GABA and its B-receptor are present at the node of Ranvier in a small population of sensory fibers, implicating a role in myelination

Journal of Neuroscience Research 93:285–295 (2015) GABA and Its B-Receptor Are Present at the Node of Ranvier in a Small Population of Sensory Fibers, Implicating a Role in Myelination Mikael Corell,1 Grzegorz Wicher,1,2 Katarzyna J. Radomska,3 E. Duygu Da glıkoca,4 Randi Elberg Godskesen,5 Robert Fredriksson,1 Eirikur Benedikz,5 Valerio Magnaghi,6 and Åsa Fex Svenningsen1,5* 1 Department of Neuroscience, Uppsala University, Uppsala, Sweden Department of Genetics and Pathology, Uppsala University, Uppsala, Sweden 3 Department of Organismal Biology, Uppsala University, Uppsala, Sweden 4 Department of Molecular Biology and Genetics, Bogazici University, Istanbul, Turkey 5 IMM-Neurobiology Research, University of Southern Denmark, Odense, Denmark 6 Department of Pharmacological and Biomolecular Sciences, University of Milan, Milan, Italy 2 The g-aminobutyric acid (GABA) type B receptor has been implicated in glial cell development in the peripheral nervous system (PNS), although the exact function of GABA signaling is not known. To investigate GABA and its B receptor in PNS development and degeneration, we studied the expression of the GABAB receptor, GABA, and glutamic acid decarboxylase GAD65/67 in both development and injury in fetal dissociated dorsal root ganglia (DRG) cell cultures and in the rat sciatic nerve. We found that GABA, GAD65/67, and the GABAB receptor were expressed in premyelinating and nonmyelinating Schwann cells throughout development and after injury. A small population of myelinated sensory fibers displayed all of these molecules at the node of Ranvier, indicating a role in axon–glia communication. Functional studies using GABAB receptor agonists and antagonists were performed in fetal DRG primary cultures to study the function of this receptor during development. The results show that GABA, via its B receptor, is involved in the myelination process but not in Schwann cell proliferation. The data from adult nerves suggest additional roles in axon–glia communication after injury. VC 2014 Wiley Periodicals, Inc. Key words: GABAB receptor; Schwann cells; GABA; nodes of Ranvier; peripheral nervous system Axon–glia communication is essential for most processes involved in maintenance and function in the nervous system. Some signaling molecules used in this process have long been considered neuron-specific neurotransmitters but are also generated by glial cells and used to modulate neuronal signals at synapses. Some of these neurotransmitters function as growth and differentiation factors (Urazaev et al., 2001; Fields and Stevens-Graham, 2002; Hanani, 2010). One of these neurotransmitters, gaminobutyric acid (GABA), the predominant inhibitory neurotransmitter of the vertebrate nervous system, can C 2014 Wiley Periodicals, Inc. V also act as a neurohormone, paracrine signaling molecule, metabolic intermediate, and trophic factor (Owens and Kriegstein, 2002; Lujan et al., 2005). GABA signals via the ionotropic receptors GABAA and GABAA-q and the metabotropic GABAB receptor (Nicoll, 1988; Bettler et al., 2004). The GABAB receptor is widely distributed throughout the central nervous system. Activation of the receptor either opens calcium and potassium ion channels or inactivates adenylyl cyclase (AC) and inhibits the cyclic adenosine monophosphate (cAMP) pathway (Kuner et al., 1999; Bettler and Tiao, 2006). Although GABA is a neurotransmitter, and GABA receptors are generally localized to synapses, many glial cells also express this receptor (Charles et al., 2003; Magnaghi et al., 2004; Luyt et al., 2007). Astrocytes have functional GABAB receptors, and the agonist baclofen decreases AC activity in astrocyte primary cultures (Fraser et al., 1994; Oka et al., 2006; Beenhakker and Huguenard, 2010). In hippocampal slice cultures, GABAB receptors potentiate inhibitory synaptic transmission, possibly This article was published online on 18 October 2014. An error was subsequently identified. This notice is included in the online and print versions to indicate that both have been corrected on 5 November 2014. Contract grant sponsor: Swedish Research Council; Contract grant number: M 2006-4268; Contract grant sponsor: Gyllenstiernska Krapperupstiftelsen; Contract grant sponsor: Åhlen-stiftelsen; Contract grant sponsor: Novo Nordisk Fonden; Contract grant sponsor: A.P. Mïller og Hustru Chastine Mc-Kinney Mïllers Fond til almene Formaal *Correspondence to: Assoc. Prof. Åsa Fex Svenningsen, Department of Molecular Medicine-Neurobiology Research. J.B. Winslows vej 21.1, 5000 Odense, Denmark. E-mail: aasvenningsen@health.sdu.dk Received 4 July 2014; Revised 28 August 2014; Accepted 4 September 2014 Published online 18 October 2014 in Wiley Online Library (wileyonlinelibrary.com). DOI: 10.1002/jnr.23489 286 Corell et al. mediated via astrocytes (Kang et al., 1998; Oka et al., 2006). GABAB receptor stimulation is also known to increase migration as well as proliferation of oligodendrocyte precursors (Charles et al., 2001; Luyt et al., 2007). GABA and its receptors are present in the peripheral nervous system (PNS; Jessen et al., 1986; Magnaghi et al., 2004; Magnaghi, 2007). In sensory neurons of the dorsal root ganglia (DRG), the GABAB receptor is expressed and transported to the nerve terminals, where it regulates primary afferent neurotransmitter release in the spinal cord (Desarmenien et al., 1984; Towers et al., 2000). GABA is produced by DRG neurons (Desarmenien et al., 1984; Schoenen et al., 1989), but its function in DRGs and peripheral nerves is not clear. GABAB receptors are present in both satellite cells and Schwann cells (Magnaghi et al., 2004; Magnaghi, 2007), but the cellular PNS distribution in vivo, during development is unknown. The function of the GABAB receptors has been studied primarily in neonatal Schwann cells in vitro, which are devoid of neuronal signaling. In such cells, GABAB receptors are involved in both proliferation and myelination (Magnaghi et al., 2004, 2010), but is this the case when neurons are present or In vivo? To answer this question, we investigated the precise localization of GABA and its B receptor in the developing sciatic nerve and in dissociated fetal DRG cultures containing both neurons and Schwann cells. In the sciatic nerve, we found a unique population of myelinating Schwann cells expressing GABAB receptors as well as GABA at the node of Ranvier. In DRG cultures where neurons are present GABAB receptor stimulation