Name: ____________________________ _________________________________

Last/Surname First/Given Name

Student ID: ____________________________________ Section #: _______________

BIO206 Term Test 2

Fall 2023
Instructor: Ichiro Inamoto

November 22, 2023

IB110, 5 pm
Duration: 90 minutes

This test is 20 % of your Final Grade

IMPORTANT: You can not request for accommodations for medical reasons etc.
once you have begun writing this test.

Allowed aids and stationaries: Pens / Pencils / Non-programable calculator

Codon table is provided at the end of this test booklet.

Answer questions 1 - 29 on the provided Scantron sheet.

• Answers written in this test booklet will NOT be marked for questions 1 - 29.

Answer questions 30 - 35 in the test booklet.

• Answers written in pencil will NOT be considered for a re-mark
• A test with missing name / student ID MAY NOT BE GRADED

Questions 1 - 29 2 marks each x 29 = 58 marks

Question 30 12 marks
Question 31 6 marks
Question 32 11 marks
Question 33 4 marks
Question 34 15 marks
Question 35 14 marks
120 marks total

1
Name: ____________________________ _________________________________
Last/Surname First/Given Name
1. What is the correct order of these promoter elements in the eukaryotic class II promoter?
a) BREU TATA BRED DPE INR MTE
b) BRED TATA BREU MTE INR DPE
c) BRED TATA BREU INR MTE DPE
d) BREU TATA BRED INR DPE MTE
e) BRED TATA BREU INR DPE MTE
f) BREU TATA BRED INR MTE DPE

2. What is the major function of TFIIE?

a) Clamps DNA onto RNA polymerase II so that the enzyme does not fall off.
b) Brings the RNA polymerase II to the class II promoter.
c) Helps TFIID bind to the TATA box.
d) Binds to the TATA box.
e) Opens up the dsDNA to generate the transcription bubble.

3. What best describes the function of a mediator protein during eukaryotic transcription?
a) It enzymatically modifies the RNA polymerase II to make it enter transcription elongation.
b) It reorganizes the protein CDS of pre-mRNA by cutting out introns.
c) It synthesizes an mRNA on the template DNA strand.
d) It decides if the RNA polymerase II should enter transcription elongation or not.
e) It binds to various conserved DNA sequences on the eukaryotic class II promoter to recruit
the RNA polymerase II.

4. You discovered a new enzyme which was isolated from a eukaryotic nucleus. The enzyme is
believed to be involved in pre-mRNA modification, and its function is to cut in middle of ssRNA at
a specific sequence. Which process does this enzyme participate in? Choose your best guess.
a) RNA synthesis
b) 5' capping
c) splicing
d) poly-adenylation (note: both choices 'c' and 'd' were accepted as correct answers)
e) mRNA transport into the cytoplasm
f) (none of the above applies to this question)

5. What is the nucleotide base found at the branch point of an intron?

a) Adenine
b) Cytosine
c) Guanine
d) Thymine
e) Uracil
f) (more than one of the above are correct)

2
Name: ____________________________ _________________________________
Last/Surname First/Given Name
6. The U1 and U2 snRNPs recognize specific mRNA sites based on
a) hydrophobicity.
b) DNA:RNA complementary base pairing.
c) RNA:RNA complementary base pairing.
d) protein shapes which recognize mRNA.
e) hydrogen bonds using amino acid side chains.

7. Which of these statements is incorrect? "The genetic code...

a) has a punctuation."
b) is polar."
c) is non-overlapping."
d) is organized with degeneracy."
e) is ambiguous."
f) is a triplet code."
g) (more than one of the above are incorrect)

8. Which amino acid does the codon AAG correspond to?

a) Asparagine
b) Cysteine
c) Glutamic acid
d) Leucine
e) Lysine
f) Phenylalanine

9. An open reading frame of a protein contains 300 nucleotides, including the stop codon. What
is the length of the protein coded in this open reading frame?
a) 49 aa
b) 50 aa
c) 99 aa
d) 100 aa
e) 299 aa
f) 300 aa

10. Because of genetic code degeneracy,

a) there are many un-used codons in the 64 possible combinations.
b) a single anticodon can only recognize a single codon.
c) a single codon can code for multiple different amino acids.
d) an amino acid is always coded by a single codon.
e) more than one codon can code for the same amino acid.

