Influenza-Induced Immune Suppression To

RESEARCH ARTICLE
Influenza-induced immune suppression to

methicillin-resistant Staphylococcus aureus is
mediated by TLR9
Giovanny J. Martı́nez-Colón1, Helen Warheit-Niemi ID2, Stephen J. Gurczynski ID3, Quincy
M. Taylor ID4, Carol A. Wilke3, Amy B. Podsiad3, Joel Crespo1, Urvashi Bhan3, Bethany
B. Moore ID3,5*
1 Graduate Program in Immunology, University of Michigan, Ann Arbor, MI, United States of America,
2 Microbiology and Immunology Graduate Program, University of Michigan, Ann Arbor, MI United States of
a1111111111 America, 3 Pulmonary and Critical Care Medicine Division, Department of Internal Medicine, University of
a1111111111 Michigan, Ann Arbor, MI, United States of America, 4 Literature, Sciences and the Arts, Microbiology,
a1111111111 University of Michigan, Ann Arbor, MI, United States of America, 5 Department of Microbiology and
a1111111111 Immunology, University of Michigan, Ann Arbor, MI, United States of America
a1111111111
* bmoore@umich.edu
Abstract
OPEN ACCESS
Citation: Martı́nez-Colón GJ, Warheit-Niemi H, Bacterial lung infections, particularly with methicillin-resistant Staphylococcus aureus
Gurczynski SJ, Taylor QM, Wilke CA, Podsiad AB, (MRSA), increase mortality following influenza infection, but the mechanisms remain
et al. (2019) Influenza-induced immune unclear. Here we show that expression of TLR9, a microbial DNA sensor, is increased in
suppression to methicillin-resistant
murine lung macrophages, dendritic cells, CD8+ T cells and epithelial cells post-influenza
Staphylococcus aureus is mediated by TLR9. PLoS
Pathog 15(1): e1007560. https://doi.org/10.1371/ infection. TLR9-/- mice did not show differences in handling influenza nor MRSA infection
journal.ppat.1007560 alone. However, TLR9-/- mice have improved survival and bacterial clearance in the lung
Editor: Ryan Langlois, University of Minnesota, post-influenza and MRSA dual infection, with no difference in viral load during dual infection.
UNITED STATES We demonstrate that TLR9 is upregulated on macrophages even when they are not them-
Received: July 23, 2018 selves infected, suggesting that TLR9 upregulation is related to soluble mediators. We rule
out a role for elevations in interferon-γ (IFNγ) in mediating the beneficial MRSA clearance in
Accepted: January 3, 2019
TLR9-/- mice. While macrophages from WT and TLR9-/- mice show similar phagocytosis
Published: January 25, 2019
and bacterial killing to MRSA alone, following influenza infection, there is a marked upregu-
Copyright: © 2019 Martı́nez-Colón et al. This is an lation of scavenger receptor A and MRSA phagocytosis as well as inducible nitric oxide
open access article distributed under the terms of
synthase (Inos) and improved bacterial killing that is specific to TLR9-deficient cells. Bone
the Creative Commons Attribution License, which
permits unrestricted use, distribution, and marrow transplant chimera experiments and in vitro experiments using TLR9 antagonists
reproduction in any medium, provided the original suggest TLR9 expression on non-hematopoietic cells, rather than the macrophages them-
author and source are credited. selves, is important for regulating myeloid cell function. Interestingly, improved bacterial
Data Availability Statement: All relevant data are clearance post-dual infection was restricted to MRSA, as there was no difference in the
within the paper and its Supporting Information clearance of Streptococcus pneumoniae. Taken together these data show a surprising
files.
inhibitory role for TLR9 signaling in mediating clearance of MRSA that manifests following
Funding: This work was supported by the National influenza infection.
Institutes of Health, an institutional fellowship from
the Rackham graduate school and a scholarship
from the Miller fund for innovative immunology
research. The funders had no role in study design,
data collection and analysis, decision to publish, or
preparation of the manuscript.
PLOS Pathogens | https://doi.org/10.1371/journal.ppat.1007560 January 25, 2019 1 / 23

TLR9 loss improves MRSA clearance post-influenza
Competing interests: The authors have declared

that no competing interests exist. Author summary
Influenza-associated secondary bacterial infections, particularly with methicillin-resistant
Staphylococcus aureus (MRSA), are a major cause of morbidity and mortality, and better
therapeutic strategies are needed. Stimulation of TLR2 has shown promise for improving
health in influenza-bacteria dual-infected animals. However, nothing is known about the
role of other TLRs, including TLR9, in influenza-bacteria dual infection pathology. This is
the first study of TLR9 regulation of influenza-bacterial superinfection and it highlights
an unexpected pathologic role for TLR9 in regulating clearance of MRSA post-H1N1. It
also highlights the important observation that TLR9 signaling has very different outcomes
in the setting of influenza infection than in naïve mice and shows important distinctions
in the mechanisms for susceptibility to MRSA vs. S. pneumoniae post-influenza. Our
results also suggest that TLR9 expression on non-hematopoietic cells regulates macro-
phage function in vivo.
Introduction
Influenza viruses are single-stranded RNA viruses with a segmented genome capable of under-
going mutagenesis to evade host immunity and they cause seasonal outbreaks leading to over a
half million deaths per year worldwide (World Health Organization, 2016)[1]. Influenza
viruses can overcome traditional vaccine strategies such as inoculation with inactivated
viruses, as this will not confer long-lasting protection to antigenic drift [2]. There are three
types of influenza viruses that can infect humans (A, B, and C). Influenza A virus (IAV) and
influenza B can both cause seasonal outbreaks but IAV is generally more severe. IAV infec-
tions can be complicated by bacterial pathogens including Staphylococcus aureus, and Strepto-
coccus pneumoniae leading to increased morbidity and mortality [3]. Retrospective studies
have shown that 95% of the deaths caused by the 1918 influenza pandemic (Spanish Flu) were
complicated by bacterial superinfections [3, 4]. More recently, whole-blood transcriptome
analysis of over 225 influenza-infected patients showed a shift and enrichment in gene signa-
tures from viral response to bacterial response in critically ill patients [5]. Thus, to decrease
morbidity and mortality of IAV infections we need a better understanding of how to treat sec-
ondary bacterial infections. Past studies have found that IAV infections can lead to secondary
bacterial infections by increasing the attachment sites for bacteria, reducing responsiveness of
immune cells, and reducing efficiency of antibiotics [6–8]. Yet, the mechanisms underlying
influenza-induced mortality are still poorly understood and we need better therapeutic strate-
gies to improve outcomes for influenza-infected individuals.
Toll-like receptors (TLRs) are germline encoded pathogen recognition receptors (PRRs)
capable of initiating innate immune responses, and regulating adaptive immunity to both viral
and bacterial pathogens [9]. They are primarily expressed in immune cells, and are membrane
bound and distributed in the extracellular membrane and endosomes making them able to
recognize extracellular and intracellular pathogen components [10]. Manipulation of TLRs has
shown great potential in combating bacterial infections. For example, agonistic stimulation of
TLR4, a lipopolysaccharide (LPS) receptor, has been shown to improve bacterial clearance in
Pseudomonas aeruginosa infected mice [11]. IAV has been shown to alter the expression of
TLRs including downregulation of TLR2, a bacterial lipopeptide sensor, in human monocytes
and dendritic cells [12]. TLR2 agonist stimulation was shown to have therapeutic potential to
improve survival as well as bacterial and viral clearance in a mouse model of viral-bacterial
coinfection [13]. However, little is known about the role of other TLRs that are altered in IAV
infections and their implications in secondary bacterial infections.