did not affect the spontaneous proliferation but clearly influenced myelination. It was also found that GABA, via its B receptor, is involved in nerve regeneration. MATERIALS AND METHODS Animals and Dissection This study was approved by the regional ethics committees for research on animals (Uppsala, Sweden, and Odense, Denmark) and was carried out in accordance with the policies of the Society for Neuroscience. Sprague-Dawley rats were used for all experimental procedures and kept on a 12-hr dark– light cycle with food and water ad libitum. The cellular localization of the GABAB receptors was investigated in rat embryos at embryonic day (E) 17, rat pups, and adult rats. Fetal rats were decapitated, whereas older animals were killed by an overdose of CO2 and decapitated. All tissues used were taken from both female and male rats. DRGs and sciatic nerves were dissected and used either for immunohistochemistry or for Western blot analysis. The adult (3–5 months old) sciatic nerves were cut into segments and teased on Superfrost glasses with fine needles under a dissection microscope. The teased nerves were fixed for 15 min in Stefanini’s fixative (2% paraformaldehyde [PFA]; Sigma-Aldrich, Stockholm, Sweden) and 140 ml/liter of saturated picric acid solution (SigmaAldrich) in phosphate-buffered saline (PBS), cryoprotected in 10% sucrose in PBS, and frozen. Adult ganglia with dorsal and ventral roots were fixed for 1 hr in 4% PFA, cryoprotected in 20% sucrose in PBS, mounted in Tissue-Tech (Sakura Finetek, Histolab Products, Gothenburg, Sweden), and cryosectioned (10 mm) on a Cryocut 1800 (Leica, Stockholm, Sweden). Sciatic nerves were collected for Western blot analysis, frozen on dry ice, and stored at 280 C. Western Blot Analysis Sciatic nerves from different postnatal (P) stages (P0, P5, P10, P15) and adults (3–5 months old) were weighed, cut into smaller pieces, and lysed in 100 ml/g lysis buffer (98% NP-40 cell lysis buffer; FNN021; Invitrogen, Stockholm, Sweden), 1% Triton-X, and 1% Halt protease inhibitor cocktail (Thermo Scientific, Copenhagen, Denmark). Tissue was homogenized on ice and centrifuged at 16,000g at 4 C for 20 min. The supernatants were transferred into new tubes and kept at 280 C until use. The protein concentrations were determined by using a Pierce BCA protein assay kit (Thermo Scientific). Equal amounts of protein (40 mg) were resolved on 8% sodium dodecyl sulfate-polyacrylamide gel electrophoresis gel and blotted onto nitrocellulose membranes (Hybond ECL; GE Healthcare, Piscataway, NJ). The membranes were blocked for 1 hr at room temperature with 5% skim milk in TBST (10 mM TrisHCl, 0.15 M NaCl, pH 7.4, 0.05% Tween 20; Sigma-Aldrich), followed by incubation with primary antibodies from Abcam (Cambridge, United Kingdom): mouse anti-GABAB1 receptor (1:400), rabbit anti-GABAB2 receptor (1:250), mouse antiGAD65 (1:1,000), and mouse anti-GAD67 (1:1,000) diluted in blocking solution at 4 C overnight. After they had been washed five times with TBST, membranes were incubated for 1 hr with horseradish peroxidase-labeled donkey anti-rabbit or antimouse immunoglobulins (1:5,000) from GE Healthcare and again washed five times with TBS. Bands were visualized with an ECL Plus Western blotting detection system (GE Healthcare). The membranes were stripped and labeled for actin (mouse anti-b-actin HRP conjugated, 1:3,000; BioSite, Copenhagen, Denmark) as a loading control. Degenerating Nerve Segments Degenerated nerve segments were made with freshly dissected adult rat sciatic nerve. The nerves were cleaned and cut into 3–5-mm segments under a dissection microscope and placed directly in Dulbecco’s modified Eagle’s medium (DMEM; Invitrogen) with 10% fetal bovine serum (SigmaAldrich) for 1 or 2 weeks. Some segments were fresh frozen to use as control for Western blotting with degenerated nerves. Other control segments were fixed, treated with cryoprotection media, and sectioned or teased. In vitro degenerated nerve segments were treated in a similar fashion. Sciatic Nerve Injury Female Sprague-Dawley rats with a body weight of approximately 200 g were anesthetized with an intraperitoneal injection of a mixture of sodium pentobarbitone (60 mg/ml; Apoteket, Stockholm, Sweden) and sodium chloride (9 mg/ml, 1/10, v/v). The sciatic nerve in the hind limb was exposed and crushed for 60 sec with fine flat tweezers. The crush was made perpendicular to the nerve, and care was taken not to induce injury resulting from nerve stretching. The wound was closed, Journal of Neuroscience Research GABA and Its B Receptor in Schwann Cells and the rats were then housed for 6 days and anesthetized with an overdose of CO2. The crushed nerve was fixed in 4% PFA for 2 hr and treated as previously described for in vitro degenerated nerve. Primary DRG Cell Cultures The dissection procedure and cell culture method have been described previously by Fex Svenningsen et al. (2003). The DRG from E17 rat embryos were dissected and separated under a microscope, treated enzymatically with 0.125% trypsin (Invitrogen) in L15 media at 37 C for 15 min, and mechanically dissociated. The cells were washed in L15 medium containing 10% fetal bovine serum (Sigma-Aldrich) to stop the enzymatic reaction and centrifuged at 70g. The pellets were washed in L15 and centrifuged once more to remove debris and trypsin residue. The cells were then suspended in Neurobasal medium containing 2% B27 and 0.3% L-glutamine (Invitrogen) and supplemented with 100 ng/ml nerve growth factor (Millipore, Billerica, MA). The use of B27 instead of fetal bovine serum keeps the fibroblast contamination and growth to an absolute minimum. No antibiotics were used in the medium. The cells were plated on poly-L-lysine (Sigma-Aldrich)-coated chamber slides (Lab-Tek; Nunc International, G€ oteborg, Sweden) at a cell density of 30,000 cells per 300 ml in each 180-mm2 well. To stop proliferation and induce differentiation and myelination, the medium was supplemented with 50 mg/ml ascorbic acid (Sigma-Aldrich) after 4 days in vitro (DIV). The cultures were fixed after 1, 2, 14, and 28 DIV to examine the expression of the GABAB receptors at different time points in culture development. Cells were fixed in Stefanini’s fixative for 15 min, washed three times in PBS, and cryoprotected with 20% sucrose in PBS. Functional Studies With GABAB Receptor Agonist and Antagonist in DRG Cell Cultures To study the function of the GABAB receptor, DRG cultures were treated with the agonist baclofen (100 mM in 1% dimethylsulfoxide [DMSO]; Sigma-Aldrich) or with the selective