3
Name: ____________________________ _________________________________
Last/Surname First/Given Name

wildtype ATGGGACCATTCATTCTAGGCGGCCCCGAG
mutant ATGGGACCAATCATTCTAGGCGGCCCCGAG

Figure 1.

11. Figure 1 shows a sequence alignment between CDSs of two proteins; one is the wildtype
protein whereas the other is a mutant. The first ATG in these sequences are their start codons.
The mutation is underlined. Name this mutation.
a) silent
b) missense
c) nonsense
d) frameshift

12. During codon-anticodon recognition, codon position 3 pairs with

a) Anticodon position 1
b) Anticodon position 2
c) Anticodon position 3
d) Anticodon position 4
e) Anticodon position 5

13. The synthesis site of an aminoacyl-tRNA synthetase

a) will accept the correct amino acid to enter, or any amino acids which are smaller than the
correct one.
b) will cleave off the amino acid which is bound to tRNA.
c) only charges the correct amino acid to the tRNA.
d) will accept all amino acids to enter, except for the correct one.
e) will accept the correct amino acid to enter, or any amino acids which are larger than the
correct one.

14. The major function of the ribosomal large subunit is to

a) align tRNA to the mRNA.
b) perform power stroke.
c) hold the mRNA.
d) catalyze transpeptidation.
e) bring tRNA to the ribosome's A-site.

4
Name: ____________________________ _________________________________
Last/Surname First/Given Name

Figure 2. Schematic diagram of a tRNA. The anticodon sequence and the polarity of this molecule
is shown. Arrows 1 - 4 are pointing at other features of this molecule.

15. Name the amino acid which gets charged onto the tRNA in Figure2. Assume that this molecule
is in a human cell.
a) Arginine
b) Glutamine
c) Histidine
d) Serine
e) Tyrosine
f) Valine
g) (more than one of the above are correct)

16. Chose the best answer. In Figure 2, arrow 1 is pointing at a structure which you expect to
a) get an amino acid charged at the end of the conserved sequence, CCA
b) get an amino acid charged at the end of the conserved sequence, ACC
c) find codons
d) find anticodons
e) find pseudouridines
f) find dihydrouridines

5
Name: ____________________________ _________________________________
Last/Surname First/Given Name

-20 -10 1 10 20
| | | | |
a) UUUGCAUAUAAUACCAGCUGCAAUGAGGAGGCUGCAAUAAUCGCCUC

b) GCUGGCCCUGCUGGCAAGGAGGAUGGGACCCAACUCUGACGGUGAGA

c) CUGUACAUCACUGGACGGAGUGAUGGCUUCUUAAGGAGGCUAGAACC

d) CACUGGAGGAGGCAUCCACGCUAUGCUAACAGGUUCUCCUAGGACCA

e) GGGUCUUUGACAUGUCGGCCUGAUGCAGCCUUCGGCCCAAGCUCCUA

Figure 3.

17. Figure 3 shows five sequences of bacterial mRNA molecules, named "a" to "e". The sequences
AUG are underlined. Numbers show the relative location of the bases compared to the Adenine
of the AUG sequence. Of these sequences, which one has an AUG sequence that can be
recognized by the small ribosomal subunit as a start codon? Chose the best answer.

18. The bacterial 50S ribosomal subunit contains

a) 18S rRNA
b) 16S rRNA
c) 28S rRNA
d) 5.85S rRNA
e) 5S rRNA
f) (more than one of the above are correct)

19. Bacterial tRNAini is special because it

a) carries an acetylated methionine.
b) is the only tRNA which can bind to the 'P-site' before the full ribosome assembles.
c) is actually made out of ssDNA, not ssRNA.
d) recognizes a stop codon.
e) is the only tRNA which recognizes the codon AUG.
f) (more than one of the above are correct)

6
Name: ____________________________ _________________________________
Last/Surname First/Given Name
20. During the formation of 30S Initiation Complex, which of these proteins ensure that fMet-
tRNAini gets inserted into the correct site of the ribosome?
a) IF1
b) IF2-GTP
c) IF3
d) EF-Tu
e) EF-G
f) (more than one of the above are correct)

21. Translation Elongation

a) reads mRNA 5' to 3' while producing peptide N- to C-terminus.
b) reads mRNA 5' to 3' while producing peptide C- to N-terminus.
c) reads mRNA 3' to 5' while producing peptide N- to C-terminus.
d) reads mRNA 3' to 5' while producing peptide C- to N-terminus.

