Green tea extract containing enhanced levels of epimerized catechins attenuates scopolamine-induced memory impairment in mice

Journal of Ethnopharmacology 258 (2020) 112923 Contents lists available at ScienceDirect Journal of Ethnopharmacology journal homepage: www.elsevier.com/locate/jethpharm Green tea extract containing enhanced levels of epimerized catechins attenuates scopolamine-induced memory impairment in mice T Ho Jung Baea,1, Jihyun Kima,1, Se Jin Jeonb, Jaehoon Kima, Nayeon Gooa, Yongwoo Jeonga, Kyungnam Choa, Mudan Caia, Seo Yun Junga, Kyung Ja Kwonb, Jong Hoon Ryua,c,∗ a Department of Life and Nanopharmaceutical Science, Kyung Hee University, Seoul, 02447, Republic of Korea Department of Neuroscience, Center for Neuroscience Research, Institute of Biomedical Science and Technology, Konkuk University School of Medicine, Seoul, 05029, South Korea c Department of Oriental Pharmaceutical Science, Kyung Hee University, Seoul, 02447, Republic of Korea b A R T I C LE I N FO A B S T R A C T Keywords: Green tea Epimerization (−)-Epigallocatechin 3-O-Gallate Gallocatechin gallate Synaptophysin Cognitive function Ethnopharmacological relevance: Green tea has been used as a traditional medicine to control brain function and digestion. Recent works suggest that drinking green tea could prevent cognitive function impairment. During tea manufacturing processes, such as brewing and sterilization, green tea catechins are epimerized. However, the effects of heat-epimerized catechins on cognitive function are still unknown. To take this advantage, we developed a new green tea extract, high temperature processed-green tea extract (HTP-GTE), which has a similar catechin composition to green tea beverages. Aim of the study: This study aimed to investigate the effect of HTP-GTE on scopolamine-induced cognitive dysfunction and neuronal differentiation, and to elucidate its underlying mechanisms of action. Materials and methods: The neuronal differentiation promoting effects of HTP-GTE in SH-SY5Y cells was assessed by evaluating neurite length and the expression level of synaptophysin. The DNA methylation status at the synaptophysin promoter was determined in differentiated SH-SY5Y cells and in the hippocampi of mice. HTPGTE was administered for 10 days at doses of 30, 100 and 300 mg/kg (p.o.) to mice, and its effects on cognitive functions were measured by Y-maze and passive avoidance tests under scopolamine-induced cholinergic blockade state. Results: HTP-GTE induced neuronal differentiation and neurite outgrowth via the upregulation of synaptophysin gene expression. These beneficial effects of HTP-GTE resulted from reducing DNA methylation levels at the synaptophysin promoter via the suppression of DNMT1 activity. The administration of HTP-GTE ameliorated cognitive impairments in a scopolamine-treated mouse model. Conclusions: These results suggest that HTP-GTE could alleviate cognitive impairment by regulating synaptophysin expression and DNA methylation levels. Taken together, HTP-GTE would be a promising treatment for the cognitive impairment observed in dysfunction of the cholinergic neurotransmitter system. 1. Introduction Green tea has been used not only as a beverage but also as a medicinal herb for thousands of years (Graham, 1992). Traditionally, it has been used to improve digestion and to stimulate mental clarity (Heo, 2005). In addition to numerous health benefits (Chacko et al., 2010; Cooper et al., 2005; Higdon and Frei, 2003), several epidemiological studies also support the traditional benefit of green tea consumption on cognitive functions (Feng et al., 2010; Kuriyama et al., 2006; Tomata et al., 2012). Recently, it has been reported that the intake of green tea could be utilized as a new natural Alzheimer's disease (AD) prevention method (Ma et al., 2016). These positive effects of green tea consumption on brain functions have been mainly attributed to catechins, especially, (−)-epigallocatechin 3-O-gallate (EGCG). Indeed, EGCG has been shown to have neuroprotective effects in various neurodegenerative models, such as AD or Parkinson's disease (PD) models (Du et al., 2018; Jia et al., 2013; Levites et al., 2001; Rezai-Zadeh et al., 2005, 2008). EGCG, the most abundant ingredient in green tea leaves, is unstable, therefore, its considerable amounts (approximately 50%) are converted ∗ Corresponding author. Department of Oriental Pharmaceutical Science, Kyung Hee University, Seoul, 02447, Republic of Korea. E-mail address: jhryu63@khu.ac.kr (J.H. Ryu). 1 These authors contributed equally to this work. https://doi.org/10.1016/j.jep.2020.112923 Received 16 January 2020; Received in revised form 17 April 2020; Accepted 26 April 2020 Available online 01 May 2020 0378-8741/ © 2020 Elsevier B.V. All rights reserved. Journal of Ethnopharmacology 258 (2020) 112923 H.J. Bae, et al. After acclimation, mice were treated with HTP-GTE (30, 100, or 300 mg/kg, p.o.) for 10 days. The control group received vehicle solution (0.9% saline). Behavioral tests were conducted 1 h after the last administration of HTP-GTE or donepezil (5 mg/kg, i.p.). Donepezil was used as a positive control. In behavior studies and Western blot analysis, scopolamine was administered to the same animal 30 min after the above treatments. into its iso-epimer, (−)-gallocatechin 3-O-gallate (GCG), during the process of tea infusion (Wang et al., 2000). As such, tea catechins undergo epimerization, i.e., the conversion of tea catechins to their corresponding isomers, during the manufacturing and brewing processes. Catechin epimers have been shown to have more biological activities, such as anti-hypercholesterolemic, antiallergic and antioxidant activities, than the original catechins (Ikeda et al., 2003). In a preliminary in vitro study, we also observed that heat-treated green tea extract and GCG markedly enhanced neurite outgrowth compared with green tea extract and EGCG. Interestingly, AD therapeutics in the clinic, such as donepezil and memantine also stimulate neurite outgrowth in vitro (Page et al., 2015). Epigenetic regulation, like DNA methylation, has been known to be associated in neuronal differentiation processes. Postmortem brain analysis of AD patients has shown that neurogenesis was reduced and the DNA methylation levels of genes involved in neuronal plasticity were changed (He and Shen, 2009; Mu and Gage, 2011; Rao et al., 2012). In addition, higher DNA methylation levels have been reported in the hippocampus of AD patients compared to controls (BlancoLuquin et al., 2018). DNA methylation could induce changes in gene expression and neuronal plasticity (Borrelli et al., 2008; Feng et al., 2015). These findings suggest that the inhibition of DNA methylation might be a target for treating cognitive dysfunction. EGCG has been reported to modulate DNA methylation by attenuating the effects of DNA methyltransferase (DNMT), especially DNMT1 (Lee et al., 2005; Yiannakopoulou, 2015). However, it has not yet been clearly elucidated whether other catechin