BN2301

Biochemistry and Biomaterials for

Bioengineers

Lecture 2

Dr. Cheow Lih Feng bieclf@nus.edu.sg

Biochemistry and Biomaterials for Bioengineers

Key concepts of biological molecules, enzymatic

catalysis, their roles and functions in health and
disease, analytical methods, engineered
biomaterials, as well as relevant new developments
of biotechnology and biomaterials, and their
applications.

1. Nucleic Acids (DNA, RNA)

2. Proteins and Enzymes
3. Biomaterials
Why do we learn this
1. Molecular and Cell Biology 3. Disease and Health

2. Biotechnology
Lesson Plan for Part 1
Week Lecture Tutorial Lab
2 Lecture 2
(Nucleic Acids)

3 Lecture 3 Tutorial 1
(DNA Technology)

4 Lecture 4 Tutorial 2
(Cancer and Sequencing)

5 Quiz 1

6 Lab 1 (Online)
Lecture Outline

Nucleic Acids
DNA
• Structure and Properties
• Replication
RNA
• Structure and Properties
• Transcription
The Genetic Code
• Translation
DNA is the blueprint of life

50 trillion cells in our body DNA is the blueprint of life

Instruction manual: 3 billion

Every cell has the same copy of DNA characters
1 page = 3000 characters
1 million pages
Our differences are encoded in DNA

Single Nucleotide Polymorphism DNA mutation can cause cancer

DNA

Deoxyribonucleic Acid
1. Structure
2. Biochemistry
3. Base Pairing
DNA in cells

In eukaryotes, such as plants and animals, DNA is found in the nucleus, a specialized,
membrane-bound vault in the cell, as well as in certain other types of organelles
(such as mitochondria and the chloroplasts of plants).

In prokaryotes, such as bacteria, the DNA is not enclosed in a membranous envelope,

although it's located in a specialized cell region called the nucleoid.
DNA Structure

DNA is a polymer of nucleotides (monomer)

Each nucleotide is composed of:

1. Nitrogenous base

2. Sugar

3. Phosphate
Four DNA bases ***

Four kinds of nitrogenous bases:

Purine bases (2 carbon rings)

Pyrimidine bases (1 carbon ring)

Sugar

The five-carbon sugar in DNA is

called deoxyribose

The carbon atoms of a

nucleotide’s sugar molecule are
numbered as 1ʹ, 2ʹ, 3ʹ, 4ʹ, and 5ʹ
(1ʹ is read as “one prime”), as
shown in the figure above.

In a nucleotide, the sugar

occupies a central position,
with the base attached to its 1ʹ
carbon and the phosphate
group attached to its 5ʹ carbon.
Phosphate
In a cell, a free nucleotide about to be added to the end of a polynucleotide chain will
bear a series of three phosphate groups.

When the nucleotide joins the growing DNA or RNA chain, it loses two phosphate groups.
So, in a chain of DNA or RNA, each nucleotide has just one phosphate group.
Polynucleotide chains
A consequence of the structure of nucleotides is that a polynucleotide chain has
directionality – that is, it has two ends that are different from each other.
At the 5’ end, or beginning, of the chain, the 5’ phosphate group of the first nucleotide in
the chain sticks out.
At the other end, called the 3’ end, the 3’ hydroxyl of the last nucleotide added to the
chain is exposed.
DNA sequences are usually written in the 5' to 3' direction, meaning that the nucleotide at
the 5' end comes first and the nucleotide at the 3' end comes last.

As new nucleotides are added

to a strand of DNA or RNA, the
strand grows at its 3’ end, with
the 5ʹ phosphate of an incoming
nucleotide attaching to the
hydroxyl group at the 3’ end of
the chain. This makes a chain
with each sugar joined to its
neighbors by a set of bonds
called a phosphodiester
linkage.
Double Stranded DNA

DNA chains are typically found in a double

helix, a structure in which two matching
(complementary) chains are stuck together, as
shown in the diagram at right.

The sugars and phosphates lie on the outside

of the helix, forming the backbone of the DNA;
this portion of the molecule is sometimes
called the sugar-phosphate backbone.

The nitrogenous bases extend into the interior,

like the steps of a staircase, in pairs; the bases
of a pair are bound to each other by hydrogen
bonds.
Antiparallel Orientation

The two strands of the helix run in opposite directions, meaning that the 5ʹ end of
one strand is paired up with the 3ʹ end of its matching strand.

This is referred to as antiparallel orientation and is important for the copying of DNA.
DNA: Complimentary base pairing

The nitrogen bases form the double-strand of

DNA through weak hydrogen bonds.

Adenine pair with Thymine

A=T

Cytosine pairs with Guanine

C=G

This is known as Watson-Crick pairing

A-T vs G-C bond

A-T is a double bond…

C-G is a triple bond (stronger)

DNA double strand can separate into 2 single

strands when heated

Which strand would require more energy to

separate: an A-T rich or a C-G rich double
strand?
C-G rich double strand
Chargaff’s Rule

The rules of base pairing explain the phenomenon that whatever the amount of
adenine (A) in the DNA of an organism, the amount of thymine (T) is the same.
Similarly, whatever the amount of guanine (G), the amount of cytosine (C) is the same.
DNA Complementarity

As a result of base-pair complementarity and the antiparallel arrangement of DNA.