22. What is the function of EF-G? Chose the best answer.

a) Helps push the tRNA into the next sites during ribosome translocation.
b) Charges tRNA.
c) Helps terminate translation.
d) Helps bring tRNA to the ribosome.
e) Recycles EF-Ts.
f) Helps the ribosome perform the ratcheting motion.

23. The codon UGA has entered the A-site of the 70S ribosome. Which of the following statements
correctly describe the outcome of this event?
a) tRNA with the corresponding anticodon will enter the A-site.
b) The peptide attached to the tRNA in the P-site will get released by hydrolysis.
c) eRF will enter the A-site.
d) RF-1 will enter the A-site, followed by the entry of RF-3.
e) The ribosome will perform the ratcheting motion.
f) (more than one of the above are correct)

24. Polycistronic genes are rarely seen in eukaryotes because

a) only one Kozac sequence can exist per mRNA.
b) eukaryotes have a nucleus.
c) their mRNA must be read from the 5' end.
d) only one ribosome can bind to eukaryotic mRNA at once.
e) ribosomes can directly bind to RBS.

7
Name: ____________________________ _________________________________
Last/Surname First/Given Name
25. An Okazaki fragment
a) is necessary because the lagging strand is being opened in the 3' to 5' direction by the
replication fork.
b) is found on the leading strand of the replication fork.
c) extends continuously until the end of DNA replication.
d) has RNA at their 3' ends.
e) is a single stranded nucleic acid which contains both ribonucleotides and
deoxyribonucleotides.
f) (more than one of the above is correct)

26. Compared to RNA polymerases, DNA polymerases

a) can only synthesize short DNA sequences.
b) usually makes more mistakes.
c) can synthesize DNA using an empty template strand.
d) can synthesize DNA in a 3' to 5' direction.
e) synthesizes nucleic acids more accurately.

27. Antibiotics such as Ampicillin and Penicillin characterized by their

a) β-lactam ring.
b) imidazole group.
c) phenyl group.
d) pentose sugar.
e) carboxyl group.

28. Alu sequence is an example of a

a) target DNA which can not be amplified by PCR.
b) very long stretch of miscellaneous DNA.
c) non-coding region in protein ORF which gets cut out from pre mRNA.
d) gene's promoter region.
e) transposable element.

29. During DNA extraction, Chelex is used to remove

a) positively charged ions from the cell lysate.
b) negatively charged ions from the cell lysate.
c) genomic DNA from the cell lysate.
d) large cell debris from the cell lysate.
e) the cell pellet from the cell lysate.

8
Name: ____________________________ _________________________________
Last/Surname First/Given Name
30. The C-terminal domain of eukaryotic RNA polymerase II regulates various events during
transcription initiation and elongation. (12 marks in total)

a) Describe the structure of the RNA polymerase II CTD. (4 marks)

RNA polymerase II CTD is domain which has many repeats of the sequence YSPTSPS.

b) Describe the event which happens to the RNA polymerase II CTD to signal the enzyme to enter
transcription elongation. (2 marks)

TFIIH phosphorylates the fifth serines of the RNA polymerase II CTD.

c) Describe how the RNA polymerase II CTD coordinates pre-mRNA maturation during translation
transcription elongation. You don't need to discuss the actual molecular events for these
maturation steps. (6 marks)

Fifth serines are phosphorylated at the beginning of elongation. This recruits enzymes for 5'
capping.

During the middle of elongation, the second serines also gets phosphorylated (i.e., the fifth and
second serines are phosphorylated). This recruits enzymes for splicing.

At the end of elongation, the fifth serines gets dephosphorylated, so only the second serines are
phosphorylated. This recruits enzymes for adding the poly-A tails.

9
Name: ____________________________ _________________________________
Last/Surname First/Given Name
31. Figure 4 represents the ribose sugar of the branch point nucleoside in an intron. Carbon and
oxygen atoms are represented as C and O, respectively. Answer the following questions using the
diagram (6 marks)
a) Using simple lines, connect the atoms of this molecule to represent the Q-shape of the
intron once it is completely spliced out. You don't need to draw detailed structures such
as individual atoms etc.
b) Indicate the locations of (what used to be the) 5’ and 3’ exon/intron junctions.
c) Indicate all nitrogenous bases at the 5' and 3' exon/intron junctions which are 100%
conserved for all introns.