derivatives also have potential effects on DNMT1 activity. In a preliminary study, we noticed that GCG, the corresponding iso-epimer of EGCG, exhibited more potent inhibitory activity on DNMT1 than EGCG. Interestingly, a heat-treated green tea extract with high amounts of GCG markedly inhibited DNMT1 in an in vitro study, suggesting that heat-induced changes in the chemical constituents of green tea extract could exert positive effects on cognitive function if its DNMT1 activity could be also found in in vivo. Regarding the findings on neuronal outgrowth and DNA methylation, heat-treated green tea extract with high amounts of GCG may induce positive effects on cognitive function. We attempted to prepare a modified green tea extract containing high amounts of GCG, an iso-epimer of EGCG, and obtained a high temperature processed-green tea extract (HTP-GTE), which contained an approximately 6-fold higher concentration of GCG than the fresh green tea leaf extract (GTE). In the present study, we investigated whether HTP-GTE and its phytochemicals enhance neuronal differentiation and modulate epigenetic changes in vitro and in vivo. Thereafter, we examined whether HTP-GTE ameliorates cognitive dysfunction induced by the cholinergic blockade as measured by the Ymaze test and the passive avoidance test. In addition, we examined whether HTP-GTE affects acetylcholinesterase activity. 2.2. Materials All chemicals except the tea-related compounds were procured from Sigma Chemical Co. (St. Louis, MO). EGCG, GCG, and the other chemicals for standardization of the green tea extract were procured from Wako Pure Chemicals (Osaka, Japan). SH-SY5Y neuroblastoma cells were procured from the Korean Cell Line Bank (Seoul, Korea). Dulbecco's modified Eagle's medium/nutrient mixture F-12 (DMEM/F12) and fetal bovine serum (FBS) were obtained from GIBCO (Waltham, MA) and HyClone (Logan, UT). The EpiQuik DNMT1 activity assay kit was purchased from EpiGentek (Brooklyn, NY). The Nunc™ Lab-Tek™ II CC2™ Chamber Slide was obtained from Nunc (Waltham, MA; Lot No., 154852). Rabbit polyclonal anti-microtubule-associated protein 2 (MAP2) and the rabbit polyclonal anti-synaptophysin antibodies were procured from Abcam (Cambridge, MA) and the anti-β-actin antibody was obtained from Santa Cruz Biotechnology, Inc. (Santa Cruz, CA). The RNeasy mini kit for RNA and QIAamp DNA Mini kit for DNA extraction was purchased from Quiagen (Germantown, MD). The SuperScript VILO Master Mix for complementary DNA (cDNA) synthesis, TOPO TA cloning kit, Alexa Fluor 594-conjugated goat anti-rabbit and Alexa Fluor 488-conjugated goat anti-rabbit antibodies were obtained from Invitrogen (Carlsbad, CA). TaqMan universal master mix and TaqMan probes for qPCR were purchased from Applied Biosystems (Foster City, CA). An acetylcholinesterase inhibitor screening kit (QuantiChrom™) was obtained from BioAssay Systems (Hayward, CA). All drugs were freshly prepared before each test. Donepezil and scopolamine were dissolved in 0.9% saline solution. HTP-GTE was dissolved in 10% Tween 80 solution. 2.3. Preparation of HTP-GTE The HTP-GTE was prepared and provided by Amorepacific R&D Unit (Gyeonggi-do, Korea). In brief, the green tea leaves (Camellia sinensis L., Theaceae, CS) were obtained in the spring from Osulloc Tea Garden on Jeju Island, Korea. The specimen was kept in the herbarium of the Amorepacific R&D Unit (specimen No. HTP-GTE171221). The dried CS leaves were extracted two times with 50% aqueous ethanol at 60 °C for 3 h. The extract was decaffeinated by filtration with activated carbon and incubated at 100 °C (1.2 atm) under aqueous conditions for 5 h to obtain the HTP-GTE. After heat treatment (100 °C), the HTP-GTE was concentrated with a rotary evaporator (Buchi R200, Flawil, Switzerland) under vacuum and stored in a refrigerator (−20 °C) prior to HPLC analysis (yield, 23.2%). To obtain the green tea extract (GTE), green tea leaves were extracted with 50% aqueous ethanol and obtained as described above, without incubation at high temperature and pressure for 5 h (yield, 20%). For quality assurance, the final HTP-GTE was standardized according to the total catechins [sum of 8 catechins: EGCG, GCG, (−)-epigallocatechin (EGC), (−)-gallocatechin (GC), (−)-epicatechin 3-O-gallate (ECG), (+)-catechin 3-O-gallate (Sun et al.), (−)-epicatechin (EC), and catechin (C)], EGCG and GCG based on high-performance liquid chromatography (HPLC)-PDA (Alliance 2695 system, Waters) using a Thermo Syncronis C18 column (250 × 4.6 mm, I.D. of 5 μm; Thermo Fisher Scientific Inc.) (Fig. 1). The contents of the total catechins and marker compounds (EGCG and GCG) in the final HTPGTE were 247.8 ± 1.6 mg/g, 58.6 ± 0.1 mg/g, and 59.0 ± 0.8 mg/ g (n = 3), respectively. 2. Materials and Methods 2.1. Animals Five-week-old male ICR mice (25–27 g) were purchased from Orient Bio (Gyeonggi-do, Korea) and acclimated for one week before each experiment. Mice were provided food and water ad libitum in a room with constant temperature (23 ± 1 °C) and humidity (60 ± 10%). The room was maintained on a 12-h light/dark cycle. We used a total of 196 mice in the experiments (n = 10 per each group in open filed test, Y-maze test and passive avoidance test; n = 6 per each group in the Western blot). Each of all mice was randomly allocated for one experiment. All animal experiments were performed in agreement with the Animal Care and Use Guidelines published by Kyung Hee University, Republic of Korea. All protocols using animals were approved by the Institutional Animal Care and Use Committee (KHUASP (SE)-18-046). 2 Journal of Ethnopharmacology 258 (2020) 112923 H.J. Bae, et al. Fig. 1. The representative HPLC chromatogram of catechin compounds in high-temperature-processed green tea extract (HTP-GTE). HTP-GTE was standardized using reverse-phase high-performance liquid chromatography (HPLC)-PDA (Alliance 2695 system, Waters) system. Separation was carried out using a Thermo Syncronis C18 column (250 × 4.6 mm, I.D., 5 μm; Thermo Fisher Scientific Inc.). The mobile phases were 0.1% acetic acid in water for solvent A and acetonitrile for solvent B. The gradient elution was 90% A + 10% B at 0–10 min, 85% A + 15% B at 10–30 min, 80% A + 20% B at 30–53 min, 5% A + 95% B at 53–55 min, 90% A + 10% B at 55–60 min with a flow rate of 1.0 mL/min. The injection volume of sample was 20 μl, and the wavelength of UV was 280 nm. Each peak was named by corresponding compound obtained by standard curve. EGCG, (−)-epigallocatechin 3-O-gallate; GCG, (−)-gallocatechin 3-O-gallate; EGC, (−)-epigallocatechin; GC, (−)-gallocatechin; ECG, (−)-epicatechin 3-O-gallate; CG, (+)-catechin 3-O-gallate; EC, (−)-epicatechin; C, catechin. (For interpretation of the references to colour in this figure legend, the reader is referred to the Web version of this article.) for 15 min, and incubated in 0.1% Triton X-100 with PBS for 5 min. Then, the cells were stained with an anti-MAP2 or anti-synaptophysin antibody (1:200 each) diluted in 10% goat serum in 0.1% Triton X-100 with PBS overnight at 4 °C. Secondary antibodies (Alexa Fluor 594conjugated goat anti-rabbit or Alexa Fluor 488-conjugated goat antirabbit antibody) were added for 1 h at room temperature. After the washing process, the coverslips were mounted onto glass slides and visualized with a confocal laser scanning microscope (LSM710, Carl Zeiss, NY). 