10
1. Pour the egg yolk, vinegar, and water into a blender.

Blend at medium speed for 30 seconds.
2. Add a small portion of the oil to the mixture. Blend at
medium speed until the oil is completely mixed in.
3. Repeat Step 2 until all oil is added. Blend at medium
speed for an additional 30 seconds.
4. Transfer the mayonnaise into a graduated cylinder.
Observe for phase separation after 15 and 60 minutes,
and after one, three, and seven days.

1. Vegan mayonnaise contains no egg ingredients. What
other natural food ingredients would you recommend
to replace egg yolk in vegan mayonnaise? Read the
ingredient list of commercial vegan mayonnaise, what
ingredients are responsible for the stability of the
emulsion?
2. A common optional ingredient in the manufacture of
mayonnaise is mustard. Besides contributing to the
flavor, what is the purpose of adding mustard? Explain
your answer.
3. In addition to phospholipids, egg yolk also contains
cholesterol, which has a reported HLB value of 2.7
[30], i.e. it is very lipophilic and thus effective for
stabilizing water‐in‐oil emulsions. And yet,
mayonnaise is an oil‐in‐water emulsion. Explain.
(Hint: what is the ratio of phospholipids to cholesterol
in egg yolk? And what happens if the ratio is too low?)
19.7 References
249
www.ajpdf.com
1 FoodData Central [Internet]. [cited 29 January 2020].

https://fdc.nal.usda.gov/index.html
2 Griffin, W.C. (1949). Classification of surface‐active
agents by “HLB”. Journal of the Society of Cosmetic
Chemists 1: 311–326.
3 Davies, J.T. (1957). A quantitative kinetic theory of
emulsion type. I. Physical chemistry of the emulsifying
agent. Proceedings of 2nd International Congress Surface
Activity, 426–438.
4 Bancroft, W.D. (1912). The theory of emulsification, I. The
Journal of Physical Chemistry 16 (3): 177–233.
5 Bancroft, W.D. (1912). The theory of emulsification, II.
The Journal of Physical Chemistry 16 (5): 345–372.
6 Bancroft, W.D. (1912). The theory of emulsification, III.
7 Bancroft, W.D. (1912). The theory of emulsification, IV.
8 Bancroft, W.D. (1913). The theory of emulsification, V.
9 Bancroft, W.D. (1915). The theory of emulsification, VI.
10 Heertje, I., Roijers, E.C., and Hendrickx, H.A.C.M. (1998).
Liquid crystalline phases in the structuring of food
products. LWT – Food Science and Technology 31 (4):
387–396.
11 Gaudino, N., Ghazani, S.M., Clark, S. et al. (2019).
Development of lecithin and stearic acid based oleogels
and oleogel emulsions for edible semisolid applications.
Food Research International 116: 79–89.
12 Kralova, I. and Sjöblom, J. (2009). Surfactants used in
food industry: a review. Journal of Dispersion Science
and Technology 30 (9): 1363–1383.
250
www.ajpdf.com
13 Flanagan, J. and Singh, H. (2006). Microemulsions: a

potential delivery system for bioactives in food. Critical
Reviews in Food Science and Nutrition 46 (3): 221–237.
14 Gaysinsky, S., Davidson, P.M., Bruce, B.D., and Weiss, J.
(2005). Stability and antimicrobial efficiency of eugenol
encapsulated in surfactant micelles as affected by
temperature and pH. Journal of Food Protection 68 (7):
1359–1366.
15 Gaysinsky, S., Davidson, P.M., Bruce, B.D., and Weiss, J.
(2005). Growth inhibition of Escherichia coli O157: H7
and Listeria monocytogenes by carvacrol and eugenol
encapsulated in surfactant micelles. Journal of Food
Protection 68 (12): 2559–2566.
16 Ruengvisesh, S., Loquercio, A., Castell‐Perez, E., and
Taylor, T.M. (2015). Inhibition of bacterial pathogens in
medium and on spinach leaf surfaces using plant‐
derived antimicrobials loaded in surfactant micelles.
Journal of Food Science 80 (11): M2522–M2529.
17 Ruengvisesh, S., Oh, J.K., Kerth, C.R. et al. (2019).
Inhibition of bacterial human pathogens on tomato skin
surfaces using eugenol‐loaded surfactant micelles
during refrigerated and abuse storage. Journal of Food
Safety 39 (2): e12598.
18 e‐CFR: TITLE 21—Food and Drugs [Internet].
Electronic Code of Federal Regulations. Sect. Part 172—
Food Additives Permitted for Direct Addition to Food for
Human Consumption. https://www.ecfr.gov/cgi‐
bin/text‐idx?
SID=0b8004630f024a1e7e349c48ddc9e30b&mc=true
&tpl=/ecfrbrowse/Title21/21cfr172_main_02.tpl
19 Elías‐Argote, X., Laubscher, A., and Jiménez‐Flores, R.
(2013). Dairy ingredients containing milk fat globule
membrane: description, composition, and industrial
potential. In: Advances in Dairy Ingredients (eds. G.W.
Smithers and M.A. Augustin ), 71–98. Ames, Iowa:
251
www.ajpdf.com
Wiley: Institute of Food Technologists. (IFT Press

series).
20 FDA (2015). Final determination regarding partially
hydrogenated oils. Federal Register 80 (116): 34650–
34670.
21 Riel, R.R. (1960). Specifications for the spreadability of
butter. Journal of Dairy Science 43 (9): 1224–1230.
22 Weiss, J. and McClements, D.J. (2000). Mass transport
phenomena in oil‐in‐water emulsions containing
surfactant micelles: solubilization. Langmuir 16 (14):
5879–5883.
23 Zana, R. and Weill, C. (1985). Effect of temperature on
the aggregation behaviour of nonionic surfactants in
aqueous solutions. Journal de Physique Lettres 46 (20):
953–960.
24 Thévenot, C., Grassl, B., Bastiat, G., and Binana, W.
(2005). Aggregation number and critical micellar
concentration of surfactant determined by time‐
dependent static light scattering (TDSLS) and
conductivity. Colloids and Surfaces A: Physicochemical
and Engineering Aspects 252 (2): 105–111.
25 Armstrong, D.W. (1985). Micelles in separations:
practical and theoretical review. Separation and
Purification Methods 14 (2): 213–304.
26 Bullerman, L.B., Lieu, F.Y., and Seier, S.A. (1977).
Inhibition of growth and aflatoxin production by
cinnamon and clove oils. Cinnamic aldehyde and
eugenol. Journal of Food Science 42 (4): 1107–1109.
27 Gill, A.O. and Holley, R.A. (2004). Mechanisms of
bactericidal action of cinnamaldehyde against listeria
monocytogenes and of eugenol against L.
monocytogenes and Lactobacillus sakei. Applied and
Environmental Microbiology 70 (10): 5750–5755.
252
www.ajpdf.com
28 Anton, M. (2013). Egg yolk: structures, functionalities

and processes. Journal of the Science of Food and
Agriculture 93 (12): 2871–2880.
29 Blesso, C.N. (2015). Egg phospholipids and
cardiovascular health. Nutrients 7 (4): 2731–2747.
30 Pasquali, R.C. and Bregni, C. (2006). Balance hidrofílico‐
lipofilico (HLB) del colesterol y sus aplicaciones en
emulsiones del tipo aceite en agua. Acta Farmaceutica
Bonaerense 25 (2): 239–244.

Brady, J.W. (2013). Introductory Food Chemistry , 638.
Hasenhuettl, G.L. and Hartel, R.W. (eds.) (2008). Food
Emulsifiers and their Applications , 2e, 426. New York:
Springer.
McClements, D.J. (2016). Food Emulsions: Principles,
Practices, and Techniques , 3e, 690. Boca Raton: CRC
253
www.ajpdf.com
Appendix I
Conversion Factors
Mass
1 kg = 103 g = 2.2046 pounds (lb)

1 lb= 16 ounces (oz) = 453.59 g
1 oz = 28.35 g
1 ton = 2000 lb = 907.185 kg
1 metric ton = 1000 kg = 1.10 ton
Volume
1 quart (qt) = 4 cups (c) = 32 fluid oz (fl oz) = 0.946 l

1 gallon (gal) = 4 qt = 3.785 l
1 l = 1.0567 qt = 1000 ml
1 c = 8 fl oz = 237 ml =16 tablespoons
1 tablespoon = 3 teaspoons = 0.5 fl oz = 14.8 ml
1 teaspoon = 4.9 ml
Length
1 m= 1.0936 yards = 39.37 inches (in)

1 km = 0.621 miles (mi)
1 mi = 5280 feet (ft) = 1.609 km
1 inch (in) = 2.54 cm
1 Angstrom (Å) = 10−10 m
Temperature
°K = °C + 273.15
254
www.ajpdf.com
°C = (°F – 32)
°F = + 32
Energy
1 Calorie (Cal) = 1000 cal = 1 kcal

1 cal = 4.184 Joules (J)
1 kcal = 4.184 kJ
Prefixes
milli = 10−3
micro = 10−6
nano = 10−9
pico = 10−12
kilo = 103
255
www.ajpdf.com
Appendix II
Concentration
Concentration is used to express the relative amount of a
substance in a solution, food, or other material. When the
mixture is homogeneous, as is the case in solutions, the
concentration will be the same in all parts of the mixture.
Thus, if the concentration of a sample or aliquot taken from
a larger portion is measured, the concentration of the
entire portion is known. Also, when the concentration and
the total volume or weight of a mixture is known, the total
amount of the solute can be determined: amount of solute
= (concentration) × (volume or weight of solution).
Definition
Concentration is the amount of a substance present per
unit volume or weight of a liquid or solid. Units of
concentration include two terms arranged in a ratio. Some
common expressions of concentration are listed in Table
II.1.
256
www.ajpdf.com
Table II.1 Common expressions of concentration.

