Asian Journal of Andrology (2024) 26, 295–301

www.asiaandro.com; https://journals.lww.com/ajandrology

Open Access
ORIGINAL ARTICLE

Cuproptosis mediates copper-induced testicular

Sperm Biology

spermatogenic cell death

Jing-Yi Zhang1, Xu-Jun Yu1, Jun-Jun Li2, Yao Xiao1, Guang-Sen Li3, Fang Yang4, Liang Dong4

Cuproptosis, a novel mechanism of programmed cell death, has not been fully explored in the context of spermatogenic cells. This
study investigated the potential involvement of cuproptosis in spermatogenic cell death using a mouse model of copper overload.
Sixty male Institute of Cancer Research (ICR) mice were randomly divided into four groups that received daily oral gavage with
sodium chloride (control) or copper sulfate (CuSO4) at 50 mg kg−1, 100 mg kg−1, or 200 mg kg−1, for 42 consecutive days. Mice
subjected to copper overload exhibited a disruption in copper homeostasis. Additionally, significant upregulated expression of key
cuproptosis factors was accompanied by a significant rise in the rates of testicular tissue cell apoptosis. Immunohistochemical
analysis revealed the presence of ferredoxin 1 (Fdx1) in Sertoli cells, Leydig cells, and spermatogenic cells at various stages of
testicular development, and the Fdx1-positive staining area was significantly increased in copper-overloaded mice. Mitochondrial
dysfunction and decreased adenosine triphosphate levels were also observed, further implicating mitochondrial damage under
cuproptosis. Further analyses revealed pathological lesions and blood−testis barrier destruction in the testicular tissue, accompanied
by decreased sperm concentration and motility, in copper-overloaded mice. In summary, our results indicate that copper-overloaded
mice exhibit copper homeostasis disorder in the testicular tissue and that cuproptosis participates in spermatogenic cell death.
These findings provide novel insights into the pathogenic mechanisms underlying spermatogenic cell death and provide initial
experimental evidence for the occurrence of cuproptosis in the testis.
Asian Journal of Andrology (2024) 26, 295–301; doi: 10.4103/aja202383; published online: 26 January 2024

Keywords: blood−testis barrier; cuproptosis; ferredoxin 1; spermatogenic cell death

INTRODUCTION however, it is unclear whether cuproptosis is involved in spermatogenic

Cell death is considered an essential mechanism for maintaining cell death. Therefore, this study aimed to investigate the potential role of
normal physiological activity. Therefore, normal body tissues always cuproptosis in the process of spermatogenic cell death and to improve
exhibit a large amount of cell death and rapid clearance by phagocytic our understanding of the pathological basis of male infertility.
cells. The smooth operation of this mechanism for removing dead
cells is crucial for healthy biological functioning.1 However, exposure MATERIALS AND METHODS
of cells to harmful external stimuli can lead to increased cell death. Ethics of the animal experiments
During spermatogenesis and maturation, cell death induced by The animal experiments in this study met the ethical standards for
mechanisms including apoptosis2 and autophagy,3 which are widely the use of experimental animals and were approved by the Ethics
present in spermatogenic cells, is important for eliminating abnormal Committee of Chengdu University of Traditional Chinese Medicine
spermatogenic cells and ensuring the accurate transmission of genetic (Chengdu, China; Approval No. 2022-68).
information. Importantly, an abnormal increase in spermatogenic cell
death can lower the number and quality of sperm, leading to male Materials and reagents
infertility. Copper sulfate (CuSO4) was purchased from Aladdin Reagents
In recent years, the mechanisms of cell death have been studied (C141450; Shanghai, China). The following antibodies were used
intensively. The known mechanisms of spermatogenic cell death, which for immunoblotting analysis: anti-rabbit ferredoxin 1 (Fdx1; for
include apoptosis, autophagy, ferroptosis, necrosis,4 senescence,5 and western blotting, 1:1000, ab108257; Abcam, Cambridge, MA,
mitotic catastrophe,6 feature distinct morphological and biochemical USA), anti-rabbit Fdx1 (for immunohistochemistry, 1:100, YT8131;
characteristics. Nevertheless, much remains unknown regarding the Immunoway, Newark, CA, USA), anti-rabbit solute carrier family
mechanisms of cell death, and their continued investigation will lead 31 member 1 (Slc31a1; 1:1000, A0773; ABclonal, Wuhan, China),
to a deeper understanding of this essential process. A recent study anti-rabbit dihydrolipoamide acetyltransferase (Dlat; 1:1000, A8814;
has confirmed a novel cell death mechanism known as cuproptosis;7 ABclonal), anti-rabbit occludin (1:1000, ab216327; Abcam), anti-rabbit
1
Chengdu University of Traditional Chinese Medicine, Chengdu 611137, China; 2Chengdu Fifth People’s Hospital, The Fifth People’s Hospital of Chengdu University of
Traditional Chinese Medicine, Chengdu 611130, China; 3TCM Regulating Metabolic Diseases Key Laboratory of Sichuan Province, Hospital of Chengdu University of
Traditional Chinese Medicine, Chengdu 610072, China; 4Department of Surgery, The Reproductive and Women-Children Hospital, Chengdu University of Traditional
Chinese Medicine, Chengdu 610041, China.
Correspondence: Dr. XJ Yu (yuxujun@cdutcm.edu.cn) or Dr. JJ Li (lijunjun@cdutcm.edu.cn)
Received: 01 August 2023; Accepted: 08 December 2023
 Cuproptosis in testicular cell death
JY Zhang et al