antagonist CGP55845 (10 mM in 1% DMSO; Tocris Bioscience, Bristol, United Kingdom) for 2 DIV (from the time of plating), the point when the spontaneous Schwann cell proliferation rate was at its highest (data not shown). To examine differentiation and myelination, DRG cultures received a prolonged treatment with either 100 mM baclofen or 10 mM CGP55845. The dissociated DRGs were plated in 24-well plates at a density of 500,000 cells/well; eight wells were used for each treatment group. After 4 DIV, the medium was changed and supplemented with 50 mg/ml ascorbic acid (Sigma-Aldrich). To sustain the activity and the concentration of the compounds, fresh solutions were added when the medium was changed twice per week. After 28 DIV, the cultures were harvested for RNA isolation and subsequent quantitative real-time polymerase chain reaction (PCR). Immunochemistry Tissue. The slides with teased fibers and cryosections were washed three times with PBS to remove the cryoprotecJournal of Neuroscience Research 287 tive solution and preincubated with blocking solution (0.25% bovine serum albumin and 0.25% Triton X-100 in PBS, pH 7.2) for 1 hr at room temperature. Next, the slides were treated overnight at 4 C with a combination of primary antibodies diluted in blocking solution. The two subunits of the GABAB receptor were labeled by using either guinea pig anti-GABAB1 or anti-GABAB2 receptor (1:400; Millipore) or rabbit antiGABAB1 receptor (1:200, Abcam). To determine where GABA was synthesized and stored, mouse anti-GABA (1:400, SigmaAldrich) and rabbit anti-GAD65/67 (1:500, Abcam) were used. Glial cells were colabeled with mouse antiglial fibrillary acidic protein (GFAP; 1:1,000; Sigma-Aldrich), and neurons were labeled either with rabbit antineurofilament 200 kDa (NF200; 1:1,000; Sigma-Aldrich) or with mouse antiperipherin (1:500; Millipore). The myelination process was studied with the early myelin marker mouse anti-Rip (1:1,000; Developmental Studies Hybridoma Bank, Iowa City, IA), and fully developed myelin was labeled with rabbit serum against myelin basic protein (MBP; 1:1,000; a gift from Dr. David Colman’s laboratory) or with mouse anti-MBP (1:1,000; Sternberger Monoclonals, Lutherville, MD). To study the node of Ranvier in detail, rabbit anti-contactin-associated protein (Caspr; 1:1,000; a gift from Dr. Colman’s laboratory) was used to visualize the paranodes. After the slides had been washed three times with PBS, secondary antibodies diluted in blocking solution were applied and incubated at room temperature for 2 hr. Antibodies were donkey anti-guinea pig RRX, anti-mouse RRX, and antirabbit RRX (1:400; Jackson Immunoresearch, West Grove, PA) and donkey anti-mouse fluorescein isothiocyante (FITC) and anti-rabbit FITC (1:200; Jackson Immunoresearch). Controls were made with only secondary antibody to avoid investigating nonspecific labeling of tissues and cells. The slides were then washed twice and mounted in DTG mounting media (2.5% DABCO [Sigma-Aldrich], 50 mM Tris-HCl, pH 8.0, 90% glycerol) with or without 0.375 mg/ml 40 ,6-diamidino-2phenylindole (DAPI; Sigma-Aldrich). DRG cell cultures. The primary antibodies used to label the DRG cultures were guinea pig anti-GABAB1 receptor or anti-GABAB2 receptor, rabbit GABAB2 receptor, mouse anti-GABA, rabbit anti-GAD65/67, mouse anti-GFAP, rabbit anti-MBP, rabbit anti-NF 200 kDa, and mouse anti-CNP (1:500; Sternberger Monoclonals). For immunocytochemistry, goat anti-mouse- and anti-rabbit Alexa Fluor 488 secondary antibodies (1:500; Molecular Probes) were used instead of FITC. DRG proliferation and treatment. To visualize the BrdU labeling, the cultures were preincubated with 2 M HCl for 4 hr after fixation. The primary antibody used was FITC-conjugated rat anti-BrdU (Nordic Biosite, Taby, Sweden). Microscopy, Image Acquisition, and Quantification The sections and cultures were analyzed via an Olympus fluorescence microscope in Volocity software (PerkinElmer, Upplands-V€asby, Sweden). Images were taken either with the Olympus microscope or a Zeiss LSM 510 Meta confocal microscope (Carl Zeiss, Oberkochen, Germany). The recording parameters were as follows: for Alexa488, an argon laser 288 Corell et al. TABLE I. List of Primers for Real-Time PCR Accession No. Reference (housekeeping) gene GAPDH Genes of interest GFAP MBP MAG PMP22 Forward primer Reverse primer X02231 acatgccgcctggagaaacct gcccaggatgccctttagtgg NM_017009 NM_017026 NM_017190 NM_017037 atgactatcgccgccaactgc cgcatcttgttaatccgttctaat agaagccagaccatccaa Tgtaccacatccgccttg tcctggtaactcgccgactcc gagggtttgtttctggaagtttc ctgattccgctccaagtg cctggacagactgaagcc (488 nm) and BP 505–550 nm were used; for RRX, a DPSS laser (561 nm) and LP 575 nm were used; and for Alexa647, an HeNe laser (633 nm) and BP 636–754 nm were used. For all images, the pinhole opening was <100 lm (1 Airie unit), and the confocal scans were 1 mm in thickness. The image resolution was 0.20 mm when using a 363 oil immersion objective with a 1.4 numerical aperture. The images were processed and arranged in Photoshop, Illustrator, and InDesign CS4 (Adobe Systems, San Jose, CA). To quantify the proliferation rate of cultures treated with baclofen or CGP55845 and DMSO control, five images were randomly taken in each well, a total of 40 images for every treatment group. The number of BrdU-positive cells and the total number of cells were counted for each image. The ratios of BrdU-positive cells/total number of cells for the treated cultures were compared with the ratio of BrdU-positive cells/total number of cells in the DMSO-treated control. Values are presented as mean 6 SEM, and results were analyzed by Student’s t-test (Prism 5.0a; GraphPad Software, San Diego, CA). Statistical significance was defined as P < 0.05. possible, the primers were also designed to span introns to avoid potential amplification of genomic DNA. The sequences are presented in Table I. Real-Time PCR Relative expression levels of the housekeeping gene GAPDH and the genes of interest were determined by quantitative real-time PCR with an MyiQ thermal cycler (Bio-Rad, Copenhagen, Denmark). Each reaction, with a total volume of 20 ml, contained 0.20 pmol/ml of each primer (Thermo Scientific) and Sybr Green Mastermix (10 ml; Bio-Rad). All realtime PCR experiments were performed in triplicate with a negative control for each primer pair on each plate. Amplifications were carried out under the following conditions: initial denaturation at 95 C for 15 min, then 40 cycles of denaturing at 95 C for 30 sec, annealing at 52–62 C for 30 sec, and extension at 72 