Unit of Definition Common
concentration abbreviations
Molarity mol solute/l solution M, mol l–1
Millimolarity mmol solute/l mM, mmol l–1
solution
Normality Equivalents solute/l N, Eq l–1, equiv l–
solution 1
Weight percent g solute/100 g wt %, w/w %
solution
Milligram mg solute/100 g mg %
percent solution
Weight/volume g solute/100 ml w/v %
percent solution
Parts per g solute/g solution × ppm, mg kg–1, µg
million 106 or mg solute/l g–1, mg l–1, µg
solution ml–1
Parts per g solute/g solution × ppb
billion 109
Suggested Reading
Robinson, J.K., McMurry, J., and Fay, R.C. (2019). Chemistry,
8e, 1200. Hoboken, NJ: Pearson Education, Inc.
Segel, I.H. (1976). Biochemical Calculations: How to Solve
Mathematical Problems in General Biochemistry, 2e, 441.
New York: Wiley.
257
www.ajpdf.com
Appendix III
Acids, Bases, Buffers, and pH
Measurement
Review of pH and Acid–Base

Equilibria
Acids and Bases
Recall the following definitions:
Bronsted‐Lowry acid: A substance that can donate a

proton (H+).
Bronsted‐Lowry base: A substance that can accept a
proton.
Acids and bases react to neutralize each other and form

salts:
When the acid donates a proton, the resulting anion

becomes a proton acceptor or a base. When the base
accepts a proton, it becomes an acid. When chemical
species differ only by the presence or absence of a proton,
they are called conjugate acid/base pairs: A− is the
conjugate base of HA; BH+ is the conjugate acid of B. For
example, when acetic acid is dissolved in water, it reacts
with water (the base in this case):
Since the concentration of water is essentially constant in

dilute solutions, it is common to write the above equation
leaving out the water:
258
www.ajpdf.com
It is important to keep in mind that free protons in water

solution are always bound to water molecules. Since some
of the acetic acid molecules give up protons in water to
form ions, we say that acetic acid dissociates or ionizes in
solution.
Acid/Base Equilibria
To understand acid/base chemistry in more depth, we
apply the principles of chemical equilibrium. Recall that
many chemical reactions do not go to completion, i.e. they
are reversible. When this is the case, there will be a point in
time after two reactants are brought together when the
concentrations of reactants and products reach a constant
value. This is known as the state of chemical equilibrium:
Where A and B are reactants, C and D are products, and a,

b, c, and d are coefficients in the balanced chemical
equation.
At equilibrium, the concentrations can be described by the
equilibrium constant, Keq:
If we can write a balanced equation for a reaction

occurring in a solution and if we know the value of the
equilibrium constant for the reaction, it is possible to
determine the concentration of a given species if the
concentrations of the other species are known.
The strengths of acids and bases are determined by the
extent to which they ionize in aqueous solution. Acids and
bases that ionize nearly completely are termed “strong.”
HCl and NaOH are examples of a strong acid and a strong
base, respectively. Some acids and bases ionize to only a
259
www.ajpdf.com
limited extent, making them examples of “weak” acids or

“weak” bases. Acetic acid is an example of a weak acid.
Ammonia is an example of a weak base. It reacts with
water to form an ammonium ion and a hydroxide ion:
The ionization of weak acids and bases at equilibrium may

also be expressed as equilibrium constants, in this case
referred to as Ka or Kb. For example, the equilibrium
expression for ammonia is:
Again, the concentration of water is assumed constant and

is not included in the equilibrium equation.
Water itself is a weak acid and ionizes to a limited extent:
Thus, the equilibrium constant for water is:
Since the concentration of water is assumed constant in

aqueous solution, a new equilibrium constant, Kw, is
defined:
The concentration of H+ (often written as [H+]) or OH−

([OH−]) in solutions of weak acids or bases may be
calculated if Ka or Kb and the concentration of the acid or
base are known. Once [H+] or [OH−] is known, the
concentration of the other is easily calculated using the
equation for Kw.
260
www.ajpdf.com
The pH Scale
Concentrations of hydrogen ions in foods and other
biological systems are usually 0.01 mol l−1 or less.
Therefore, it is often more convenient to express them on a
logarithmic scale using pH notation. In this notation, pH is
defined as the negative log of the hydrogen ion
concentration: pH = −log [H+]. To calculate the pH of a
system, the concentration of hydrogen ions must first be
determined. As an example, let’s calculate the pH of pure
water. Since [H+][OH−] = 10−14, and in pure water [OH−] =
[H+], then [H+] = 10−7 M. Thus, pH = −log 10−7 = 7.
To calculate the pH of a 10−2 M solution of a strong acid,
HA, we assume complete dissociation, so [H+] = [A−] = 10−2
M. Thus, pH = −log [H+] = −log 10−2 = 2.
Now let’s determine the pH of a 10−3 M solution of the
weak acid HA (Ka = 1.6 × 10−6). At equilibrium:
Since [H+] = [A−], we can substitute H+ for A−:
Since HA is a weak acid, we can assume that [H+] is very

much smaller than [HA] (why?) and thus we can disregard
it when calculating the concentration of HA in solution.
Solving for [H+], we have [H+] = 4.0 × 10−5. To calculate pH,
we simply plug into the equation for pH:
261
www.ajpdf.com
Refer to any introductory chemistry book or see Segel [1]

for exercises of this kind.
pK
Another important concept to review is pK. Ka or Kb are
frequently expressed in terms of pK instead of K. pKa = −log
Ka and pKb = −log Kb. Thus, an acid with a Ka of 10−3 has a
pKa of 3. What is the pKb of a base with Kb = 1.4 × 10−2?
The pKa of an acid may be determined by titrating the acid
with base and plotting a titration curve. The titration graph
of a weak acid is shown in Figure III.1. Notice that in the
region between pH 4 and 6, large amounts of base are
added with little change in pH. This, by definition, is the
buffer region. After pH 6.5, tiny amounts of base produce a
very large change in pH. This is termed the equivalence
point, where all acid molecules have been converted to the
salt form, i.e. the number of equivalents of base added
equals the number of equivalents of acid initially present.
To determine the pK, simply find the pH at which half the
base equivalents have been added, in this case 500 ml. At
this point, [HA] = [A−], and so pH = pKa.
262
www.ajpdf.com
Figure III.1 Titration of a weak monoprotic acid, HA (pKa =

5.00) with a strong base (KOH). Note that the acid is half
titrated, [HA = A−], when 500 ml of the base is added.
Buffers: Functions and Uses

The addition of even small amounts of strong acids or
bases to water or to dilute solutions of strong acids or
bases causes large changes in pH. The pH of a buffered
solution, on the other hand, changes only a little when
small amounts of acids or bases are added. Buffers are
solutions containing a weak acid and its conjugate base or
a weak base and its conjugate acid.
To understand how buffers work, recall that the Ka of an
acid is defined as:
Rewriting we have:
263
www.ajpdf.com
Taking the negative log of both sides:
Or
This is the familiar Henderson–Hasselbalch equation.

Notice that when the concentrations of the acid HA and its
salt, A−, are equal, pH = pKa.
The Henderson–Hasselbalch equation is useful for a
number of reasons. First, it may be used to show that
additions of small amounts of acid or base to a buffer result
in very small changes in pH compared to what would occur
in pure water or in a solution of the salt of a strong acid
and a strong base such as NaCl. It also allows an easy way
to calculate the amounts of acid and base to add to a
solution to obtain a desired pH (in other words, how to
make up a buffer.) Finally, it may be used to calculate pK
from experimental data.
To see how buffers stabilize pH, let us compare the effects
of adding 100 ml of 0.01 M HCl to 1.00 l of water at pH 7
and to 1.00 l of a 1.0 M pH 7 buffer (HA/A−). Assume the
pKa of HA equals 7.0. (Note that 100 ml of 0.01 M HCl
contains 0.001 mol of HCl.) In the water–acid mixture, the
hydrogen ion concentration would be: 0.001 mol/1.1 l =
0.000909 mol l−1. Therefore, pH may be calculated as
follows:
264
www.ajpdf.com
When acid is added to the buffer, most of the protons from

the HCl would combine with A−:
Thus, to calculate the concentration of H+ in the buffer

after the HCl addition, we must account for the protons
that combined with A−. Remember that at pH 7, [HA] = [A−]
= 0.5 M since the pKa of HA equals 7.0. (Note: The
concentration of a buffer equals the concentration of the
acid plus the concentration of its conjugate base.) Adding
0.001 mol HCl to the system gives [HA] = 0.501 mol/1.1 l
and [A−] = 0.499 mol/1.1 l. Using the
Henderson/Hasselbalch equation:
Clearly, the buffer serves to inhibit the large change in pH

that occurs when acid is added to water.
A third way in which the Henderson–Hasselbalch equation
is useful is in making up buffers at a given pH and in
determining buffer capacity. Buffer capacity may be
defined in two ways: (i) the number of moles H+ or OH−
required to give a certain pH change in 1 l of a buffer or (ii)
the pH change that occurs when a given amount of acid or
base is added to 1 l of the buffer. The buffer capacity is a
function of the concentration of the buffer. The higher the
concentration, the higher the buffer capacity.
Problems
1. How much acetic acid (pKa = 4.75, Ka = 1.6 × 10−5) and
sodium acetate are required to make 1 l of 0.2 M
acetate buffer, pH 4.5?
Let HA = acetic acid, and A− = acetate. In a 0.2 M
buffer, [HA] + [A−] = 0.2 M;
Let [A−] = x; then [HA] = 0.2−x;
265
www.ajpdf.com
Plugging into the Henderson–Hasselbalch equation:
Therefore, for a 0.2 M buffer at pH 4.5, add 0.13

moles of acetic acid and 0.07 moles of sodium acetate
and dilute to 1 l.
Now you calculate the amounts of acetic acid and
sodium acetate necessary for preparing 1.0 l of a 0.4
M acetate buffer, pH 4.5. Answers: 0.256 moles of
acetic acid and 0.144 moles of sodium acetate.
2. How much 1.0 M HCl is required to change the pH of 1
l of a 0.2 M acetate buffer, pH 4.5, to 3.5? (The answer
is the buffering capacity of the buffer.)
To solve the problem, we simply calculate the
concentration of HA at pH 3.5 and at pH 4.5 and
subtract.
Plugging into the Henderson–Hasselbalch equation:
Thus, at pH 3.5, the concentration of HA = 0.19 M and

the concentration of A− = 0.01 M. Earlier, we found
that [HA] at pH 4.5 was 0.13 M. Thus, buffering
266
www.ajpdf.com
capacity in the acid direction equals 0.19−0.13 = 0.06

mol l−1.
The buffer capacity in the alkaline direction would be
calculated as follows:
Thus, [A−] = 0.17 and buffer capacity equals

