GMR 8818
GMR 8818
GMR 8818
Copyright © 2016 The Authors. This is an open-access article distributed under the terms
of the Creative Commons Attribution ShareAlike (CC BY-SA) 4.0 License.
hmg gene generated positive results from all DNA samples, which were
further tested with the GM targets. These targets were not detected in
the five conventional maize cultivars, but were detected in the GM
seeds hosting these fragments. Analysis of processed foods identified
four cultivars as conventional and six as GM, which were mostly
correctly labeled. Seven (53.8%) dry grain samples were classified as
conventional, while six (46.2%) were classified as GM. Three (11.1%)
corn ear samples were identified as conventional, and the remaining 24
(88.9%) were GM maize. These results demonstrate the high frequency
of GM maize in processed products, including fresh corn ears intended
for consumption in South Brazil.
INTRODUCTION
Maize (Zea mays), or corn, is one of the most widely consumed grains by humans and
livestock throughout the world. As a component of the human diet, it can be consumed fresh
as corn ears, used as a staple food for processed meals (polenta, tortillas, burritos), or as a
snack food, such as popcorn and corn chips. In general, variation in the moisture content
accounts for the different properties of these foods; while corn ears have more than 70% water
content, dry grains (used in processed foods) have only 15 to 20% (Silva et al., 2010).
Due to its importance in human and animal diets, maize is a leading crop plant in
Brazil, with a plantation area of 15.8 million hectares and a total production of 85.5 million tons
in the 2014/2015 crop. It is the second most cultivated grain, accounting for 40% of the total
crop production in the country (CONAB, 2015). Data from maize producing companies reveal
that 478 cultivars were available to farmers during the last crop in Brazil, including 292
genetically modified (GM or transgenic) and 186 conventional cultivars (Cruz, 2014; Cruz,
2015). In addition, there were 320 different genetic materials, 186 of which were marketed as
GM and conventionally, and 134 commercialized only as GM crops (lacking the conventional
option). All of these cultivars can be used to produce dry grains, silage for livestock animals,
and corn ears. In the last crop, only 17 cultivars were recommended for the production of corn
ears, while 474 cultivars were indicated for dry grain production and whole plant silage. Four
other cultivars were recommended for the production of popcorn and corn starch (Cruz, 2015).
GM corn crops express insecticidal genes (cry or vip), derived from the soil bacterium
Bacillus thuringiensis (Bt), in order to control the major Lepidoptera species. Currently
commercialized GM biotech crops have different events to achieve this effective control, such
as Herculex I (TC1507), YieldGard (MON810), Agrisure TL (Bt11), TL Viptera (MIR162), and
VT PRO (MON890314). Plant leaves produce different Cry proteins according to the inserted
event, such as Cry 1F, Cry 1Ab, Cry 1A.105, Cry 2Ab2, Cry 3Bb1, Cry 34Ab1, and Cry 35Ab2.
More recently, GM seeds with insecticidal traits stacked with tolerance to the herbicides
glyphosate (Roundup Ready NK603 and TG GA21) or glufosinate-ammonium (Liberty Link
Technology) have also been commercialized in Brazilian producing regions (Cruz, 2015). All
of these GM events carry at least one promoter and one terminator region, in addition to the
main gene (cry, vip, epsps, etc.). The promoter region p-35S (from the cauliflower mosaic
virus) and the terminator t-Nos (from the nopaline synthase gene) are the
most commonly used in GM maize seeds (Wolf et al., 2000; Dinon et al., 2011).
The use of GM crops has many social, environmental, and economic advantages.
GM crops reduce the use of chemical insecticides; provide benefits to human health, the
environment, and biodiversity; and lead to higher productivity increases income for farmers
(Romeis et al., 2006; Hutchison et al., 2010; Tabashnik, 2010; Ronald, 2011). These
advantages explain the intensive use of biotech crops since their first commercial release in
1996. The total cumulative area of transgenic crops exceeds 1.8 billion hectares with a 3 to 4%
consistent increase per year. As a consequence, GM maize products have been increasingly
marketed in the last few years (James, 2014).
The production of food and feed from GM plants is subject to specific regulation.