IAV infection was shown to increase the expression of TLR9 in human monocytes and den-
dritic cells [12]. TLR9 is an endosomal receptor that recognizes unmethylated cytosine and
guanine (CpG) motifs which are rich in viral and bacterial DNA and mitochondrial DNA
(mtDNA)[14, 15]. Here, we aimed to study the role of TLR9 in IAV-associated bacterial sec-
ondary infections, particularly with the bacterial pathogen methicillin-resistant Staphylococcus
aureus (MRSA). Studying MRSA secondary infections is of high importance as in recent pan-
demics it was the main cause of secondary pneumonia in IAV infected individuals [16]. Addi-
tionally, MRSA is the leading cause of bacterial infections in humans worldwide, and
infections are difficult to treat as MRSA is resistant to all known β-lactam antibiotics [17].
With the use of a mouse-adapted IAV strain, A/Puerto Rico/8/1934 (PR8), we found that
TLR9 expression is elevated in lung macrophages, dendritic cells, CD8 T cells and epithelial
cells from PR8 infected mice. TLR9-/- mice infected with PR8 or MRSA alone did not differ in
clearance of either pathogen from wild-type (WT) mice, but they experience improved survival
post PR8-MRSA dual infection and show improved bacterial phagocytosis and killing post
dual infection Our findings show a previously unrecognized role for TLR9 in limiting clear-
ance of MRSA post-dual infection.
Results
IAV increases expression of TLR9 in macrophages
Changes in expression of different toll-like receptors (TLRs) (TLR2, TLR3, TLR4, TLR7,
TLR8, and TLR9) have been reported before in human monocytes and dendritic cells from
seasonal influenza infected patients [12]. Similarly, in our murine experiments, we noted that
TLR9 gene expression is increased in lung leukocytes obtained by collagenase digestion and
ficoll density separation 5 days post-PR8 infection while TLR4 is reduced (Fig 1A). Protein
expression was also increased in these lung leukocytes post-PR8 infection as measured by
TLR9 immunoblotting (Fig 1B). To understand which cells were upregulating TLR9, we used
flow cytometry to characterize the major immune cells in the lung compartment. We found
that CD8 T cells, macrophages (interstitial and alveolar), and dendritic cells were the main
cells with higher TLR9 expression post-PR8 (Fig 1C). We did not find changes in NK cells, B
cells, or neutrophils but CD4 T cells showed a lower frequency of TLR9+ cells (Fig 1C). Adher-
ence selection of lung leukocytes for 1 h after collagenase digestion enriches for myeloid cells
such as monocytes and macrophages and allowed us to detect gene expression changes in mul-
tiple TLRs after influenza infection in these cells. We found that apart from TLR9 being
increased, TLR3 and TLR2 were also altered with increased and decreased expression, respec-
tively (Fig 1D). These later observations were also seen previously in human monocytes from
influenza-infected individuals [12]. Interestingly, direct infection of isolated alveolar macro-
phages with PR8 also shows an increase in TLR9, TLR7 and TLR3, with no changes in TLR2,
and reduced TLR4 (Fig 1E). We also detected TLR9 mRNA increased 24 hours post-PR8 infec-
tion in cultured bone marrow derived macrophages (BMDMs) (Fig 1F).
In order to determine whether TLR9 was being upregulated only in infected macrophages
or also in non-infected cells, we infected bone marrow derived macrophages (BMDMs) for 24
or 48h with H1N1 or mock infection. We then measured levels of H1N1 infection by expres-
sion of the viral protein, NP, and looked for TLR9 levels by flow cytometry on cells which also
expressed CD45 and F4/80 (Fig 2A). TLR9 is expressed on 55.4 ± 1.6% of H1N1 infected
BMDMs compared to 50.2 ± 1.3% of mock infected cells at 24 h whereas NP expression was
noted in only 0.3 ± 0.07% of cells at this time point (n = 4–5 group, P<0.05 for mock vs.
infected TLR9%, flow plots from one sample for each shown). At 48 h, expression of TLR9 in
mock-infected samples was seen in 19.9 ± 1.0% of mock infected cells and 28.2 ±1.08% of

Fig 1. TLR9 overexpression in lung immune cells post-IAV infection. (A) Relative gene expression of TLRs (9, 7, 3, 2, 4) by RTqPCR and (B)
western blotting of TLR9 and β-actin. RNA and protein were isolated from lung leukocytes post-collagenase digestion in mice infected with 100
PFUs of H1N1 (PR8) for 5 days or placebo (PBS). β-actin was used to normalize RNA in samples. (C) Frequency of TLR9+ cells measured by flow
cytometry in lung immune cells post-collagenase digestion. Gating was as follows: CD4+ T cells (CD45+,CD90.2+, CD3+, CD4+), CD8+ T cells

(CD45+,CD90.2+, CD3+, CD4-, CD8+), natural killer cells (CD45+,CD90.2+, NKp46+), B cells (CD45+,CD90.2-, CD19+), neutrophils (CD45+,
CD11b+, LY6G+), interstitial macrophages (CD45+, CD64+, CD11b+, F4/80+), alveolar macrophages (CD45+, CD64+, CD11C+, Siglec F+) and
dendritic cells (CD45+, CD64-, CD11c+, MCHIIhigh). Staining for TLR9 was performed on cells which were fixed and permeabilized. (D) Relative
expression of TLRs (9, 7, 3, 2, 4) after lung macrophage isolation by adherence selection from PBS or IAV-infected mice. (E) Relative expression
of TLRs (9, 7, 3, 2, 4) in alveolar macrophages infected or not ex-vivo with H1N1 (MOI:0.01) for 24 hours. (F) BMDMs from Balb/c mice infected
with H1N1 at MOI:0.01 and measured for TLR9 mRNA after 48h. Statistics are student T test between comparative groups. � P<0.05,�� P<0.01,
��
P<0.001, �� P<0.0001. Experiments in panels A, D, E and F were repeated at least 2 times with similar results. Panels B and C are single
experiments on n = 4 (panel B) or n = 5 (panel C) mice.
https://doi.org/10.1371/journal.ppat.1007560.g001
H1N1 infected cells. By 48 h, 0.1 ± 0.008% of BMDMs were NP+ (n = 4–5 per group, P<0.001
for TLR9% between mock and H1N1-infected cells at 48 h). Furthermore, BMDMs were not
productively infected by H1N1 as NP expression decreased from 24 to 48h. To our knowledge,
we are the first to report that infection of macrophages ex vivo with IAV can increase TLR9
expression. The signal to mediate this increase was likely independent of IAV recognition by
TLR7, or by IAV-induced release of CpG rich mitochondrial (mt)DNA as TLR7 and TLR9
agonist stimulation lead to downregulation of TLR9 gene expression relative to mock infection
(Fig 2B). Taken together with the observation that TLR9 is increased on uninfected cells and
on cell types not traditionally infected by IAV in vivo, these data are consistent with a secreted
mediator being responsible for the upregulation of TLR9 expression post-H1N1 infection.
TLR9-/- mice show no difference in susceptibility to H1N1 or MRSA

infection alone
The upregulation of TLR9 following H1N1 infection suggested the potential for cross-talk
between viral infection and bacterial genome sensing. However, before addressing this, we
wanted to first determine whether loss of TLR9 had any impact on host defense against infec-
tion with H1N1 alone or MRSA alone. Fig 3A demonstrates that 5 days post-infection with
100 PFU H1N1, WT (Balb/c) and TLR9-/- mice showed equivalent viral loads in the lung by
plaque assay and in a separate experiment that viral M1 gene expression in the lung at this
time was similar between genotypes (Fig 3B).
Currently, there are conflicting results regarding the role of TLR9 in single MRSA infection
[18, 19]. To understand if TLR9-/- mice were susceptible to a single MRSA infection, we moni-
tored mice for 7 days post-infection. We did not detect any deaths in either TLR9-/- or WT
mice but weight recovery during the MRSA infection was slower in TLR9-/- mice (S1 Fig). We
detected reduced immune cell infiltration in the alveolar compartment post-MRSA infection
alone in TLR9-/- mice (Fig 3C). However, this did not affect bacterial clearance (Fig 3D) or
lung injury (Fig 3E) as both were reduced significantly 48 h post-infection in both genotypes.
Previous work has shown that TLR9-/- mice have reduced TNF-α in the bronchoalveolar
lavage fluid (BALF) post-MRSA [19]. We detected lower amounts of TNF-α, IL-6, IL-1β and
IL-10 in the BALF of MRSA-infected TLR9-/- mice (Fig 3F). Yet, lower amounts of these cyto-
kines did not have a negative effect on bacterial clearance, lung injury, or survival. Reduced
immune cell infiltration and the lower cytokine profile might be explained by lower NF-κB
activation post-MRSA infection as TLR9 is a sensor of bacterial DNA [20].
TLR9-/- mice are resistant to IAV and MRSA dual infection

Secondary bacterial infections in IAV infected individuals are a main cause of mortality and
morbidity [21]. To study the potential crosstalk between the virus and the bacteria, we tested
IAV-MRSA coinfection models in Balb/c mice consisting of an initial viral infection (10 or 100
PFU) followed by a secondary bacterial infection on various days (S2 Fig). We determined that
we could detect susceptibility to MRSA infection as early as 5 days post-100 PFU PR8 infection

Fig 2. TLR9 is upregulated in non-infected BMDMs. (A) BMDMs were infected with MOI:0.01 H1N1 and cells were
stained for expression of F480, TLR9 and NP by flow cytometry after 24 or 48 h. Flow plots are representative of
n = 4–5 samples with similar results in 2 experiments. (B) BMDMs were treated with the TLR9 agonist, ODN 2395, or
with the TLR7 agonist, imiquimod (R837), for 24 hours at a concentration of 1μM or 1μg/ml, respectively. RNA was
isolated and TLR9 transcript expression was measured by RTqPCR; n = 4; Results analyzed by ANOVA with Tukey
post-test.�� P<0.001 and are indicative of two similar experiments.
(S2B Fig; schematic diagrammed in Fig 4A). We next tested this dual infection model in WT
and TLR9-/- mice and observed a significant survival difference between TLR9-/- and WT
mice, where 77% of TLR9-/- mice survived the secondary bacterial infection compared to 33%
of WT mice (Fig 4B; data represent n = 13 mice combined from 2 separate survival assays
matched for sex and starting weight). Surviving Balb/c mice on average weighed less than

Fig 3. Balb/c and TLR9-/- mice show similar susceptibility to H1N1 and MRSA alone. (A) Balb/c and TLR9-/- mice were infected with 100 PFU
H1N1 and lungs were collected for determination of viral load by plaque assay or (B) by detection of viral M1 gene levels; n = 4-5/group. Panel A
was repeated 2 times and panel B is a single experiment done to confirm results of plaque assay. Student’s T-test shows results are not significantly
different between genotypes. (C) Total number of cells (left) and percentage of leukocytes (right) in the alveolar compartment of BALB/c and
TLR9-/- mice infected with MRSA alone and quantified using a hemocytometer and differential staining; samples were taken by bronchoalveolar
lavage 24 hours post-MRSA (7x107 CFUs) infection. (D) Lung bacterial burden and (E) albumin measurements in the BALF 24 and 48 hours
post-MRSA (7x107 CFUs) infection in BALB/c and TLR9-/- mice. (F) Cytokine levels in the BALF of BALB/c and TLR9-/- mice infected with
MRSA (7x107 CFUs) for 24 hours. Cytokines were measured by ELISA. (C) & (F) Statistics are student T test; ns = non-significant, � P<0.05,
��
P<0.01, �� P<0.001. Panel C was repeated twice and panel F is a single experiment with n = 4–5 mice/group. (D) and (E) statistics were
obtained by one-way analysis of variance with Tukey’s posttest. �� P<0.0001. The 24 h time point was repeated at least 2 times and the 48h time
point was a single experiment.