2.4. Cell culture and treatments The neuroblastoma cells (SH-SY5Y cell line) were grown in Dulbecco's modified Eagle's medium/nutrient mixture F-12 (DMEM/F12, GIBCO) supplemented with penicillin (100 units/ml), streptomycin (100 μg/ml), and 10% FBS at 37 °C in a saturated humidity atmosphere containing 95% air and 5% CO2. Cells were seeded at an initial density of 104 cells/cm2 per well in 6-well cell culture plates (Corning, NY). After 1 day, the media were replaced with DMEM/F-12 containing 3% FBS and all-trans-retinoic acid (RA) at a final concentration of 10 μM for 7 days to induce differentiation. The cells were treated with an extract (HTP-GTE or GTE, 10 μg/ml each), catechin (GCG or EGCG, 1 μM each), or RG108 (10 μM, a nonnucleoside small-molecule DNMT inhibitor (Lyko and Brown, 2005)) during differentiation. Neurite outgrowth analysis was performed as described previously (Kim and Yoo, 2016). Briefly, the neurite length was determined by manually measuring the images taken from a phase-contrast microscope using Image J (NIH, Bethesda, MD). SH-SY5Y cells were plated onto a Nunc™ Lab-Tek™ II CC2™ Chamber Slide (Nunc, Waltham, MA; 154852) and were differentiated for 7 days. The cells were fixed with 4% paraformaldehyde in phosphate-buffered saline (PBS) overnight at 4 °C and then washed with PBS. In total, length of 50 neurites were evaluated for each group. 2.7. RNA extraction and real-time quantitative PCR To verify the effects of HTP-GTE on neuronal differentiation, HTPGTE was dissolved in DMSO and added to the culture medium to the indicated final concentration with all-trans RA (10 μM) for 7 days. After 7 days of HTP-GTE and RA treatment, the cells were harvested, and the total RNA from the cells was prepared with an RNeasy mini kit. One microgram of total RNA was used to synthesize complementary DNA (cDNA) using SuperScript VILO Master Mix. Approximately 1 μg of cDNA samples and each TaqMan probe were diluted in the TaqMan universal master mix. PCR was performed on a 7500 real-time PCR system (Thermo Fisher Scientific, Waltham, MA). After the completion of PCR, the amount of mRNA was calculated by the comparative CT method. TaqMan probes for qPCR (Applied Biosystems) were synaptophysin and glyceraldehyde-3-phosphate dehydrogenase (GAPDH) (probe identifications are as follows: Hs00300531_m1, synaptophysin; 4326317E, GAPDH). 2.5. DNMT1 activity assay The DNMT1 activity level was measured by an EpiQuik DNA methyltransferase 1 activity assay kit according to the manufacturer's guidelines. In brief, SH-SY5Y cells were treated with an extract (HTPGTE or GTE, 10 μg/ml each) or catechin (GCG or EGCG, 1 μM each), respectively. RG108 (10 μM) was used as a positive control. The results were obtained using a microplate reader (Tecan, Salzburg, Austria) at 450 nm. 2.8. Genomic DNA purification and bisulfite sequencing DNA was isolated using the QIAamp DNA Mini kit. Bisulfite conversion was conducted using the EpiTect bisulfite kit. Converted DNA was amplified by PCR using primers designed with Methprimer software (www.urogene.org/methprimer/index.html). The sequences of primers were as follows: forward, GGAATAAATAGGTAAAGTGG; and reverse, CCGGGGAGAGGAGACCTCCC. PCR products were cloned into bacteria using the TOPO TA cloning kit, and 15 clones for each sample were sequenced by COSMO Genetech (Seoul, Korea). 2.6. Immunofluorescence SH-SY5Y cells were differentiated with 10 μM RA and each agent for 7 days. The cells were washed with PBS, fixed in 4% paraformaldehyde 3 Journal of Ethnopharmacology 258 (2020) 112923 H.J. Bae, et al. guillotine door (5 × 5 cm) as described elsewhere (Kim et al., 2009). Both chambers were identical in size (20 × 20 × 20 cm) and contained a metal grid-floor for electrical foot shock. The drug administration schedule for the passive avoidance test was the same as in the Y-maze test. For an acquisition trial, the mouse was gently placed in the illuminated compartment, and the guillotine door was opened 10 s later. When the mouse entered the dark compartment, the guillotine door automatically closed, and the mouse received an electrical foot shock (0.5 mA, 3 s). The time at which the mouse entered the dark compartment from the illuminated compartment was measured as the latency time. If the mouse did not move into the dark compartment within 60 s, the mouse was gently introduced into the dark chamber, and the latency time was recorded as 60 s. We performed the retention trial 24 h after the acquisition trial. We placed the mouse in the illuminated chamber again and recorded the time taken to enter the dark compartment for each mouse. If the mouse did not enter the dark compartment within 300 s, it was considered that the mouse remembered the electrical foot shock from the acquisition trial and the latency was recorded as 300 s. 2.9. Western blot Mice were administered each drug for 10 days. Thirty minutes after the last administration of either HTP-GTE (30, 100, or 300 mg/kg) or donepezil (5 mg/kg), the mice were treated with scopolamine (1 mg/ kg, i.p.). The control group received 0.9% saline solution rather than HTP-GTE or donepezil. The mice were sacrificed 30 min after scopolamine treatment for Western blot analysis. The isolated hippocampal tissues were homogenized and the homogenates (20 μg of total protein) were analyzed by SDS-PAGE (12% gel) under reducing conditions, as described elsewhere (Kim et al., 2009). The separated protein mixtures were moved onto PVDF membranes in transfer buffer at 400 mA for 2 h at 4 °C. After blocking with skim milk (5%), the membranes were incubated with anti-synaptophysin (1:2000), or anti-β-actin (1:5000) antibodies overnight at 4 °C. Then, the membranes were incubated with a secondary antibody labeled with horseradish peroxidase at proper dilution (1:5000) for 2 h. During each step, the membranes were washed with Tris-buffered saline/Tween 20. Finally, the membranes were developed with enhanced chemiluminescence (Amersham Life Science, Arlington Heights, IL). The images were scanned using the LAS-4000 mini bio-imaging program (Fujifilm Lifescience USA, Stamford, CT). The densitometric analysis of immunoreactive bands was performed using Image J Software (NIH, Bethesda, MD). 2.13. Statistical analysis All data were presented as the mean ± standard error of the mean (S.E.M.). A one-way analysis of variance (ANOVA) was used to analyze all presented data. For multiple comparisons, the Student-NewmanKeuls test was used. Data from the distance traveled with a 5 min interval of the open field task were analyzed by two-way ANOVA followed by Bonferroni's post hoc test. Statistical significance was set to p < 0.05. For in vitro data were evaluated after confirming that the data met appropriate assumptions (normality, homogeneity of variance, and independent sampling). 