296

claudin-11 (1:1000, A12478; ABclonal), anti-rabbit zonula occludens-1 Real-time quantitative PCR (RT-qPCR)
(ZO-1; 1:5000, 21773-1-AP; Proteintech, Wuhan, China), anti-mouse RNA samples were extracted using Animal Total RNA Isolation
β-actin (1:1000, GB11001; Servicebio, Wuhan, China), and anti-mouse Kits (RE-03011, FOREGENE, Chengdu, China) for the synthesis of
β-tubulin (1:5000, M20005; Abmart, Shanghai, China). complementary DNA (cDNA). The ChamQ Universal SYBR qPCR
Master Mix (Q711, Vazyme) was used for RT-qPCR. The sequences
Animals and treatments
of primers designed to amplify the genes Fdx1, Dlat, Slc31a1,
Sixty male Institute of Cancer Research (ICR) mice (age: 6 weeks;
ATPase copper transporting alpha (Atp7a), and ATPase copper
weight: 28–30 g) purchased from Dossy Laboratory Animal Company
transporting beta (Atp7b) for the RT-qPCR analysis are provided in
(Chengdu, China) were divided into four groups with 15 mice per
Supplementary Table 1.
group. The control group received 0.9% sodium chloride (NaCl)
solution by gavage. The experimental groups received CuSO 4 Immunohistochemistry
(50 mg kg−1, 100 mg kg−1, or 200 mg kg−1) dissolved in 0.9% NaCl The testes of mice were fixed in 4% paraformaldehyde, embedded
solution by oral gavage. The interventions were administered daily in paraffin, sliced into 5-μm sections, dewaxed, and rehydrated.
in all groups over 42 consecutive days. It is worth noting that doses The sections were then boiled in citrate buffer to achieve antigen
of CuSO4 exceeding 300 mg kg−1 were found to be highly lethal to recovery. Endogenous peroxidase activity was quenched with 3%
the mice. After conducting multiple preliminary experiments, we H2O2 and non-specific binding was blocked with 10% normal goat
established 50 mg kg−1, 100 mg kg−1, and 200 mg kg−1, administered serum. The sections were incubated with anti-rabbit Fdx1 (1:100,
orally for 42 consecutive days, as the final experimental doses. During YT8131) at 4°C overnight, washed with phosphate-buffered saline
the treatment period, two mice in the 100 mg kg−1 CuSO4 treatment (PBS), and then incubated with goat anti-rabbit IgG H&L/HRP (1:200,
group and three mice in the 200 mg kg−1 CuSO4 treatment group died. bs-0295G-HRP) for 1 h at room temperature. Finally, the sections were
stained with hematoxylin and a Nikon Eclipse C1 electron microscope
Sample collection, body weight monitoring, and testis weight and
(Nikon, Tokyo, Japan) was used for microscopic examination and
growth index measurement image collection.
After 42 days of treatment, the mice were anesthetized and euthanized
to collect testicular and liver tissues and whole blood samples for Hematoxylin and eosin (H&E) staining and transmission electron
further analysis. The epididymis was removed and semen quality microscopy
was immediately checked. Body weight was monitored every week The testicular specimens were fixed with 10% formalin for 24 h,
and documented at the time of sacrifice. The testis growth index was wrapped in paraffin, sliced into 4-µm sections, and stained with
calculated using the recorded data as follows: testis growth index = H&E. With the guidance of Dr. Juan Liu, a senior surgical pathologist
testis weight (mg) / body weight (g). from Chengdu University of Traditional Chinese Medicine, and
by referencing relevant literature methodologies, we counted the
Inductively coupled plasma mass spectrometry (ICP-MS) analyses
number of spermatogenic cells and Sertoli cells across 30 cross-
Copper concentrations were determined using ICP-MS. Accurately
sections of seminiferous tubules in each group. 8 The testicular
weighed liver (0.4 g) and testis tissues (0.4 g) and whole blood (2–10 ml)
specimens were then fixed with 3% glutaraldehyde, postfixed with
samples were transferred to glass or polytetrafluoroethylene digestion 1% osmium tetroxide, dehydrated in graded acetone, infiltrated in
vessels. Ethanol and carbon dioxide were removed from samples by Epox 812, and embedded. Semi-thin sections were stained with
preheating at low temperature on an electric heating plate. Samples methylene blue. Ultrathin sections were cut with a diamond knife,
were then placed in 10 ml of a mixture of nitric acid and perchloric stained with uranyl acetate and lead citrate, and examined under a
acid (10:1), digested by electrothermal heating or a graphite digestion JEM-1400FLASH transmission electron microscope (JEOL, Tokyo,
apparatus, cooled, diluted with water to 25 ml, and mixed well Japan).
for later use. Blank controls were prepared in parallel. The copper
concentrations in the test solutions were determined by ICP-MS using Adenosine triphosphate (ATP) assay
the following instrument parameters: scanning mode, peak hopping; Testicular tissues were homogenized in ice-cold extraction buffer
number of scans, 60; integration time, 10 ms; 3 points measured per and then centrifuged. ATP levels in testicular tissues were measured
mass; measurement mode, pulse/analog; and peristaltic pump speeds, using an ATP assay kit (BC0300; Solarbio), in accordance with the
30 rpm for analysis and 70 rpm for rinsing. manufacturer’s protocols.
Western blotting Measurement of testicular mitochondrial membrane potential
Concentrations of proteins extracted from radio immunoprecipitation (MMP)
assay (RIPA) Lysis Buffer (P0013B; Beyotime, Shanghai, China) for Testicular samples were ground to prepare a cell suspension. After
western blotting were measured using the bicinchoninic acid (BCA) collection and washing, the cells were incubated in 1× JC-1 staining
protein assay kit (PC0021; Solarbio, Beijing, China). The membrane solution (C2006; Beyotime) at 37°C for 30 min. The cells were then
was incubated with the following secondary antibodies at room rinsed and suspended in PBS before being analyzed using flow
temperature for 1 h: goat anti-rabbit IgG heavy and light chains/ cytometry to determine the fluorescence intensities of JC-1 monomers
horseradish peroxidase (H&L/HRP) (1:20 000, bs-0295G-HRP; (green) and JC-1 aggregates (red). Under normal conditions, cells
Bioss, Beijing, China) and goat anti-mouse IgG H&L/HRP (1:20 000, that possess an intact MMP exhibit spontaneous aggregation of
bs-0296G-HRP; Bioss). An enhanced chemiluminescence (ECL) JC-1, resulting in the production of red fluorescence. By contrast, in
chemiluminescent substrate reagent kit (E412-01; Vazyme, Nanjing, cells with reduced MMP, JC-1 exists as a monomer that emits green
China) was used to evaluate the blots. ImageJ software (National fluorescence and cannot form aggregates. Therefore, an increased ratio
Institutes of Health, Bethesda, MD, USA) was used to check the of red-to-green fluorescence intensity signifies an elevation in MMP,
results. whereas a decreased ratio indicates a reduction in MMP.

