Lesson 2

Life Always Finds a Way

Learning Objectives:
Describe general features of the history of life on
Earth, including generally accepted dates and
sequence of the geologic time scale and charac-
teristics of major groups of organisms present
during these time periods

Describe EVOLUTION as a unifying theme in the

study of life

Trace the development of EVOLUTIONARY

thought ; explain the evidences of evolution
Lesson 2.1

History of Life on
Earth
 Earth has gone through a series of
major geological and biological
changes throughout its existence.
How is the geologic time scale
divided?
Earth’s History
is proved using

Abso-
Relative
lute Dat-
Dating
ing

Geo-
Index logic
fossils time
scale
 Geologic Time Scale
• EON (half billion years or more)

• ERA (several hundred million years)

• PERIOD (one hundred million years)

• EPOCH (tens of millions of years)

• AGE (millions of years)

 EONS
Hadean, Archean, Proterozoic, Phanerozoic

• The oldest eon, recognized only in 2012

• Name was derived from the word Hades, referring to the hellish conditions and violent
cosmic collisions that characterized the Earth four billion years ago
 EONS
Hadean, Archean, Proterozoic, Phanerozoic

Archean eon is still not much clear among geologists due to the few fossil or mineral
evidence that could support it.
 EONS
Hadean, Archean, Proterozoic, Phanerozoic

Proterozoic eon is characterized by the presence of oxygen in the atmosphere due to

the emergence of cyanobacteria, allowing other organisms, such as eukaryotes and
other microorganisms to live.
 EONS
Hadean, Archean, Proterozoic, Phanerozoic

Phanerozoic eon spans within the past 541 million years up to the present.

The eon is linked with the Cambrian explosion, which is a rapid evolutionary event
when complex organisms believed to have first evolved on Earth appeared.
 ERAS
Precambrian, Paleozoic, Mesozoic, Cenozoic

The geologic time scale begins with a long span of time, called Precambrian, covering
about 88% of life’s history.

The earliest forms of organisms that first emerged in this Precambrian Earth were
Probably similar to present-day bacteria.
 ERAS
Precambrian, Paleozoic, Mesozoic, Cenozoic

Paleozoic era (paleo “ancient/early” ; zoic “life”) lasted for 300 million years.

Many of the organisms that have emerged during this period were invertebrates or
animals without backbones.
 PALEOZOIC ERA
Periods: Cambrian, Ordovician, Silurian, Devonian, Mississippian, Pennsylvanian, Permian
 ERAS
Precambrian, Paleozoic, Mesozoic, Cenozoic

Mesozoic era (meso “middle”) lasted 180 million years and is known for being the age
of dinosaurs, although mammals have already evolved during this era.
MESOZOIC ERA
Periods: Triassic, Jurassic, Cretaceous
 ERAS
Precambrian, Paleozoic, Mesozoic, Cenozoic

Cenozoic era (ceno “latest”) began 65 million years ago until present. It is known as
the age of Mammals because they are most common and dominant species of this era.
CENOZOIC ERA
Our planet has been a major fac-
tor in the emergence and disap-
pearance of many organisms that
diversify into various forms to
survive.

From single-celled bacteria to

the biggest whale, all provide
uniqueness to Earth’s colorful
landscape.
Lesson 2.2

Evolution is a
Unifying Theme
in the Study of
Life
The great diversity of life here on Earth is a result of evolution.
 EVOLUTION = Descent with modification
DESCENT – Inheritance ; MODIFICATION – Changing of traits

Evolution refers to cumulative genetic change in a population of organisms over time.

It occurs within the population when some of the traits become more common or
less common from one generation of population to the next.
FELIDAE
The Cat Family
Antibiotic and pest resistance revealed that bacteria and insects can ride an evolutionary
fast track. They have the ability to evolve quickly due to their adaptive characteristics.
Changes in Evolutionary Thought Over Time
Lesson 2.3
 PRE-DARWINIAN THEORIES
During the end of 18th century and the beginning of 19th century, most
naturalists believed in the idea that species have been created
separately and remained unchanged from the time of their creation
until the present time.
This belief was grounded in the writings of Plato.
“IDEAL FORM”

Aristotle recognized that organisms on Earth are related to one

another in a hierarchy from simple to complex organisms.
“SCALA NATURAE”
This thought will dominate the scientific community for
nearly 2000 years.
 In the 1600s, the idea of CREATIONISM
predominates the common thinking.