0.17−0.07 = 0.1 mol l−1.
Now you calculate buffer capacity for the 0.4 M buffer.
Answers: Acid, 0.123 mol l−1; Base, 0.196 mol l−1.
Choosing a Buffer System

There are many buffer systems available and choosing the
best buffer is not always easy. Clearly, the most important
criteria in choosing an appropriate buffer is to match the
pH desired with the pK of the buffer. The closer the pK is to
the desired pH, the more buffering capacity the buffer will
have. Generally, the rule of thumb is that the ratio of
conjugate base concentration to acid concentration should
be between 0.1 and 10.0 for effective buffering i.e. buffers
work best at pHs within ± 1 unit of the buffer pK. A few
simple calculations using the Henderson‐Hasselbalch
equation will show you how much buffering capacity exists
within and outside this range.
Acetic, citric and phosphoric acids along with their sodium
or potassium salts are widely used buffering agents in food
systems. The following short list shows the effective
buffering ranges of these salts:
Buffer system Effective buffering range,
pH
Citric acid–sodium citrate 2.1–4.7
Acetic acid–sodium acetate 3.6–5.6
267
www.ajpdf.com
Buffer system Effective buffering range,

pH
Ortho and pyrophosphate 2.0–3.0, 5.5–7.5, and 10–12
anions
When used for experimental purposes, a buffer should
function to maintain the pH at a specified value and should
not influence experimental variables. Thus, it is important
to choose a buffer which does not interact with the other
substances being used in the experiment. Some decades
ago, an extensive series of studies was done on available
buffers by Good and his coworkers [2]. They set forth a list
of criteria for choosing a buffer and then went about
designing new buffers or evaluating old ones based on
these criteria. The so‐called Good buffers are now widely
used in food chemistry, biochemistry, and biological
research. Good’s criteria along with brief explanations
follow.
1. pKa between 6 and 8. This criteria is more useful for

biochemistry experimentation and less useful for food
systems; Good’s point was that biochemists would
profit from having a number of buffers operating in
the range of interest, rather than relying on one buffer
of pKa = 7.
2. High solubility in aqueous systems. Clearly important
in biology, although not always important in foods.
3. Exclusion by biological membranes.
4. Minimal salt effects. It is important that salts and
other ions in the system do not affect the buffer and
that the buffer does not act as an interfering ion in the
experiment.
5. Little influence of concentration, temperature, or ionic
strength of the solution on degree of dissociation. The
buffer should be able to maintain a pH level through
changes in storage temperature or through addition of
salts or other components of a system. Thus, minor
changes can be made in product formulations without
268
www.ajpdf.com
requiring changes in the buffer. In practice, no buffer

is totally unaffected by these influences.
6. Well‐defined or nonexistent interactions with mineral
cations. Many acids or salts will bind with metal ions,
thus changing the dissociation equilibrium of the acid
and reducing the functional use, if any, of the metal.
7. Chemical stability. This is of obvious importance.
Buffers must not break down with storage or light
exposure.
8. Insignificant light absorption in the visible range. This
characteristic is important in experiments where
spectrophotometric measurements are planned.
9. Easily available in pure form. For food systems, this
should be extended to include availability in Food
Grade.
Some common buffers along with pKa values are listed in

Table III.1.
269
www.ajpdf.com
Table III.1 pKa values for some common biological buffers

[3].
Name Chemical name pKa
Phosphate 2.12
(pKa1)
Citrate 3.06
(pKa1)
Formate 3.75
Succinate 4.19
(pKa1)
Citrate 4.74
(pKa2)
Acetate 4.75
Citrate 5.40
(pKa3)
Succinate 5.57
(pKa2)
MES 2‐(N‐morpholino)ethanesulfonic 6.15
acid
ADA N‐2‐acetaminoiminodiacetic acid 6.60
BIS‐TRIS 1,3‐ 6.80
propane bis(hydroxymethyl)methylamino
propane
PIPES piperazine‐N,N’‐bis(2‐ 6.80
ethanesulfonic acid)
ACES N‐2‐acetamido‐2‐ 6.90
aminoethanesulfonic acid)
Imidazole 7.00
MOPS 3‐(N‐morpholino)propanesulfonic 7.20
acid
Phosphate 7.21
(pKa2)
270
www.ajpdf.com
Name Chemical name pKa

TES N‐trishydroxymethylmethyl‐2‐ 7.50
aminoethanesulfonic acid
HEPES N‐2‐hydroxyethylpiperazine‐N‐2‐ 7.55
ethanesulfonic acid
HEPPS N‐2hydroxyethylpiperazine‐N’‐ 8.00
3propane sulfonic acid
TRICINE N‐ 8.15
tris(hydroxymethyl)methylglycine
Glycine 8.20
amide,
hydrochloride
TRIS Tris(hydroxymethyl)aminomethane 8.30
BICINE N,N‐Bis(2‐Hydroxyethyl)glycine 8.35
Glycylglycine 8.40
Borate 9.24
CHES Cyclohexylaminoethanesulfonic 9.50
acid
CAPS 3‐ 10.40
(cyclohexylamino)propanesulfonic
acid
Phosphate 12.32
(pKa3)
Preparation of Buffers
To prepare a buffer, you can either start with both the acid
and its conjugate base and calculate the amounts of each to
add, or you can start with either the acid or the conjugate
base, adjust the pH with a strong acid or base, and then
make to volume. In either case, the pH should be checked
and adjusted before bringing the buffer to the final desired
concentration. Buffers will actually vary slightly from
theoretical pH. Thus, it is better to use standardized
formulae for making up buffers of a desired pH. These may
271
www.ajpdf.com
be found in the CRC Handbook of Biochemistry and

Molecular Biology [4] and other handbooks. Also, Sigma‐
Aldrich has a “Buffer Reference Center” on their website
[5] that may be helpful. It includes tables for preparing
some frequently used buffers. Directions for preparing
some common buffers are given in Tables III.2, III.3, and
III.4.
Table III.2 Some standard buffers, pH ranges where they
a,b
are effective buffers, and effects of temperature on pH .
Buffer Name of buffer pH Temp ΔpH/
no. range °K
1 Glycine/HCl 1.2–3.4 Room 0
2 Na citrate/HCl 1.2–5.0 Room 0
3 Na citrate/NaOH 5.2–6.6 20°C +0.004
4 Phosphate 5.0–8.0 20°C 0.003
5 Citric 2.2–7.8 21°C
acid/phosphate
6 Acetate 3.5–5.6 25°C
7 Tris maleate 5.2–8.6 23°C
8 Tris/HCl 7.2–9.0 23°C
a Adapted from [6].
b See [4] for a more extensive list of buffers.
272
www.ajpdf.com
Table III.3 Stock solutions and formulas for mixing buffers.

Buffer Stock solutions for preparing Mixing
no.a buffersb formulas
for
preparing
A B
buffersc
1 0.1 M glycine + 0.1 M HCl 0.1 M HCl x ml A +
(100−x)
ml B
2 0.1 M disodium citrate 0.1 M HCl x ml A +
(21.01 g citric acid (100−x)
monohydrate + 200 ml 1 M ml B
NaOH diluted to 1.0 l)
3 0.1 M disodium citrate 0.1 M x ml A +
(21.01 g citric acid NaOH (100−x)
monohydrate + 200 ml 1 M ml B
NaOH made to 1.0 l)
4 1/15 M potassium 1/15 M x ml A +
dihydrogen phosphate disodium (100−x)
phosphate ml B
5 0.1 M citric acid 0.2 M x ml A +
disodium (100−x)
phosphate ml B
6 0.1 M sodium acetate 0.1 M x ml A +
acetic acid (100−x)
ml B
7 0.2 M Tris maleate (24.23 g 0.2 M 25 ml A +
Tris + 23.21 maleic acid NaOH x ml B
made to 1.0 l) made up
to 100 ml
8 0.2 M Tris (24.23 g Tris 0.1 M HCl 25 ml A +
made to 1.0 l) x ml B
made up
to 100 ml
a See Table III.2 for the name of the buffer.
273
www.ajpdf.com
b Stock solutions should be prepared from CO ‐free distilled water and

2
reagent‐grade chemicals.
c Values for x are given in Table III.4.
274
www.ajpdf.com
Table III.4 Values for x (see Tables III.2 and III.3) to make
up various buffers of a specified pH.
pH Buffer no. pH
1 2 3 4 5 6 7 8
1.2 11.1 9.0 1.2
1.4 26.4 17.9 1.4
1.6 36.2 23.6 1.6
1.8 43.9 27.6 1.8
2.0 50.7 30.2 2.0
2.2 56.5 32.2 98.8 2.2
2.4 62.3 34.1 94.5 2.4
2.6 68.4 36.0 90.0 2.6
2.8 74.4 37.9 85.1 2.8
3.0 81.0 39.9 80.3 3.0
3.2 86.2 42.1 76.0 3.2
3.4 90.3 44.8 72.0 3.4
3.6 47.8 68.4 3.6
3.8 51.2 65.1 10.9 3.8
4.0 55.1 62.0 16.6 4.0
4.2 60.0 59.1 23.9 4.2
4.4 66.4 56.4 33.5 4.4
4.6 74.9 53.7 44.9 4.6
4.8 85.6 51.2 56.6 4.8
5.0 100.0 99.2 49.0 67.8 5.0
5.2 87.1 98.4 46.9 76.8 3.2 5.2
5.4 78.0 97.3 44.7 84.0 5.0 5.4
5.6 70.3 95.5 42.4 89.3 7.3 5.6
5.8 64.5 92.8 40.0 9.7 5.8
6.0 60.3 88.9 37.4 12.4 6.0
6.2 57.2 83.0 34.5 15.2 6.2
6.4 54.8 75.4 31.4 17.9 6.4
275
www.ajpdf.com
pH Buffer no. pH
1 2 3 4 5 6 7 8
6.6 53.2 65.3 27.9 20.8 6.6
6.8 53.4 23.5 22.2 6.8
7.0 41.3 19.0 23.7 7.0
7.2 29.6 13.8 25.2 44.7 7.2
7.4 19.7 9.8 26.7 42.0 7.4
7.6 12.8 6.8 28.6 39.3 7.6
7.8 7.4 4.6 31.2 33.7 7.8
8.0 3.7 33.9 27.9 8.0
Activity and Ionic Strength