Fig 4. TLR9-/- mice are resistant to secondary bacterial infection. (A) Sketch of infection model where Balb/c and
TLR9-/- mice are infected with 100 PFUs of H1N1 5 days prior to infection with 7x107 CFUs of MRSA (US300). Mice
are monitored daily to check for survival. (B) Survival assay of Balb/c (n = 13) and TLR9-/- (n = 13) mice following
coinfection. (C) Weight changes (left) and initial weight (right) of all mice used in survival assay. Data are combined
from 2 independent experiments with mice matched for weight and sex at start. Statistics for weight changes on each
day and initial weight were student T test, non-significant (ns); P<0.05 only on days 8 and 11. Statistics in survival
assay were done with the Log-rank (Mantel-Cox), P = 0.03.
surviving TLR9-/- mice but this only reached significance on days 8 and 11 (Fig 4C). In both
experiments we noted that the TLR9-/- mice appeared healthier than did the WT mice in terms
of posture, grooming and activity in the cage post-dual infection.

Fig 5. TLR9-/- mice experience improved bacterial clearance post-IAV and MRSA coinfection. (A) Bacterial burden in lungs and (B) albumin levels in BALF from
BALB/c and TLR9-/- mice that were infected with IAV (100 PFUs, H1N1) or treated with placebo, PBS, 5 days prior to MRSA (7x107 CFUs) infection; samples were
harvested 24 hours post-MRSA infection. (C) Quantification of influenza titers in whole lung of BALB/c and TLR9-/- mice infected with influenza (100 PFUs, H1N1) 5
days prior to MRSA (7x107 CFUs) infection or PBS treatment. (A and C) Statistics were obtained by one-way analysis of variance with Bonferroni’s posttest, Panel B
used Tukey’s post-test; ns = non-significant, � P<0.05, �� P<0.01, �� P<0.001, �� P<0.0001. All experiments were repeated at least 2 times with similar results.
TLR9-/- mice experience improved MRSA clearance post-dual infection

To determine whether the improved survival in the dual-infected TLR9-/- mice corresponded
with better bacterial clearance, WT and TLR9-/- mice were infected with H1N1 on day 0 or
were mock-infected. On day 5, mice received 7 x 107 CFU MRSA and lungs were harvested
24h later. Fig 5A shows that in WT mice, preceding H1N1 infection impairs clearance of
MRSA relative to mice getting mock infection prior to MRSA. Furthermore, we were able to
detect better bacterial clearance in the IAV-infected TLR9-/- mice 24 hours post-MRSA infec-
tion than in WT mice, but saw no difference in tissue injury (Fig 5B) or viral load (Fig 5C) in
the presence or absence of MRSA between genotypes. Importantly, the difference we note in
bacterial clearance at day 6 (24h post-MRSA infection) precedes the first deaths on day 7
(Fig 4B).

Better bacterial clearance in TLR9-/- mice post-dual infection is

independent of increased levels of IFN-γ
To understand whether TLR9-/- mice are clearing the bacteria better post dual infection due to
differences in their cytokine profiles, we measured the levels of different pro and anti-inflam-
matory cytokines. We detected reduced amounts of TNF-α, IL-1β, IL-6, and IL-17, but
increased levels of IFN-γ in TLR9-/- mice (Fig 6A). High levels of IFN-γ have previously been
shown to improve MRSA clearance due to full activation of macrophages [22]. Together with
this, we detected higher numbers of TH1 (CD45+,CD90.2+,CD4+,IFN-γ+), CD8 T (CD45+,
CD90.2+,CD4-,CD8+,IFN-γ+), and NK (CD45+,CD90.2+,NKP46+,IFN-γ+) cells, but no differ-
ence in other immune cells including B cells (CD45+,CD90.2-,CD19+), and CD4 T (CD45+,
CD90.2+,CD4+) cells (Fig 6B). S3 Fig. shows the gating strategy for these analyses. To test
whether high levels of IFN-γ in the bronchoalveolar lavage fluid (BALF) were responsible for
the improved bacterial clearance in TLR9-/- mice, we neutralized IFN-γ during IAV-MRSA
coinfection. To our surprise, there was no difference between isotype-treated and IFN-γ-neu-
tralized mice in terms of MRSA bacterial burden in either genotype (Fig 6C) even though we
successfully neutralized the elevated IFN-γ levels in TLR9-/- mice (Fig 6D).
TLR9-/- lung macrophages have increased phagocytosis, bacterial killing,

and iNOS expression post-IAV infection
To determine if IAV was inducing changes in TLR9-/- mice that were leading to resistance to a
MRSA infection, we measured the cytokine profile in the BALF in WT and TLR9-/- mice post-sin-
gle IAV infection. There were no differences in cytokines tested 5 days post-IAV infection (Fig
7A). We also found no significant differences in the immune cells recruited to the lungs (S4 Fig).
Despite being present in equal numbers, monocyte/macrophages isolated from IAV-infected
TLR9-/- mice have increased MRSA phagocytosis (Fig 7B). This increased phagocytosis correlates
with higher expression of scavenger receptor A (SRA) on monocyte/macrophages isolated on day
5 from TLR9-/- versus WT mice infected with H1N1 (Fig 7C). Our laboratory has previously
shown that phagocytosis of non-opsonized MRSA requires SRA expression [23]. TLR9-/- mice also
show improved intracellular killing of ingested bacteria (Fig 7D) and TLR9-/- lung macrophages
have higher levels of iNOS post-IAV compared to WT (Fig 7E). Nitric oxide production has been
shown to be crucial in clearing MRSA infection [24]. To test whether TLR9 expression might sup-
press iNOS increase, we infected BMDMs from WT and TLR9-/- mice and measured iNOS expres-
sion. TLR9-/- macrophages have higher expression of iNOS post-IAV infection suggesting that
TLR9 is a negative regulator of iNOS expression in BMDMs post-IAV infection (Fig 7F).
Loss of TLR9 in hematopoietic cells or antagonism of TLR9 in

macrophages is insufficient to improve MRSA clearance post-H1N1
To determine whether loss of TLR9 just in hematopoietic cells was needed for the beneficial
effects on MRSA clearance, we created chimeric (WT into WT and TLR9-/- in WT) mice and
tested clearance of MRSA infection alone or clearance of MRSA following dual infection (Fig
8A). Surprisingly, loss of TLR9 in hematopoietic cells alone showed no benefit in clearance of
MRSA alone or MRSA post-H1N1. Further proof that inhibition of TLR9 just in monocyte/
macrophages was insufficient to improve MRSA clearance post-H1N1 is shown in Fig 8B
where treatment of adherence purified monocytes and macrophages from H1N1-infeced mice
with control oligodeoxynucleotide (ODN) or ODN2088, a TLR9 antagonist, demonstrated
that ODN2088 treatment impaired (rather than improved) MRSA phagocytosis relative to
control ODN-treated cells.

Fig 6. Higher bacterial clearance in TLR9-/- mice post-IAV and MRSA coinfection is independent of exacerbated levels of IFN-γ. (A)
Cytokine measurement in BALF from BALB/c and TLR9-/- mice that were infected with IAV (100 PFUs, H1N1) 5 days prior to MRSA (7x107
CFUs) infection. (B) Absolute number of lung immune cells post-lung collagenase digestion in BALB/c and TLR9-/- mice that were infected with
IAV (100 PFUs, H1N1) 5 days prior to MRSA (7x107 CFUs) infection. Cells were quantified by flow cytometry; gating was as follow: B cells
(CD45+CD90.2-CD19+); CD4+ T cells (CD45+CD90.2+CD4+); TH1 (CD45+CD90.2+CD4+,IFN-γ+); CD8+ T cells (CD45+CD90.2+CD4-,CD8+,
IFN-γ+); NK cells (CD45+CD90.2+NKP46+,IFN-γ+). (C) Lung bacterial burden and (D) IFN-γ levels in BALB/c and TLR9-/- mice that were
treated with 200μg of IFN-γ neutralizing antibody or isotype control and infected with IAV (100 PFUs, H1N1) 5 days prior to MRSA (7x107
CFUs) infection. (A-B) Statistics are student T test between comparative groups; ns = non-significant, � P<0.05, �� P<0.01, �� P<0.001,
��
P<0.0001. Panels A and B represent single experiments on 4–5 mice/group. (C-D) Statistics were obtained by one-way analysis of variance
with Tukey’s posttest; ns = non-significant, � P<0.05, �� P<0.01. Panels C and D represent a single experiment due to limited availability of
neutralizing antibody.
Lung epithelial cells upregulate TLR9 post-H1N1

Taken together, the results in Fig 8A and 8B suggest that stimulation of TLR9 on structural or
other non-hematopoietic cells of the lung likely causes release of soluble mediators that