2.10. Open field test To examine whether HTP-GTE stimulates spontaneous locomotor behavior, we conducted an open field test. Mice were administered with each drug for 10 days, and the last administration of HTP-GTE (30, 100, or 300 mg/kg) or vehicle was terminated 1 h before the test. Mice were placed in the middle of the black square open field box (w × d × h: 41.5 × 41.5 × 41.5 cm) equipped with the video-based Ethovision system (Noldus, Wageningen, The Netherlands) and recorded for 30 min. The movement of mice was tracked, and the total distance moved was calculated using EthoVision 3.1 (Noldus, Netherlands) to evaluate the horizontal locomotor activity. After each trial, the apparatus was cleaned with 70% ethanol spray to remove any odors or residues. 3. Results 3.1. The effects of the tea extracts or catechins on neuronal differentiation Changes in neurogenesis appear to be a common feature in various neurodegenerative diseases including AD (He and Shen, 2009; Mu and Gage, 2011). To test whether each tea extract modulates neuronal differentiation, HTP-GTE (10 μg/ml) or GTE (10 μg/ml) was treated to the SH-SY5Y cells with RA. GTE was used as a reference agent. EGCG or its iso-epimer, GCG (1 μM each), was also added to the cells. RG108 (10 μM) was used as a positive control (Fig. 2A). There were significant differences between each treated group in neurite length [F (5, 294) = 36.33, Fig. 2B]. As shown in Fig. 2B, HTP-GTE enhanced the neurite length in SH-SY5Y cells (p < 0.05). Similar results were also observed in the GCG- or RG108-treated groups (p < 0.05). However, EGCG and GTE significantly shortened the neurite length compared to the control (p < 0.05). In addition, the differentiated neurons also expressed the well-known neuronal marker, MAP2 (Fig. 2C). These results suggest that HTP-GTE and GCG promote neuronal differentiation and neurite outgrowth, as observed in RG108. 2.11. Y-maze test The horizontal Y-maze is constructed with three dark opaque polyvinyl plastic arms (40 × 3 × 12 cm) that are symmetrically disposed at 120° angles from each other, as described elsewhere (Ko et al., 2015). One hour before the test, the last administration of either HTPGTE (30, 100, or 300 mg/kg) or donepezil (5 mg/kg) was terminated. The control group received vehicle solution rather than HTP-GTE or donepezil. Scopolamine (1 mg/kg, i.p.) was used for inducing memory impairment. Each mouse was initially placed in one arm, and the sequence of arm entry (i.e., ABCCAB, etc.) was recorded over 8 min by video camera-based EthoVision system (Noldus, Netherlands). The water spray was used to remove any residual odors and residues in the Y-maze arms between each test. An actual alternation was defined as an entry into all three arms on consecutive choices (i.e., ABC, BAC or CAB but not BCC or CCA). The analysis of actual alternation was manually conducted by a person who was blind to the treatment. We defined the alternation score (%) for each mouse as the ratio of the number of actual alternations to the possible number of alternations (defined as the total number of arm entries minus two) multiplied by 100, as shown by the following equation: % alternation = [(number of alternations)/ (total arm entry numbers – 2)] × 100. 3.2. The effect of tea extracts or catechins on DNMT1 activity It has been reported that neuronal differentiation is regulated by DNA methylation (Hsieh and Gage, 2004). Therefore, to investigate which tea extract among HTP-GTE or GTE actively modulates DNMT1 activity, we tested the inhibitory ability of HTP-GTE and GTE on the DNMT1 enzymatic activity. In addition, we also measured the inhibitory activity of catechins (EGCG and GCG) on DNMT1 activity. As shown in Fig. 3, HTP-GTE considerably inhibited DNMT1 activity [F (5, 12) = 140.4, p < 0.05]. Furthermore, the inhibitory effect of HTPGTE was more potent than that of GTE. In addition, GCG, the major catechin of HTP-GTE, suppressed DNMT1 activity as observed in RG108, whereas EGCG, the major catechin of GTE, did not influence 2.12. Passive avoidance test The passive avoidance apparatus consisted of an illuminated chamber (50-W bulb) connected to a dark chamber divided into a 4 Journal of Ethnopharmacology 258 (2020) 112923 H.J. Bae, et al. Fig. 2. The effect of catechins and green tea extract on neuronal differentiation and outgrowth of SHSY5Y. (A) Microscopic view of differentiated SHSY5Y cells and (B) quantification of neurite length were presented. (C) Representative image of differentiated SH-SY5Y cells immunolabeled with antiMAP2 antibody was presented. Anti-MAP2 staining (El-Husseini et al.) was used to identify mature neurons and saw neurite outgrowth, and DAPI staining (blue) was used to label all nuclei. All-transretinoic acid (RA, 10 μM) was used to induce differentiation. Data represent the mean ± S.E.M. of three independent experiments. *P < 0.05, ***P < 0.001 (compared to the control group, oneway ANOVA, Student-Newman-Keuls test). The bar in A, 50 μm; The bar in C, 20 μm. CON, control; HTPGTE, high-temperature-processed green tea extract; GTE, green tea extract; GCG, (−)-gallocatechin 3-Ogallate; EGCG, (−)-epigallocatechin 3-O-gallate. (For interpretation of the references to colour in this figure legend, the reader is referred to the Web version of this article.) 3.3. HTP-GTE regulates the expression level of synaptophysin Synaptophysin, a synaptic vesicle protein, is used as a marker for synaptic integrity (Markakis and Gage, 1999) (Sun et al., 2007) and is involved in synaptic plasticity changes (Janz et al., 1999; Wiedenmann et al., 1986). Furthermore, it is also known that the level of synaptophysin is inversely correlated with memory impairment (Schmitt et al., 2009; Smith et al., 2000). In SH-SY5Y cells, there were significant differences in synaptophysin levels between each group [F (2, 9) = 27.53, p < 0.05]. By the administration of HTP-GTE, the synaptophysin expression was markedly increased, as observed in RG108 (p < 0.05, Fig. 4A and B). 3.4. The effects of HTP-GTE on locomotor behavior To examine whether HTP-GTE affects locomotor activity and/or anxiety–like behaviors, we investigated the effect of HTP-GTE on locomotor activity using the open-field test in mice. There were no significant changes in the total distance moved between each treatment group [F (3, 36) = 0.51, p > 0.05, Fig. 5A]. Similarly, the distance moved every 5 min for 30 min was not changed after each drug administration [F (5, 216) = 0.67, p > 0.05, Fig. 5B]. These results suggested that HTP-GTE did not exert any stimulatory activity on locomotor behavior. Fig. 3. The effect of catechins and green tea extracts on DNMT1 activity. The enzyme activity was performed as described in the Materials and Methods section. Data represent the mean ± S.E.M. (n = 4/group). *P < 0.05, ***P < 0.001 (compared to the control group, one-way ANOVA, StudentNewman-Keuls test). CON, control; HTP-GTE, high-temperature-processed green tea extract; GTE, green tea extract; GCG, (−)-gallocatechin 3-O-gallate; EGCG, (−)-epigallocatechin 3-O-gallate. (For interpretation of the references to colour in this figure legend, the reader is referred to the Web version of this article.) 