When working buffer problems with the objective of
understanding how buffers work, we generally assume that
buffers are ideal solutions. In practice, such an assumption
can get you into trouble. This is because some other
characteristics of a buffer solution that we haven’t
considered so far may affect the pH of the buffer and its
buffering capacity. These are concentration (adding a very
dilute acid or base will greatly increase total volume,
changing the extent of dissociation of the buffer), ionic
strength, and temperature. Also, if the buffer used is
polyprotic, such as phosphate or citrate, then it will have
more than one pK and will buffer in more than one region.
In order to understand these factors, we need to review the
concepts of activity and ionic strength. As solutions
become more concentrated, solutes begin to interact in
ways that reduce their “effective concentrations.” When
this happens, the participation of a solute in an equilibrium
reaction will be less than predicted from its actual
concentration. Activity is a term for concentration that
reflects the effective concentration of a solute. It is related
to concentration as follows:
276
www.ajpdf.com
where:
a = activity of A
f = the activity coefficient
[A] = the concentration of A in moles/liter
The activity coefficient is usually less than 1 and it

approaches 1 as the concentration of A approaches zero,
i.e. in very dilute solutions activity equals concentration.
Activity coefficients are related to ionic strength as shown
in Figure III.2.
Figure III.2 Effect of ionic strength on activity coefficients.

Modified from [7].
Ionic strength is an expression of the concentration of ions
in solution.
Where:I = ionic strength

∑ = the “sum of”
277
www.ajpdf.com
c i = the molar concentration of the ith ion

z i = the charge on the ith ion (1, 2, etc.)
The Henderson–Hasselbalch equation states that the pH of

a buffer is dependent only on the ratio of the concentration
of the conjugate base to the conjugate acid. Actually pH
depends on the ratio of activities of these species.
Unfortunately, the effect of ionic strength on the activity of
a solute is not the same for all ions. The greater the charge
on an ion, the greater will be the effect of increases in ionic
strength on its activity. Table III.5 lists the activity
coefficients of some ions in solution.
Table III.5 Values for activity coefficients of some ions at
different concentrations in aqueous solution [1].
Ion Ionic concentration (M)
0.001 M 0.01 M 0.1 M
H+ 0.975 0.933 0.86
OH− 0.975 0.925 0.805
Acetate− 0.975 0.925 0.82
H2PO− 0.975 0.928 0.744
0.903 0.740 0.445
0.796 0.505 0.16
H2Citrate− 0.975 0.926 0.81
HCitrate2− 0.903 0.741 0.45
Citrate3− 0.796 0.51 0.18
HCO3− 0.975 0.928 0.82
0.903 0.742 0.445
Ions other than the buffer ions will also affect the activities
of the buffer components. For example, addition of NaCl to
a buffer solution will affect the pH of the solution because
of its contribution to the total ionic strength of the solution.
In this case, it is common to correct the pK rather than the
278
www.ajpdf.com
activities of the buffer ions. Details of this type of

correction may be found in Segel [1].
pH Measurement
pH can be measured using either pH indicators or a pH
meter. Indicators have been widely used, but their utility in
food systems is limited by the fact that foods are usually
opaque and colored themselves and changes in indicator
color are not readily seen. Also, indicators are not very
sensitive and provide only a ballpark indication of pH.
Thus, pH values are usually measured using pH meters,
which accurately measure the hydrogen ion activity of
solutions.
Detailed descriptions of how pH meters operate can be
found in most books on analytical chemistry. The following
is a brief discussion of the operation and care of pH meters.
The pH meter consists of a voltmeter and two electrodes,
the reference electrode and the indicator electrode.
Frequently, the two electrodes are physically combined
into a combination electrode, which looks like a single
electrode. The indicator electrode contains a glass
membrane, which is permeable to H+ but not other ions.
Thus, hydrogen ions in the solution can diffuse across the
membrane unaccompanied by anions. The accumulated
hydrogen ions inside the electrode cause a positive charge
to be built up with a negative charge on the other side, thus
an electric potential is set up across the glass membrane.
This potential can be measured by the voltmeter due to the
circuit created by the indicator electrode, the reference
electrode, and the solution. The reference electrode has a
porous plug, which allows contact with the solution and
completes the circuit.
If you are interested in the details of pH meter function,
you should consult one of the references listed. pH meters
are simple to use and give accurate results if the following
steps are followed and appropriate precautions are taken.
279
www.ajpdf.com
Making pH Measurements
1. The pH meter must be calibrated before use with a
buffer of appropriate pH. Buffer standards may be
purchased from chemical supply houses. The pH of the
buffer standard should be as close as possible to the
pH to be measured.
2. It is important that the temperature control unit be
adjusted to match the temperature of the solution
being measured.
3. The electrode must be treated with care!! Always leave
it in water or some solution to prevent it from drying
out and be careful not to scratch or chip the glass bulb
at the bottom. Before immersing into a solution, the
electrode should be rinsed and blotted dry. The
electrode should not touch the bottom or sides of the
container when measuring pH.
4. The electrode must be kept clean. This can be a
challenge, especially when solutions containing
proteins, lipids, and viscous carbohydrate are used.
Cleaning procedures for electrodes are provided by
the manufacturer and should be consulted. In some
cases, soaking in detergent solutions or rinsing with
acetone will do the trick. Sluggishness or drift in the
pH reading is an indication that the electrode may be
dirty.
References
1 Segel, I.H. (1976). Biochemical Calculations: How to Solve
Mathematical Problems in General Biochemistry, 2e, 441.
New York: Wiley.
2 Good, N.E., Winget, G.D., Winter, W. et al. (1966).
Hydrogen ion buffers for biological research.
Biochemistry 5 (2): 467–477.
3 Mohan, C. (2003). Buffers – A Guide for the Preparation
and Use of Buffers in Biological Systems. Calbiochem:
280
www.ajpdf.com
EMD Biosciences Inc.

4 Lundblad, R.L. and Macdonald, F. (eds.) (2018). Handbook
of Biochemistry and Molecular Biology, 5e, 1001. Boca
Raton: CRC Press, Taylor & Francis Group.
5 Buffer Reference Center | Sigma‐Aldrich [Internet]. [cited
10 February 2020].
https://www.sigmaaldrich.com/life‐science/core‐
bioreagents/biological‐buffers/learning‐center/buffer‐
reference‐center.html
6 Lentner, C. (ed.) (1984). Geigy Scientific Tables. 3: Physical
Chemistry, Composition of Blood, Hematology,
Somatometric Data, 8th, rev.enl.e, 359. Basel: CIBA‐
Geigy AG.
7 Skoog, D.A., Holler, F.J., and Crouch, S.R. (2018). Principles
of Instrumental Analysis, 7e, 959. Australia: Cengage
Learning.
Suggested Reading
Lindsay, R.C. (2017). Food additives. In: Fennema’s Food
Group.
Miller, D.D. (2017). Minerals. In: Fennema’s Food Chemistry ,
5e (eds. S. Damodaran and K.L. Parkin ), 627–679. Boca
Raton: CRC Press, Taylor & Francis Group.
Robinson, J.K., McMurry, J., and Fay, R.C. (2019). Chemistry ,
8e, 1200. Hoboken, NJ: Pearson Education, Inc.
Skoog, D.A., West, D.M., Holler, F.J., and Crouch, S.R. (2012).
Fundamentals of Analytical Chemistry , 9e, 1072.
Belmont, CA: Cengage Learning.
281
www.ajpdf.com
Appendix IV
Spectrophotometry
Introduction
Note: The following is a brief overview of the basic principles of
spectrophotometry. For an excellent and detailed description of
UV/visible spectrophotometry, as well as general spectroscopy,
see Penner [1, 2].
Electromagnetic radiation may be classified according to
wavelength or frequency. Frequency and wavelength are related
according to the following formula:
(IV.1)
where λ is the wavelength, ν is the frequency, and c is the speed of
light (3 × 1010 cm s−1). Units for wavelength are usually
nanometers (nm), but Angstroms (Å), microns (μm), or
centimeters (cm) may also be used.
1 Å = 10−10 m
1 nm = 10−9 m
1 μm = 10−6 m
1 cm = 10−2 m
Table IV.1 shows wavelength ranges for the various classifications

of electromagnetic radiation.
Table IV.1 Classification of electromagnetic radiation and effects
of radiation on molecules.
Source: Modified from [3].
Region X‐rays Ultraviolet Visible Infrared Microwave