Fig 7. TLR9-/- lung macrophages have increased phagocytosis, bacterial killing, and iNOS expression post-IAV infection. (A)
Cytokine measurement in BALF from BALB/c and TLR9-/- mice that were infected with IAV (100 PFUs, H1N1) for 5 days n = 5/group
(some values are overlapping in the dot plots) for all but IL-10 which was from an experiment with n = 3 TLR9-/- mice and 5 Balb/c mice.
(B) Ex vivo MRSA phagocytosis by macrophages isolated by collagenase digestion and adherence purification from mock or H1N1
infected mice on day 5, n = 3. (C) SRA expression analyzed by real-time RT-PCR in monocyte/macrophages isolated on day 5 from
H1N1-infected mice, n = 3. (D) Ex vivo MRSA killing assay using adherence selected lung macrophages from BALB/c and TLR9-/- mice
that were infected with IAV (100 PFUs H1N1) for 5 days or treated with PBS; n = 8/group in mock infections and n = 3/group in H1N1
infected mice. (E) Quantitative reverse transcriptase-PCR measurement of relative gene expression of iNOS from adherence selected
lung macrophages from BALB/c and TLR9-/- mice that were infected with IAV for 5 days or treated with PBS; RNA samples were

normalized to their β-actin levels and setting mock-infected Balb/c to 1; n = 3-5/group. (F) BMDMs from Balb/c or TLR9-/- mice were
mock-infected for 24 h or were infected with MOI:0.01 H1N1 for 24 or 48 h before RNA was prepared and analyzed for expression of
iNOS normalized to their β-actin levels and setting mock-infected Balb/c to 1; n = 3/group. Panels A and C were analyzed by student’s t-
test. Panels B, D, E and F were analyzed by two-way ANOVA with Sidak’s multiple comparison test.; Non-significant (ns), � P<0.05,
��
P<0.001, �� P<0.0001. Panels A-D are single experiments using multiple mice, panels E and F were repeated two times.
improve macrophage function in clearance of MRSA post-H1N1. To verify that TLR9 is mod-
ulated on lung structural cells post-H1N1 infection, we purified alveolar epithelial cells from
WT or TLR9-/- mice and infected them ex vivo with MOI = 0.01 H1N1 or cells were mock-
infected. After 24 h, RNA was made from infected cells and analyzed for TLR9 gene expres-
sion. Fig 8C demonstrates that epithelial cells from WT mice upregulate TLR9 mRNA expres-
sion and confirm that TLR9-/- mice do not express TLR9 transcripts.
Fig 8. Improved clearance of MRSA post-H1N1 requires loss of TLR9 on non-hematopoietic cells; TLR9 is
upregulated on lung epithelial cells post-infection. (A) Chimeric mice were generated by transplanting bone marrow
from Balb/c or TLR9-/- mice into lethally irradiated Balb/c recipients. Following 5 weeks of engraftment, chimeric
mice were infected with 7 x 107 CFU MRSA alone or were infected with H1N1 (100 PFU) prior to infection with 7 x
107 MRSA on day 5. Mice were harvested for CFU counts in lungs 24h post-MRSA infection. N = 5 mice/group, single
experiment analyzed by ANOVA with Bonferroni post-test. �� P<0.01. (B) Adherence purified monocytes and
macrophages isolated on day 5 from H1N1-infected mice were treated with control ODN or the TLR9 antagonist
ODN2088 at 10 μM concentration for 24h prior to infection with FITC-labeled MRSA for 2 h to measure phagocytosis.
Single experiment with N = 10 replicates using cells combined from 3 mice. Data were analyzed by ANOVA with
Tukey post-test. �� P<0.01, �� P<0.0001. (C) Primary lung epithelial cells were isolated and infected ex vivo with
MOI = 0.01 H1N1 or were mock infected for 24 h. Cells were then collected and analyzed for mRNA expression of
TLR9. Symbols represent individual wells each with unique mock or H1N1 infection of cells pooled from 3 mice. Data
were analyzed by ANOVA with Tukey post-test. � P<0.05, �� P<0.001.

Discussion
Lower respiratory infections are the fourth leading cause of death with 3 million deaths each
year worldwide (WHO, 2018). The influenza virus infects the upper and lower respiratory
tract and is successful at infecting 3–5 million individuals each year, taking the life of nearly a
half million of these individuals [1]. Severe illness and death in influenza infections are seen
mostly in high risk subjects, the very young and the elderly. However, recent influenza out-
breaks have taken the life of younger and healthier citizens creating public health concerns.
Secondary bacterial superinfections are responsible for high morbidity and mortality in influ-
enza-infected patients [21]. Even with proper care including influenza vaccines, hygiene, and
antibiotics, influenza-associated secondary bacterial infections are a burden to public health
[25]. Additionally, the over-use of antibiotics has led to the selection of multidrug resistant
bacterial pathogens making it harder to reduce the severity of bacterial infections [17]. Thus,
we are in need of better therapeutic strategies against viral-bacterial co-infections that can
improve public health. Influenza infections have been shown to alter the expression of TLRs in
immune cells [12]. Manipulation of TLRs, in particular TLR2, has been shown to improve sur-
vival, and microbial clearance in mice co-infected with influenza and bacterial pathogens [13].
However, little is known about the potential roles that other TLRs can have in controlling
viral-bacterial co-infections.
TLR9 is an intracellular receptor that recognizes unmethylated CpG motifs which are rich
in microbial DNA [14]. TLR9 expression was reported to be elevated in monocytes and den-
dritic cells from influenza-infected patients compared to healthy individuals [12]. Here, we
noted that IAV infection similarly increases TLR9 expression in murine immune cells from
mice infected with a mouse-adapted IAV strain (PR8) (Fig 1A–1D). This increase can also be
achieved in cultured alveolar macrophages (Fig 1E) and BMDMs (Fig 1F) infected in vitro. We
tested whether stimulation of TLR7, the innate influenza sensor could lead to increased expres-
sion of TLR9 as it is known that NF-κB activation by TLRs can induce TLR expression [26].
However, TLR7 stimulation actually reduced mRNA levels for TLR9 (Fig 2B). Influenza infec-
tions can lead to mitochondrial membrane permeabilization and release of mitochondrial
components [27]. Release of mtDNA can also lead to activation of TLR9 due to mtDNA’s high
concentration of unmethylated CpG [15, 20]. However, we found that CpG oligonucleotide
stimulation of TLR9 also inhibited TLR9 mRNA (Fig 2B). Thus, it is still unclear how the IAV
virus leads to the increased TLR9 expression noted in mice and humans. Because we see eleva-
tions of TLR9 in cells that are not actually infected with IAV, this mechanism is likely to be via
secreted mediators and this will be a focus of our future investigations.
Mice lacking TLR9 (TLR9-/- mice) did not differ in viral response against IAV compared to
WT as there was no difference in measured viral titers or M1 viral gene expression (Fig 3A and
3B), cytokine profiles (Fig 6A), or immune cell infiltration (S4 Fig). However, TLR9-/- mice
were resistant to an IAV-MRSA coinfection with improved bacterial clearance (Fig 5A). The
improved clearance of MRSA in TLR9-/- mice was not due to a preexistent resistance to the
bacteria as there was no difference in single MRSA infection between WT and TLR9-/- mice
(Fig 3D). Previous reports focused on the role of TLR9 in single MRSA infection have shown
conflicting results. TLR9-/- mice were reported to have decreased MRSA clearance despite
showing a lower amount of TNF-α [19]. In contrast, MRSA was shown to induce a type I inter-
feron response dependent on TLR9, and TLR9-/- mice were reported to have lower TNF-α and
improved bacterial clearance [18]. Similar to the previous findings, we noted a decrease in
cytokine secretion in TLR9-/- mice, specifically TNF-α, IL-6 and IL-10 were lower to single
MRSA infection (Fig 3F); however, TLR9-/- mice did not differ from WT in bacterial clearance,
survival and tissue injury despite lower lung immune cell infiltration and cytokine release (Fig