Scientists began to disproved

the idea of unchanging
species due to accumulation
of evidences, like fossils that
show different rock layers.
If all types of organisms were created in one place and at one point in time, how come
do we have different groups of unique organisms in different parts of Earth?

Puzzled with this thought, most natural explorers began to hypothesize that populations
might have evolved or changed over time.
George-Louis Leclerc, Comte de Buffon
(1707-1788)
• A mathematician and naturalist working on Histoire Naturelle
• His drawings featured overarching theories about the planet
and its organisms.
• He proposed that a comet may have struck the sun and in the
process, its debris became the planets of the solar system.
• In 1749, he openly suggested that closely related species
may have arisen from a common ancestor.
• The change may have evolved due to changes in the
environment or even by chance.

Species change and they migrate from their original location to

a new environment, explaining their distribution.
 Erasmus Darwin
• Grandfather of Charles Darwin
• English physician, poet, and amateur scientist
• He believed that evolution could occur in living organisms
and humans, yet it was unclear to him how it occurs
• His poems and a two-volume scientific publication titled
Zoonomia or The Laws of Organic Life contain his ideas
on evolution (1794)
• He argued that life may have started evolving long before
the start of the history of humankind.

Life evolved from one common ancestor, which

branched off into all species we know today.
Jean Baptiste Lamarck (1744-1829)
• French naturalist
• In 1809, he proposed the idea that species, including
humans, descended from other species.
• He believed in two mechanisms:
- The physical desire of an animal determines how the body
will develop into something
- The changes in the organ size caused by its use and disuse
can be inherited by offsprings, disuse of a certain body part
may weaken the organ, leading to its disappearance
• This hypothesis was called the theory of acquired
characteristics
New species evolve from existing species through environmental
forces acting on them. Traits could be passed on to the next genera-
tion.
Lamarck’s theory of acquired characteristics
 DARWINIAN TIMES
• The cellular mechanisms involved in heredity were not yet fully known in the mid-
eighteenth century to fully understand inherited characteristics.
• As naturalist, Charles Darwin and Alfred Russel Wallace were able to come up
with a deeper explanation on how living things evolve, which stands until today.
 Fossils discovered in the late 1700s
to the early 1800s convinced many
scientists that plants and animals
had changed or evolved from simple
to complex organisms.

Plesiosaur, an extinct marine reptile

Geologists prove that Earth could be millions of years older as it undergoes major but
slow, continuous change over time.
 Darwin was appointed as the ship’s
naturalist for the five-year journey of the
HMS Beagle (1831-1836) to map the
coastline of South America.

Before he sailed, he got hold of the first

volume of Charles Lyell’s book on the
Principles of Geology.

He became an avid proponent of Lyell’s idea of

slow and steady geological processes that
change Earth’s surface and Earth may have
been hundreds or millions of years older than
the previously held belief.
A map of Darwin’s five-year voyage that became the basis for his theory of evolution by
natural selection.
 Darwin’s trip to Galapagos Islands, a volcanic island
near Ecuador filled with unique sets of plants and
animals, impressed him and allowed him to explore
the variability in the appearances of a single species.

He spent all his time making full sketches and

observations, and accumulating pieces of evidence
that the living things he observed could shed light on
the origin of species.
 Alfred Russel Wallace
• He traveled to South America to collect plant and animal
specimens, and noticed the magnificent variations among them
• He devised a theory by natural selection to support what he saw
from his voyage
• Wallace and Darwin presented their theory on evolution in 1858

Both of them regarded NATURAL SELECTION as a mechanism for

the changes over time among organisms from a common ancestor,
as well as the idea of survival of the fittest.
 Darwin attracted
more attention
when he published
his monumental
and well-documented
manuscript, titled
“On the Origin of
Species by
means of
Natural Selection”

Although not received with positivity by the scientific community at that time,
both Darwin and Wallace left a priceless legacy with two essential concepts:
DESCENT WITH MODIFICATION – organisms descended from common ancestors
NATURAL SELECTION – the mechanism that ensures the survival and reproductive
success of individuals who better adapted to their environment.
Darwin’s conclusions at the end of the voyage
1. Individual members within a population of species are varied and some of the
variations could be inherited by future generations
2. Members of the population have the capacity to produce more offsprings than
the environment could provide such as food, shelter, or space.