Wavelength, 0.1–100 100–400 400–800 800– 105–108
nm 100,000
Effect on Excitation Excitation Excitation Increased Increased
molecule of of valence of valence molecular molecular
subvalence electrons electrons vibrations rotations
electrons
282
www.ajpdf.com
Chemical species interact with electromagnetic radiation in ways

that reduce the intensity of the radiation. The effects of the
interaction vary with the wavelength of the radiation and the
nature of the chemical species and include transitions in
molecular vibrations, molecular rotations, and electron energy
levels. Interactions may be quantified by comparing the radiation
incident on a sample with the radiation transmitted by the sample.
Such comparisons are generally made with instruments called
spectrophotometers and require that the sample be dissolved in a
solvent that does not absorb appreciably at the wavelength of
interest.
Spectrophotometers generally follow the basic setup shown in
Figure IV.1. The essential elements and their functions are as
follows:
1. Light source. Usually a tungsten filament lamp is used to

generate wavelengths from 340 to 900 nm (visible) and a
hydrogen lamp is used to generate wavelengths from 200 to
360 nm (UV).
2. Monochromator. Since it is desirable to have monochromatic
light incident on the sample, some method must be used to
obtain a narrow range of wavelengths from the polychromatic
light generated by the lamps. Prisms or diffraction gratings
are used to separate the different wavelengths into narrow
ranges.
3. Slit. Light leaving the monochromator is not truly
monochromatic but consists of a narrow range of
wavelengths. The purpose of the slit is to decrease the width
of this band to improve the purity of the light that strikes the
sample.
4. Sample containers. Generally 1‐cm‐wide rectangular cuvettes
are used.
5. Light‐detecting phototube or photocell. These are devices that
contain a photosensitive material that emits electrons when
exposed to light. The electrons are emitted in an amount
proportional to the light intensity. Thus, the intensity of the
transmitted light I can be measured.
283
www.ajpdf.com
Figure IV.1 Schematic diagram of the basic components of a

spectrophotometer.
The amount of light that interacts with a sample in a

spectrophotometer may be expressed as either transmittance or
absorbance. Transmittance T is the fraction of light transmitted by
a solution:
(IV.2)
where I is the intensity of the radiation transmitted by the sample,
and I 0 is the intensity of the radiation incident on the same
sample. Absorbance A is an expression of the amount of radiation
absorbed by a sample and is equal to the negative log of T:
(IV.3)
The amount of monochromatic radiation that is absorbed by a
solution is proportional to the concentration of the absorbing
species in the solution and the distance the radiation travels
through the sample. Beer’s law is an expression of these
relationships:
(IV.4)
where ε is the absorption coefficient (also called the molar
extinction coefficient), b is the path length of the radiation in the
sample, and c is the concentration of the absorbing species. The
units most used for each of these are shown below:
A: absorbance has no units
284
www.ajpdf.com
ε: M−1cm−1 or mM−1cm−1
b: cm (cuvettes with 1 cm path lengths are the most common)
c: M or mM
Beer’s law is useful for determining concentrations of solutes in

solution. It states that there should be a linear relationship
between concentration and absorbance. Therefore, if ε and b are
known, it is possible to calculate concentration from an
absorbance value measured with a spectrophotometer. Of course,
one must be certain that the wavelength setting and the
absorbance reading of the spectrophotometer are accurate and
that there are no interfering substances present. In practice, it is
usually better to run a series of standards of known concentration
and determine the concentration of the unknown from a standard
curve.
In many cases, the substance to be measured does not absorb
appreciably at a suitable wavelength but may react with a second
substance to form a colored compound that does absorb. When
carrying out this type of an assay, it is important that the second
substance be present in excess, so it is not limiting for color
formation. A general equation for this type of assay is shown
below:
(IV.5)
When using spectrophotometry to determine the concentration of

a substance in solution, it is best to construct a standard curve.
This is done by preparing a series of standards of varying
concentrations and reacting the standards with the color‐forming
reagents under the exact conditions that will be used when
assaying the unknown. In most cases, the color‐forming reagents
and solvents will absorb a small amount at the wavelength of
interest. It is a good idea, therefore, to prepare a reagent blank
that contains all of the reagents at the appropriate concentrations
but none of the substance to be assayed. The absorbance of the
reagent blank can be subtracted from that of the sample by either
zeroing the spectrophotometer with the reagent blank or zeroing
with the solvent and subtracting the absorbance of the reagent
blank from each sample absorbance reading. Absorbance
measurements are most accurate in the range of 0.1–1.0
285
www.ajpdf.com
absorbance units. It is wise, therefore, to adjust concentrations (by

dilution or adding more sample) so that absorbance readings will
be in this range. Concentration adjustments should be made
before the color‐forming reagents are added.
Apparent deviations from Beer’s law do occur, and it is important
to be aware of situations in which nonlinearity may be a problem.
Beer’s law holds only for dilute solutions. In concentrated
solutions, molecules may interact in ways that change their
absorptive properties. If your standard curve includes
concentrations both higher and lower than that of your unknown
sample, then you will know if you have a problem and can make
adjustments accordingly. Another common cause of nonlinearity
is insufficient amounts of color‐forming reagents. Figure IV.2
shows a standard curve.
Figure IV.2 A typical standard curve obtained in quantitative

spectrophotometry.
Operation of a Spectrophotometer
While key components of most spectrophotometers are similar,
operating procedures provided by manufacturers might vary. It is
worthwhile to carefully review the instruction manual of the
instrument you are using to ensure proper operation and
maintenance.
Notes for Operators
286
www.ajpdf.com
1. Allow time for the spectrophotometer to warm up before

starting your experiment.
2. When operating the instrument over a period of time,
recheck 100% T periodically and reset if necessary.
3. The 100% T adjustment must be reset every time the
wavelength is changed.
4. All solutions must be free of bubbles.
5. Cuvettes must be at least half full.
6. Cuvettes must be clean. Use a low‐lint antistatic tissue to
wipe off fingerprints.
7. Align the mark on the cuvettes with the direction of the
monochromatic light beam.
8. Check for any spills or drips after each measurement. The
sample compartment should be clean.
9. For quantitative analysis, make sure the
absorbance/transmittance of the sample solution falls within
the linear region of the standard curve. Dilute the sample as
needed.
Problem Set
1. A solution of a light‐absorbing substance has an absorption
maximum at 540 nm. Is this ultraviolet, visible, or infrared
light? Express the wavelength in Angstroms, microns,
centimeters, and meters.
2. A 1.0 g l−1 solution of compound X has a transmittance of
80% in a 1 cm cuvette at 500 nm. The molecular weight of X is
100 g mol−1.
a. Calculate the absorption coefficient of X.
b. Calculate the transmittance of a 2.0 g l−1 solution of X at
500 nm.
c. Calculate the absorbance of both solutions (1.0 and 2.0 g
l−1).
References
1 Penner, M.H. (2017). Basic principles of spectroscopy. In: Food
Analysis, 5e (ed. S.S. Nielsen), 79–88. New York, NY: Springer
287
www.ajpdf.com
Science+Business Media.
2 Penner, M.H. (2017). Ultraviolet, visible, and fluorescence
spectroscopy. In: Food Analysis, 5e (ed. S.S. Nielsen), 89–106.
New York, NY: Springer Science+Business Media.
3 Segel, I.H. (1976). Biochemical Calculations: How to Solve
Mathematical Problems in General Biochemistry, 2e. New York:
Wiley. 441 p.
1. 540 nm is in the visible range. 540 nm = 5,400 Å = 0.54 μm =

5.4 × 10−5 cm = 5.4 × 10−7 m.
2. a. ε = 9.69 M−1cm−1.
b. b)T of a 2.0 g l−1 solution = 64%.
c. c)A of a 1.0 g l−1 solution = 0.0969; A of a 2.0 g l−1
solution = 0.1938.
288
www.ajpdf.com
Appendix V
Chromatography
What Is Chromatography?
Chromatography is a technique for separating components
of mixtures as they are carried by a mobile fluid phase
through a stationary solid or liquid phase. The separation
is accomplished because the mobility of each solute
depends on its distribution between the mobile phase and
the stationary phase. Solutes with a higher affinity for the
stationary phase will move more slowly than solutes with a
higher affinity for the mobile phase.
The technique of chromatography was originated by the
Russian botanist Michael Tswett in 1906. He used
petroleum ether, a nonpolar solvent, to extract a mixture of
green and yellow pigments from leaves. He then found he
was able to separate these pigments by passing the extract
through a column of fine powder. He called his method
chromatography from the Greek meaning “color writing,”
because he used it to separate colored compounds. Today,
chromatography is mainly used to separate colorless
compounds, but the name remains to describe any
technique based on the same principles.
Many advances have been made since chromatography was
invented, and it is now one of the most widely used
techniques in the fields of biochemistry, organic chemistry,
and food chemistry. Chromatography may be used to
separate subcellular fractions, specific substances in foods,
and even closely related compounds such as simple sugars.
Partition and adsorption chromatography separate solutes
on the basis of solubility and adsorptive affinity,
respectively; but other types can separate solutes on the
basis of molecular weight (gel permeation
chromatography) or ionic charge (ion exchange
chromatography). All these techniques can be used, under
289
www.ajpdf.com
properly controlled conditions, to identify solutes in

solution. They may also be used to quantify the amounts of
solute present.
The following is a brief overview of the principles and
terminology of chromatography. Students are encouraged
to see Ismail [1] for an excellent discussion of the basic
principles and Reuhs [2] for a more thorough treatment on
high‐performance liquid chromatography (HPLC).
Chromatography Terminology
A rather specialized terminology has been adapted to
describe and differentiate the various types of
chromatography. Before describing the types of
chromatography and the principles involved, it will be
helpful to define a few terms.
Adsorbent. The stationary phase in adsorption

chromatography. The stationary phase of partition
chromatography may also be referred to as the
adsorbent.
Development. The process of separating a solute from
the sample using chromatography.
Eluant. The mobile phase once it is eluted from the
column.
Elution. The process of removing a solute from the
stationary phase.
Mobile phase. Material that is passed through the
chromatography apparatus and stationary phase. It is
a liquid in liquid chromatography and a gas in gas
chromatography.
Normal phase chromatography. Chromatography with
a polar stationary phase and a nonpolar mobile phase.
Origin. Physical location where the sample is first
placed.
290
www.ajpdf.com
Reverse phase chromatography. Chromatography with

a nonpolar stationary phase and a polar mobile phase.
Solvent or developer. Any mobile phase.
Sorbent. Any stationary phase.
Stationary phase. Material that is held in place during
chromatography and that retains some component of
the sample.
Support. The inert solid material serving to hold the
liquid stationary phase in place in partition
chromatography.
Types of Chromatography
The various types of chromatography are distinguished by
the type of mobile or stationary phases used, the apparatus
employed, or the basis of separation. Distinctions are not
always clear‐cut, and frequently one type of
chromatography may have the characteristics of two or
more other types.
The most basic distinction is based on the nature of the
mobile phase. In gas chromatography, the mobile phase is a
gas. In liquid chromatography, the mobile phase is a liquid.
In gas chromatography, the sample is vaporized and
carried by a carrier gas through a column packed with
some material that acts as the stationary phase.
Temperatures are usually quite high, and a specialized
piece of equipment is required. In liquid chromatography,
many different types of apparatus are used, ranging from a
piece of filter paper suspended in a test tube containing
some liquid solvent to highly sophisticated HPLC
instruments that have precision pumps capable of forcing
the mobile phase through the stationary phase at high
pressures. Paper, thin layer, column chromatography, and
HPLC all fall into the category of liquid chromatography.
The bases of separation of the components of a mixture by
chromatographic means are the forces of interaction
between solute molecules and the stationary and mobile
291
www.ajpdf.com
phases. These forces may be ionic, polar, or dispersive in

nature. Ionic forces result from the interaction of charged
species (ions). Polar forces occur when polar molecules
interact. Some molecules, such as water, have partially
positive and partially negative regions as a result of
electron withdrawing or donating groups. These polar
molecules are permanent dipoles and are attracted to each
other. Dispersive forces result when electrons in nonpolar
or weakly polar molecules are displaced slightly by
adjacent molecules. This causes the formation of a
temporary dipole, which can then interact with other
dipoles. These interactions are important when nonpolar
solute molecules come in contact with nonpolar stationary
phases. See Simpson [3] for a detailed description of these
forces of interaction. Simpson [3] distinguishes among the
various types of chromatographic methods based on the
predominant type of molecular interaction involved. The
following is a summary of Simpson’s description of the
various chromatographic modes for liquid
chromatography.
Adsorption Chromatography (AC)