The sequence of one strand completely determines the sequence of the
complementary strand

If one strand is 5’-AATTGGCC-3’, the complementary strand must have the sequence
3’-TTAACCGG-5’. This allows each base to match up with its partner. This property also
suggest a mechanism for DNA to replicate in order to pass down genetic information.
 Semi-conservative Replication
• Every cell in our body contain the same
DNA sequence
• DNA needs to be replicated exactly once
during every cell division
• DNA replication of one helix of DNA
(parental) results in two identical helices
(daughter)
• Each newly synthesized strand of
daughter DNA is made by addition of
nucleotides that is complementary to the
parent strand
• DNA replication is semi-conservative,
meaning that one parent strand is always
passed on to the daughter helix of DNA
DNA Replication Animation I

https://www.youtube.com/watch?v=TNKWgcFPHqw
 Replication forks
• First step in DNA replication is
unzipping of two DNA strands with
DNA Helicase
• The replication origin forms a Y-
shape called the replication fork
 Leading and Lagging Strand Replication
• DNA polymerase can only replicate from Leading strand
5’ to 3’ direction
• For the leading strand, DNA polymerase
moves in the direction of the replication
fork, replication occurs continuously
• On the lagging strand, DNA polymerase
moves away from the fork. As the fork
Lagging strand
opens, new DNA that needs to be
replicated is uncovered
• The lagging strand replicates in small fragments known as Okazaki
fragments. Each subsequent Okazaki fragment is replicated more
closely to the receding replication fork than the fragment before
• Replication occurs discontinuously. These fragments are finally
stitched together by DNA ligase, creating a continuous strand
DNA Replication Animation II

https://www.dnalc.org/resources/3d/04-mechanism-of-replication-advanced.html
CENTRAL DOGMA
transcription

DNA translation

RNA
replication Proteins

• Direction of information flow:

– DNA ->RNA -> Protein
• Transcription: Synthesis of RNA from DNA
• Translation: Synthesis of Protein from RNA
RNA

RNA: Ribonucleic Acid

Is very similar to DNA
(repeating subunits, nucleotides).

Difference between RNA and DNA:

RNA contains a different sugar: ribose instead of deoxyribose.
Bases are A, G, C, and U (uracil)
A pairs with U; G pairs with C
RNA

• RNA is single stranded

and shorter
• RNA is less stable than DNA:
RNA doesn’t persist in the cell for
long whereas DNA can persist for
the life of the cell.
• RNA can sometimes form
secondary structures
Transcription animation

• https://www.youtube.com/watch?v=oeNUzRCIH1k
Transcription: DNA à RNA
• Transcription occurs in the nucleus
• Enzyme responsible for transcription
is known as RNA Polymerase
• RNA polymerase binds to DNA helix at
promoter region
• An open complex is formed as DNA
unwinds
• RNA nucleotides are polymerized
from nucleotide triphosphates to
make a messenger RNA in the 5’ to 3’
direction
• Transcription begins at transcription
start site is terminated when
sequences in the terminator region
are encountered
Transcription animation

https://www.dnalc.org/resources/3d/12-transcription-basic.html
Splicing
• Once mRNA is formed,
enzyme complex in the
nucleus known as
spliceosome remove the
Introns and leave the
Exons
• This process is known as
splicing, and it provides
much more diversity in the
proteins that can be coded
Splicing animation

https://www.dnalc.org/resources/3d/rna-splicing.html
CENTRAL DOGMA
transcription

DNA translation

RNA
replication Proteins

• Direction of information flow:

– DNA ->RNA -> Protein
• Transcription: Synthesis of RNA from DNA
• Translation: Synthesis of Protein from RNA
 Amino Acids
There are 20 amino acids – they are like the building blocks
to make all proteins
The Genetic Code
• Each 3 consecutive bases on the mRNA is a code word, codon, that
specifies an amino acid. The code is non-overlapping: bases are not
shared between consecutive codons
• The genetic code consists of 64 codons, but only 61 code amino acid.
• Three codons act as signal terminators (UAA,UAG,UGA)
• One codon, AUG, codes for methionine, and is also the start codon
Exercise
• You are given the following RNA base sequence. What protein does it
code for?
AUGGGUAUUGCUUAUAAUCACCUAGAGUAA

AUG-GGU-AUU-GCU-UAU-AAU-CAC-CUA-GAG-UAA

Met Asn
Translation: RNA à Protein
• Translation: synthesizing a protein from amino acids, according
to the sequences of the nucleotides in mRNA.
• Occurs at the ribosome, in cytoplasm of cell
• Ribosomes consist of
a large subunit and
a small subunit.
mRNA binds to the
small subunit.
Transfer RNA (tRNA)
• Transport molecule
that carries specific
amino acid to a
ribosome (80 nt long)
• Folded
• Each tRNA recognizes
the correct codon on
the mRNA molecule
Translation
Steps in Translation
1. mRNA leaves the nucleus and migrates to ribosome
2. mRNA binds to small ribosomal subunit
3. tRNA brings an amino acid to the ribosome, where
anticodon on the tRNA binds to the codon of the
mRNA
4. The amino acid bonds to its adjoining amino acid to
form a growing polypeptide molecule
5. The tRNA without the amino acid is released from the
ribosome
6. Other tRNA’s bring amino acids to the ribosome to
complete the protein molecule
Protein translation

U
U

U
Protein synthesis

• Occurs in the cytoplasm of the cell

• Many ribosomes can occupy the same strand of mRNA for
simultaneous protein synthesis
Translation animation

https://www.dnalc.org/resources/3d/16-translation-advanced.html
 Genomic
Geography

• In Cell Nucleus: RNA is produced by transcription.

• RNA is single-stranded; substitutes the sugar ribose for deoxyribose and the base uracil for
thymine
• Messenger RNA (mRNA), conveys the DNA recipe for protein synthesis to the cell cytoplasm.
• mRNA binds to ribosome, each three-base codon of the mRNA links to a specific form of
transfer RNA (tRNA) containing the complementary three-base sequence.
• This tRNA, in turn, transfers a single amino acid to a growing protein chain.
• Each codon directs the addition of one amino acid to the protein.
Central Dogma

https://www.dnalc.org/resources/3d/central-dogma.html
Summary