3, S1 Fig). Thus, TLR9 seems to play a differential role in resistance to MRSA in the context of
secondary bacterial infection post-IAV.
TLR9-/- mice have increased IFN-γ in the BALF together with higher numbers of IFN-γ
producing cells (TH1, CD8 T cells, and NK cells) in the lung post coinfection (Fig 6A and 6B).
This increase in IFN-γ provided a potential explanation for the improved bacterial clearance
in TLR9-/- mice as IFN-γ has been shown to increase clearance of MRSA [22]. However, in our
studies, INF-γ neutralization [confirmed by ELISA (Fig 6D)] was not able to decrease clear-
ance of MRSA in TLR9-/- mice (Fig 6C). Therefore, the enhanced clearance of MRSA is inde-
pendent of IFN-γ. Previous findings have shown that S. aureus is able to evade immunity and
survive inside cells including phagocytic cells [17]. This is consistent with our data showing
that IFN-γ cannot improve killing of MRSA post-H1N1 (Fig 6C).
While elevated IFN-γ was not critical for MRSA clearance, previous studies have shown
that IFN-γ plays a negative role in Streptococcus pneumoniae (SPS3) clearance post-IAV infec-
tion by decreasing the expression of macrophage receptor with collagenous structure
(MARCO) [28]. Just like MRSA, SPS3 is a gram-positive bacterial pathogen that is a high
threat to influenza-infected individuals [29, 30]. Thus, we wondered if TLR9-/- mice would
make higher levels of IFN-γ following dual infection with H1N1 + SPS3, and if so, if that
would correlate with higher SPS3 bacterial loads. Interestingly, we found that TLR9-/- mice
have no difference in SPS3 clearance with or without an initial influenza infection (S5A Fig).
Furthermore, IFN-γ levels in the BALF of TLR9-/- mice after IAV-SPS3 infection were not sig-
nificantly higher than in dual-infected WT mice (S5B Fig). These findings highlight the impor-
tant observation that TLR9 signaling has very different outcomes in the setting of influenza
infection than in naïve mice and shows important distinctions in the mechanisms for suscepti-
bility to MRSA vs. S. pneumoniae post-influenza.
Shortly after infection, MRSA is engulfed by phagocytes [31]. Macrophages, especially M1
(antimicrobial) polarized macrophages, play an essential role in the clearance of MRSA [32].
So we tested the ability of macrophages from TLR9-/- mice to clear MRSA in culture. TLR9-/-
macrophages isolated from mock-infected mice had no difference in phagocytosis or intracel-
lular bacterial clearance compared to WT (Fig 7B and 7D). However, macrophages from IAV-
infected TLR9-/- mice are capable of improving bacterial clearance and killing (Fig 7B and 7D).
The increased phagocytosis is likely related to the elevated SRA expression on macrophages
from TLR9-/- mice post-H1N1 (Fig 7C). Interestingly, TLR9-/- monocyte/macrophages from
infected mice have higher expression of iNOS (Fig 7E). Similarly, BMDMs from TLR9-/- mice
show higher iNOS expression following ex vivo infection with H1N1 (Fig 7F). It has previously
been reported that mice lacking iNOS expression are deficient in clearance of MRSA and
more than 50% of mice will not survive a MRSA infection past 24 hours [24]. Thus, induction
of iNOS is a likely explanation for why TLR9-/- macrophages are more effective at clearing
MRSA post-IAV infection.
Our results suggest that neutrophil accumulation is similar between WT and TLR9-/- mice
in response to MRSA alone (Fig 3B) or following H1N1 infection (S4 Fig). In Fig 7 we show
that lung monocyte/macrophages show improved phagocytosis and bacterial killing against
MRSA in TLR9-/- mice. These results suggested that hematopoietic innate immune cells are
primarily responsible for MRSA clearance. To determine whether the effects of TLR9 inhibi-
tion were localized to the myeloid immune cells, we created bone marrow chimeras to explore
outcomes in mice which lacked TLR9 solely in the hematopoietic compartment. Interestingly
however, these chimeras (WT into WT and TLR9-/- into WT) showed equivalent clearance of
MRSA both alone and post-H1N1 (Fig 8A). This suggests that the beneficial effects of TLR loss
may be due to non-hematopoietic cell signaling. In this regard, it is interesting that we have
noted TLR9 upregulation on lung epithelial cells infected ex vivo with H1N1 (Fig 8C). We

attempted to treat mice with 2088 ODN or control ODN to see if TLR9 antagonism in wild-
type mice was beneficial. However, these results were variable at the highest dosage of ODN
2088 tested (50 μg given on days 0, 2 and 5 i.p.). We believe this reflects the fact that antago-
nism of structural or other non-hematopoietic cells is needed and thus our dosage may not
have been optimal. Future experiments will explore WT into TLR9-/- chimeric mice for out-
comes and will also explore lung-specific delivery of the ODN 2088.
In conclusion, our findings provide evidence that TLR9 plays a negative role in IAV-associ-
ated secondary MRSA infections. Blocking of TLR9 post-IAV infection can improve MRSA
clearance and TLR9-/- monocytes/macrophages show increased bacterial phagocytosis and
intracellular killing post-IAV infection. Taken together, this suggests that TLR9 antagonism
may be an effective therapeutic for MRSA complicated influenza infections assuming proper
dosing can be identified. However, care should be taken to know the nature of the secondary
infection as TLR9 regulates MRSA, but not SPS3 coinfection. Future work will be focused on
elucidating the mechanism(s) of influenza-induced upregulation of TLR9 and the pathways
which TLR9 alters to regulate MRSA killing.
Material and methods

Mice
BALB/c mice were bred in the animal facilities at the University of Michigan (Ann Arbor, MI).
Breeding colonies of TLR9-/- mice, on a BALB/c background, were kindly donated by Dr. Shi-
zuo Akira [14] and were also bred in the animal facilities of the University of Michigan (Ann
Arbor, MI). All mice used were at least 6–7 weeks old by the time of infection and/or
treatment.
Chimeric BMT mice

Balb/c mice were treated with 9 Gy total body irradiation split dose and infused with 5 million
whole bone marrow cells from either Balb/c or TLR9-/- mice. Chimeric mice were given acidi-
fied water (pH 3.3) for 3 weeks post-transplant and were used for experiments at 5 weeks post-
BMT.
Ethics statement
Experiments were approved by the University of Michigan Institutional Animal Care and Use
Committee under protocol PRO 7857. The animal use procedures are in compliance with Uni-
versity guidelines, State and Federal regulations and the standards of the “Guide for the Care
and Use of Laboratory Animals. The University’s Animal Welfare Assurance Number on file
with the NIH Office of Laboratory Animal
Welfare (OLAW) is A3114-01, and our facilities are accredited by the Association for the
Assessment and Accreditation of Laboratory Animal Care International.
Bacteria and virus

Staphylococcus aureus (US300) was grown in nutrient broth and incubated with gentle agita-
tion overnight at 37˚C. Streptococcus pneumoniae (SPS3) (serotype 3, 6303) was grown in
Todd Hewitt Broth with 0.5% yeast extract and incubated overnight in anaerobic conditions at
37˚C and 5% CO2. Colony forming units (CFUs) were determined by optical density relative
to known standard curves. Influenza A virus (IAV) (H1N1) strain A/PR/8/34 (PR8) was pur-
chased from ATCC.

Cells
Alveolar Macrophages (AMs) were isolated by bronchoalveolar lavage performed with supple-
mented Dulbecco’s Modified Eagle Medium (DMEM) (89% DMEM, 10% fetal bovine serum
(FBS), and 1% penicillin-streptomycin (Pen-Strep) mixture) containing 5mM of ethylenedi-
aminetetraacetic acid (EDTA). Total lung leukocytes were obtained by perfusing the lung with
PBS followed by digesting the whole lung with Collagenase A and DNAse followed by Ficoll
density separation as we have described [33]. Lung monocyte/macrophages were selected from
these lung leukocytes by adherence to tissue culture plastic for 1 h and then cells were washed
twice with PBS. Over 90% of attached cells were monocyte/macrophages (myeloid cells) by dif-
ferential staining of attached cells, with the remaining cells largely neutrophils. Bone marrow
derived macrophages (BMDMs) were obtained by differentiating bone marrow stem cells
(from BALB/c or TLR9-/- mice) for 7 days with L-cell-supplemented culture medium (59%
Iscove’s modified Dulbecco’s medium (IMDM), 30% L-929 cell supernatant, 10% FBS, and 1%
Pen-Strep mixture). Primary alveolar epithelial cells were isolated using a procedure previously
described [34]. Isolated epithelial cells were cultured on fibronectin coated plates for 2 days
prior to infection with MOI = 0.01 PFU H1N1 for 24 h prior to harvest of cells for RNA. All
cells were incubated in 37˚C in 5%CO2 until used for experiments.
Flow cytometry antibodies

TLR9 (J15A7; BD Biosciences; San Jose, CA), IgG1 (MOPC-21; BD Biosciences; San Jose, CA),
CD45 (30-F11; BD Biosciences; San Jose, CA), CD11b (M1/70; BD Biosciences; San Jose, CA),
CD11c (N418; Biolegend; San Diego, CA), Siglec F (E50-2440; BD Biosciences; San Jose, CA),
MHC II (I-A/I-E) (M5/114.15.2; BD Biosciences; San Jose, CA), CD64 (X54-5/7.1; Biolegend;
San Diego, CA), F4/80 (BM8 eBiosciences; SanDiego, CA), LY6G (1A8; BD Biosciences; San
Jose, CA), CD3 (17A2, BD Biosciences; San Jose, CA), CD90.2 (53–2.1; BD Biosciences; San
Jose, CA), CD4 (GK1.5; Biolegend; San Diego, CA) CD8 (53–6.7; BD Biosciences; San Jose,
CA), NKP46 (29A1.4; Biolegend; San Diego, CA), CD19 (1D3; BD Biosciences; San Jose, CA),
Fc Block(CD16/CD32) (2.4G2; BD Biosciences; San Jose, CA). The NP antibody used was
MA1-7322 from Thermofisher (Waltham, MA) conjugated to FITC.
Model of infection
Influenza infections were done with intranasal instillation of 20μl of PBS containing 100 pla-
que forming units (PFUs) of PR8 to mice that were anesthetized with a mixture of ketamine
and xylazine. Mock infections were PBS alone. MRSA infections were done intratracheally and
the dose was always intended to be 7x107CFUs per mouse but instillations through all the
experiments came in the range of 5x107CFUs-2x108CFUs.
Survival assays
Mice were infected intranasally with 100 PFUs of PR8 for 5 days before intratracheal instillation
of 7x107 CFUs of MRSA. All mice were anesthetized with a mixture of ketamine and xylazine
before viral or bacterial infection. Mice were monitored daily during the course of infection and
weighed each morning. Mice were euthanized when reaching a weight loss of greater than 25%.
In supplemental data, a survival assay was carried out to MRSA alone as well.
Plaque assay and viral M1 expression

Madin-Darby canine kidney (MDCK) cells obtained from Dr. Adam Lauring (University of
Michigan) were used for the viral titer quantification from whole lungs of infected mice.