3.5. The effects of HTP-GTE on working and long-term memory DNMT1 activity. These findings, that HTP-GTE more efficiently inhibits DNMT1 activity than GTE, might be derived from the higher levels of GCG in HTP-GTE. Therefore, we adopted HTP-GTE hereafter and explored its effects on synaptic protein and cognitive function. The passive avoidance test and the Y-maze test were employed to examine the effect of HTP-GTE on spatial working and long-term memory. In the Y-maze test, there were significant differences between groups in spontaneous alternation [F (5, 54) = 7.644, p < 0.05, Fig. 6A]. HTP-GTE (30, 100, or 300 mg/kg) markedly increased 5 Journal of Ethnopharmacology 258 (2020) 112923 H.J. Bae, et al. Fig. 4. The effect of the high-temperature-processed green tea extract (HTP-GTE) on synaptic protein in differentiated SH-SY5Y cells. (A) Alterations in the expression level of synaptophysin determined by real-time PCR were presented. Each mRNA level was normalized to that of GAPDH. Data represent the mean ± S.E.M. (n = 4/group). (B) Differentiated neurons with all-trans-retinoic acid (RA) immunostained for nuclei (DAPI, blue) and synaptophysin (green) were presented. The bar in B, 20 μm ***P < 0.001 (compared to the control group, oneway ANOVA, Student-Newman-Keuls test). Con, control. (For interpretation of the references to colour in this figure legend, the reader is referred to the Web version of this article.) Fig. 5. The effect of the high-temperature-processed green tea extract (HTPGTE) on spontaneous locomotor behavior. Horizontal locomotor activity was measured using the open field test during 30 min. HTP-GTE (30, 100 and 300 mg/kg, p.o.) was administered for 10 days. (A) Total distance traveled for 30 min and (B) distance traveled with 10 min interval were presented. Data represent means ± S.E.M (n = 10/group). CON, control; n.s., not significant (one-way ANOVA). (For interpretation of the references to colour in this figure legend, the reader is referred to the Web version of this article.) Fig. 6. The effects of the high-temperature-processed green tea extract (HTPGTE) on scopolamime-induced memory deficits in the Y-maze task (A) and in the passive avoidance test (B). HTP-GTE (30, 100 and 300 mg/kg, p.o.) was administered for 10 days. Data represent means ± S.E.M (n = 10/group). *Significantly different from the vehicle control group (P < 0.05, one-way ANOVA, Student-Newman-Keuls test). # Significantly different from the scopolamine only treated group (p < 0.05, one-way ANOVA, Student-NewmanKeuls test). CON, control; DNZ, donepezil. (For interpretation of the references to colour in this figure legend, the reader is referred to the Web version of this article.) spontaneous alternation behavior compared to the vehicle-treated control group, as was observed in the donepezil-treated group (p < 0.05). Furthermore, in the acquisition trial of the passive avoidance test, there were no significant differences in the step-through latency between groups [F (4, 45) = 1.060, p > 0.05, Fig. 6B]. In the retention trial, the step-through latency was significantly different between the groups [F (4, 45) = 114.5, p < 0.05, Fig. 6B]. Interestingly, HTP-GTE (30, 100, 300 mg/kg) administration significantly reversed the reduced step-through latency induced by scopolamine administration (p < 0.05). Similar results were also observed in the donepeziltreated group (p < 0.05). Taken together, these results indicate that the administration of HTP-GTE can ameliorate scopolamine-induced working and long-term memory impairment. 3.6. HTP-GTE increases synaptophysin expression levels and modulates DNA methylation at the synaptophysin promoter To examine whether the increased expression levels found in vitro are similarly observed in vivo or not, we investigated the effects of HTPGTE on the synaptophysin expression levels in mice. There were 6 Journal of Ethnopharmacology 258 (2020) 112923 H.J. Bae, et al. Fig. 7. The protein expression of synaptophysin in the hippocampus of scopolamine-induced memory deficit mice. The high-temperature-processed green tea extract (HTP-GTE) (30, 100, 300 mg/kg) was administration for 10 days. (A) The immunoreactivity and (B) quantitative analysis of protein were presented. The densitometric analysis of ratios of protein level/actin was normalized to the control group. Data represent the mean ± S.E.M. (n = 6/group). # Significantly different from the scopolamine only treated group (P < 0.05, one-way ANOVA, Student-Newman-Keuls test). CON, control; DNZ, donepezil. (For interpretation of the references to colour in this figure legend, the reader is referred to the Web version of this article.) high contents of catechin epimers, resulting in almost the same amount of catechins and their epimers, with content close to that of green tea beverages. Neurons are characterized by multiple protrusions called neurites, which are essential for polarity through their differentiation into dendrites and axons, and express neuronal markers, including the cytoskeletons (MAP2, neuron filament, etc.) and synaptic vesicle proteins, which are involved in neuronal plasticity (synaptophysin, synaptotagmin, etc.) (El-Husseini et al., 2000; Kwon and Chapman, 2011; Soltani et al., 2005; Trojanowski et al., 1986). In addition, alterations in neurogenesis appear to be a common hallmark not only in different neurodegenerative diseases, such as AD, PD, and Huntington's disease, but also in higher brain functions including learning and memory formation (Mu and Gage, 2011; Steiner et al., 2006; Winner et al., 2011). In the present study, we observed that HTP-GTE and its active catechin, GCG, potentiated neuronal differentiation, but GTE and its major active catechin, EGCG, did not. Furthermore, in an in vitro DNMT1 activity study, we also observed that HTP-GTE is more potent than GTE. It has been reported that DNMT1, which is responsible for establishing de novo genomic DNA methylation patterns, is markedly increased in scopolamine-induced amnesic mice (Singh et al., 2015). These in vitro studies suggest that HTP-GTE rather than GTE or catechin congeners would induce beneficial roles in synaptic plasticity or cognitive functions. However, it has been suggested that GTE or EGCG also promotes neuronal differentiation, which is inconsistent with our data. One study showed that unfractionated green tea polyphenols or their major component, EGCG, influence neurite outgrowth in PC12 cells (Gundimeda et al., 2014). In another study, EGCG treatment at concentrations below 1 μM also promoted neuronal differentiation of adult hippocampal precursor cells in vitro (Ortiz-Lopez et al., 2016). One possible explanation for