Note: I've numbered the carbons of the ribose sugar just as a reference. This was not required in
your answer.

10
Name: ____________________________ _________________________________
Last/Surname First/Given Name
32. Consider these events which occurred in a bacterial cell:
1. A tRNA has been charged by an aminoacyl-tRNA synthetase and is now freely floating in
the cytoplasm (call this molecule 'aa-tRNA'). The aa-tRNA is waiting to participate in
translation.
2. Moments later, the same aa-tRNA is found inside the ribosome, ready for
transpeptidation to occur. Transpeptidation has not happened yet.

Describe in detail the molecular events which occurred between these two time points. (11
marks)

• the aa-tRNA gets bound by EF-Tu-GTP

• EF-Tu-GTP-tRNA approaches the ribosome, and inserts the tRNA into the A-site of the
ribosome
• codon/anticodon pairing occurs between the tRNA and the mRNA
• when codon/anticodon correctly match the small subunit of the ribosome sends a signal
to the EF-Tu-GTP
• EF-Tu-GTP hydrolyzes GTP which causes a conformational change. The conformational
changes breaks its tRNA-binding surface
• tRNA is released into the A-site of the ribosome

There are 12 possible marks for Question 32. You could earn a total of 12/11 for this question,
with two bonus marks.

11
Name: ____________________________ _________________________________
Last/Surname First/Given Name
33. You are running an enzymatic assay in your lab, testing the activity of RNA polymerase II. Your
enzymatic assay kit, purchased from a company, came with a 20x concentrated solution of the
enzymatic Assay buffer. You need to dilute this concentrated Assay buffer before you can use it in
your assay. Your assay requires 200 μL of the buffer. How would you prepare the 1x working
solution using water as a diluent? (4 marks)

Calculation
(1/20)(200 μL) = 10 μL
200 μL - 10 = 190 μL

Answer
10 μL of 20x Assay buffer + 190 μL of water

12
Name: ____________________________ _________________________________
Last/Surname First/Given Name
34. A prokaryotic ribosome is in the elongation phase. Draw it, following instructions below: (15
marks)
• Draw the ribosomal subunits and label them with their proper names.
• Draw the mRNA and label its polarity.
• Draw the A, P and E sites.
• Draw tRNAs occupying A and P sites.
• Draw the growing peptide and the amino acid.
o The growing peptide is 5 amino acids long and has a sequence 'MRKAY'. A sixth
amino acid, G, is about to get added to the growing peptide.
o The ribosome you are drawing is immediately BEFORE the transpeptidation event.
o Represent each amino acids as simple circles (no need to draw chemical structures
at all), labelled with their one-letter names.

There are 16 possible marks for Question 32. You could earn a total of 16/15 for this question,
with two bonus marks.

13
Name: ____________________________ _________________________________
Last/Surname First/Given Name
35. Draw the replication bubble, following instructions below: (14 marks)
• Include both replication forks with new DNA being synthesized on all template DNA.
• Label the leading strand, lagging strand and Okazaki fragments.
• Label RNA primers.
• Label polarity of all nucleotides.
• Label the position of the origin of replication.
• You do not need to represent any proteins in this diagram.

There are 15 possible marks for Question 32. You could earn a total of 15/14 for this question,
with two bonus marks.

14
Name: ____________________________ _________________________________
Last/Surname First/Given Name

Codon table.

Second position
U C A G
Phenylalanine Serine Tyrosine Cysteine U
Phenylalanine Serine Tyrosine Cysteine C
U
Leucine Serine STOP STOP A
Leucine Serine STOP Tryptophan G
Leucine Proline Histidine Arginine U
Leucine Proline Histidine Arginine C
C

Third position
First position

Leucine Proline Glutamine Arginine A

Leucine Proline Glutamine Arginine G
Isoleucine Threonine Asparagine Serine U
Isoleucine Threonine Asparagine Serine C
A
Isoleucine Threonine Lysine Arginine A
Methionine Threonine Lysine Arginine G
Valine Alanine Aspartic Acid Glycine U
Valine Alanine Aspartic Acid Glycine C
G
Valine Alanine Glutamic Acid Glycine A
Valine Alanine Glutamic Acid Glycine G

15