Briefly, 2x105 MDCK cells were grown in 12-well plate until a well-covered cell monolayer was
achieved. Cells were then incubated with serial dilutions of homogenized lungs from infected
mice. Cells were washed in 1x MEM-BSA (DMEM, L-Glutamine, amphotericin, Pen-strep,
and 10% BSA) medium, then incubated with gentle agitation for an hour at 37˚C with virus
containing sample prior to the addition of a MEM-BSA & 3% Carboxy Methyl Cellulose over-
lay containing 2.5 mg/mL trypsin (within phenol red). Plates were left at 37˚C for 48–72 hours
before adding a crystal violet solution for plaque quantification. In some experiments viral
gene expression was determined by levels of H1N1 M1 gene expression by real-time PCR.
IFN-γ neutralization
PR8 infected mice were treated with 200μg of IFN-γ neutralizing antibody (XMG1.2; BioXcell;
West Lebanon, NH) or its isotype control (HRPN; BioXcell; West Lebanon, NH) intraperito-
neally on day 5 post-PR8 infection prior to a secondary bacterial infection with MRSA (7x107
CFUs). Successful neutralization was confirmed by measuring IFN-γ levels in broncholalveolar
lavage fluid (BALF) by ELISA and by verifying that bronchoalveolar lavage fluid from neutral-
ized mice was unable to activate an IRF-1 reporter cell line. Isotype-treated mouse BALF acti-
vated the fluorescent IRF reporter at a level of 1 ±0.1 fold, while anti-IFNγ treated BALF
showed 5-fold lower activation at 0.21 ±0.03 (P = 0.0007).
Tetrazolium dye reduction assay of bacterial killing

2x105 alveolar macrophages (AMs) or BMDMs per well were seeded into duplicate 96 well
plates: one control and one experimental plate. Cells from both plates were treated with IgG-
opsonized bacteria (MOI 50:1) for 30 minutes at 37˚C. The cells on the experimental plate
were washed twice with PBS and then incubated with or without IFN-γ (10ng/ml) at 37˚C for
120 minutes, whereas the control plate was keep in 4˚C with 0.5% saponin in growth medium.
After 120 minutes, 0.5% saponin in growth medium was added to experimental plate and
Thiazolyl blue Tetrazolium Bromide assay was performed for each plate as explained in [35].
Opsonized phagocytosis values were obtained from control plates.
Non-opsonized phagocytosis assay

Heat inactivated and fluorescein isothiocyanate (FITC)-labeled bacteria was added into a half-
area black 96 well plate containing 2x105 cells per well at a MOI of 1:300 Cells were allowed to
ingest bacteria for 120 minutes before trypan blue was added to quench extracellular fluores-
cence. Intracellular fluorescence was obtained by measuring fluorescence at 485ex/535em
using a Spectra M3 microplate reader.
Enzyme-linked immunosorbent assay (ELISA) and albumin quantification

Cytokine measurement was performed with the use of R&D duo set ELISA kits for murine
IFN-γ, TNF-α, IL-1β, IL-6, IL-10, and IL-17. Murine albumin measurement was performed
with the use of the Bethyl Laboratory (Montgomery, TX) albumin ELISA kit.
Immunoblotting
TLR9 immunoblotting was performed in total lung immune cells after collagenase digestion.
In these experiments, cell lysates were obtained using RIPA buffer with protease inhibitor.
Briefly, total protein from lung immune cells was separated in a polyacrylamide gel using a
mini gel tank (Invitrogen, Carlsbad, CA), following by transferring protein to a polyvinylidene

Table 1. Primers and probes used throughout experiments.

Name Sequence (5’-3’) Strand Modification
ATGGGCTCGGCGATTTC Forward
TLR2 ATGCAACCTCCGGATAGTGACT Reverse
CGGAGTCAGACGTAGTGAGCGAG Probe 5’Fam-3’Tamra
GCCCTCCTCTTGAACAACGC Forward
TLR3 ACTTCAGCCCAGAGAAAGTGCT Reverse
ACCAGCTGCTGGCCACCAGCGAG Probe 5’Fam-3’Tamra
AAGGAGTGCCCCGGTTTC Forward
TLR4 CACAATAACCTTCCGGCTCTTG Reverse
TGCCAACATCATCCAGGAAGGCT Probe 5’Fam-3’Tamra
TCTGCAGGACCTCTGTCCTTG Forward
TLR7 TGATTGTCTGTGGTCAGGGCAT Reverse
TGGCCTGCAAATCCACAGGCTCACCCA Probe 5’Fam-3’Tamra
GAGTACTTGATGTGGGTGGGAAATT Forward
TLR9 GCCACATTCTATACAGGGATTGG Reverse
CCGTCGCTGCGACCATGCC Probe 5’Fam-3’Tamra
ACATCAGGTCGGCCATCACT Forward
INOS CGTACCGGATGAGGCTGTGAAT Reverse
CCCCACCGGAGTGACGGCA Probe 5’Fam-3’Tamra
CCTGGACGAGTCGGTCAGAA Forward
MARCO CTTCAGCTCGGCCTCTGTT Reverse
CCACGCGTCCGGATCATGGGT Probe 5’Fam-3’Tamra
TGAAGGACTGGGAACACTCACA Forward
SRAI/II CAGTAAGCCCTCTGTCTCCCTTT Reverse
TTCATTCAAGGGCCTCCTGGACCC Probe 5’Fam-3’Tamra
GGACTGCAGCGTAGACGCTT Forward
Influenza CATCCTGTTGTATATGAGGCCCAT Reverse
A virus
CTCAGTTATTCTGCTGGTGCACTTGCCA Probe 5’Fam-3’Tamra
CCGTGAAAAGATGACCCAGATC Forward
β-Actin CACAGCCTGGATGGCTACGT Reverse
TTTGAGACCTTCAACACCCCA Probe 5’Fam-3’Tamra
https://doi.org/10.1371/journal.ppat.1007560.t001
fluoride (PVDF) membrane that was blocked with 5% non-fat milk followed by overnight
incubation with a polyclonal anti-TLR9 antibody(PA5-20202; Invitrogen; Carlsbad, CA).
Quantitative real-time PCR

mRNA was isolated using TRIzol according to the manufacturer’s instructions. Relative gene
expression measurements were achieved with the use of a Step-one plus real-time PCR system
from Applied Biosystems (Foster City, CA). Gene-Specific primers and probes were designed
with the GenScript Real-time PCR primer design software (Genscript Biotech Corporation,
Piscataway, NJ). Table 1 shows the sequence of primers and probes used in the current studies.
Statistical analysis
Graphpad Prism version 7 software (Graphpad Prism Software Inc., La Jolla, CA) was used to
analyze experimental results. When groups of two were compared, student’s T-test was used to
determine statistical significance. Groups of � 3 were compared using one-way analysis of var-
iance with Bonferroni multiple mean comparisons.

Supporting information
S1 Fig. TLR9-/- and Balb/c mice show equivalent susceptibility to MRSA alone. Balb/c and
TLR9-/- mice were (A) weighed on day 0 to verify there was no difference in their starting
weight. Mice of both genotypes were infected with 1.3 x 108 CFU MRSA via oropharyngeal
aspiration. (B) Mice were weighed daily and (C) assessed for survival through day 7. TLR9-/-
mice lost more weight on day 3 post-infection, but recovered by day 7. �� P<0.01 by Student’s
t-test at day 3.
(TIF)
S2 Fig. Reduced MRSA clearance, and exacerbated lung tissue injury in the lung post-IAV
infection. Bacterial load measurement in the whole lung of mice infected, or not, with (A) 10
PFUs or (B) 100 PFUs and co-infected with MRSA 5, 7 or 10 days post-H1N1 infection. Albu-
min measurements from the BALF of (C) 10 PFUs or (D) 100PFUs IAV-infected or not mice
for 5, 7 and 10 days and co-infected with MRSA for 24 hours. Relative expression of M1 viral
gene in lungs of mice infected with 10 PFUs (E) or 100 PFUs (F) of IAV, samples were taken
on days 3, 5, 7, and 10 post-infection. Statistics are ANOVA with Tukey’s post-test. � P<0.05,��
P<0.01, �� P<0.001, �� P<0.0001; # two mice died in this group before bacterial load mea-
surement. 0 dpi mice were infected with placebo, PBS, 5 days before MRSA coinfection.
(TIF)
S3 Fig. Flow gating strategy for Fig 6B in the main text. Gates are shown for one representa-
tive sample of each genotype of mice dual infected with H1N1 and MRSA on day 5. Balb/c
shown in top panels and TLR9-/- mouse shown on bottom.
(TIF)
S4 Fig. Immune cell profiles in TLR9-/- mice post-IAV infection. Absolute number of
lung immune cells post-lung collagenase digestion in BALB/c and TLR9-/- mice that
were infected with IAV (100 PFUs, H1N1) for 5 days. Total lung cells counted by hemo-
cytometer and immune cell quantification was done by flow cytometry; gating was as
follows: neutrophils (CD45+,CD11b+,MHCII-,Ly6G+); conventional dendritic cells
(CD45+,CD11c+,MHCII+,CD64-); AMs (CD45+,CD11c+,Siglec F+,CD64+); interstitial Macs
(CD45+,CD11b+,MHCII+,Siglec F-, CD64+); B cells (CD45+CD90.2-CD19+); CD4 T cells
(CD45+CD90.2+CD4+); CD8 T cells (CD45+CD90.2+CD4-); Th1 (CD45+CD90.2+CD4+,IFN-
γ+); Th2 (CD45+CD90.2+CD4+IL-4+); Th17 (CD45+CD90.2+CD4+IL-17a+); Tregs
(CD45+CD90.2+CD4+Foxp3+). Statistics are student T test between comparative groups;
ns = non-significant.
(TIF)
S5 Fig. TLR9-/- mice have no difference in clearance of Streptococcus pnuemoniae and have
no difference in IFN-γ. (A) Lung bacterial burden and (B) cytokine levels in BALB/c and
TLR9-/- mice infected with IAV (100 PFUs, H1N1), or treated with PBS, 5 days prior to Strep-
tococcus pneumoniae (SPS3) (3x105 CFUs) infection; samples were taken 24 hours post SPS3
infection. Statistics are ANOVA in panel A and student T test between comparative groups in
panel B. Non-significant (ns), � P<0.05, �� P<0.01, �� P<0.001, �� P<0.0001.
(TIF)
Acknowledgments
We thank Dr. Lonnie Shea and Dr. Joseph Decker from the department of Biomedical Engi-
neering at the University of Michigan for their help in confirming successful IFN-γ neutraliza-
tion by bioassay. We thank the Flow Cytometry core at the Biomedical Science Research