C for 1 min. Melting point curves were analyzed after the thermocycling to confirm that only one product with the expected melting point was formed. mRNA Expression Analysis The 4-week-old treated DRG cultures, made from approximately 10 rat pups for each culture setup, were harvested by aspirating the medium and lysing in Trizol (Invitrogen) for 15 min. The cells were homogenized by pipetting with a Pasteur pipette. A Nucleospin RNA II kit from Macherey-Nagel (Duren, Germany) was used for total RNA isolation, and all steps were carried out according to the manufacturer’s protocol. The absence of genomic DNA was confirmed by performing a PCR with primers for rat glyceraldehyde-3-phosphate dehydrogenase (GAPDH; see Table I). The RNA concentration was determined via a Nanodrop spectrophotometer (2000C; Thermo Scientific). cDNA was synthesized with a high-capacity cDNA reverse transcription kit (Applied Biosystems, Copenhagen, Denmark) and random hexamer primers according to the manufacturer’s instructions. The concentration of the templates was about 5 ng/ml, and the concentration of each primer was 0.25 pmol/ml. Statistical Analysis Parallel assays for each sample were performed with GAPDH for normalization. Standard curves were prepared for each target by using serial dilutions of a single sample. LinRegPCR (Ramakers et al., 2003) was used to calculate PCR efficiencies for each sample. After that, Grubbs’ test was applied to remove outliers and calculate average PCR efficiency for each primer pair (Grubbs, 1969; Stefansk, 1972). Relative quantification of gene expression changes was determined via the 2DDCt method with Pfaffl’s modification, and an induction ratio was obtained by normalizing the treated cultures to the controls (Pfaffl, 2001; Pfaffl et al., 2004). The expression data for each gene was checked for normality and equality of variances between groups. Differences in gene expression between groups were analyzed by one-way ANOVA, followed by a least significant difference (LSD) post hoc test. Confidence intervals of 95% were used as the criterion for statistical significance (P < 0.05). Statistics were calculated in SPSS 11.5.0 (IBM, Copenhagen, Denmark). Primer Design The primers were designed in Beacon Designer software (Premier Biosoft, Palo Alto, CA) with Sybr Green settings and were based on sequences downloaded for each rat’s mRNA. Primers were 18–21 nucleotides in length with a melting point between 55 C and 62 C and formed products in the range of 70–100 base pairs. Primer efficiencies were 80–100%. When RESULTS GABAB Receptor Expression Decreases With Age The expression levels of GABAB receptors GAD56 and GAD67 were first investigated by immunoblotting with protein homogenates from P0, P5, P10, P15, and adult sciatic nerves. The GABAB receptor subunits as well Journal of Neuroscience Research GABA and Its B Receptor in Schwann Cells Fig. 1. Western blot analysis of protein lysates from postnatal and adult rat sciatic nerve. Both the GABAB1a (130 kDa) and the GABAB2 subunits (100 kDa) were expressed during postnatal development but decreased with age and the progression of myelination. The overall expression of GAD65 and GAD67 increased somewhat during development. To confirm the loading of equal amounts of protein, the membrane was also labeled with b-actin (n 5 5). as GAD65/67 were expressed in the postnatal sciatic nerve. The GABAB receptors clearly decreased with age, whereas the GAD increased with a maximum at P15. Both GAD65 and GAD67 were present in the adult nerve but at a lower level than at P15 (Fig. 1). GABA and GABAB Receptors Are Present Primarily in Nonmyelinating Schwann Cells The GABAB receptor expression was investigated in sections of adult rat DRG and in teased preparations of adult rat sciatic nerve. In DRGs, both neurons and satellite glia expressed GABAB receptors, and the expression was particularly high in the satellite glia (Fig. 2A,B; arrows). In the sciatic nerve, GABAB receptors were found primarily in nonmyelinating Schwann cells (Fig. 2C,C0 ,D), and this cell type was also found to be GABA and GAD65/67 positive (Fig. 2E,F). These data suggest that nonmyelinating Schwann cells both generate and store GABA. GABAB Receptors GABA and GAD65/67 Are Present in a Small Population of Myelinating Schwann Cells Most myelinating Schwann cells did not express GABAB receptors, GAD65/67, or GABA. A small population of axons with thick myelin sheaths expressed the GABAB receptor, GABA, and GAD65/67 in the nodal region (Fig. 2G–L). Whereas GAD65/67 was on the axonal side of the node (Fig. 2J), the GABAB receptor was present on the glial side (Fig. 2G,H,K,L). The distribution of the GABAB receptor covers not only the nodal area but also the paranodal and juxtaparanodal segment of these Schwann cells (Fig. 2G,K). The labeling partially overlapped with Caspr I labeling, an axonal paranodal marker. Furthermore, the axon connected with the node Journal of Neuroscience Research 289 was labeled with peripherin, indicating that the axon is sensory. The exact location of GABA itself was somewhat difficult to determine since it was unclear whether it was distributed on the glial or axonal side (Fig. 2I). We next investigated where the fibers containing GABAB positive nodes originated. Cryosections were made from the DRG with intact dorsal and ventral roots that were labeled with antibodies to the GABAB receptor subunits. The glia of the ventral root completely lacked GABAB receptors. GABAB-positive nodes as well as nonmyelinating Schwann cells were localized to the dorsal root (Fig. 2M). The fibers surrounded by these Schwann cells were labeled with NF200 (Fig. 2K) but also contained a population that was labeled with peripherin (Fig. 2L), which specifically labels sensory fibers. The fact that the GABAB-positive nodes are present only in the dorsal root further demonstrates that these nodes have a sensory origin. The GABAB Receptor Is Upregulated in Degenerated Nerves and in the Distal Segment of Crushed Rat Sciatic Nerves Because the GABAB receptor is downregulated with age and rate of myelination, we also wanted to investigate possible changes in the expression induced by an injury, especially in the distal segment, where the Schwann cells lose axonal contact after injury. To this end, adult sciatic nerve was dissected, cut into 3–5-mm segments, and cultured for 1 or 2 weeks. The GABAB receptor was upregulated in the segments (Figs. 2O,P and 3). Immunochemistry also indicated that the GABAB receptor partially colocalized with the MBP labeling (Fig. 2O,P). The