Products for human or animal use containing more than 1% GM organisms have to be labeled
to inform consumers (Brazilian Government - Law No. 4680, April 25, 2003; Marinho et al.,
2014). The aim of the present study was to detect GM maize in industrially processed products,
dry grains, and corn ears commercialized for fresh consumption in the Rio Grande do Sul
State, south of Brazil. All samples were tested for the presence of two genetic regions usually
present in GM crops (the p-35S promoter and the t-NOS terminator) and one main gene ( cry
1A.105) present in the most commercialized GM corn crops grown in this region (VT PRO).
Samples
DNA extraction
All samples were processed prior to DNA extraction. Grains were first macerated and
0.1 to 0.2 mg was used for the analysis of DNA. DNA was extracted by an adapted silica
method (Boom et al., 1990) using commercial reagents (Simbios Biotecnologia, Cachoeirinha,
RS, Brazil). Briefly, 1350 µL synthesis solution (5 M guanidine thiocyanate, 0.1 M Tris-HCl, pH
6.4) was added to each sample, which were then incubated at 60°C for 10 min. After
centrifugation (10,000 g, 3 min), the supernatant was transferred to a tube containing 20 µL silica suspension.
This mixture was stirred and centrifuged (10,000 g, 3 min), and the pellet was washed twice
with 1000 µL wash solution A (5 M guanidine thiocyanate, 0.1 M Tris-HCl, pH 6.4), twice with
wash solution B (75% ethanol), and once with wash solution C (100% ethanol). The silica was
dried and the DNA was separated using 50 µL eluting solution (10 mM Tris-HCl, pH 8.0, 1 mM
EDTA).
CELERON TL + + - +
TL FORMULA + + - +
VIP STATUS + - - +
STATUS VIP3 + + - +
Conventional AG 8025 + - - -
BM 911 + - - -
FORMULA + - - -
CELERON + - - -
STATUS + - - -
hmg - endogenous corn gene; p-35S - promoter region; cry 1A.105 - main maize gene for the MON89034 event; t-
Nos - terminator region. Biomatrix (BM), Santa Helena Seeds (SHS), Dekalb (DKB), Dow Agroscience (2B),
Agroceres (AG), and Syngenta (Celeron, Formula, and Status brands).
Figure 1. Cities of the corn ears producers in Rio Grande do Sul. The state capital, Porto Alegre, is highlighted in red.
Primers and probes targeting high mobility group (hmg, a constitutive maize gene),
p-35S, the cry 1A.105 gene, and t-Nos were selected based on the results of previous studies
(Table 2). All primers and probes were evaluated using the Primer Express software (Applied
Biosystems, Norwalk, CT, USA). Oligonucleotides were purchased from Applied Biosystems
or Integrated DNA Technologies (Coralville, IA, USA).
Table 2. Primers and TaqMan probes used in the real time PCR.
Primers Sequence (orientation 5'-3') Amplicon size (bp) Reference
p-35S - F GCC TCT GCC GAC AGT GGT 82 Waiblinger et al., 2008
p-35S - R AAG ACG TGG TTG GAA CGT CTT C Huber et al., 2013
p-35S - P FAM-CAA AGA TGG ACC CCC ACC CAC G- ZEN-IOWA BLACK FQ
t-Nos - F CAT GTA ATG CAT GAC GTT ATT TAT G 84 Reiting et al., 2007
t-Nos - R TTG TTT TCT ATC GCG TAT TAA ATG T Huber et al., 2013
t-Nos - P VIC-ATG GGT TTT TAT GAT TAG AGT CCC GCA A- ZEN-IOWA BLACK FQ
cry1A.105 - F TCAGAGGTCCAGGGTTTACAGG cry1A105 - 113 Dinon et al., 2011
R GTAGTAGAGGCATAGCGGGATTCTTG
cry1A105 - P FAM-AGACATTCTTCGTCGCACAAGTGGAGGACC-ZEN –IOWA BLACK FQ
ZM1- F(hmg) TTGGACTAGAAATCTCGTGCTGA ZM1- R(hmg) 79 Corbisier et al., 2010
GCTACATAGGGAGCCTTGTCCT
ZM1- P(hmg) VIC-CAATCCACACAAACGCACGCGTA- IOWA BLACK FQ
F: Forward first; A: reverse primer; FAM and VIC TaqMan reporter dye labels; MGB and ZEN-IOWA BLACK
FQTaqMan quencher dye labels.