Adsorption is the adhesion of molecules to the surface of a
solid. Silica gel is the most widely used adsorbent
(stationary phase) in liquid adsorption chromatography.
Alumina and diatomaceous earth are also used. The mobile
phase in adsorption chromatography is usually a nonpolar
liquid, such as heptane, but more polar liquids may also be
used. Silica gel is a porous solid material with hydroxyl
groups covering its surface (Figure V.1). Adsorption occurs
when solute or solvent molecules interact with the
hydroxyl groups. When water is present, most of the
hydroxyl groups have water associated with them. Heating
at 150–200 °C will remove the water, and heating is
commonly used to activate silica gel before use. Water may
interfere with the adsorption of solute molecules.
292
www.ajpdf.com
Figure V.1 Structure of silica gel, showing the hydroxyl

groups on the surface.
Liquid–Liquid Partition Chromatography

(LLPC)
In this type of chromatography, a liquid is adsorbed on a
solid matrix such as silica gel to form a liquid stationary
phase. In LLPC, the stationary phase liquid is usually polar
and the mobile phase liquid is nonpolar. Separation
depends on the relative solubilities of solutes in the mobile
and stationary phases. Solutes are partitioned between the
two phases in the same way that solutes partition between
immiscible liquids in a separatory funnel.
Bonded Phase Chromatography (BPC)

In BPC, the surface of the adsorbent is covered with
organic groups, which are covalently bound to it. BPC is an
improvement over LLPC, because the stationary phase can
have many of the properties of a liquid but is more stable
than when liquids are merely adsorbed to a solid matrix.
Bonded phase columns are the most popular columns for
use in HPLC. The most widely used bonded phases are
nonpolar hydrocarbons containing 8–18 carbons per
molecule. Polar and ionic organic groups may also be used.
Silica gel is the solid support of choice. The organic
constituents are bound to the silica gel by siloxane bridges
(Figure V.2).
293
www.ajpdf.com
Figure V.2 Structures of stationary phase packing material

with silica gel as the solid support. Note that the
hydrocarbon chains are covalently linked to the silicon
atoms in the silica gel. The C‐18 and C‐8 designations refer
to the number of carbons in the hydrocarbon chains bound
to the silica.
When the stationary phase is polar, a nonpolar mobile
phase would be used. This is frequently called normal
phase chromatography, presumably because it was the
most common during the early history of chromatography.
When the stationary phase is nonpolar and the mobile
phase is polar, we have the so‐called reverse phase
chromatography.
Ion‐Exchange Chromatography (IEC)

The stationary phase in IEC contains ionic groups (either
cationic or anionic) that attract solute ions of opposite
charge. Frequently, IEC is a form of BPC because the ionic
groups are covalently linked to a solid matrix. The mobile
phase in IEC is usually an aqueous buffer.
Gel Permeation Chromatography (GPC)

In GPC, solutes are separated on the basis of molecular
size. The stationary phase in GPC is composed of tiny
particles covered with pores of a defined size. Large
294
www.ajpdf.com
molecules cannot penetrate the particles and move rapidly

through the stationary phase. Small molecules enter the
particles through the pores and are retarded. In GPC,
solutes are eluted in order of decreasing molecular size.
GPC is often referred to as size exclusion chromatography.
High‐Performance Liquid
Chromatography
HPLC is a specialized form of chromatography that has
many advantages over more traditional chromatographic
methods. It requires fairly sophisticated equipment
specifically designed for rapid and efficient separation and
quantitation of the components in a sample. It is widely
used in the food industry. Some of its advantages include
rapid analyses, specificity, high sensitivity (ability to detect
low concentrations of the material in question), and
simplified sample preparation.
Nearly anything found in food can be detected and
quantified by HPLC, provided it can be solubilized in a
suitable solvent. Sugars, organic acids, vitamins, amino
acids, flavor compounds, additives, preservatives, and
adulterants are examples of food components that have
been detected and quantified by HPLC.
As the name implies, HPLC is a type of liquid
chromatography in which a liquid mobile phase is passed
through a stationary phase under high pressure. The
stationary phase is contained within a narrow bore tube,
called the column. It is common to classify HPLC as either
normal phase or reverse phase (see Figure V.3). In normal
phase chromatography, the stationary phase is a highly
polar substance such as silica with amino or cyano groups
bonded to it. The mobile phase is nonpolar, e.g. hexane or
chloroform. In this system, polar substances are retained
on the column longer than those that are less polar. Sugars,
steroids, nitro compounds, amino acids, proteins, and
peptides have all been analyzed with normal phase
chromatography. In reverse phase chromatography, the
295
www.ajpdf.com
stationary phase is nonpolar (typically a C8 or C18

hydrocarbon) and the mobile phase is polar (water,
methanol, or acetonitrile). Nonpolar materials are retained
on the column longer in this form of HPLC. Amines,
phenols, water‐soluble vitamins, and essential oils are
some of the materials that have been analyzed using
reverse phase chromatography.
Figure V.3 A schematic representation of reverse phase

and normal phase chromatography. The order of elution of
sample components is shown in the rectangles, e.g. in
reverse phase chromatography, highly polar components
are eluted first.
Two types of mobile phase delivery systems are common

in HPLC systems: isocratic and gradient. In an isocratic
system, the mobile phase remains the same and is pumped
at the same flow rate for the entire separation run. This
technique is suitable for many applications. In a gradient
296
www.ajpdf.com
system, both the flow rate and mobile phase concentration

change over the course of the separation. This is
particularly helpful in methods development, where one
can quickly run a scouting gradient to determine the best
concentration at which to run the separation. Some
methods require a stronger solvent toward the end of
separation to elute particularly sticky compounds from the
column.
The HPLC System

The actual configuration of an HPLC system depends on
the types of samples being analyzed. However, most
systems will have the following features:
1. A pump to deliver the mobile phase. The pump should

be able to provide a uniform flow rate at pressure as
high as 3,000 psi.
2. An injector to introduce the sample to be analyzed.
Loop injectors are the most common type for routine
analyses. A syringe is used to load the sample loop in
the injector, and the mobile phase carries the sample
toward the column.
3. A guard column to protect the more expensive
analytical column from particulates and compounds
that may irreversibly bind to the stationary phase. The
guard column is essentially a smaller version of the
analytical column.
4. An analytical column to perform the separation, based
on the relative affinities of various components of the
sample for the packing material.
5. A detector to detect the components of the sample as
they elute from the column. A variable wavelength UV
detector is the all‐purpose detector of choice for most
systems. More sophisticated and expensive systems
may employ a mass spectrometer as the detector. LC‐
MS greatly enhances the capacity to identify
components in a mixture.
297
www.ajpdf.com
6. An integrator/computer for data acquisition. The

integrator/computer calculates the peak areas and
heights and reports the retention times of the various
peaks identified in the chromatogram.
A schematic of such a typical system is provided in Figure

V.4.
298
www.ajpdf.com
Figure V.4 A schematic representation of an HPLC system

(Scott Langston, personal communication).
References
299
www.ajpdf.com
1 Ismail, B.P. (2017). Basic principles of chromatography.

In: Food Analysis , 5e (ed. S.S. Nielsen ), 185–212. New
York, NY: Springer Science+Business Media.
2 Reuhs, B.L. (2017). High performance liquid
chromatography. In: Food Analysis , 5e (ed. S.S. Nielsen ),
213–226. New York, NY: Springer Science+Business
Media.
3 Simpson, C.F. (1982). Separation modes in HPLC. In:
HPLC in Food Analysis (ed. R. Macrae ), 79–121. London;
New York: Academic Press. (Food science and
technology).
4 Yost, R.W., Ettre, L.S., and Conlon, R.D. (1980). Practical
Liquid Chromatography: An Introduction . Norwalk, CT:
Perkin‐Elmer. 255 p.
Suggested Reading
Lough, W.J. and Wainer, I.W. (eds.) (1995). High
Performance Liquid Chromatography: Fundamental
Principles and Practice , 1e. London; New York: Blackie
Academic & Professional. 276 p.
Nollet, L.M.L. and Toldrá, F. (eds.) (2013). Food Analysis by
HPLC , 3e. Boca Raton, FL: CRC Press. 1062 p.
300
www.ajpdf.com
Appendix VI
Electrophoresis
Introduction
Electrophoresis is a powerful technique that is widely used
in food chemistry and biochemistry laboratories.
Electrophoresis separates charged species on the basis of
charge and molecular size.
The basic principle behind electrophoresis is that charged
species move in an electric field. The direction and rate of
movement of these species depend on the charge (+ or −),
the number of charges, and the size of the ion. A cation (a
positive ion) will migrate toward the cathode (the negative
pole) and an anion (a negative ion) will migrate toward the
anode (the positive pole). Usually, the species to be
separated are applied to a solid support, normally a gel.
Polyacrylamide gels are the most versatile although
agarose and starch gels are also used. Paper and cellulose
acetate strips are used as well. The big advantage of gels is
that they can be prepared with varying pore sizes. This
permits separations on the basis of size by a process called
molecular sieving (think of the gel as a sieve through which
small ions pass more readily than large ones).
The rate at which an ion moves through the supporting
medium can be expressed as follows [1]:
The voltage of the applied electric field can be set at any