Asian Journal of Andrology

 Cuproptosis in testicular cell death
JY Zhang et al

297

Terminal deoxynucleotidyl transferase dUTP nick end labeling significantly elevated (all P < 0.01). Slc31a1 levels were also markedly
(TUNEL) assay higher in all three CuSO4 treatment groups than those in the control
Testicular tissue sections were sequentially dewaxed, hydrated, and group (all P < 0.05), while Dlat levels were higher in the 200 mg kg−1
placed in dH2O, cultivated in proteinase K working solution for CuSO4 treatment group than those in the control group (P < 0.05).
25 min at 37°C, then washed with PBS (pH 7.4) in a rocker device
Expression of key genes involved in cuproptosis
(TSY-B, Servicebio). A moderate dose of terminal deoxynucleotidyl
As presented in Supplementary Figure 2, compared with the control
transferase (TDT) enzyme, deoxyuridine triphosphate (dUTP),
group, Fdx1 mRNA expression levels were significantly higher in
and buffer were added to the TUNEL kit at a 1:5:50 ratio and then
the 50 mg kg−1 CuSO4 treatment group (P < 0.05). This increase
a Nikon Eclipse C1 was used for microscopic examination and
was even more pronounced in the groups treated with 100 mg kg−1
image collection. The apoptosis index was calculated as follows: the
and 200 mg kg−1 CuSO4 (both P < 0.01). Compared with the control
apoptosis index = (number of TUNEL-positive cells/total number
group, there were significant elevations in Slc31a1 mRNA levels in the
of whole cells) × 100%.
100 mg kg−1 and 200 mg kg−1 CuSO4 treatment groups (both P < 0.01)
Sperm quality and Dlat mRNA levels in the 200 mg kg−1 CuSO4 treatment group
Bilateral epididymal tissues were placed in Ham F10 medium at (P < 0.01), respectively. These results were in line with the protein
37°C and incubated for 30 min, until the epididymal sperm were expression findings. Additionally, all three CuSO4 treatment groups
completely separated. Sperm quality was evaluated by an automatic showed increased Atp7a mRNA levels (all P < 0.01), while the 100 mg
sperm detection and analysis system (Suiplus SSA-II; Suiplus Software, kg−1 and 200 mg kg−1 CuSO4 treatment groups showed markedly higher
Beijing, China). mRNA levels of Atp7b (both P < 0.05), compared with the control group.

Statistical analyses Distribution and quantification of Fdx1 in the testis

Data are displayed as mean ± standard deviation (s.d.). One-way The distribution of Fdx1 protein in the testis was observed using
analysis of variance (ANOVA) was applied to explore significant immunohistochemistry assays, which showed that Fdx1 was present
differences between the experimental groups and the control group in Sertoli cells, Leydig cells, and spermatogenic cells at various stages
using Graph Pad Prism version 9 (GraphPad Software, San Diego, CA, of testicular development (Supplementary Figure 3a). Therefore,
USA). P < 0.05 was considered to indicate a statistically significant cuproptosis is related to the testicular damage caused by CuSO4. The
difference. immunohistochemical findings also showed that the proportion of
the Fdx1-positive area was significantly increased in the 100 mg kg−1
RESULTS and 200 mg kg−1 CuSO4 treatment groups compared with that in the
Body weight, testis weight and testis growth index control group (both P < 0.01; Supplementary Figure 3b).
There were no significant differences in body weight, testis weight, or
testis growth index between all three CuSO4 treatment groups and the Testicular damage
control group (Supplementary Figure 1a–1c). The morphology of testicular tissue after H&E staining was observed
under an optical microscope (Supplementary Figure 4a). There
Changes in copper levels were no obvious pathological changes in testicular sections from the
Copper levels in the blood in all three CuSO4 treatment groups were control group, whereas all three CuSO4 treatment groups exhibited
higher than those in the control group (all P < 0.01; Figure 1a). In
the liver, copper levels were markedly higher in the 100 mg kg−1 and
200 mg kg−1 CuSO4 treatment groups than those in the control group
(both P < 0.01; Figure 1b), and in the testis, they were markedly higher
in the 200 mg kg−1 CuSO4 treatment group than those in the control
group (P < 0.01; Figure 1c).
Expression of key proteins involved in cuproptosis
As presented in Figure 2a and 2b, compared with the control
group, Fdx1 protein levels in all three CuSO4 treatment groups were
a