Real time-PCR
Real-time TaqMan PCR assays were performed using StepOne Plus® (Applied
Biosystems). First, PCR with the hmg primers/probe set was carried out to evaluate the
quality of all extracted DNA. Next, three separate PCRs were run to detect p-35S, t-Nos, and
cry1A-105. All reactions were carried out in a total volume of 30 µL with 2 µL DNA template,
1.5 U Taq DNA polymerase and the respective enzyme reaction buffer (Ludwig Biotecnologia,
Porto Alegre, RS, Brazil), 1.5 mM MgCl2, 0.06 mM each dNTP , 0.25 µM each primer, and
0.125 µM probe(s). The following cycling parameters were used: one cycle of 95°C for 3 min,
40 cycles of 95°C for 15 s, and 60°C for 60 s. Cycle threshold was defined for each sample
and compared to that of the positive and negative controls.
RESULTS
All probes and primers used in this study were first tested using two GM crop cultivars
hosting the VT PRO event (BM 915 PRO and SHS 7920 PRO). Both generated positive
results for the four targets: the constitutive maize gene hmg, the promoter region p-35S, the
main Bt gene cry 1A.105, and the terminator region t-Nos. The TaqMan PCR assays proved
to be effective at detecting all four different targets for these two cultivars (Table 1).
The remaining 16 maize seeds, including five conventional and 11 GM crops, were
analyzed using the four PCR assays described (Table 1). Briefly, all samples were found to
be positive for the endogenous maize gene hmg. Conventional maize seeds (AG 8025, BM
911, Celeron, Formula, and Status) presented negative results for the other three targets. Of
the 11 GM crops, 10 amplified for the p-35S promoter and the t-Nos terminator gene
fragments, while six were also positive for the cry1A.105 gene. These remaining six maize
cultivars were all positive for cry1A.105, p-35S, and t-Nos. As defined by the producers, all of
those cultivars host the GM event PRO (MON89034). The cultivars AG 5011 and Status VIP presented
positive results only for p-35S and t-Nos, respectively. The remaining three samples (Celeron
TL, Formula TL, and Status VIP3) presented positive results for both the p-35S and t-Nos
regions (Table 1).
All 23 industrially processed products (six corn flours, four canned corns, and 13 dry
grains for animal feed) tested positive for the hmg gene (Table 3). In 11 samples, none of the
maize GM targets were detected, and they were classified as conventional (non-GM). Of the
other 12 samples, at least one of the GM targets was detected, and they were defined as GM
foods. Seven samples were positive for the three GM targets, two for the p-35S and t-Nos
regions, two for p-35S, and one for t-Nos (Table 3). Among the 12 transgenic samples, only
the five corn flours had a GM label on their packaging.
Table 3. Description of the commercial samples: industrially processed foods (corn flours and canned corn),
dry grains, and corn ears.
hmg - endogenous corn gene; p-35s - promoter region; cry 1A.105 - main maize gene for the MON89034 event; t-
Nos - terminator region.
Real-time PCR assays were used to detect the presence of transgenic maize in 27
commercial samples of corn ears. Grains of all samples tested positive for the endogenous hmg
gene. Analysis of the three specific GM targets revealed that only three samples were
negative, and these were classified as conventional. The remaining 24 (88.9%) corn ear
samples were positive for at least one DNA region of the GM crops (Table 3). Interestingly,
19 samples were positive for the three targets, meaning that they all carry the transgenic
event VT PRO (MON89034).
DISCUSSION
GM maize food and feed have been marketed worldwide. In Brazil, all food products
intended for human and animal consumption containing over 1% GM crops are required to be
properly labeled (Brasil, 2003). consequently, immunological and molecular biology
Techniques have been developed to detect the presence of specific GM DNA fragments in food
and feed products. Immunological assays (such as linked enzyme immunosorbent assay and
immunochromatography) are fast and user-friendly and require relatively low investment in terms
of equipment and personnel. The immunochromatographic strip test is the most-disseminated
assay used in the field, and is even used by farmers to separate GM from non-GM crops.
However, this assay detects specific transgenic proteins (Bt crystal protein in maize or EPSPS
in soybean), which are often not readily available in some plants, seeds, and consequently, food
products (Nascimento et al., 2012; Cantelmo et al., 2013).