desired level. The charge on the molecule will be a function
of the chemical nature of the molecule and the pH of the
medium. The friction the molecule encounters will be a
function of the size and shape of the molecule (larger
molecules experience more friction because it is more
301
www.ajpdf.com
difficult for them to move through the pores). Temperature

and ionic strength may also affect ion mobility, so it is
important to control them as well. It is always a good idea
to include an internal standard when doing an
electrophoretic analysis to correct for slight variations in
conditions.
Polyacrylamide gels are prepared by mixing (in aqueous
solution) acrylamide, bis‐acrylamide, a catalyst (N,N,N′,N′‐
tetramethylethylenediamine; TEMED), and a free‐radical
initiator (ammonium persulfate). The gels are formed as a
result of the polymerization of acrylamide and N,N′‐
methylene‐bis‐acrylamide. This type of reaction should be
familiar to you from your organic chemistry classes. The
formation of polyethylene from ethylene and of polyvinyl
chloride from vinyl chloride are similar reactions. All these
reactions proceed via a free radical mechanism. Figure VI.1
shows the reaction for the formation of polyacrylamide
gels. The pore size in the gel can be adjusted by changing
the concentration of acrylamide in the mixture (for large
pore sizes, use low acrylamide concentrations and vice
versa).
302
www.ajpdf.com
Figure VI.1 The formation of polyacrylamide from

acrylamide and bis‐acrylamide. Persulfate decomposes to
sulfate free radicals and serves to initiate the free radical
reaction. TEMED is a catalyst for the reaction.
The apparatus for conducting an electrophoresis

experiment includes the following (Figure VI.2):
1. A buffer to hold the pH constant and to act as an

electrolyte.
2. A buffer chamber.
3. A solid support (usually a gel).
4. A holder for the gel (either small tubes or a flat tray).
5. A power supply to generate an electric field.
303
www.ajpdf.com
Figure VI.2 Gel electrophoresis apparatus. To operate,

samples are applied to the wells, the apparatus is covered,
and a current is applied. Negatively charged proteins
migrate toward the anode.
Probably the most common application of electrophoresis
is the separation, characterization, identification, and/or
quantification of proteins. Proteins lend themselves well to
electrophoresis because each protein has its own
characteristic size and charge at a given pH. The charge on
a protein is a function of its amino acid composition and
the pH. At low pH, proteins generally carry a net positive
charge because of protonation. At high pH values, proteins
are negatively charged. At some intermediate pH
(depending on the protein), proteins have no net charge
and, therefore, would not migrate in an electric field.
To obtain maximum resolution of proteins, the following
set of experimental variables must be optimized:
1. The buffer pH (maximal charge difference).

2. Gel pore size (maximal molecular sieving).
304
www.ajpdf.com
3. Buffer ionic strength (sufficient for adequate buffering

and current carrying capacity but low enough to allow
large potential gradients).
4. Narrow starting zones (less total migration is required
for complete zone separation when proteins are
bunched together at the top of the gel).
Often, buffer systems that are designed to dissociate all

proteins into their individual subunits are employed.
Sodium dodecyl sulfate (SDS) (Figure 19.1) is an anionic
detergent. It is the conjugate base of dodecyl hydrogen
sulfate, a strong acid. SDS disrupts the quaternary
structure of most multimeric proteins. Dithiothreitol and
mercapto ethanol are reducing agents that cleave disulfide
bonds in proteins (Figure VI.3). They may be used to
dissociate polypeptide chains linked by disulfide bridges.
Once the proteins are disrupted with these reagents, SDS
binds to the various proteins in a constant weight ratio via
hydrophobic interactions. The original charge on the
protein now becomes insignificant compared to the
negative charges provided by the bound detergent. It is
estimated that proteins bind one SDS ion for every two
amino acid residues. Thus SDS–protein complexes have
essentially identical charge densities. Moreover, the bound
SDS anions force folded up protein molecules into a linear,
rod‐like conformation since the negative charges repel one
another and the conformation with the greatest separation
of the charges is the linear conformation (Figure VI.4).
Thus, the distance that proteins migrate in polyacrylamide
gels is determined largely by the length of the molecule,
which is strongly correlated with molecular weight (MW).
A plot of the log10 of protein MW versus relative mobility
shows a linear relationship between the two. Recall that
relative mobility is expressed as the R f value:
305
www.ajpdf.com
Figure VI.3 Cleavage of the disulfide bond by

dithiothreitol.
Figure VI.4 Binding of sodium dodecyl sulfate (SDS) to a

protein molecule. The bound SDS anions force the
conformation of the proteins into linear, rod‐like
conformations.
Thus a standard curve can be constructed for proteins of

known MWs and used to estimate MWs of unknown
proteins (Figure VI.5).
306
www.ajpdf.com
Figure VI.5 A calibration plot of molecular weight

standards run on SDS PAGE. Note that the two parallel lines
represent different electrophoresis runs on gels of
different acrylamide concentrations. The upper line is from
a gel with a lower acrylamide concentration compared
with the lower line.
Source: From [3].
The MWs of unknown proteins are determined by

comparing their migration rates with standards. Standards
307
www.ajpdf.com
are a composite of several proteins of known MWs.

Proteins of similar MWs will travel at the same rate and
migrate the same distance within the gel. The absolute
distance of migration will depend on the pore size in the
gel – proteins travel farther when pore size is larger. As
mentioned above, pore size can be adjusted by adjusting
the concentration of acrylamide in the gel preparation. Gels
made from a 11% acrylamide solution are recommended
for separating proteins with MWs ranging from 14,000 to
70,000 daltons. For proteins in the MW range of 30,000–
200,000 daltons, 7% gels are recommended [3]. A common
standard contains the following proteins: myosin (MW =
200,000), β‐galactosidase (MW = 116,250), phosphorylase
B (MW = 97,400), serum albumin (MW = 66,200),
ovalbumin (MW = 45,000), carbonic anhydrase (MW =
31,000), trypsin inhibitor (MW = 21,500), lysozyme (MW =
14,400), and aprotinin (MW = 6,500). A different standard
would be chosen when studying proteins with lower MWs.
See Smith [4] for more discussion on protein separation by
electrophoresis and other techniques.
References
1 Switzer, R.L. and Garrity, L.F. (1999). Experimental
Biochemistry , 3e. New York: W. H. Freeman and Co. 451
p.
2 Bio‐Rad Laboratories, Inc (2020). A guide to
polyacrylamide gel electrophoresis and detection
[Internet]. https://www.bio‐
rad.com/webroot/web/pdf/lsr/literature/Bulletin_604
0.pdf (accessed 6 May 2020).
3 Sigma Chemical Company (1998). SDS molecular weight
markers in a discontinuous buffer. Technical Bulletin No.
MWS‐877L [Internet].
https://www.sigmaaldrich.com/content/dam/sigma‐
aldrich/docs/Sigma/General_Information/1/c2273inf.p
df (accessed 6 May 2020).
308
www.ajpdf.com
4 Smith, D.M. (2017). Protein separation and

characterization procedures. In: Food Analysis , 5e (ed.
S.S. Nielsen ), 431–453. New York, NY: Springer
Science+Business Media.
Suggested Reading
Garfin, D.E. (2009). One‐dimensional gel electrophoresis.
In: Methods in Enzymology (eds. R.R. Burgess and M.P.
Deutscher ), 497–513. Academic Press. (Guide to
Protein Purification, 2nd Edition; vol. 463).
Wasserman, B.P. (1986). Detection of proteolysis by
sodium dodecyl sulfate polyacrylamide gel
electrophoresis: a demonstration of protein hydrolysis
and electrophoresis fundamentals. Journal of Food
Biochemistry 10 (2): 83–91.
309
www.ajpdf.com
Appendix VII
Glossary
Acid:
A substance capable of donating a proton.
Aldonic acids:
Organic acids formed when aldehyde groups on sugars
are oxidized. Thus, the carboxylic acid group is on C‐1
of the sugar. Examples are gluconic acid and galactonic
acid, which form when glucose and galactose are
oxidized.
Alginates:
Polysaccharides composed primarily of mannuronic
and guluronic acids joined by 1 → 4 linkages; occur
naturally in brown seaweeds; used in salad dressings,
pie fillings, structured fruit pieces, and many bakery
and dairy products.
Anthocyanins:
Plant pigments with colors ranging from red to blue
(red in acidic conditions and blue in neutral to alkaline
conditions). Anthocyanins are glycosides.
Anthocyanidins:
Plant pigments that form when the glycosidic bond
linking the sugar molecule to the main structure in
anthocyanins is hydrolyzed, releasing the sugar
molecule.
Antioxidant:
A substance capable of slowing, stopping, or preventing
oxidation.
Base:
A substance capable of accepting a proton.
Buffers:
Solutions containing a weak acid and its conjugate base
or a weak base and its conjugate acid. Minimize
changes in pH when small amounts of acid or base are
added.
310
www.ajpdf.com
Carotenoids:
A class of yellow, orange, and red pigments found in
higher plants. Of the more than 600 known carotenoids,
about 50 have vitamin A activity. Carotenoids are fat
soluble and can scavenge free radicals and quench
singlet oxygen.
Carrageenans:
A family of sulfated linear polysaccharides that occur
naturally in red seaweeds. They are polymers of D‐
galactose and 3,6‐anhydro‐D‐galactose. Noted for their
ability to form gels with milk.
Chlorophyll:
Green pigments containing a porphyrin ring complexed
with a magnesium ion.
Chromatography:
A technique for separating components of mixtures as
they are carried by a mobile fluid phase through a
stationary solid or liquid phase.
Chromatograph:
The apparatus used in the performance of
chromatography.
Chromatogram:
A visual record of the output from a chromatographic
run. This could be visible colored bands appearing on a
thin‐layer sheet used in thin layer chromatography, a
series of peaks on a computer screen showing the time‐
dependent elution of compounds in a mixture in high‐
performance liquid chromatography, or other forms of
display of chromatographic results.
Electrophoresis:
A technique for separating charged species (proteins
and nucleic acids) on the basis of charge and molecular
size.
Enzymatic browning:
Browning that develops when cut or bruised surfaces of
fruits, vegetables, and shellfish are exposed to air.
Catalyzed by polyphenoloxidases.
Free radicals:
311
www.ajpdf.com
Chemical species that contain one or more unpaired