these discrepancies is differences in the experimental conditions, such as the concentration of catechins (< 0.5 μM vs. 1 μM), and the cell lines used for neuronal differentiation (PC12 cells vs. SH-SY5Y). The neuronal differentiation of SH-SY5Y cells induced by RA treatment might be triggered through different signaling pathways, which are regulated by the MYCN transcription factor (Das et al., 2010) and might be enhanced by HTP-GTE and GCG, but might also be inhibited by GTE or EGCG. How this is regulated by catechins will be an issue to consider in further studies. Synaptophysin is an abundant integral membrane glycoprotein that is present in presynaptic vesicles and is involved in the release of neurotransmitters (Rehm et al., 1986; Wiedenmann et al., 1986). Synaptophysin is used as a functionally mature neuronal marker and is associated with the regulation of synapse formation and long-term potentiation (Cheung et al., 2009). The loss of synaptophysin induces cognitive impairment, and the recovery of synaptophysin enhances memory performance (Imbimbo et al., 2010; Sze et al., 1997). In addition, lower levels of synaptophysin were found in the postmortem brains of dementia patients (Mukaetova-Ladinska et al., 2013). In the present study, HTP-GTE and GCG appeared to efficiently enhance the expression of synaptophysin levels in differentiated cells, and HTP-GTE significant changes in the expression level of synaptophysin in the hippocampus [F (5, 30) = 5.814, p < 0.05, Fig. 7]. The level of synaptophysin expression after the administration of HTP-GTE increased in a dose-dependent manner (p < 0.05). A similar result was also observed in the donepezil-treated group (Fig. 7). Recently, it has been reported that DNA methylation at the synaptophysin promoter is increased in the postmortem brains of AD patients (Rao et al., 2012) and is involved in synaptophysin gene expression (Fan et al., 2020). Given the previous observations, we tested alterations of DNA methylation levels at the synaptophysin promoter in the hippocampus of the scopolamine-induced memory-impaired mouse model. As shown in Fig. 8, the methylation rate in the specific region of the synaptophysin promoter was significantly changed between groups [F (2, 15) = 42.29, p < 0.05]. DNA methylation at the synaptophysin promoter was markedly increased in the scopolamine-treated mouse hippocampus (p < 0.05). Such increased DNA methylation at the synaptophysin promoter was reduced to the control level by the administration of HTP-GTE (p < 0.05). These results support the possibility that the enhanced synaptophysin expression and decreased DNA methylation levels at the synaptophysin promoter would play a role in the cognitive function of HTP-GTE. 4. Discussion This study investigated the effect of HTP-GTE, which contains equivalent amounts of epicatechins and catechins, on neuronal differentiation in SH-SY5Y cells and scopolamine-induced cognitive dysfunction in mice. HTP-GTE enhanced neuronal differentiation in SHSY5Y cells and prevented the scopolamine-induced alterations in the DNA methylation status at the synaptophysin promoter-associated CpG island via the inhibition of DNMT1 activity. HTP-GTE also ameliorated scopolamine-induced memory impairment in mice, as observed in the Y-maze and the passive avoidance tests. These observations suggested that HTP-GTE might be a possible anti-amnesic treatment for memory impairment. Green tea is not only a widely consumed beverage in the world, but it is also known as a medicinal herb (Graham, 1992). In addition, drinking green tea has been reported to have a therapeutic effect against cognitive impairment (Feng et al., 2010; Kuriyama et al., 2006; Tomata et al., 2012). However, most studies on the relationship between tea consumption and cognitive function are epidemiological studies (green tea as a drink), not interventional studies (green tea as a supplement) (Ma et al., 2016). Green tea contains lots of polyphenolic compounds, and research has focused on tea catechins. However, tea catechins undergo epimerization during tea brewing, and catechin epimers are known to have different biological activities compared to the original catechins, such as anti-hypercholesterolemic, anti-allergic, antioxidant activities, or anti-amyloidogenic effects on fibril formation (Ikeda et al., 2003). Therefore, we developed a green tea extract containing high amounts of catechin epimers termed HTP-GTE. The characteristics of HTP-GTE compared with those of green tea extract are the 7 Journal of Ethnopharmacology 258 (2020) 112923 H.J. Bae, et al. Fig. 8. The effect of high-temperature-processed green tea extract (HTP-GTE) on CpG methylation of synaptophysin in the hippocampus of scopolamineinduced memory deficit mice. HTP-GTE (300 mg/kg, p.o.) was administered for 10 days. Control group was treated with vehicle solution. Scopolamine only treated group (1 mg/kg, i.p.) was also prepared. (A) Schematic illustration of syanptophysin including the CpG island. (B) Bisulfite sequencing analysis of four CpG sites within synaptophysin in the hippocampus. (C) Quantification of DNA methylation at four CpG sites, as determined by bisulfite sequencing in the hippocampus. Data represent the mean ± S.E.M. (n = 6/group). *Significantly different from the vehicle-treated control group (p < 0.05, one-way ANOVA, Student-Newman-Keuls test). #Significantly different from the scopolamine only treated group (P < 0.05, one-way ANOVA, Student-NewmanKeuls test). CON, control; SCO, scopolamine. (For interpretation of the references to colour in this figure legend, the reader is referred to the Web version of this article.) effect of HTP-GTE on acetylcholinesterase activity in vitro and ex vivo (Supplementary Fig. S2). HTP-GTE had an inhibitory effect on acetylcholinesterase activity in vitro and ex vivo, as was also observed by others (Kaur et al., 2008; Soares et al., 2019). These results suggest that HTP-GTE alleviates cognitive impairment related to working or longterm memory through the changes in synaptic functions, including the synaptophysin expression or DNA methylation, and also partly by modulating the cholinergic neurotransmitter system. increased hippocampal synaptophysin levels in mice. In addition, HTPGTE administration ameliorated DNA hypermethylation at the synaptophysin promoter. Additionally, CpG island hypermethylation at the synaptophysin promoter has been observed in brain samples from AD patients (Rao et al., 2012). These results suggested that HTP-GTE could bring memory ameliorating activity through enhanced neuronal differentiation, increased expression of synaptophysin, and inhibition of DNA methylation on the synaptophysin promoter. In the present study, we observed that HTP-GTE ameliorated spontaneous alterations in the Y-maze test. HTP-GTE also significantly reversed the reduction in the latency caused by scopolamine during the retention trial measured by the passive avoidance test. In addition, the administration of HTP-GTE or GTE alleviated scopolamine-induced long-term memory impairment, and HTP-GTE exhibited greater efficacy than GTE (Supplementary Fig. S1). It is well known that cholinergic system abnormalities are correlated with cognitive symptoms in AD patients (Tabet, 2006; Wenk, 2003). Therefore, we also measured the 5. Conclusion In the present study, we found that HTP-GTE exerts beneficial effects on learning and memory processes in mice with scopolamine-induced memory impairment. The ameliorating function of HTP-GTE might be, at least in part, derived from its action on synaptic plasticity via the upregulation of synaptophysin levels and the downregulation of DNA methylation on the synaptophysin promoter region. Therefore, 8 Journal of Ethnopharmacology 258 (2020) 112923 H.J. Bae, et al. HTP-GTE would be a valuable novel approach for treating cognitive impairment observed in cholinergic dysfunction states, such as AD. peroxide. Biochem. Biophys. Res. Commun. 