Molecular biology assays (mainly PCR) are specific, sensitive, and have been widely
used to detect the presence of GM crops. Although requiring special reagents and equipment,
PCR can detect the presence of specific exogenous genes inserted into the plant genome
(including the seeds), and represents the most widely used method to detect GM food and feed
(Dinon et al., 2011; Branquinho et al., 2013; Cantelmo et al., 2013). In the present study, we
used real time PCR to detect three GM-specific fragments: the promoter region p-35S derived
from the cauliflower mosaic virus (Waiblinger et al., 2008; Huber et al., 2013), the terminator
region, t-Nos, derived from the nopaline synthase gene of Agrobacterium tumefaciens (Reiting
et al., 2007; Huber et al., 2013), and the main cry1A.105 gene from Bt (Dinon et al., 2011).
These PCR assays were successfully implemented, in addition to an assay targeting the
constitutive hmg gene, which was used as an endogenous control (Corbisier et al., 2010). Two
GM crop cultivars carrying the VT PRO event (BM 915 PRO and SHS 7920 PRO) presented
positive results for all three targets. Furthermore, the other conventional and GM maize cultivars
presented results that were expected based on register information, as demonstrated in previous
studies (Reiting et al., 2007; Waiblinger et al., 2008; Dinon et al., 2011; Huber et al., 2011; ,
2013).
All of the food samples analyzed were positive for the endogenous hmg gene,
demonstrating the absence of inhibition in the PCR and the presence of sufficient genetic
material in these highly processed foods. Previous studies have demonstrated that it is not
possible to detect oils and refined starches derived from GM crops because of the excessive
heat, low pH, and enzymes used in the processing of corn flour products (Conceição et al.,
2006), The five flour samples that had a GM label were positive for all of the tested targets,
showing the presence of grains with the VT PRO event. The only non-labeled flour was negative
for the three GM targets. A study was previously performed to verify compliance with Brazilian
laws on the reporting of GM crops in food (Branquinho et al., 2013). Those authors reported the
occurrence of several food products with GM organisms that were not properly labeled between
2011 and 2012. In the following year, the same products were properly labeled in accordance
with Brazilian law. Another study conducted in Turkey revealed the presence of GM maize events
in the feed composition used for livestock production (Meriç et al., 2014).
Conversely, the majority of corn ears (24 of 27, 88.9%), collected in the market and
produced by small companies in different regions of Rio Grande do Sul State, were positive for
at least one GM target (p-35S, t- Nos, and/or the cry 1A.105 gene). Those results demonstrate
the intensive use of GM cultivars to produce commercial corn ears for human consumption.
Furthermore, 19 samples were positive for the four targets, demonstrating that they are probably
cultivars containing the GM VT PRO (MON89034) event. This may be due to the majority of the
GM maize cultivars commercialized in the current season (55%) carrying the VT PRO event
(Cruz, 2014; Cruz, 2015).
Crops used for corn ear production have been developed to meet characteristics sought
by consumers, which includes intense yellow grains, fruity and sugary taste, soft texture, and
being free of spike damage. Some of these are still planted to produce corn ears and/or sweet
corn (Lopes et al., 2014). In the last crop season (2014/15), 17 maize cultivars were suitable
for the production of corn ears, and only one of those hosts the MON89034 event (VT PRO).
This specific cultivar has not been widely distributed and commercialized to the small farmers
that plant and sell corn ears to the commercial companies (Cruz, 2014). It is likely that several
of the 292 GM cultivars used for other purposes (dry grain, silage) have been widely planted in
the field. Maize in Brazil is produced widely by small farmers, who do not usually have the
opportunity to select cultivars and purchase the seeds from local markets with restricted
commercial options. Therefore, seeds are used for the production of dry grains and silage
because they are commonly available in the market (Cruz, 2015).
Non-transgenic corn crops can be pollinated by transgenic plants grown in neighboring
locations (Devos et al., 2009). Good management practice of transgenic crops (use of natural
barriers, cultivation of conventional plants in the borders, postponing or advancing sowing to
the flowering period) could help to avoid the contamination of non-transgenic crops (Palaudelmàs
et al., 2012). Of note, producers have responsibility, especially in organic production, for the
accuracy of the information provided about the crop (CIB, 2011). According to Brazilian law,
the use of transgenic grains is also prohibited in organic products; Therefore, producers should
avoid any possible contamination with GM maize (MAPA, 2015; Santos, 2015). Currently, 46%
of maize produced comes from family farms in Brazil, many of which are focused on organic
corn production (MDA, 2015).
The present study has two limitations. First, not all of the 21 transgenic maize events
released for sale in Brazil were tested (although the GM events tested here represent more
than 95% of the GM seeds produced in the last crop). Second, the number of analyzed samples
used to represent the southern region of Brazil or the whole country is low.