b
Figure 2: Expression levels of key cuproptosis proteins in the testis in the four
a b c
study groups. (a) Western blotting assay and (b) relative protein expression
Figure 1: Copper concentrations in the four study groups of mice. Copper levels normalized to the control group of Fdx1, Slc31a1, and Dlat in the
concentrations in the (a) blood, (b) liver, and (c) testis in the control, 50 mg kg−1 CuSO4, 100 mg kg−1 CuSO4, and 200 mg kg−1 CuSO4 treatment
50 mg kg−1 CuSO4, 100 mg kg−1 CuSO4, and 200 mg kg−1 CuSO4 treatment groups. Data are presented as mean ± standard deviation. *P < 0.05 and
groups, respectively. Data are presented as mean ± standard deviation. **
P < 0.01, the value of the indicated group compared with the control group
**
P < 0.01, the value of the indicated group compared with that of the control shows significant difference. NS: non-significant; Fdx1: ferredoxin 1; Slc31a1:
group shows significant difference. NS: non-significant. solute carrier family 31 member 1; Dlat: dihydrolipoamide acetyltransferase.

Asian Journal of Andrology

 Cuproptosis in testicular cell death
JY Zhang et al

298

severe, dose-dependent pathological disturbances. Sertoli cells and damage: a dissolved BTB structure that appeared blurred, with few
spermatogenic cells were markedly decreased (all P < 0.01), as shown regional junction complexes that were broken and others that were
in Supplementary Figure 4b and 4c. In the control group, irregularly open. Meanwhile, as presented in Figure 3a and 3b, the protein levels
shaped Sertoli cells and spermatogenic cells with distinct nucleoli of occludin, claudin-11, and ZO-1 were significantly decreased in all
were observed within the seminiferous tubules. The peritubular three CuSO4 treatment groups compared with those in the control
region exhibited an intact basal lamina surrounded by tunica propria group (all P < 0.01).
containing focal areas of spindle-shaped fibromyocytes. Clusters of Mitochondrial dysfunction
interstitial cells characterized by cytoplasmic richness, eosinophilia, As shown in Figure 4a and 4b, compared with the control group, all
and occasional cells with 1–2 eccentric nucleoli were visible in the three CuSO4 treatment groups exhibited significant decreases in the
testicular interstitium. By contrast, in the 50 mg kg−1 CuSO4 treatment JC-1 red/green ratio with increasing doses of CuSO4, indicating a
group, there was slight luminal dilation of the seminiferous tubules substantial reduction in testicular MMP (all P < 0.01). Furthermore,
and slight reduction in the numbers of spermatogonia, spermatocytes, Figure 4c illustrates that all three CuSO4 doses resulted in significant
spermatids, mature spermatozoa, and Sertoli cells. The testicular decreases in testicular ATP levels compared with the control
interstitium exhibited an increased width, with a slight change in (all P < 0.01).
the number of interstitial cells. In the 100 mg kg−1 CuSO4 treatment
group, we observed moderate luminal dilation of the seminiferous Apoptosis rate in the testis
tubules accompanied by significant reductions in the numbers of TUNEL assays revealed that the TUNEL-positive cell rates in the testis
spermatogonia, spermatocytes, spermatids, mature spermatozoa, of mice in the 100 mg kg−1 and 200 mg kg−1 CuSO4 treatment groups
and Sertoli cells. The testicular interstitium showed an increased were higher than that in the control group (both P < 0.05; Figure 5).
width, with a slight decrease in the number of interstitial cells. In Impairment of spermatogenesis
the 200 mg kg−1 CuSO4 treatment group, there was severe luminal Supplementary Figure 6 shows that CuSO4 treatment damaged
dilation of the seminiferous tubules, severe reduction in the numbers spermatogenesis. Relative to the control group, sperm concentrations
of spermatogonia, spermatocytes, spermatids, mature spermatozoa, were significantly decreased in the 100 mg kg−1 and 200 mg kg−1 CuSO4
and Sertoli cells, and a significant decrease in interstitial cells within treatment groups (both P < 0.01; Supplementary Figure 6a), and sperm
the interstitial compartment. motility was significantly decreased in all three CuSO4 treatment groups
(all P < 0.01; Supplementary Figure 6b).
Blood−testis barrier (BTB) destruction
Supplementary Figure 5 shows the BTB structure under electron DISCUSSION
microscopy. While the BTB structure of the testicles was normal in the Cuproptosis is distinct from known cell death mechanisms and is
control group, different degrees of injury were observed in all three dependent on the tricarboxylic acid (TCA) cycle and mitochondrial
CuSO4 treatment groups. In the 50 mg kg−1 CuSO4 treatment group, respiration. Although the potential involvement of cuproptosis in the
the BTB was relatively complete, with slight dissolution of junction process of spermatogenic cell death remains unclear, many studies have
complexes in a few regions. In the 100 mg kg−1 CuSO4 treatment group, shown that damage to testicular spermatogenic function is related to the
the BTB structure was partially dissolved and exhibited a blurred TCA cycle.9–11 Recently, a predictive model constructed by Zhao et al.12
appearance, and some regional junction complexes were open. The illustrated the relationship between human spermatogenic dysfunction
200 mg kg−1 CuSO4 treatment group exhibited the most significant and cuproptosis. In this study, we verified the existence of cuproptosis
in the testis using copper-overloaded mice. Disorders in copper
homeostasis are known to lead to cuproptosis. Copper homeostasis