Building of the University of Michigan (Ann Arbor, MI) for assisting in all of the Flow Cytom-
etry experiments.
Author Contributions
Conceptualization: Giovanny J. Martı́nez-Colón, Urvashi Bhan, Bethany B. Moore.
Formal analysis: Giovanny J. Martı́nez-Colón, Helen Warheit-Niemi, Amy B. Podsiad, Joel
Crespo.
Funding acquisition: Urvashi Bhan, Bethany B. Moore.
Investigation: Giovanny J. Martı́nez-Colón, Stephen J. Gurczynski, Quincy M. Taylor, Carol
A. Wilke, Amy B. Podsiad, Urvashi Bhan, Bethany B. Moore.
Methodology: Giovanny J. Martı́nez-Colón, Stephen J. Gurczynski, Carol A. Wilke, Amy B.
Podsiad.
Project administration: Giovanny J. Martı́nez-Colón, Bethany B. Moore.
Resources: Giovanny J. Martı́nez-Colón, Carol A. Wilke.
Supervision: Bethany B. Moore.
Validation: Quincy M. Taylor.
Visualization: Giovanny J. Martı́nez-Colón, Joel Crespo, Bethany B. Moore.
Writing – original draft: Giovanny J. Martı́nez-Colón.
Writing – review & editing: Giovanny J. Martı́nez-Colón, Helen Warheit-Niemi, Stephen J.
Gurczynski, Quincy M. Taylor, Carol A. Wilke, Amy B. Podsiad, Urvashi Bhan, Bethany B.
Moore.
References
1. Iuliano AD, Roguski KM, Chang HH, Muscatello DJ, Palekar R, Tempia S, et al. Estimates of global sea-
sonal influenza-associated respiratory mortality: a modelling study. Lancet (London, England). 2018;
391(10127):1285–300. Epub 2017/12/19. https://doi.org/10.1016/s0140-6736(17)33293-2 PMID:
29248255; PubMed Central PMCID: PMCPMC5935243.
2. Du Y, Xin L, Shi Y, Zhang TH, Wu NC, Dai L, et al. Genome-wide identification of interferon-sensitive
mutations enables influenza vaccine design. Science (New York, NY). 2018; 359(6373):290–6. Epub
2018/01/20. https://doi.org/10.1126/science.aan8806 PMID: 29348231.
3. McCullers JA. The co-pathogenesis of influenza viruses with bacteria in the lung. Nature reviews Micro-
biology. 2014; 12(4):252–62. Epub 2014/03/05. https://doi.org/10.1038/nrmicro3231 PMID: 24590244.
4. Morens DM, Taubenberger JK, Fauci AS. Predominant role of bacterial pneumonia as a cause of death
in pandemic influenza: implications for pandemic influenza preparedness. The Journal of infectious dis-
eases. 2008; 198(7):962–70. Epub 2008/08/20. https://doi.org/10.1086/591708 PMID: 18710327;
PubMed Central PMCID: PMCPMC2599911.
5. Dunning J, Blankley S, Hoang LT, Cox M, Graham CM, James PL, et al. Progression of whole-blood
transcriptional signatures from interferon-induced to neutrophil-associated patterns in severe influenza.
Nature immunology. 2018; 19(6):625–35. Epub 2018/05/20. https://doi.org/10.1038/s41590-018-0111-
5 PMID: 29777224; PubMed Central PMCID: PMCPMC5985949.
6. McCullers JA. Insights into the interaction between influenza virus and pneumococcus. Clinical microbi-
ology reviews. 2006; 19(3):571–82. Epub 2006/07/19. https://doi.org/10.1128/CMR.00058-05 PMID:
7. Didierlaurent A, Goulding J, Patel S, Snelgrove R, Low L, Bebien M, et al. Sustained desensitization to
bacterial Toll-like receptor ligands after resolution of respiratory influenza infection. The Journal of
experimental medicine. 2008; 205(2):323–9. https://doi.org/10.1084/jem.20070891 PMID: 18227219;

8. Sun K, Yajjala VK, Bauer C, Talmon GA, Fischer KJ, Kielian T, et al. Nox2-derived oxidative stress
results in inefficacy of antibiotics against post-influenza S. aureus pneumonia. The Journal of experi-
mental medicine. 2016; 213(9):1851–64. Epub 2016/08/17. https://doi.org/10.1084/jem.20150514
PMID: 27526712; PubMed Central PMCID: PMCPMC4995072.
9. Iwasaki A, Medzhitov R. Regulation of adaptive immunity by the innate immune system. Science (New
York, NY). 2010; 327(5963):291–5. Epub 2010/01/16. https://doi.org/10.1126/science.1183021 PMID:
10. O’Neill LA, Golenbock D, Bowie AG. The history of Toll-like receptors—redefining innate immunity.
Nature reviews Immunology. 2013; 13(6):453–60. Epub 2013/05/18. https://doi.org/10.1038/nri3446
PMID: 23681101.
11. Nakamura S, Iwanaga N, Seki M, Fukudome K, Oshima K, Miyazaki T, et al. Toll-Like Receptor 4 Ago-
nistic Antibody Promotes Host Defense against Chronic Pseudomonas aeruginosa Lung Infection in
Mice. Infection and immunity. 2016; 84(7):1986–93. https://doi.org/10.1128/IAI.01384-15 PMID:
12. Lee N, Wong CK, Hui DS, Lee SK, Wong RY, Ngai KL, et al. Role of human Toll-like receptors in natu-
rally occurring influenza A infections. Influenza and other respiratory viruses. 2013; 7(5):666–75. Epub
2013/04/05. https://doi.org/10.1111/irv.12109 PMID: 23552014; PubMed Central PMCID:
PMCPMC5781199.
13. Mifsud EJ, Tan AC, Short KR, Brown LE, Chua BY, Jackson DC. Reducing the impact of influenza-
associated secondary pneumococcal infections. Immunology and cell biology. 2016; 94(1):101–8.
Epub 2015/07/03. https://doi.org/10.1038/icb.2015.71 PMID: 26134269.
14. Hemmi H, Takeuchi O, Kawai T, Kaisho T, Sato S, Sanjo H, et al. A Toll-like receptor recognizes bacte-
rial DNA. Nature. 2000; 408(6813):740–5. Epub 2000/12/29. https://doi.org/10.1038/35047123 PMID:
11130078.
15. Zhang Q, Raoof M, Chen Y, Sumi Y, Sursal T, Junger W, et al. Circulating mitochondrial DAMPs cause
inflammatory responses to injury. Nature. 2010; 464(7285):104–7. Epub 2010/03/06. https://doi.org/10.
1038/nature08780 PMID: 20203610; PubMed Central PMCID: PMCPMC2843437.
16. Finelli L, Fiore A, Dhara R, Brammer L, Shay DK, Kamimoto L, et al. Influenza-associated pediatric mor-
tality in the United States: increase of Staphylococcus aureus coinfection. Pediatrics. 2008; 122
(4):805–11. Epub 2008/10/03. https://doi.org/10.1542/peds.2008-1336 PMID: 18829805.
17. Lehar SM, Pillow T, Xu M, Staben L, Kajihara KK, Vandlen R, et al. Novel antibody-antibiotic conjugate
eliminates intracellular S. aureus. Nature. 2015; 527(7578):323–8. Epub 2015/11/05. https://doi.org/10.
1038/nature16057 PMID: 26536114.
18. Parker D, Prince A. Staphylococcus aureus induces type I IFN signaling in dendritic cells via TLR9.
Journal of immunology (Baltimore, Md: 1950). 2012; 189(8):4040–6. Epub 2012/09/11. https://doi.org/
10.4049/jimmunol.1201055 PMID: 22962685; PubMed Central PMCID: PMCPMC3466375.
19. van der Meer AJ, Achouiti A, van der Ende A, Soussan AA, Florquin S, de Vos A, et al. Toll-like receptor
9 enhances bacterial clearance and limits lung consolidation in murine pneumonia caused by methicillin
resistant Staphylococcus aureus. Molecular medicine (Cambridge, Mass). 2016; 22. Epub 2016/08/11.
https://doi.org/10.2119/molmed.2015.00242 PMID: 27508882; PubMed Central PMCID:
PMCPMC5023514.
20. Zhang JZ, Liu Z, Liu J, Ren JX, Sun TS. Mitochondrial DNA induces inflammation and increases TLR9/
NF-kappaB expression in lung tissue. International journal of molecular medicine. 2014; 33(4):817–24.
Epub 2014/02/19. https://doi.org/10.3892/ijmm.2014.1650 PMID: 24535292; PubMed Central PMCID:
PMCPMC3976143.
21. Hussell T, Wissinger E, Goulding J. Bacterial complications during pandemic influenza infection. Future
microbiology. 2009; 4(3):269–72. Epub 2009/03/31. https://doi.org/10.2217/fmb.09.3 PMID: 19327113.
22. Greenlee-Wacker MC, Nauseef WM. IFN-gamma targets macrophage-mediated immune responses
toward Staphylococcus aureus. Journal of leukocyte biology. 2017; 101(3):751–8. Epub 2016/10/07.
https://doi.org/10.1189/jlb.4A1215-565RR PMID: 27707882; PubMed Central PMCID:
PMCPMC5295848.
23. Domingo-Gonzalez R, Katz S, Serezani CH, Moore TA, Levine AM, Moore BB. Prostaglandin E2-
induced changes in alveolar macrophage scavenger receptor profiles differentially alter phagocytosis of
Pseudomonas aeruginosa and Staphylococcus aureus post-bone marrow transplant. Journal of immu-
nology (Baltimore, Md: 1950). 2013; 190(11):5809–17. Epub 2013/05/01. https://doi.org/10.4049/
jimmunol.1203274 PMID: 23630358; PubMed Central PMCID: PMCPMC3660503.
24. Urbano R, Karlinsey JE, Libby SJ, Doulias PT, Ischiropoulos H, Warheit-Niemi HI, et al. Host Nitric
Oxide Disrupts Microbial Cell-to-Cell Communication to Inhibit Staphylococcal Virulence. Cell host &
microbe. 2018; 23(5):594–606 e7. Epub 2018/05/01. https://doi.org/10.1016/j.chom.2018.04.001
PMID: 29706505; PubMed Central PMCID: PMCPMC5949146.