electrons. Most free radicals are unstable and highly
reactive. Commonly identified by a dot signifying an
unpaired electron, e.g., •OH is the formula for hydroxyl
radical.
Galactomannans.
Hydrocolloids with long backbone chains composed of
repeating mannose units linked by β‐1,4‐glycosidic
bonds and galactose side chains linked to mannose
residues by α‐1,6‐glycosidic bonds. Common
galactomannans include locust bean gum and guar
gum.
Glyphosate:
An effective herbicide that binds irreversibly to the
active site of 5‐enolpyruvyl‐shikimate‐3‐phosphate
synthase (EPSPS), thereby blocking the synthesis of
aromatic amino acids in the plant.
Gums:
Water‐soluble polysaccharides capable of increasing
viscosity or forming gels in aqueous systems. Examples
include alginate, xanthan, guar, and carrageenan. Also
called hydrocolloids.
Homolysis:
The symmetrical cleavage of a covalent bond such that
one electron of the pair forming the bond goes with
each product. Homolysis of covalent bonds yields free
radicals.
Hydrocolloids:
Polymers that can be dissolved or dispersed in water
and that produce thickening or gelling.
Hydrolysis:
The breaking of covalent bonds through the reaction
with water. Bonds susceptible to hydrolysis include
peptide bonds, ester bonds, and glycosidic bonds.
Hydrolytic rancidity:
Rancidity that develops when lipases attack triacyl
glycerols that contain short‐chain fatty acids. Most
commonly occurs in products containing milk fat.
312
www.ajpdf.com
Hydroperoxide:
A hydrogen‐containing peroxide.
Leavening:
A term derived from the Latin word levo, which means
“raising or making light.” Used in the baking industry to
describe the rising of bread doughs and cake batters.
The process of increasing the volume of batters and
doughs by incorporating gas into them.
Lipid hydroperoxide:
A hydroperoxide formed from lipids, usually
polyunsaturated fatty acids.
Maillard reaction:
A reaction between reducing sugars and amines
resulting in browning and flavor development. A form
of nonenzymatic browning.
Metmyoglobin:
Myoglobin in which the complexed iron has been
oxidized to the ferric (Fe3+) form. Brown in color and
accounts for the brown color of cooked meat.
Myoglobin:
One of the major pigments in meat. A protein
containing a heme group with complexed iron in the
ferrous (Fe2+) form. Dark purplish red in color.
Neutralizing value:
The amount of NaHCO3 that can be neutralized by 100
parts of a leavening acid.
Normal phase chromatography:
Chromatography in which a polar stationary phase and
a nonpolar mobile phase are used.
Oxidation:
A reaction in which a chemical species either loses
electrons, gains oxygen, or loses hydrogen.
Oxidative rancidity:
Rancidity in foods that results from the oxidation of
constituent lipids.
Oxymyoglobin:
313
www.ajpdf.com
Myoglobin containing molecular oxygen bound to the

iron in the heme complex. Bright red in color and
contributes to the red color of fresh meat.
Peroxidases:
A group of enzymes that catalyze oxidation–reduction
reactions with peroxides as substrates. Peroxidases are
ubiquitous in plant tissues and are among the most
heat stable enzymes in plants.
Phytochemicals:
Chemicals that occur naturally in plants.
Polyunsaturated fatty acids (PUFA):
Fatty acids that contain more than one carbon–carbon
double bond per molecule. Susceptible to oxidation
because of the presence of the double bonds. Fats and
oils from plant sources (soybean, corn, sunflower,
peanut) tend to be high in PUFAs.
Reactive oxygen species (ROS):
Oxygen‐containing species that are more reactive than
ground‐state molecular oxygen (triplet oxygen).
Examples include hydrogen peroxide, singlet oxygen,
superoxide, hydroxyl radicals, peroxyl radicals, and
alkoxyl radicals.
Reducing sugars:
Sugars capable of reducing various oxidizing agents.
Examples include glucose, fructose, lactose, and
maltose.
Reduction:
A reaction in which a chemical species either gains
electrons, loses oxygen, or gains hydrogen.
Reverse phase chromatography:
Chromatography in which a nonpolar stationary phase
and a polar mobile phase are used.
Saturated fatty acids:
Fatty acids with no carbon–carbon double bonds. Much
less susceptible to oxidation than unsaturated fatty
acids. Animal fats and coconut and palm oils are
particularly rich in saturated fatty acids.
314
www.ajpdf.com
Singlet Oxygen (1O2):

An excited (reactive) form of molecular oxygen.
Contains an empty π*2p orbital and thus is an
electrophile. Reacts readily with carbon–carbon double
bonds in PUFA to form lipid hydroperoxides.
Superoxide ( ):
A free radical formed when molecular oxygen gains one
electron. Produced by phagocytic cells to kill bacteria
and viruses. It also forms when electrons leak from the
electron transport chain and combine with oxygen.
Surfactants:
Amphiphilic molecules containing one or more
nonpolar, as well as polar regions, thus serving as
emulsifying agents at the interface between oil and
water.
Triplet oxygen (3O2):
Ground‐state molecular oxygen. The predominant form
of oxygen in the air. Relatively unreactive toward most
organic molecules at physiologic temperatures unless
reactions are enzyme catalyzed. Not considered a ROS.
Uronic acids:
Organic acids formed from the oxidation of –CH2OH
groups on sugars without oxidizing the aldehyde
groups. Examples include glucuronic and galacturonic
acids.
Vitamin E:
A fat‐soluble vitamin. Functions as an antioxidant to
protect cell membranes from oxidation. Eight naturally
occurring compounds (four tocopherols and four
tocotrienols) have vitamin E activity. α‐Tocopherol is
the most active form.
Warmed over flavor (WOF):
The off‐flavor that develops in cooked meat when it is
refrigerated and then reheated.
Xanthan gum:
An extracellular polysaccharide produced by the
bacterium Xanthomonas campestris. Highly soluble in
315
www.ajpdf.com
hot and cold water and imparts high viscosity at low

concentrations. Used as a thickening and stabilizing
agent in syrups, salad dressings, and gravies.
316
www.ajpdf.com
WILEY END USER LICENSE

AGREEMENT
Go to www.wiley.com/go/eula to access Wiley’s ebook
EULA.
317

Food Chemistry A Laboratory Manual 2nd Edition

Uploaded by

Copyright:

Available Formats

Food Chemistry A Laboratory Manual 2nd Edition

Uploaded by

Document Information

Original Title

Copyright

Available Formats

Share this document

Share or Embed Document

Sharing Options

Did you find this document useful?

Is this content inappropriate?

Copyright:

Available Formats

Food Chemistry A Laboratory Manual 2nd Edition

Uploaded by

Copyright:

Available Formats

www.ajpdf.

This edition first published 2022

Names: Miller, Dennis D., 1945- author. I Yeung, C. K., author.

Preface to the Second Edition xv

1 Acids, Bases, and Buffers 1

2 Chemical Leavening Agents 7

2.4 Reagents and Materials

4.5.4 Browning in Nonfat Dry Milk (Demonstration)

6 Functional Properties of Proteins 65

6.5.3.2 Soy Protein Isolation

8 Enzymatic Browning: Kinetics of Polyphenoloxidase 87

9 Blanching Effectiveness 102

10 Lipid Oxidation 109

11 Ascorbic Acid: Stability and Leachability 127

12 Hydrolytic Rancidity in Milk 138

13 Caffeine in Beverages 149

14 Color Additives 156

14.5.3 Quantitative Analysis of FD&C Red Dye # 40 in Cranberry Juice

15 Plant Pigments 176

16 Meat Pigments 191

17 Meat Tenderizers 204

17.5.2.1 Loading and Running the Gel

18 Detection of Genetically Engineered Maize Varieties 212

19 Food Emulsions and Surfactants 230

Appendix III 258

Appendix VII 310

Table 5.2 Functional properties of xanthan gum

Table 15.1 FDA approved “color additives exempt

Figure 3.1 Three representations of the structure

Figure 7.1 Lactose (conformational

Figure 12.3 Cu2+ combines with

Figure VI.1 The formation of polyacrylamide from

Preface to the Second Edition

revising these summaries, we relied heavily on two widely

Preface to the First Edition

About the Companion Website

Preparations and solutions for all chapters

Acids, Bases, and Buffers

After completing this exercise, students will be able to:

2 1 Acids, Bases, and Buffers

Table 1.1 Acids common in foods: structures and pKa values.

Substance Structure pKa Food found in

Acetic acid CH3COOH pK = 4.75 Vinegar, figs

Adipic acid HOOC(CH2)4COOH pK1 = 4.43 Beets

Butyric acid CH3(CH2)2COOH pK = 4.82 Cheese, butter

Citric acid CH2COOH pK1 = 3.06 Oranges, lemons, apricots, tomatoes

Lactic acid CH3CHCOOH pK = 3.83 Yogurt, buttermilk, cheese, beer

Malic acid HOOCCH2CHCOOH pK1 = 3.40 Apples, apricots, grapes, oranges,

Oxalic acid COOH pK1 = 1.27 Spinach, potatoes, tomatoes

Phosphoric acid OH pK1 = 2.12 Tomatoes, acidulant used in soft

Tartaric acid OH pK1 = 2.98 Grapes

Sodium hydrogen O O pK = 1.99 Acidulant. Lowers pH without

1.2.1.1 Food Acidulants

1.3 ­Apparatus and Instrument 3

1.2.1.2 Reactions of Food Acids

Reaction with alcohols to form esters:

1) pH meter equipped with a pH electrode

4 1 Acids, Bases, and Buffers

Table 1.2 Approximate pH values for some common foodsa.

1.3 Apparatus and Instrument 3