b b c
Figure 3: Protein expression levels of occludin, claudin-11, and ZO-1 in the Figure 4: Mouse testicular mitochondrial function. (a) MMP of testis (JC-1
mouse testis. (a) Western blotting assay and (b) relative expression levels staining), (b) JC-1 red/green ratio quantification, and (c) ATP content in the
of occludin, claudin-11, and ZO-1 normalized to the control group in the control, 50 mg kg−1 CuSO4, 100 mg kg−1 CuSO4, and 200 mg kg−1 CuSO4
50 mg kg−1 CuSO4, 100 mg kg−1 CuSO4, and 200 mg kg−1 CuSO4 treatment treatment groups. Data are presented as mean ± standard deviation. **P < 0.01,
groups. Data are presented as mean ± standard deviation. **P < 0.01, the the value of the indicated group compared with the control group shows
value of the indicated group compared with the control group shows significant significant difference. MMP: mitochondrial membrane potential; ATP:
difference. ZO-1: zonula occludens-1. adenosine triphosphate.

Asian Journal of Andrology

 Cuproptosis in testicular cell death
JY Zhang et al

299

is mainly dependent on three copper transporters: Slc31a1, Atp7a, tissue of copper-overloaded mice. Fdx1 is a key regulatory factor in
and Atp7b. Slc31a1 participates in copper absorption, while Atp7a the mechanism of cuproptosis.7 Excessive intracellular copper can
and Atp7b are related to copper discharge.13,14 Slc31a1 is a primary lead to upregulation of Fdx1 and lipoacylation of proteins. The lipid
gateway for copper uptake in mammalian cells and is highly expressed acylation modification of proteins is a conservative post-translational
in the testes.15 Slc31a1 plays a critical role in the accumulation of modification of lysine residues that occurs in only four proteins
copper in the testes, where its toxicity causes damage.16,17 High doses involved in the TCA cycle, including Dlat.29,30 As a component of the
of CuSO4 (200 mg kg−1) result in a large accumulation of copper in pyruvate dehydrogenase complex, Dlat catalyzes the decarboxylation
the epididymides, testes, and scrota of mammals, leading to severe of pyruvate to acetyl coenzyme A in the TCA cycle.31 As an upstream
structural changes, metabolic disorders, decreased sperm quality, and regulator of protein lipoacylation modification, Fdx1 is directly
infertility.18–20 involved in regulating the lipoacylation of proteins (including Dlat).
Over the past few decades, our understanding of the molecular Fdx1 reduces Cu2+ to the more toxic Cu+ form, thereby inhibiting the
mechanism of copper homeostasis and the structure and function of synthesis of Fe-S cluster proteins and inducing cell death (Figure 6).
copper-containing proteins has greatly improved. The discovery of Immunohistochemistry results in the current study showed that Fdx1
copper-transporting ATPases, such as Atp7a and Atp7b, was a major was present in Sertoli cells, Leydig cells, and spermatogenic cells at
breakthrough.21–24 Atp7a and Atp7b use the energy from ATP hydrolysis various stages of testis development, and the Fdx1-positive area was
to transfer copper into the lumen of the Golgi apparatus to support the significantly increased in copper-overloaded mice. Meanwhile, the
protein secretion pathway and participate in ATP-dependent transport histopathological lesions of the testis in copper-overloaded mice,
of copper ions through the plasma membrane or cell membrane.25–29 In which included significant reduction in the numbers of Sertoli cells,
humans and rodents, the X-linked Atp7a (rodent Atp7a) gene encodes spermatogenic cells, and sperm, as well as vacuolar degeneration
the Atp7a protein, which is expressed in almost all cells in the body.21–23 and necrosis of spermatogenic cells, indicated the involvement
In mammals, the Atp7b protein is mainly synthesized in the liver, but is of cuproptosis. Cuproptosis is a novel form of programmed cell
expressed in multiple other tissues, including the placenta, breasts, eyes, death that is completely distinct from necrosis and apoptosis. In
lungs, and brain.15 In this study, we found that copper‑overloaded mice this study, we found evidence for both cuproptosis and necrosis
exhibited copper homeostasis disorder, and the mRNA expression levels in the process of copper-induced spermatogenic cell death. These
of Slc31a1 in the 100 mg kg−1 and 200 mg kg−1 CuSO4 treatment groups three cell death modes, cuproptosis, apoptosis, and necrosis,
were increased compared with the control group. However, Atp7a and each have different characteristics. In cuproptosis, which features
Atp7b mRNA expression levels in the 200 mg kg−1 CuSO4 treatment group mitochondrial membrane damage and impaired enzyme function
were also increased, indicating that an increase in intracellular copper in the TCA cycle, Fdx1 is a key regulatory factor.7 Necrosis mainly
content is accompanied by increased expression of these copper excretion features nuclear fragmentation, dissolution, and disappearance,
proteins as a way to protect cells from copper damage. Interestingly, this cytoplasmic coagulation and dissolution, and the liquefaction of
study also revealed that Atp7b is expressed in the testicular tissue of the extracellular matrix.32 The characteristics of apoptosis mainly
mice, which provides new evidence on Atp7b expression in this tissue. include cell membrane foaming, cell contraction, and the formation
To explore whether cuproptosis occurs in the mouse testis, the of apoptotic bodies.33 Additionally, copper has been demonstrated to
protein expression levels of Fdx1 and Dlat were determined. These directly catalyze lipid peroxidation and glutathione depletion, which
experiments revealed that Fdx1 and Dlat expression was increased, contribute to copper-elicited pathological alterations in biological
and the cell death rate was significantly increased, in the testicular systems.20 Our findings indicate that copper-induced germ cell
death involves not only cuproptosis, but also necrosis and apoptosis,
suggesting that multiple forms of cell death may be intricately
intertwined and occur simultaneously. This provides initial evidence
for cuproptosis occurring in the mouse testis.