distal segment of the in vivo crushed and degenerated sciatic nerve was investigated next. The segment was crushed 6 days prior to sacrifice of the animal. Immunolabeled cryosections made from these nerves showed an increase in GABAB receptor expression similar to that seen in the in vitro degenerated segments (Fig. 2N). Expression of GABAB Receptor, GABA, and GAD65/67 in Schwann Cell Development To further study the distribution of the GABAB receptor, GABA, and GAD65/67 in Schwann cell development, dissociated E17 rat DRG cultures were used. Shortly after plating, both DRG neurons and Schwann cells expressed GABAB1 and GABAB2 receptor subunits in cultures, as is the case in vivo (Fig. 4A,A0 ,B,B0 ,I,J). The receptors were localized evenly in the Schwann cell membrane (Fig. 4A,A0 ,B,B0 ). After 4 DIV, ascorbic acid was added to the medium to induce myelination. The cultures were kept for 7–28 DIV to obtain thick myelin. The nonmyelinating Schwann cells of the cultures continued to express the GABAB receptor during the entire time in culture (data not shown). Cells that started their myelination program downregulated the GABAB receptor expression, and fully myelinated segments had no or low expression (Fig. 4E,E0 ,F,F0 ). 290 Corell et al. Fig. 2. In sections of the adult dorsal root ganglia many neurons express the GABAB1 (red) and GABAB2 subunits (red, A,B). The labeling was even more intense in Satellite cells (arrows, A,B). DRG neurons are double-labeled with neuronal marker neurofilament 200 kDa (NF). In preparations of teased adult sciatic nerve (C-F) both GABAB1 (red) and GABAB2 receptor (red) were expressed uniformly in nonmyelinating Schwann cells (C,D). GABA (red, E) and GAD65/ 67 (red, F) were also expressed in these cells. The nonmyelianting Schwann cells were double-labeled with GFAP (green, C0 ,F). DAPI was used as nuclei staining (blue). In preparations of teased adult sciatic nerve, the expression of GABAB1 (red) and GABAB2 (red) were localized to the myelin sheath at the node of Ranvier (G,H) in a small population of larger caliber axons; double-labeled with the myelin marker Rip (green, G,H). In these myelinated fibers, GABA was localized at the node of Ranvier (I) and GAD65/67 was expressed in the axon and node of Ranvier (J). All axons positive for GABA receptors at the nodes expressed neurofilament 200 kDa (NF, green, K0 ) and peripherin (green, L0 ). The paranodes in these axons were labeled with Caspr (blue, K,K0 ,L,L0 ). To determine the origin of this population, the dorsal root (DR) and the ventral root (VR) were labeled with anti-GABAB receptor (M). Interestingly, GABAB receptors exist only in Schwann cells of sensory axons. Myelin sheaths are double-labeled with myelin basic protein (MBP, I,J,M). (N) The distal segment of an in vivo crushed nerve that was removed from the rat after 6 days. The section show a clear up-regulation of GABAB1 (red) in the myelinated fibers labeled with MBP (green). In segments of the sciatic nerve, cultured in vitro for on week, to mimic the distal segment after injury, the same upregulation of both GABAB receptor subunits could be seen (O, P). This experiment show that the upregulation of the GABAB receptor was not due to external factors such as macrophage infiltration of externally produced growth factors. The GABAB receptor subunits in red and MBP in green. Scale bars 5 50 mm. Journal of Neuroscience Research GABA and Its B Receptor in Schwann Cells Fig. 3. Adult sciatic nerve was dissected cut in 3-5 mm segments and cultured for 1 and 2 weeks. This procedure was made to mimic Wallerian degenerate. Both receptor subunits were upregulated in segments cultured for 1 and 2 weeks compared to control. This western confirms the data shown in figure 2N-P, indicating the increased GABAB receptor expression may be an attempt by the Schwann cells to be more responsive to excreted GABA from growing axons. The stimulation of the GABAB receptor could potentially lead to a production of growth factors and other chemoattractants necessary for axonal guidance and sprouting. Both GAD65/67 and GABA were found primarily in the neuronal cell bodies of the cell cultures (Fig. 4K,L), but they were also present in the axon itself (data not shown). Similarly to the nonmyelinating Schwann cells observed in vivo, GABA and GAD65/67 were present in the premyelinating young Schwann cells (Fig. 4C,D), and the expression decreased as the cells started to myelinate axons (data not shown). Just as in vivo, fully myelinated segments expressed very little GABA or GAD65/67 (Fig. 4G,H). Functional Studies of the GABAB Receptor in DRG Cell Cultures It has previously been shown that baclofen, a potent GABAB receptor agonist, decreases proliferation and reduces the synthesis of myelin proteins in pure cultures of Schwann cells from neonatal rats (Magnaghi et al., 2004; Faroni et al., 2011). However, the proliferation and myelination in these cultures was induced by using forskolin, a potent adenylate cyclase agonist. Because our cultures proliferated spontaneously and also contained neurons that actively produced GABA in the culture, we wanted to investigate the response to GABA agonists and antagonists in this more complex system. In DRG cultures, Schwann cell proliferation is spontaneous and visibly high the first days after plating but decreases with time. We first determined that the highest rate of proliferation was at 48 hr (2 DIV) after plating (data not shown). DRG primary cultures were then exposed to 100 mM of the GABAB receptor agonist baclofen or 10 mM of the antagonist CGP55845 for 2 DIV, and cell proliferation was then evaluated by using bromodeoxyuridine (BrdU) incorporation. The number of BrdU-incorporating cells compared with the total number of cells did not decrease with treatment of either baclofen or CGP55845 compared with DMSO-treated controls (Fig. 5A). To test whether baclofen or CGP55845 would interfere with the myelination process, other DRG cultures were treated with these compounds for 28 DIV. Journal of Neuroscience Research 291 To sustain the levels of the agonist or the antagonist, fresh compounds were applied twice per week during normal medium change. With real-time PCR, the relative mRNA expression levels of myelin markers were normalized with the housekeeping gene GAPDH and compared among the treatment groups. The mRNA expression levels for MAG and MBP decreased in the baclofen-treated cultures and increased in cultures treated with GCP55485 (Fig. 5B–D). The mRNA levels for PMP22 showed a similar change, but it did not reach statistical