445 (1), 218–224. He, P., Shen, Y., 2009. Interruption of beta-catenin signaling reduces neurogenesis in Alzheimer's disease. J. Neurosci. 29 (20), 6545–6557. Heo, J., 2005. Dongui Bogam. Dongui Bogam Publisher Co., GyeongNam, Republic of Korea, pp. 2231. Higdon, J.V., Frei, B., 2003. Tea catechins and polyphenols: health effects, metabolism, and antioxidant functions. Crit. Rev. Food Sci. Nutr. 43 (1), 89–143. Hsieh, J., Gage, F.H., 2004. Epigenetic control of neural stem cell fate. Curr. Opin. Genet. Dev. 14 (5), 461–469. Ikeda, I., Kobayashi, M., Hamada, T., Tsuda, K., Goto, H., Imaizumi, K., Nozawa, A., Sugimoto, A., Kakuda, T., 2003. Heat-epimerized tea catechins rich in gallocatechin gallate and catechin gallate are more effective to inhibit cholesterol absorption than tea catechins rich in epigallocatechin gallate and epicatechin gallate. J. Agric. Food Chem. 51 (25), 7303–7307. Imbimbo, B.P., Giardino, L., Sivilia, S., Giuliani, A., Gusciglio, M., Pietrini, V., Del Giudice, E., D'Arrigo, A., Leon, A., Villetti, G., Calza, L., 2010. CHF5074, a novel gamma-secretase modulator, restores hippocampal neurogenesis potential and reverses contextual memory deficit in a transgenic mouse model of Alzheimer's disease. J Alzheimers Dis 20 (1), 159–173. Janz, R., Sudhof, T.C., Hammer, R.E., Unni, V., Siegelbaum, S.A., Bolshakov, V.Y., 1999. Essential roles in synaptic plasticity for synaptogyrin I and synaptophysin I. Neuron 24 (3), 687–700. Jia, N., Han, K., Kong, J.J., Zhang, X.M., Sha, S., Ren, G.R., Cao, Y.P., 2013. (-)-Epigallocatechin-3-gallate alleviates spatial memory impairment in APP/PS1 mice by restoring IRS-1 signaling defects in the hippocampus. Mol. Cell. Biochem. 380 (1–2), 211–218. Kaur, T., Pathak, C.M., Pandhi, P., Khanduja, K.L., 2008. Effects of green tea extract on learning, memory, behavior and acetylcholinesterase activity in young and old male rats. Brain Cognit. 67 (1), 25–30. Kim, D.H., Kim, S., Jeon, S.J., Son, K.H., Lee, S., Yoon, B.H., Cheong, J.H., Ko, K.H., Ryu, J.H., 2009. Tanshinone I enhances learning and memory, and ameliorates memory impairment in mice via the extracellular signal-regulated kinase signalling pathway. Br. J. Pharmacol. 158 (4), 1131–1142. Kim, H.B., Yoo, B.S., 2016. Propolis inhibits neurite outgrowth in differentiating SH-SY5Y human neuroblastoma cells. Toxicol Res 32 (3), 239–243. Ko, S.Y., Lee, H.E., Park, S.J., Jeon, S.J., Kim, B., Gao, Q., Jang, D.S., Ryu, J.H., 2015. Spinosin, a C-glucosylflavone, from zizyphus jujuba var. spinosa ameliorates abeta142 oligomer-induced memory impairment in mice. Biomol Ther (Seoul) 23 (2), 156–164. Kuriyama, S., Hozawa, A., Ohmori, K., Shimazu, T., Matsui, T., Ebihara, S., Awata, S., Nagatomi, R., Arai, H., Tsuji, I., 2006. Green tea consumption and cognitive function: a cross-sectional study from the Tsurugaya Project 1. Am. J. Clin. Nutr. 83 (2), 355–361. Kwon, S.E., Chapman, E.R., 2011. Synaptophysin regulates the kinetics of synaptic vesicle endocytosis in central neurons. Neuron 70 (5), 847–854. Lee, W.J., Shim, J.Y., Zhu, B.T., 2005. Mechanisms for the inhibition of DNA methyltransferases by tea catechins and bioflavonoids. Mol. Pharmacol. 68 (4), 1018–1030. Levites, Y., Weinreb, O., Maor, G., Youdim, M.B., Mandel, S., 2001. Green tea polyphenol (-)-epigallocatechin-3-gallate prevents N-methyl-4-phenyl-1,2,3,6-tetrahydropyridine-induced dopaminergic neurodegeneration. J. Neurochem. 78 (5), 1073–1082. Lyko, F., Brown, R., 2005. DNA methyltransferase inhibitors and the development of epigenetic cancer therapies. J. Natl. Cancer Inst. 97 (20), 1498–1506. Ma, Q.P., Huang, C., Cui, Q.Y., Yang, D.J., Sun, K., Chen, X., Li, X.H., 2016. Meta-analysis of the association between tea intake and the risk of cognitive disorders. PloS One 11 (11), e0165861. Markakis, E.A., Gage, F.H., 1999. Adult-generated neurons in the dentate gyrus send axonal projections to field CA3 and are surrounded by synaptic vesicles. J. Comp. Neurol. 406 (4), 449–460. Mu, Y., Gage, F.H., 2011. Adult hippocampal neurogenesis and its role in Alzheimer's disease. Mol. Neurodegener. 6, 85. Mukaetova-Ladinska, E.B., Andras, A., Milne, J., Abdel-All, Z., Borr, I., Jaros, E., Perry, R.H., Honer, W.G., Cleghorn, A., Doherty, J., McIntosh, G., Perry, E.K., Kalaria, R.N., McKeith, I.G., 2013. Synaptic proteins and choline acetyltransferase loss in visual cortex in dementia with Lewy bodies. J. Neuropathol. Exp. Neurol. 72 (1), 53–60. Ortiz-Lopez, L., Marquez-Valadez, B., Gomez-Sanchez, A., Silva-Lucero, M.D., TorresPerez, M., Tellez-Ballesteros, R.I., Ichwan, M., Meraz-Rios, M.A., Kempermann, G., Ramirez-Rodriguez, G.B., 2016. Green tea compound epigallo-catechin-3-gallate (EGCG) increases neuronal survival in adult hippocampal neurogenesis in vivo and in vitro. Neuroscience 322, 208–220. Page, M., Pacico, N., Ourtioualous, S., Deprez, T., Koshibu, K., 2015. Procognitive compounds promote neurite outgrowth. Pharmacology 96 (3–4), 131–136. Rao, J.S., Keleshian, V.L., Klein, S., Rapoport, S.I., 2012. Epigenetic modifications in frontal cortex from Alzheimer's disease and bipolar disorder patients. Transl. Psychiatry 2, e132. Rehm, H., Wiedenmann, B., Betz, H., 1986. Molecular characterization of synaptophysin, a major calcium-binding protein of the synaptic vesicle membrane. EMBO J. 5 (3), 535–541. Rezai-Zadeh, K., Arendash, G.W., Hou, H., Fernandez, F., Jensen, M., Runfeldt, M., Shytle, R.D., Tan, J., 2008. Green tea epigallocatechin-3-gallate (EGCG) reduces beta-amyloid mediated cognitive impairment and modulates tau pathology in Alzheimer transgenic mice. Brain Res. 1214, 177–187. Rezai-Zadeh, K., Shytle, D., Sun, N., Mori, T., Hou, H., Jeanniton, D., Ehrhart, J., Townsend, K., Zeng, J., Morgan, D., Hardy, J., Town, T., Tan, J., 2005. Green tea epigallocatechin-3-gallate (EGCG) modulates amyloid precursor protein cleavage and reduces cerebral amyloidosis in Alzheimer transgenic mice. J. Neurosci. 