a b
Figure 5: Cell apoptosis rate in mouse testicular tissue. (a) Representative
images of TUNEL assays in the control, 50 mg kg−1 CuSO4, 100 mg kg−1
CuSO4, and 200 mg kg−1 CuSO4 treatment groups. (b) Statistical analysis of
the calculated apoptosis indexes. Data are presented as mean ± standard Figure 6: Schematic diagram of key players in cuproptosis. Fdx1: ferredoxin
deviation. *P < 0.05 and **P < 0.01, the value of the indicated group compared 1; Slc31a1: solute carrier family 31 member 1; Dlat: dihydrolipoamide
with the control group shows significant difference. TUNEL: terminal acetyltransferase; TCA: tricarboxylic acid; Atp7a/b: ATPase copper transporting
deoxynucleotidyl transferase dUTP nick end labeling; NS: non-significant. alpha/beta.

Asian Journal of Andrology

 Cuproptosis in testicular cell death
JY Zhang et al

300

The physical barrier and immunity functions of the BTB are crucial death. Biomed Pharmacother 2017; 95: 1619–30.
7 Ts v e t k o v P, C o y S , P e t r o v a B , D r e i s h p o o n M , Ve r m a A , e t a l .
for maintaining a normal spermatogenic microenvironment. The BTB
Copper induces cell death by targeting lipoylated TCA cycle proteins. Science
divides the seminiferous tubules into basal chambers and proximal 2022; 375: 1254–61.
chambers, preventing harmful substances and microorganisms from 8 Skakkebaek NE, Heller CG. Quantification of human seminiferous epithelium. I.
entering the proximal chambers and providing a protective physical Histological studies in twenty-one fertile men with normal chromosome complements.
J Reprod Fertil 1973; 32: 379–89.
barrier to the seminiferous environment.34–36 The BTB also provides an 9 Kuang W, Zhang J, Lan Z, Deepak RN, Liu C, et al. SLC22A14 is a mitochondrial
immune barrier for spermatogenesis, rendering spermatogenic cells riboflavin transporter required for sperm oxidative phosphorylation and male fertility.
and sperm impervious to the production of auto-antibodies by the host Cell Rep 2021; 35: 109025.
10 Kang W, Harada Y, Yamatoya K, Kawano N, Kanai S, et al. Extra-mitochondrial
immune system.37 Our electron microscopy results in copper-overload citrate synthase initiates calcium oscillation and suppresses age-dependent sperm
mice showed that the BTB structure was dissolved and had a blurred dysfunction. Lab Invest 2020; 100: 583–95.
appearance, with opening or breakage of some regional junction 11 Cui Y, Han J, Ren J, Chen H, Xu B, et al. Untargeted LC-MS-based metabonomics
complexes. Structural and functional damage to the BTB can lead revealed that aristolochic acid I induces testicular toxicity by inhibiting amino acids
metabolism, glucose metabolism, beta-oxidation of fatty acids and the TCA cycle in
to spermatogenic dysfunction and a reduction in sperm production. male mice. Toxicol Appl Pharmacol 2019; 373: 26–38.
Furthermore, we found that sperm concentration and sperm motility 12 Zhao M, Yu WX, Liu SJ, Den YJ, Zhao ZW, et al. Identification and immuno-infiltration
were significantly decreased in copper-overloaded mice with BTB analysis of cuproptosis regulators in human spermatogenic dysfunction. Front Genet
2023; 14: 1115669.
damage. Taken together, these findings indicated the presence of copper 13 Lutsenko S. Human copper homeostasis: a network of interconnected pathways.
homeostasis disorder in the testicular tissue of copper-overloaded mice Curr Opin Chem Biol 2010; 14: 211–7.
and the certain involvement of cuproptosis in spermatogenic cell death. 14 Nevitt T, Ohrvik H, Thiele DJ. Charting the travels of copper in eukaryotes from yeast
to mammals. Biochim Biophys Acta 2012; 1823: 1580–93.
Cuproptosis may induce pathological damage and BTB destruction
15 Herman S, Lipiński P, Ogórek M, Starzyński R, Grzmil P, et al. Molecular regulation
in testicular tissue, and ultimately lead to decreased sperm quality. of copper homeostasis in the male gonad during the process of spermatogenesis.
Int J Mol Sci 2020; 21: 9053.
CONCLUSIONS 16 Ghaffari R, Di Bona KR, Riley CL, Richburg JH. Copper transporter 1 (CTR1)
The discovery of cuproptosis, a novel mechanism of cell death, expression by mouse testicular germ cells, but not Sertoli cells, is essential for
functional spermatogenesis. PLoS One 2019; 14: e0215522.
has opened a new perspective on the study of spermatogenic cell 17 Lee J, Prohaska JR, Thiele DJ. Essential role for mammalian copper transporter
death. Our findings provide evidence suggesting the involvement of Ctr1 in copper homeostasis and embryonic development. Proc Natl Acad Sci U S
cuproptosis in spermatogenic cell death, testicular tissue pathological A 2001; 98: 6842–7.
damage, mitochondrial dysfunction, BTB destruction, and decreased 18 Sakhaee E, Emadi L, Abshenas J, Kheirandish R, Azari O, et al. Evaluation of