significance (Fig. 5C). The mRNA levels of GFAP did not change with addition of baclofen or CGP55485 (Fig. 5E). DISCUSSION GABA and Its B Receptor in Nonmyelinating Schwann Cells of the Sciatic Nerve The GABA, GAD65/67, and GABAB receptors are all present in premyelinating and nonmyelinating Schwann cells, indicating that these cells both generate and store GABA and that the cells can respond to GABA through their B receptors in vivo and in vitro. It is conceivable that GABA and its receptors have a function similar to that in astrocytes, in which focused GABA release activates GABAB receptors on neighboring neurons and modulates neuronal activity (Beenhakker and Huguenard, 2010). Premyelinating and nonmyelinating Schwann cells might use GABA for similar glia–neuron communication, for example, to regulate nociceptive fibers and sensory functions. Mice that lack the GABAB1 subunit, which makes this receptor nonfunctional, show altered pain reception as well as hyperalgesia to thermal stimuli, corroborating this theory (Magnaghi et al., 2008; Faroni et al., 2014). During PNS development, the number of premyelinating Schwann cells decreases with age and the rate of myelination. This was also true for the GABAB receptor expression in vivo as well as in vitro. GABA and its B receptor were absent in most of the myelinating Schwann cells, whereas the GAD activity was sustained. This indicates that the GABA synthesized in the adult sciatic nerve acts via the ionotropic GABAA, which is also present in Schwann cells (Magnaghi et al., 2006). GABAB Receptors at the Node of Ranvier in a Small Population of Axons in the Sciatic Nerve A population of myelinated fibers displayed GABAB receptors as well as GABA and GAD65/67 at the node of Ranvier. The GABAB receptor was present on the glial side of the node, whereas GAD65/67 was localized to the axon. The localization of GABA was somewhat difficult to interpret; it might, in part, be restricted to the microvilli covering the node and would thus be in the glial compartment. This indicates that GABA might be generated in the axon, then transported and stored in the surrounding myelinating Schwann cells. These fibers had thick myelin sheaths and expressed both NF200 and peripherin, a label for 292 Corell et al. Fig. 4. In primary DRG cultures, all glial cells expressed both GABAB1 (red) and GABAB2 (red) subunits shortly after plating (A,B). These cells also expressed GABA and GAD65/67 (C,D; red). The premyelinating Schwann cells were double labeled with GFAP (A0 ,B0 ,C,D; green). At 28 DIV, many Schwann cells had myelinated axons. These myelinating Schwann cells had lost their GABAB receptor expression (E,F; red). GABA and GAD65/67 expression also decreased in the cells that started to myelinate (G,H; red). GAD65/67 expression was localized to the cell membrane of the Schwann cells (D). Myelin was double labeled with the myelin markers CNP (E0 ; green) and MBP (F0 ,G,H; green). DRG neurons express GABAB receptors, GABA, and GAD65/67 in culture (I–L; red) and are double labeled with NF200. Scale bars 5 50 mm. Journal of Neuroscience Research GABA and Its B Receptor in Schwann Cells sensory neurons. This was corroborated by the finding that nodal GABA, GAD65/67, and GABAB receptors all originated from the dorsal root. It has previously been shown that mice lacking the GABAB1 receptor subunit have irregularities in the myelin sheaths and an increased expression of several myelin proteins in large myelinated fibers expressing NF200 (Magnaghi et al., 2008). This group of neurons might be the same population found in this study. The glial cells myelinating these axons could be more dependent on GABA’s direct actions via B receptors and, thus, more vulnerable in a mouse lacking the GABAB1 receptor subunit. 293 This finding is especially interesting in light of the new phenotypes of Schwann cells that are being described (Hoke et al., 2006; Jesuraj et al., 2012). To date, phenotypic differences in Schwann cells, have been related to motor and sensory neurons, but a phenotypic difference between sensory neurons of different calibers is plausible. Distribution of GABA and Its B Receptor in DRG Cell Culture Schwann cells in cultures devoid of neurons possess functional GABAB receptors and generate GABA (Magnaghi et al., 2004). To mimic the environment of the developing PNS better, we chose to investigate the GABAB receptor-mediated actions of GABA in primary fetal DRG cultures containing a mixture of sensory neurons and glia. The Schwann cells in these cultures proliferate, mature, and myelinate axons without the addition of growth-promoting agents (Fex Svenningsen et al., 2003). The sensory neurons of the cultures expressed the GABAB receptor, GAD65/67, and GABA. This is in accordance with what is known about the distribution of these proteins in vivo (Towers et al., 2000; Charles et al., 2001). The distribution of the GABAB receptor in Schwann cells also correlated with Western blots and the immunochemical results from in vivo material. Pre- and nonmyelinating Schwann cells both expressed GABAB receptors that were downregulated as the myelination process commenced. The same was true for GABA and GAD65/67. These data show that the Schwann cells in primary DRG cultures correlate well with the in vivo findings. Schwann cells, both in vivo and in vitro, have the ability to generate GABA and respond to this neurotransmitter. Such autocrine/paracrine signaling has previously been suggested. For example, GABA, released by Schwann cells, mediated by protein kinase C, regulates the synthesis and transport of the glutamate transporter EAAC1, activating an autocrine loop that controls the uptake of glutamate, a precursor of GABA (Perego et al., 2012). The developmental downregulation of GABA and Fig. 5. The function of the GABAB receptor was studied in primary dissociated DRG cultures. Cultures were treated with either 100 mM baclofen or 10 mM CGP55485 for 2 DIV. The BrdU-incorporating cells were manually counted and compared with the total number of cells. No change in proliferation rate was detected with either treatment (A; t-test, P 5 0.2868, n 5 8; C: P 5 0.4260, n 5 8; error bars represent SEM). To investigate the effect of these compounds on myelination, the DRG cultures were treated with either 100 mM baclofen or 10 mM GCP55485 for 28 DIV. The cultures were then used for mRNA expression analysis with quantitative real-time PCR. The relative expression levels of the markers MAG (B), PMP22 (C), MBP (D), and GFAP (E) were normalized with the housekeeping gene GAPDH (one-way ANOVA, with LSD post hoc test; B: control vs. baclofen *P 5 0.049, control vs. CGP55485 *P 5 0.025, n 5 4; C: control vs. baclofen P 5 0.47, control vs. CGP55485 P 5 0.156, n 5 4; D: control vs. baclofen *P 5 0.032, control vs. CGP55485 **P 5 0.01, n 5 5; E: control vs. baclofen P 5 0.807, control vs. CGP55485 P 5 0.838, n 5 4; error bars represent SEM). Journal of Neuroscience Research 294 Corell et al. its B receptor, seen both in vivo and in vitro, also suggests that GABA might play a role in the maturation of the sciatic nerve. GABAB Receptor Is Not Involved in Spontaneous Schwann Cell Proliferation During in vivo developmental Schwann cell proliferation and subsequent myelination, axons are always present. In pure cultured Schwann cells in which the proliferation and myelination are induced by forskolin, a potent activator of the cAMP/protein kinase A pathway, both the proliferation and the expression of myelin proteins are affected by the activation of the GABAB receptor with the GABA agonist baclofen (Magnaghi et al., 2004). Although these data suggest that GABA might be implicated in both proliferation and myelination in pure Schwann cells, it is not clear whether GABA has this effect in a culture system containing neurons or whether this is the case in vivo. It fact, it has recently been shown that Schwann cells devoid of neurons and Schwann cells grown with neurons present respond differently and that neuronal contact results in a more in-vivo-like behavior (Stassart et al. 2013). It is thus far from clear whether the same signal transduction pathways are used by forskolininduced proliferating Schwann cells and by those grown in the presence of axons. In an attempt to mimic nerve development, we repeated the experiments performed by Magnaghi et al. (2004) but instead used dissociated developing DRG primary cultures, in which the Schwann cells proliferate spontaneously in vitro. Neither baclofen nor the GABAB receptor antagonist CGP55485 had any effect on this Schwann cell proliferation. These results suggest that neither GABA nor the GABAB receptor is involved in developmental Schwann cell proliferation. The difference between the earlier data and our data likely depends on the presence of the neurons. The Inhibition of GABAB Receptor Activity Increases Myelination We also investigated the effect of the GABAB receptor agonists and antagonists on long-term myelination in the DRG cultures. In cultures treated with baclofen MAG and MBP mRNA decreased, whereas GCP55485 had the reverse effect. These data indicate that GABA might be involved in the myelination process through its B receptor, controlling myelin protein expression and the myelination process. GABAB Receptors Increase After Injury GABAB receptor expression is high in undifferentiated Schwann cells and nonmyelinating Schwann cells. We therefore hypothesized that Schwann cells in damaged nerves would upregulate their GABAB receptor expression. To investigate this, we studied the expression in adult sciatic nerve segments that were allowed to degenerate in vitro for 1 and 2 weeks, mimicking the Wallerian degeneration of the distal segment after nerve transection. In the predegenerated neurons, no axonal sprouting occurs, but Schwann cell proliferation decreases after 72 hr in culture (Fex Svenningsen and Kanje, 1998). A Western blot of these segments shows that the expression of the GABAB receptor increases. We also investigated segments of the rat sciatic nerve crushed. In vivo, 6 days after nerve injury, Schwann cell proliferation had decreased, and the bands of B€ ugner had formed (in rodents). There is also an increase in NRG1 type III at this time point, secreted from outgrowing neurons. This NRG1 type III is likely involved in the initiation of myelination (Fex Svenningsen and Dahlin, 2013; Stassart et al., 2013). Teased preparations of the in vitro segments and cryosections of the in vivo crushed nerve show a clear upregulation of the GABAB receptor in MBP-positive Schwann cells. The increase is somewhat greater in the in vivo segments, which might indicate an involvement in the remyelination process. It is not likely that the GABAB receptors are involved in the injury-induced Schwann cell proliferation since this happens relatively early during the regeneration process (Pellegrino et al., 1986; Fex Svenningsen and Kanje, 1998). Because the GABAB receptor expression increases over time for at least 2 weeks, it might instead be involved in efforts to communicate with the nerve sprouts that should appear if there was a proximal segment. The Schwann cells of the bands of B€ ungner, in the distal segment, normally secrete growth factors and chemoattractants that stimulate and guide axonal growth (Mudo et al., 1993). The increased GABAB receptor expression might be an attempt by the Schwann cells to be more responsive to excreted GABA from the growing axons. The stimulation of these GABAB receptors could potentially lead to a production of growth factors and other chemoattractants necessary for axonal guidance and sprouting. It is possible that GABA production by the Schwann cells might be directly involved in axonal sprouting. This is the case in neural development, when the growth cone must respond accurately to stimuli that direct its growth. This axonal navigation depends on extracellular concentration gradients of numerous guidance cues, including GABA (Bouzigues et al., 2007). Xenopus spinal growth cone behavior as well as olfactory neuron axonal guidance and target recognition are both modulated by a gradient of GABAB receptors (Xiang et al., 2002). It is conceivable that the increase in GABAB receptors seen in Schwann cells in the injured nerve is a natural response to stimulate arriving axons to grow. ACKNOWLEDGMENTS We are grateful for the expert technical assistance of Karen Rich. The MBP and Caspr antibodies were a kind gift from the laboratory of Dr. David R. Colman. The authors have no conflicts of interest. REFERENCES Beenhakker MP, Huguenard JR. 2010. Astrocytes as gatekeepers of GABAB receptor function. J Neurosci 30:15262–15276. Bettler B, Tiao JY. 2006. Molecular diversity, trafficking and subcellular localization of GABAB receptors. Pharmacol Ther 110:533–543. Journal of Neuroscience Research GABA and Its B Receptor in Schwann Cells Bettler B, Kaupmann K, Mosbacher J, Gassmann M. 2004. Molecular structure and physiological functions of GABAB receptors. Physiol Rev 84:835–867. Bouzigues C, Morel M, Triller A, Dahan M. 2007. Asymmetric redistribution of GABA receptors during GABA gradient sensing