25 (38), Authors’ contributions Ho Jung Bae and Jihyun Kim wrote the manuscript and performed the in vivo study. Se Jin Jeon and Kyung Ja Kwon performed the in vitro study. Jaehoon Kim and Nayeon Goo performed the Western blot analysis study. Yongwoo Jeong, Kyungnam Cho, and Mudan Cai analyzed the behavioral data. Seo Yun Jung performed the AChE activity assay. Jong Hoon Ryu designed the overall study, and wrote and edited the manuscript as a corresponding author. Declaration of competing interest None of the authors has any conflicts of interest regarding this study. Acknowledgement This research was supported by grants from the Mid-Career Researcher Program and the Medical Research Program through an NRF grant funded by the Ministry of Education, Science and Technology (MEST) (2018R1A2A2A05023165), the Medical Research Center Program through the National Research Foundation of Korea (NRF) funded by the Ministry of Science and ICT (NRF2017R1A5A2014768). HTP-GTE and GTE samples were obtained from the Amorepacific R&D Unit. We thank Mr. Darine Froy N. Mabunga (College of Medicine, Konkuk University, Republic of Korea) for constructive discussions on the manuscript and editorial input. Appendix A. Supplementary data Supplementary data to this article can be found online at https:// doi.org/10.1016/j.jep.2020.112923. References Blanco-Luquin, I., Altuna, M., Sanchez-Ruiz de Gordoa, J., Urdanoz-Casado, A., Roldan, M., Camara, M., Zelaya, V., Erro, M.E., Echavarri, C., Mendioroz, M., 2018. PLD3 epigenetic changes in the hippocampus of Alzheimer's disease. Clin. Epigenet. 10 (1), 116. Borrelli, E., Nestler, E.J., Allis, C.D., Sassone-Corsi, P., 2008. Decoding the epigenetic language of neuronal plasticity. Neuron 60 (6), 961–974. Chacko, S.M., Thambi, P.T., Kuttan, R., Nishigaki, I., 2010. Beneficial effects of green tea: a literature review. Chin. Med. 5, 13. Cheung, Y.T., Lau, W.K., Yu, M.S., Lai, C.S., Yeung, S.C., So, K.F., Chang, R.C., 2009. Effects of all-trans-retinoic acid on human SH-SY5Y neuroblastoma as in vitro model in neurotoxicity research. Neurotoxicology 30 (1), 127–135. Cooper, R., Morre, D.J., Morre, D.M., 2005. Medicinal benefits of green tea: Part I. Review of noncancer health benefits. J. Alternative Compl. Med. 11 (3), 521–528. Das, S., Foley, N., Bryan, K., Watters, K.M., Bray, I., Murphy, D.M., Buckley, P.G., Stallings, R.L., 2010. MicroRNA mediates DNA demethylation events triggered by retinoic acid during neuroblastoma cell differentiation. Canc. Res. 70 (20), 7874–7881. Du, K., Liu, M., Zhong, X., Yao, W., Xiao, Q., Wen, Q., Yang, B., Wei, M., 2018. Epigallocatechin gallate reduces amyloid beta-induced neurotoxicity via inhibiting endoplasmic reticulum stress-mediated apoptosis. Mol. Nutr. Food Res. 62 (8), e1700890. El-Husseini, A.E., Schnell, E., Chetkovich, D.M., Nicoll, R.A., Bredt, D.S., 2000. PSD-95 involvement in maturation of excitatory synapses. Science 290 (5495), 1364–1368. Fan, X.Y., Yang, J.Y., Dong, Y.X., Hou, Y., Liu, S., Wu, C.F., 2020. Oxytocin inhibits methamphetamine-associated learning and memory alterations by regulating DNA methylation at the Synaptophysin promoter. Addict Biol. 25, e12697. Feng, L., Gwee, X., Kua, E.H., Ng, T.P., 2010. Cognitive function and tea consumption in community dwelling older Chinese in Singapore. J. Nutr. Health Aging 14 (6), 433–438. Feng, Y., Jankovic, J., Wu, Y.C., 2015. Epigenetic mechanisms in Parkinson's disease. J. Neurol. Sci. 349 (1–2), 3–9. Graham, H.N., 1992. Green tea composition, consumption, and polyphenol chemistry. Prev. Med. 21 (3), 334–350. Gundimeda, U., McNeill, T.H., Fan, T.K., Deng, R., Rayudu, D., Chen, Z., Cadenas, E., Gopalakrishna, R., 2014. Green tea catechins potentiate the neuritogenic action of brain-derived neurotrophic factor: role of 67-kDa laminin receptor and hydrogen 9 Journal of Ethnopharmacology 258 (2020) 112923 H.J. Bae, et al. 204 (1), 264–272. Sze, C.I., Troncoso, J.C., Kawas, C., Mouton, P., Price, D.L., Martin, L.J., 1997. Loss of the presynaptic vesicle protein synaptophysin in hippocampus correlates with cognitive decline in Alzheimer disease. J. Neuropathol. Exp. Neurol. 56 (8), 933–944. Tabet, N., 2006. Acetylcholinesterase inhibitors for Alzheimer's disease: anti-inflammatories in acetylcholine clothing!. Age Ageing 35 (4), 336–338. Tomata, Y., Kakizaki, M., Nakaya, N., Tsuboya, T., Sone, T., Kuriyama, S., Hozawa, A., Tsuji, I., 2012. Green tea consumption and the risk of incident functional disability in elderly Japanese: the Ohsaki Cohort 2006 Study. Am. J. Clin. Nutr. 95 (3), 732–739. Trojanowski, J.Q., Walkenstein, N., Lee, V.M., 1986. Expression of neurofilament subunits in neurons of the central and peripheral nervous system: an immunohistochemical study with monoclonal antibodies. J. Neurosci. 6 (3), 650–660. Wang, H., Provan, G.J., Helliwell, K., 2000. Tea flavonoids: their functions, utilisation and analysis. Trends Food Sci. Technol. 11 (4–5), 152–160. Wenk, G.L., 2003. Neuropathologic changes in Alzheimer's disease. J. Clin. Psychiatr. 64 (Suppl. 9), 7–10. Wiedenmann, B., Franke, W.W., Kuhn, C., Moll, R., Gould, V.E., 1986. Synaptophysin: a marker protein for neuroendocrine cells and neoplasms. Proc. Natl. Acad. Sci. U. S. A. 83 (10), 3500–3504. Winner, B., Kohl, Z., Gage, F.H., 2011. Neurodegenerative disease and adult neurogenesis. Eur. J. Neurosci. 33 (6), 1139–1151. Yiannakopoulou, E.C., 2015. Targeting DNA methylation with green tea catechins. Pharmacology 95 (3–4), 111–116. 8807–8814. Schmitt, U., Tanimoto, N., Seeliger, M., Schaeffel, F., Leube, R.E., 2009. Detection of behavioral alterations and learning deficits in mice lacking synaptophysin. Neuroscience 162 (2), 234–243. Singh, P., Konar, A., Kumar, A., Srivas, S., Thakur, M.K., 2015. Hippocampal chromatinmodifying enzymes are pivotal for scopolamine-induced synaptic plasticity gene expression changes and memory impairment. J. Neurochem. 134 (4), 642–651. Smith, T.D., Adams, M.M., Gallagher, M., Morrison, J.H., Rapp, P.R., 2000. Circuit-specific alterations in hippocampal synaptophysin immunoreactivity predict spatial learning impairment in aged rats. J. Neurosci. 20 (17), 6587–6593. Soares, M.B., Ramalho, J.B., Izaguirry, A.P., Pavin, N.F., Spiazzi, C.C., Schimidt, H.L., Mello-Carpes, P.B., Santos, F.W., 2019. Comparative effect of Camellia sinensis teas on object recognition test deficit and metabolic changes induced by cafeteria diet. Nutr. Neurosci. 22 (8), 531–540. Soltani, M.H., Pichardo, R., Song, Z., Sangha, N., Camacho, F., Satyamoorthy, K., Sangueza, O.P., Setaluri, V., 2005. Microtubule-associated protein 2, a marker of neuronal differentiation, induces mitotic defects, inhibits growth of melanoma cells, and predicts metastatic potential of cutaneous melanoma. Am. J. Pathol. 166 (6), 1841–1850. Steiner, B., Wolf, S., Kempermann, G., 2006. Adult neurogenesis and neurodegenerative disease. Regen. Med. 1 (1), 15–28. Sun, D., McGinn, M.J., Zhou, Z., Harvey, H.B., Bullock, M.R., Colello, R.J., 2007. Anatomical integration of newly generated dentate granule neurons following traumatic brain injury in adult rats and its association to cognitive recovery. Exp. Neurol. 10