epididymal sperm quality following experimentally induced copper poisoning in
sperm quality. This study presents new clues for the elucidation of the male rats. Andrologia 2012; 44: 110–6.
mechanisms of spermatogenic cell death and provides experimental 19 Tvrda E, Peer R, Sikka SC, Agarwal A. Iron and copper in male reproduction: a
data for cuproptosis in the testis. double-edged sword. J Assist Reprod Genet 2015; 32: 3–16.
20 Khushboo M, Murthy MK, Devi MS, Sanjeev S, Ibrahim KS, et al. Testicular
toxicity and sperm quality following copper exposure in Wistar albino rats:
AUTHOR CONTRIBUTIONS ameliorative potentials of L-carnitine. Environ Sci Pollut Res Int 2018; 25:
XJY and JYZ designed the experiments, and wrote the manuscript. 1837–62.
XJY applied for funds. JYZ and JJL conducted the experiments and 21 Mercer JF, Livingston J, Hall B, Paynter JA, Begy C, et al. Isolation of a partial
analyzed the data. LD, FY, and YX collected and provided the study candidate gene for Menkes disease by positional cloning. Nat Genet 1993; 3:
20–5.
samples. GSL checked and corrected the manuscript. All authors read 22 Chelly J, Tümer Z, Tønnesen T, Petterson A, Ishikawa-Brush Y, et al. Isolation of a
and approved the final manuscript. candidate gene for Menkes disease that encodes a potential heavy metal binding
protein. Nat Genet 1993; 3: 14–9.
COMPETING INTERESTS 23 Vulpe C, Levinson B, Whitney S, Packman S, Gitschier J. Isolation of a candidate
gene for Menkes disease and evidence that it encodes a copper-transporting ATPase.
All authors declare no competing interests. Nat Genet 1993; 3: 7–13.
24 Bull PC, Thomas GR, Rommens JM, Forbes JR, Cox DW. The Wilson disease gene
ACKNOWLEDGMENTS is a putative copper transporting P-type ATPase similar to the Menkes gene. Nat
This work was supported by the National Natural Science Foundation of Genet 1993; 5: 327–37.
China (No. 81973647 and No. 82274325) and the Chengdu Municipal Health 25 Lutsenko S, Barnes NL, Bartee MY, Dmitriev OY. Function and regulation of human
Commission (No. 2023215). copper-transporting ATPases. Physiol Rev 2007; 87: 1011–46.
26 Gupta A, Lutsenko S. Human copper transporters: mechanism, role in human
diseases and therapeutic potential. Future Med Chem 2009; 1: 1125–42.
Supplementary Information is linked to the online version of the paper on
27 Barry AN, Shinde U, Lutsenko S. Structural organization of human Cu-transporting
the Asian Journal of Andrology website. ATPases: learning from building blocks. J Biol Inorg Chem 2010; 15: 47–59.
28 Linz R, Lutsenko S. Copper-transporting ATPases ATP7A and ATP7B: cousins, not
REFERENCES twins. J Bioenerg Biomembr 2007; 39: 403–7.
1 Bertheloot D, Latz E, Franklin BS. Necroptosis, pyroptosis and apoptosis: an intricate 29 Solmonson A, DeBerardinis RJ. Lipoic acid metabolism and mitochondrial redox
game of cell death. Cell Mol Immunol 2021; 18: 1106–21. regulation. J Biol Chem 2018; 293: 7522–30.
2 Zakariah M, Molele RA, Mahdy MA, Ibrahim MI, McGaw LJ. Regulation of 30 Rowland EA, Snowden CK, Cristea IM. Protein lipoylation: an evolutionarily
spermatogenic cell apoptosis by the pro-apoptotic proteins in the testicular tissues conserved metabolic regulator of health and disease. Curr Opin Chem Biol 2018;
of mammalian and avian species. Anim Reprod Sci 2022; 247: 107158. 42: 76–85.
3 Yin J, Ni B, Tian ZQ, Yang F, Liao WG, et al. Regulatory effects of autophagy on 31 Patel MS, Nemeria NS, Furey W, Jordan F. The pyruvate dehydrogenase complexes:
spermatogenesis. Biol Reprod 2017; 96: 525–30. structure-based function and regulation. J Biol Chem 2014; 289: 16615–23.
4 McClusky LM. Several routes of cell death to secondary necrosis in the elasmobranch 32 Galluzzi L, Vitale I, Abrams JM, Alnemri ES, Baehrecke EH, et al. Molecular
testis. Apoptosis 2022; 27: 454–64. definitions of cell death subroutines: recommendations of the nomenclature
5 Zhang Y, Liu J, Li X, Zhou G, Sang Y, et al. Dietary selenium excess affected committee on cell death 2012. Cell Death Differ 2012; 19: 107–20.
spermatogenesis via DNA damage and telomere-related cell senescence and 33 Elmore S. Apoptosis: a review of programmed cell death. Toxicol Pathol 2007;
apoptosis in mice. Food Chem Toxicol 2023; 171: 113556. 35: 495–516.
6 Sasso-Cerri E, Oliveira B, de Santi F, Beltrame FL, Caneguim BH, et al. The 34 Gao Y, Xiao X, Lui WY, Lee YM, Mruk D, et al. Cell polarity proteins and
antineoplastic busulphan impairs peritubular and leydig cells, and vitamin B12 spermatogenesis. Semin Cell Dev Biol 2016; 59: 62–70.
stimulates spermatogonia proliferation and prevents busulphan-induced germ cell 35 Cheng CY, Mruk DD. The blood-testis barrier and its implications for male

Asian Journal of Andrology

 Cuproptosis in testicular cell death
JY Zhang et al

301

contraception. Pharmacol Rev 2012; 64: 16–64.