In conclusion, GM maize was detected in industrially processed commercial products
and fresh corn ears in Rio Grande do Sul State, south of Brazil. There was a high frequency of
GM maize in processed products, dry grains, and corn ears intended for fresh consumption in
South Brazil. Most food was found to carry the cry 1A.105 gene, demonstrating the intensive
use of GM maize cultivars with the VT PRO (MON89034) event.
Conflicts of interest
ACKNOWLEDGMENTS
The authors thank the students of Laboratory of Molecular Diagnosis of ULBRA for
their technical collaboration in this study. The authors also thank FAPERGS for the scientific
initiation scholarship awarded to the author CAM Oliveira and CNPq for research grants to CM
Kommers, N. Ikuta, and VR Lunge.
REFERENCES
Boom R, Sol CJ, Salimans MM, Jansen CL, et al. (1990). Rapid and simple method for purification of nucleic acids. J.
Clin. Microbiol. 28: 495-503.
Branquinho MR, Gomes DMV, Ferreira RTB, Lawson-Ferreira, et al. (2013). Detection of genetically modified maize events
in Brazilian maize-derived food products. Food Sci. Technol. (Campinas) 33: 399-403. http://dx.doi.
org/10.1590/S0101-20612013005000063
Brazil (2003). Decree No. 4,680, April 24, 2003. Regulates access to information (Lei No. 8078, September 11, 1990)
concerning genetically modified foods and ingredients. DOU Diário Oficial da União, Brasília, DF. Available at [http://
www.planalto.gov.br/ccivil_03/decreto/2003/d4680.htm]. Accessed February 25, 2016.
Cantelmo NF, Von Pinho EVR, Von Pinho RG, Von Pinho IV, et al. (2013). Detection of transgenic events in maize using
immunochromatographic strip test and conventional PCR. Science. Agrotec. 37: 404-409. http://dx.doi.org/10.1590/
S1413-70542013000500003
CIB (2011). Biotechnology Information Council - Coexistence of GM and non-GM crops in commercial crops.
Available at [cib.org.br/wp-content/uploads/2011/10/estudos_cientificos_ambiental_09.pdf]. Accessed June 04, 2016.
CONAB (2015). National Supply Company - Safra Survey 2014/15. Available at [http://www.
conab.gov.br/OlalaCMS/uploads/arquivos/15_10_16_10_52_19_safras_outu_2015.pdf]. Accessed October 27, 2015.
Conceição FR, Moreira AN and Binsfeld PC (2006). Detection and quantification of genetically modified organisms in foods
and food ingredients. Science. Rural 36: 315-324. http://dx.doi.org/10.1590/S0103-
84782006000100053
Corbisier P, Bhat S, Partis L, Xie VR, et al. (2010). Absolute quantification of genetically modified MON810 maize (Zea
mays L.) by digital polymerase chain reaction. Anal. Bioanal. Chem 396: 2143-2150. http://dx.doi.org/10.1007/
s00216-009-3200-3
Cruz JC (2014). Embrapa Milho e Sorgo. 478 millet cultivars are available in the Brazilian seed market for the 2014/15
season. Available at [http://www.cnpms.embrapa.br/milho/cultivares/]. Accessed December 15, 2015.
Cruz JC (2015). Embrapa Milho e Sorgo. 477 millet cultivars are available in the Brazilian seed market for the 2015/16
season. Available at [http://www.cnpms.embrapa.br/milho/cultivares/]. Accessed December 17, 2015.
Devos Y, Demont M, Dillen K, Reheul D, et al. (2009). Coexistence of genetically modified (GM) and non-GM crops in the
European Union. A review. Agron. Sustain. 29:11-30. http://dx.doi.org/10.1051/agro:2008051
Dinon AZ, Prins TW, van Dijk JP, Arisi ACM, et al. (2011). Development and validation of real-time PCR screening methods
for detection of cry1A.105 and cry2Ab2 genes in genetically modified organisms. Anal. Bioanal. Chem.