25. Vardakas KZ, Matthaiou DK, Falagas ME. Comparison of community-acquired pneumonia due to meth-
icillin-resistant and methicillin-susceptible Staphylococcus aureus producing the Panton-Valentine leu-
kocidin. The international journal of tuberculosis and lung disease: the official journal of the International
Union against Tuberculosis and Lung Disease. 2009; 13(12):1476–85. Epub 2009/11/19. PMID:
19919764.
26. Ding X, Jin S, Tong Y, Jiang X, Chen Z, Mei S, et al. TLR4 signaling induces TLR3 up-regulation in alve-
olar macrophages during acute lung injury. Scientific reports. 2017; 7:34278. Epub 2017/02/16. https://
doi.org/10.1038/srep34278 PMID: 28198368; PubMed Central PMCID: PMCPMC5309825.
27. Zamarin D, Garcia-Sastre A, Xiao X, Wang R, Palese P. Influenza virus PB1-F2 protein induces cell
death through mitochondrial ANT3 and VDAC1. PLoS pathogens. 2005; 1(1):e4. Epub 2005/10/05.
https://doi.org/10.1371/journal.ppat.0010004 PMID: 16201016; PubMed Central PMCID:
PMCPMC1238739.
28. Sun K, Metzger DW. Inhibition of pulmonary antibacterial defense by interferon-gamma during recovery
from influenza infection. Nat Med. 2008; 14(5):558–64. Epub 2008/04/29. nm1765 [pii] https://doi.org/
10.1038/nm1765 PMID: 18438414
29. Sharma-Chawla N, Sender V, Kershaw O, Gruber AD, Volckmar J, Henriques-Normark B, et al. Influ-
enza A Virus Infection Predisposes Hosts to Secondary Infection with Different Streptococcus pneumo-
niae Serotypes with Similar Outcome but Serotype-Specific Manifestation. Infection and immunity.
2016; 84(12):3445–57. Epub 2016/09/21. https://doi.org/10.1128/IAI.00422-16 PMID: 27647871;
30. McCullers JA, Rehg JE. Lethal synergism between influenza virus and Streptococcus pneumoniae:
characterization of a mouse model and the role of platelet-activating factor receptor. The Journal of
infectious diseases. 2002; 186(3):341–50. Epub 2002/07/23. https://doi.org/10.1086/341462 PMID:
12134230.
31. Rogers DE. Studies on bacteriemia. I. Mechanisms relating to the persistence of bacteriemia in rabbits
following the intravenous injection of staphylococci. The Journal of experimental medicine. 1956; 103
(6):713–42. Epub 1956/06/01. PMID: 13319588; PubMed Central PMCID: PMCPMC2136597.
32. Hanke ML, Heim CE, Angle A, Sanderson SD, Kielian T. Targeting macrophage activation for the pre-
vention and treatment of Staphylococcus aureus biofilm infections. Journal of immunology (Baltimore,
Md: 1950). 2013; 190(5):2159–68. Epub 2013/02/01. https://doi.org/10.4049/jimmunol.1202348 PMID:
33. Gurczynski SJ, Zhou X, Flaherty M, Wilke CA, Moore BB. Bone marrow transplant-induced alterations
in Notch signaling promote pathologic Th17 responses to gamma-herpesvirus infection. Mucosal Immu-
nol. 2018; 11(3):881–93. Epub 2017/10/19. https://doi.org/10.1038/mi.2017.85 PMID: 29044226;
34. Stoolman JS, Vannella KM, Coomes SM, Wilke CA, Sisson TH, Toews GB, et al. Latent infection by
gammaherpesvirus stimulates profibrotic mediator release from multiple cell types. American journal of
physiology Lung cellular and molecular physiology. 2011; 300(2):L274–85. Epub 2010/11/03. https://
doi.org/10.1152/ajplung.00028.2010 PMID: 21036917; PubMed Central PMCID: PMCPMC3043816.
35. Martı́nez-Colón GJ, Taylor QM, Wilke CA, Podsiad AB, Moore BB. Elevated prostaglandin E2 post–
bone marrow transplant mediates interleukin-1β-related lung injury. Mucosal Immunology. 2018; 11
(2):319–32. https://doi.org/10.1038/mi.2017.51 PMID: 28589946

Influenza-Induced Immune Suppression To

Uploaded by

Copyright:

Available Formats

Influenza-Induced Immune Suppression To

Uploaded by

Document Information

Original Title

Copyright

Available Formats

Share this document

Share or Embed Document

Sharing Options

Did you find this document useful?

Is this content inappropriate?

Copyright:

Available Formats

Influenza-Induced Immune Suppression To

Uploaded by

Copyright:

Available Formats

RESEARCH ARTICLE

Influenza-induced immune suppression to

PLOS Pathogens | https://doi.org/10.1371/journal.ppat.1007560 January 25, 2019 1 / 23

Competing interests: The authors have declared

PLOS Pathogens | https://doi.org/10.1371/journal.ppat.1007560 January 25, 2019 2 / 23

PLOS Pathogens | https://doi.org/10.1371/journal.ppat.1007560 January 25, 2019 3 / 23

PLOS Pathogens | https://doi.org/10.1371/journal.ppat.1007560 January 25, 2019 4 / 23

TLR9-/- mice show no difference in susceptibility to H1N1 or MRSA

TLR9-/- mice are resistant to IAV and MRSA dual infection

PLOS Pathogens | https://doi.org/10.1371/journal.ppat.1007560 January 25, 2019 5 / 23

PLOS Pathogens | https://doi.org/10.1371/journal.ppat.1007560 January 25, 2019 6 / 23

PLOS Pathogens | https://doi.org/10.1371/journal.ppat.1007560 January 25, 2019 7 / 23

PLOS Pathogens | https://doi.org/10.1371/journal.ppat.1007560 January 25, 2019 8 / 23

TLR9-/- mice experience improved MRSA clearance post-dual infection

PLOS Pathogens | https://doi.org/10.1371/journal.ppat.1007560 January 25, 2019 9 / 23

Better bacterial clearance in TLR9-/- mice post-dual infection is

TLR9-/- lung macrophages have increased phagocytosis, bacterial killing,

Loss of TLR9 in hematopoietic cells or antagonism of TLR9 in

PLOS Pathogens | https://doi.org/10.1371/journal.ppat.1007560 January 25, 2019 10 / 23

Lung epithelial cells upregulate TLR9 post-H1N1

PLOS Pathogens | https://doi.org/10.1371/journal.ppat.1007560 January 25, 2019 11 / 23

PLOS Pathogens | https://doi.org/10.1371/journal.ppat.1007560 January 25, 2019 12 / 23

PLOS Pathogens | https://doi.org/10.1371/journal.ppat.1007560 January 25, 2019 13 / 23

PLOS Pathogens | https://doi.org/10.1371/journal.ppat.1007560 January 25, 2019 14 / 23

PLOS Pathogens | https://doi.org/10.1371/journal.ppat.1007560 January 25, 2019 15 / 23

Material and methods

Chimeric BMT mice

Bacteria and virus

PLOS Pathogens | https://doi.org/10.1371/journal.ppat.1007560 January 25, 2019 16 / 23

Flow cytometry antibodies

Plaque assay and viral M1 expression

PLOS Pathogens | https://doi.org/10.1371/journal.ppat.1007560 January 25, 2019 17 / 23

Tetrazolium dye reduction assay of bacterial killing

Non-opsonized phagocytosis assay

Enzyme-linked immunosorbent assay (ELISA) and albumin quantification

PLOS Pathogens | https://doi.org/10.1371/journal.ppat.1007560 January 25, 2019 18 / 23

Table 1. Primers and probes used throughout experiments.

Quantitative real-time PCR

PLOS Pathogens | https://doi.org/10.1371/journal.ppat.1007560 January 25, 2019 19 / 23

PLOS Pathogens | https://doi.org/10.1371/journal.ppat.1007560 January 25, 2019 20 / 23

PLOS Pathogens | https://doi.org/10.1371/journal.ppat.1007560 January 25, 2019 21 / 23

PLOS Pathogens | https://doi.org/10.1371/journal.ppat.1007560 January 25, 2019 22 / 23

PLOS Pathogens | https://doi.org/10.1371/journal.ppat.1007560 January 25, 2019 23 / 23

You might also like