by nerve growth cones analyzed by single quantum dot imaging. Proc Natl Acad Sci U S A 104:11251–11256. Charles KJ, Evans ML, Robbins MJ, Calver AR, Leslie RA, Pangalos MN. 2001. Comparative immunohistochemical localisation of GABAB1a, GABAB1b, and GABAB2 subunits in rat brain, spinal cord, and dorsal root ganglion. Neuroscience 106:447–467. Charles KJ, Deuchars J, Davies CH, Pangalos MN. 2003. GABA B receptor subunit expression in glia. Mol Cell Neurosci 24:214–223. Desarmenien M, Feltz P, Occhipinti G, Santangelo F, Schlichter R. 1984. Coexistence of GABAA and GABAB receptors on A delta and C primary afferents. Br J Pharmacol 81:327–333. Faroni A, Castelnovo LF, Procacci P, Caffino L, Fumagalli F, Melfi S, Gambarotta G, Bettler B, Wrabetz L, Magnaghi V. 2014. Deletion of GABA-B receptor in Schwann cells regulates remak bundles and small nociceptive C-fibers. Glia 62:548–565. Fex Svenningsen Å, Kanje M. 1998. Regulation of Schwann cell proliferation in cultured segments of the adult rat sciatic nerve. J Neurosci Res 52:530–537. Fex Svenningsen A, Dahlin LB. 2013. Repair of the peripheral nerve— remyelination that works. Brain Sci 3:1182–1197. Fex Svenningsen A, Shan W-S, Colman D, Pedraza L. 2003. Rapid method for culturing embryonic neuron–glial cell cultures. J Neurosci Res 72:565–573. Fields RD, Stevens-Graham B. 2002. New insights into neuron–glia communication. Science 298:556–562. Fraser DD, Mudrick-Donnon LA, MacVicar BA. 1994. Astrocytic GABA receptors. Glia 11:83–93. Grubbs FE. 1969. Procedures for detecting outlying observations in samples. Technometrics 11:1–21. Hanani M. 2010. Satellite glial cells in sympathetic and parasympathetic ganglia: in search of function. Brain Res Rev 64:304–327. Hoke A, Redett R, Hameed H, Jari R, Zhou C, Li ZB, Griffin JW, Brushart TM. 2006. Schwann cells express motor and sensory phenotypes that regulate axon regeneration. J Neurosci 26:9646–9655. Jessen KR, Hills JM, Saffrey MJ. 1986. Immunohistochemical demonstration of GABAergic neurons in the enteric nervous system. J Neurosci 6:1628–1634. Jesuraj NJ, Nguyen PK, Wood MD, Moore AM, Borschel GH, Mackinnon SE, Sakiyama-Elbert SE. 2012. Differential gene expression in motor and sensory Schwann cells in the rat femoral nerve. J Neurosci Res 90:96–104. Kang J, Jiang L, Goldman SA, Nedergaard M. 1998. Astrocyte-mediated potentiation of inhibitory synaptic transmission. Nat Neurosci 1:683– 692. Kuner R, Kohr G, Grunewald S, Eisenhardt G, Bach A, Kornau HC. 1999. Role of heteromer formation in GABAB receptor function. Science 283:74–77. Lujan R, Shigemoto R, Lopez-Bendito G. 2005. Glutamate and GABA receptor signalling in the developing brain. Neuroscience 130: 567–580. Luyt K, Slade TP, Dorward JJ, Durant CF, Wu Y, Shigemoto R, Mundell SJ, Varadi A, Molnar E. 2007. Developing oligodendrocytes express functional GABAB receptors that stimulate cell proliferation and migration. J Neurochem 100:822–840. Magnaghi V. 2007. GABA and neuroactive steroid interactions in glia: new roles for old players? Curr Neuropharmacol 5:47–64. Journal of Neuroscience Research 295 Magnaghi V, Ballabio M, Cavarretta IT, Froestl W, Lambert JJ, Zucchi I, Melcangi RC. 2004. GABAB receptors in Schwann cells influence proliferation and myelin protein expression. Eur J Neurosci 19:2641– 2649. Magnaghi V, Ballabio M, Consoli A, Lambert JJ, Roglio I, Melcangi RC. 2006. GABA receptor-mediated effects in the peripheral nervous system: a cross-interaction with neuroactive steroids. J Mol Neurosci 28:89–102. Magnaghi V, Ballabio M, Camozzi F, Colleoni M, Consoli A, Gassmann M, Lauria G, Motta M, Procacci P, Trovato AE, Bettler B. 2008. Altered peripheral myelination in mice lacking GABAB receptors. Mol Cell Neurosci 37:599–609. Magnaghi V, Parducz A, Frasca A, Ballabio M, Procacci P, Racagni G, Bonanno G, Fumagalli F. 2010. GABA synthesis in Schwann cells is induced by the neuroactive steroid allopregnanolone. J Neurochem 112:980–990. Mudo G, Persson H, Timmusk T, Funakoshi H, Bindoni M, Belluardo N. 1993. Increased expression of trkB and trkC messenger RNAs in the rat forebrain after focal mechanical injury. Neuroscience 57:901–912. Nicoll RA. 1988. The coupling of neurotransmitter receptors to ion channels in the brain. Science 241:545–551. Oka M, Wada M, Wu Q, Yamamoto A, Fujita T. 2006. Functional expression of metabotropic GABAB receptors in primary cultures of astrocytes from rat cerebral cortex. Biochem Biophys Res Commun 341:874–881. Owens DF, Kriegstein AR. 2002. Is there more to GABA than synaptic inhibition? Nat Rev Neurosci 3:715–727. Pellegrino RG, Politis MJ, Ritchie JM, Spencer PS. 1986. Events in degenerating cat peripheral nerve: induction of Schwann cell S phase and its relation to nerve fibre degeneration. J Neurocytol 15:17–28. Perego C, Di Cairano ES, Ballabio M, Magnaghi V. 2012. Neurosteroid allopregnanolone regulates EAAC1-mediated glutamate uptake and triggers actin changes in Schwann cells. J Cell Physiol 227:1740–1751. Pfaffl MW. 2001. A new mathematical model for relative quantification in real-time RT-PCR. Nucleic Acids Res 29:e45. Pfaffl MW, Tichopad A, Prgomet C, Neuvians TP. 2004. Determination of stable housekeeping genes, differentially regulated target genes, and sample integrity: BestKeeper—Excel-based tool using pair-wise correlations. Biotechnol Lett 26:509–515. Ramakers C, Ruijter JM, Deprez RH, Moorman AF. 2003. Assumption-free analysis of quantitative real-time polymerase chain reaction (PCR) data. Neurosci Lett 339:62–66. Schoenen J, Delree P, Leprince P, Moonen G. 1989. Neurotransmitter phenotype plasticity in cultured dissociated adult rat dorsal root ganglia: an immunocytochemical study. J Neurosci Res 22:473–487. Stassart RM, Fledrich R, Velanac V, Brinkmann BG, Schwab MH, Meijer D, Sereda MW, Nave KA. 2013. A role for Schwann cellderived neuregulin-1 in remyelination. Nat Neurosci 16:48–54. Stefansk W. 1972. Rejecting outliers in factorial designs. Technometrics 14:469–479. Towers S, Princivalle A, Billinton A, Edmunds M, Bettler B, Urban L, Castro-Lopes J, Bowery NG. 2000. GABAB receptor protein and mRNA distribution in rat spinal cord and dorsal root ganglia. Eur J Neurosci 12:3201–3210. Urazaev AK, Grossfeld RM, Fletcher PL, Speno H, Gafurov BS, Buttram JG, Lieberman EM. 2001. Synthesis and release of Nacetylaspartylglutamate (NAAG) by crayfish nerve fibers: implications for axon–glia signaling. Neuroscience 106:237–247. Xiang Y, Li Y, Zhang Z, Cui K, Wang S, Yuan XB, Wu CP, Poo MM, Duan S. 2002. Nerve growth cone guidance mediated by G protein-coupled receptors. Nat Neurosci 5:843–848.