400: 1433-1442. http://dx.doi.org/10.1007/s00216-011-4875-9
Huber I, Block A, Sebah D, Debode F, et al. (2013). Development and validation of duplex, triplex, and pentaplex real-time
PCR screening assays for the detection of genetically modified organisms in food and feed. J. Agric. Food Chem
61:10293-10301. http://dx.doi.org/10.1021/jf402448y
Hutchison WD, Burkness EC, Mitchell PD, Moon RD, et al. (2010). Areawide suppression of European corn borer with Bt
maize reaps savings to non-Bt maize growers. Science 330: 222-225. http://dx.doi.org/10.1126/science.1190242
James C (2014). Global review of commercialized transgenic crops: 2014. The International Service for the Acquisition of
Agri-biotech Applications (ISAAA). Available at [http://www.isaaa.org/gmapprovaldatabase/approvedeventsin/
default.asp?CountryID=BR&Country=Brazil]. Accessed November 25, 2015.
Lopes AD, Scapim CA, Mangolin CA and Machado MF (2014). Genetic divergence among sweet corn lines estimated by
microsatellite markers. Genet. Mol. Res. 13: 10415-10426. http://dx.doi.org/10.4238/2014.December.12.3
MAP (2015). Ministry of Agriculture, Livestock and Supply - Legislação de Orgânicos. Available at [http://www.
agriculture.gov.br/arq_editor/file/Desenvolvimento_Sustentavel/Organicos/Legislacao/Nacional/Lei_n_010_831_
de_23-12-2003.pdf]. Accessed March 23, 2016.
Marinho CD, Martins FJ, Amaral Júnior AT, Gonçalves LS, et al. (2014). Genetically modified crops: Brazilian law and
overview. Genet. Mol. Res 13:5221-5240. http://dx.doi.org/10.4238/2014.July.7.15
MDA (2015). Ministério Desenvolvimento Agrário - Family agriculture produces 70% of two foods consumed
Brazilians. Available at [http://www.mda.gov.br/]. Accessed November 12, 2015.
Meriç S, Çakir O, Turgut-Kara N and Arÿ S (2014). Detection of genetically modified maize and soybean in feed samples.
Genet. Mol. Res. 13: 1160-1168. http://dx.doi.org/10.4238/2014.February.25.2
Nascimento VE, Von Pinho ÉV, Von Pinho RG and do Nascimento AD, Jr. (2012). Detection limits of the strip test and PCR
for genetically modified corn in Brazil. Genet. Mol. Res 11: 2497-2505. http://dx.doi.org/10.4238/2012.June.27.2
Palaudelmàs M, Melé E, Monfort A, Serra J, et al. (2012). Assessment of the influence of field size on maize gene flow
using SSR analysis. Transgenic Res 21:471-483. http://dx.doi.org/10.1007/s11248-011-9549-z
Reiting R, Broll H, Waiblinger HU and Grohmann L (2007). Collaborative study of a T-nos real-time PCR method for
screening of genetically modified organisms in food products. J. Verbr. Lebensm 2: 116-121. http://dx.doi.
org/10.1007/s00003-007-0189-4
Romeis J, Meissle M and Bigler F (2006). Transgenic crops expressing Bacillus thuringiensis toxins and biological
control. Nat. Biotechnol. 24: 63-71. http://dx.doi.org/10.1038/nbt1180
Ronald P (2011). Plant genetics, sustainable agriculture and global food security. Genetics 188: 11-20. http://dx.doi.
org/10.1534/genetics.111.128553
Santos N (2015). Milho Culture. Organic Milho Production System: 2013. Available at [http://www.zeamays.
com.br/sistema-de-producao-de-milho-organico/]. Accessed November 6, 2015.
Silva PSL, Silva KMB, Silva PIB, Oliveira VR, et al. (2010). Yield of Green Spikes and Grains of Milho Cultivars in
Competition with Daninhas Plants. Daninha Plant 28: 77-85. http://dx.doi.org/10.1590/S0100-
83582010000100010
Tabashnik BE (2010). Plant science. Communal benefits of transgenic corn. Science 330: 189-190. http://dx.doi.
org/10.1126/science.1196864
Waiblinger HU, Ernest B, Anderson A and Pietsch K (2008). Validation and collaborative study of a P-35S and T-nos
duplex real-time PCR screening method to detect genetically modified organisms in food products. Eur. Food Res.
Technol. 226: 1221-1228. http://dx.doi.org/10.1007/s00217-007-0748-z
Wolf C, Scherzinger M, Wurz A, Pauli U, et al. (2000). Detection of cauliflower mosaic virus by the polymerase chain
reaction: testing of food components for false-positive 35Spromoterscreening results. Eur. Food Res. Technol. 210:
367-372. http://dx.doi.org/10.1007/s002170050565