This is an open access journal, and articles are distributed under the terms of the
36 Moshrefi M, Ghasemi-Esmailabad S, Ali J, Findikli N, Mangoli E, et al. The probable
Creative Commons Attribution-NonCommercial-ShareAlike 4.0 License, which
destructive mechanisms behind COVID-19 on male reproduction system and fertility.
allows others to remix, tweak, and build upon the work non-commercially, as long
J Assist Reprod Genet 2021; 38: 1691–708.
as appropriate credit is given and the new creations are licensed under the identical
37 Pearson G, Robinson F, Beers Gibson T, Xu BE, Karandikar M, et al. Mitogen-activated
terms.
protein (MAP) kinase pathways: regulation and physiological functions. Endocr Rev
2001; 22: 153–83. ©The Author(s)(2024)

Asian Journal of Andrology

 a b c
Supplementary Figure 1: Body weight and testis growth index of the four study groups of mice. (a) Body weight, (b) testis weight, and (c) testis growth index
in the control, 50 mg kg-1 CuSO4, 100 mg kg-1 CuSO4, and 200 mg kg-1 CuSO4 treatment groups. NS: non-significant.

Supplementary Figure 2: The mRNA expression levels of key cuproptosis genes in the testis in the four study groups. RT-qPCR measurement of mRNA levels of
Fdx1, Slc31a1, Dlat, Atp7a, and Atp7b in the control, 50 mg kg-1 CuSO4, 100 mg kg-1 CuSO4, and 200 mg kg-1 CuSO4 treatment groups. Data are presented
as mean ± standard deviation. *P < 0.05 and **P < 0.01, the value of the indicated group compared with the control group shows significant difference. NS:
non-significant; Fdx1: ferredoxin 1; Slc31a1: solute carrier family 31 member 1; Dlat: dihydrolipoamide acetyltransferase; Atp7a: ATPase copper transporting
alpha; Atp7b: ATPase copper transporting bata.
 a b
Supplementary Figure 3: Immunohistochemistry of Fdx1 in the mouse testis. (a) Representative immunohistochemical staining of Fdx1 and (b) quantification
of the Fdx1-positive area in the control, 50 mg kg-1 CuSO4, 100 mg kg-1 CuSO4, and 200 mg kg-1 CuSO4 treatment groups. Scale bars=50 μm. Positive cells
were stained brown. Data are presented as mean ± standard deviation. **P < 0.01, the value of the indicated group compared with the control group shows
significant difference. Fdx1: ferredoxin 1; NS: non-significant.
 a

b c
Supplementary Figure 4: H&E staining of mouse testis sections. (a) Histological appearance of representative testis sections obtained from the control, 50 mg kg-1
CuSO4, 100 mg kg-1 CuSO4, and 200 mg kg-1 CuSO4 treatment groups. Red, orange, green, cyan, and blue arrows indicate Sertoli cells, spermatogonia,
primary spermatocytes, secondary spermatocytes and spermatids, respectively. Quantification of (b) the spermatogenic cell count and the (c) Sertoli cell
count per seminiferous tubule cross-section. Data are presented as mean ± standard deviation. **P < 0.01, the value of the indicated group compared with
the control group shows significant difference.
Supplementary Figure 5: Electron microscopy of the BTB of the mouse testis. Representative electron microscopy images obtained from the control, 50 mg kg-1
CuSO4, 100 mg kg-1 CuSO4, and 200 mg kg-1 CuSO4 treatment groups. Yellow, green, and orange arrows indicate the BTB with normal morphology and
structure, dissolved BTB structure, and open junction complex, respectively. BTB: blood−testis barrier.

a b
Supplementary Figure 6: Spermatogenesis disorder in the mouse testis. (a) Sperm concentrations and (b) sperm motility in the control, 50 mg kg-1 CuSO4,
100 mg kg-1 CuSO4, and 200 mg kg-1 CuSO4 treatment groups. Data are presented as mean ± standard deviation. **P < 0.01, the value of the indicated
group compared with the control group shows significant difference. NS: non-significant.
Supplementary Table 1: Primers designed to amplify
cuproptosis‑associated genes
Gene Sequence (5’–3’)
Fdx1 F: CAAGGGGAAAATTGGCGACTC
R: TTGGTCAGACAAACTTGGCAG
Dlat F: TCCCTCCGCATCAGAAGGTT
R: CCAACTGGAACATCTCTGGTC
Atp7a F: TGGGAAAGTGAATGGTGTCCA
R: ACGGTATTGGTTAAGACAGGGA
Atp7b F: GGGGACGATGCCTGAACAG
R: TAGCCAACATTGTCGAAGGCG
Slc31a1 F: GCCTTCGTGGCAGTGTTTTTA
R: GCGAATGCTGACTTGAGACTTTC
Gapdh F: CAGTGGCAAAGTGGAGATTGTTG
R: TCGCTCCTGGAAGATGGTGAT
Fdx1: ferredoxin 1; Dlat: dihydrolipoamide acetyltransferase; Atp7a: ATPase copper
transporting alpha; Atp7b: ATPase copper transporting beta; Slc31a1: solute carrier family
31 member 1