• Some individuals, whose hereditary characteristics favored them to cope

more efficiently in their local environment, are more likely to survive and
produce offsprings than individuals who do not possess those traits.

• Certain inherited traits flourished, becoming more common in a population

across many generations.

• These traits or adaptations can be physical, physiological, or behavioral

characteristics.
However, we should not confuse natural selection as the one responsible for variations
among species. Mutation creates variation.

Natural selection simply facilitated the individuals with better traits to withstand current
environmental challenges while producing offsprings in the next generation.
 Lesson 2.4

THE EVIDENCE
FOR EVOLUTION

47
 PALEONTOLOGY supports Evolution
Paleontologists support Darwin’s concepts of
evolution, as much of the evidence came from
fossils, the remains of dead plants and animals long ago.

These are hard resistant structures, such as teeth, shells

and bones.

Most of these fossil remains are found in sedimentary

rock layers, and suggest the different kinds of animals
that lived in a particular defined period.

Transitional fossils exhibit traits common to both

ancestral and derived groups. They can show how a
species might adapt to survive their new conditions.
Fossilized Archaeopteryx
BIOGEOGRAPHY and CONTINENTAL
DRIFT THEORY support Evolution
The geographical distribution of organisms also revealed something about how
organisms evolved in their natural environments.

Despite the physical resemblance of the

Galápagos Islands to the Cape Verde Islands off
the coast of Africa, the inhabitants of the two
island groups were completely different.

Noting the difference, Darwin realized the

importance of the history of migration as an
explanation of species distribution.
Another interesting revelation was that the animals in Galapagos Islands were similar to
the species in islands near the mainland, despite their difference in ecological
characteristics like climate and soil.
Darwin’s observations were based on the powerful influence of the environment.

South American rhea, South African ostrich, and Australian emu

are closely related but widely separated by geographical distribution.
BIOGEOGRAPHY and CONTINENTAL
DRIFT THEORY support Evolution
COMPARATIVE ANATOMY supports Evolution
Some structures that are present in today’s organisms have similarities with the
past ones, but not exactly the same.

Varied forelimbs of vertebrates ascended from the forelegs of a common ancestor.

Homologous structures are similar structures with different functions.

Bat’s wings, whale’s flippers, cat’s front leg, and human’s hand are all types of limbs with
different function but similar structure.
 COMPARATIVE ANATOMY supports Evolution
There are rudimentary structures with no obvious use at present but resemble useful
structures in ancestral relatives. In case of infection, removing them has no detrimental
effect because they have no apparent use for the individual.
These are called vestigial structures.
Vestigial structures in the human body

Auricular Muscles Human tailbone Palmaris Longus Muscle

Nictitating membrane / Palmar Grasp Reflex

Wisdom tooth Plica Semilunaris
 DEVELOPMENTAL EMBRYOLOGY
supports Evolution
Patterns of similarities have also
been revealed by observing
embryonic development.
Photographs show homologies in
embryonic structures and features
of the tails.

Humans have structure similar to

present-day organisms that most
probably came from a common
ancestor. Over time, these
structures have been modified to fit
your survival tasks in the
environment that you live.
 MOLECULAR BIOLOGY supports Evolution

To study broader groups of animals,

biologists use proteins present in their bodies
to reveal their evolutionary relationships.

Cytochrome is one of the key enzymes

practically present in every living organisms.

It reveals that the more closely related

species are, the more similar is their
cytochrome c amino acid sequence.
 MOLECULAR BIOLOGY supports Evolution
HUMAN CCAAGGTCACGACTACTCCAATTGTCACAACTGTTCCAACCGTCACGACTGTTGAACGA
CHIMPANZEE CCAAGGTCACGACTACTCCAATTGTCACAACTGTTCCAACCGTCA TGACTGTTGAACGA
GORILLA CCAAGGTCACAACTACTCCAATTGTCACAACTGTTCCAACCGTCACGACTGTTGAACGA

Genetic code of chimps and gorillas is almost identical to humans

Human and Go-

 Lesson 2.5

Main Points of
Natural Selection