www.thaiagj.org
Thai Journal of Agricultural Science 2012, 45(3): 161-170
Association of ‘Candidatus Liberibacter asiaticus’, the Causal Agent of Citrus
Huanglongbing in Murraya paniculata and Diaphorina citri in Thailand
A. Jantasorn1, Y. Duan2, T. Puttamuk1, S. Zhang3 and N. Thaveechai1,*
1
Department of Plant Pathology, Faculty of Agriculture,
Kasetsart University, Bangkok 10900, Thailand
2
USDA-ARS-USHRL, Fort Pierce, FL, USA 34945
3
University of Florida, IFAS-TREC, Homestead, FL, USA 33031-3314
*Corresponding author. Email: agrnpt@ku.ac.th
Abstract
Orange jasmine, Murraya paniculata, is a preferred alternative host for the Asian citrus psyllid,
the primary vector of citrus Huanglongbing (HLB) disease caused by ‘Candidatus Liberibacter
asiaticus’ (Las). M. paniculata plant samples and psyllids on the Murraya plants from ten diverse
geographical regions of Thailand were collected and extracted for DNA to evaluate the presence
and titers of Las by conventional PCR and two different methods of real-time PCR. The data
showed variation of Las levels both in M. paniculata and psyllids in Thailand. Different titers
among individual psyllid sample were observed in each province of Thailand. Samples from
Chanthaburi province displayed the average titer level of HLB pathogen with Ct value of 21.85.
The highest titer level was found in sample from Nakhon Pathom province with Ct values of
16.12. The titer of Las is therefore low in M. paniculata and associated psyllids. The results
suggest that urban planting of M. paniculata may serve as a minor source of Las inoculum. Our
work provides a first association of the infection frequency of Las on psyllid vector from and M.
paniculata in Thailand which could be a potential source of inoculum for citrus HLB in Thailand.
Introduction
Citrus Huanglongbing (HLB), previously known
as citrus greening is one of the most destructive
disease on citrus in the world including Thailand.
The causal agent of HLB, ‘Candidatus
Liberibacter’, belongs to the alpha subdivision of
the Proteobacteria, is restricted in phloem sieve
tubes of infected plants and transmitted by psyllids,
or by grafting or by dodder transmission (Zhou et
al., 2007). Currently, three species of the pathogen,
“Candidatus
Liberibacter
asiaticus”
(Las),
‘Candidatus Liberibacter africanus’ (Laf), and
‘Candidatus Liberibacter americanus’ (Lam) are
recognized based on 16S rRNA. ‘Candidatus
Liberibacter asiaticus’, vectored by Asian citrus
psyllid (ACP, Diaphorina citri), is the most
prevalent in the world. In Asia, M. paniculata, an
ornamental rutaceous shrub, is a preferred host for
ACP. M. paniculata, and other species in this genus
are widely distributed in commercial nurseries and
grown as amenity trees. There is a potential risk for
spreading of HLB disease through commercial
Murraya spp. seedlings.
Both D. citri and Las utilize a number of host
plants besides cultivated Citrus spp. The D. citri
has reported hosts from at least twenty-three genera
within the family Rutaceae (Halbert and
Manjunath, 2004, Pena et al., 2006), although
germplasm varies in susceptibility to psyllid
infestations. Bergera koenigii, Citrus macrophylla,
“commercial citrus” and M. paniculata have been
reported as preferred host plants of the psyllid
(Halbert and Manjunath, 2004, Westbrook et al.,
2011, Yang et al., 2006). In a study of four host
species, the intrinsic rate of increase of the D. citri
population was highest on young grapefruit (Citrus
paradisi) (Tsai et al., 2000). ‘Ca. Liberibacter
asiaticus’ has been isolated from ten Rutaceous
genera (Deng et al., 2007, Folimonova et al., 2009,
162
A. Jantasorn et al.
Halbert and Manjunath, 2004), and can also be
transmitted to non-Rutaceaous plant species
including dodder (Cuscuta campestris), tobacco
(Nicotiana
tobacum),
tomato
(Solanum
lycopersicum) and periwinkle (Catharanthus
roseus) in the laboratory using dodder transmission
(Halbert and Manjunath, 2004, Zhou et al., 2007 ).
Host range of the HLB disease may be limited by
feeding preferences of the D. citri rather than by the
physiological potential of the bacteria (Halbert and
Manjunath, 2004). In Indonesia, M. paniculata
seedling exposed to D. citri obtained from fieldgrown citrus tree showed typical external and
internal symptom 10 months post-inoculation
(Tirtawidjaja, 1981). In Thailand, however, no
abnormalities were detected on orange jasmine and
curry leaf (Berhgera koenigii) plants 8 months after
infectious psyllids fed on them (Koizumi et al.,
1996). These studies should be interpreted with
caution since only visible symptom was evaluated
but no specific technique for HLB detection was
used for inoculated plant evaluation. In China, Las
was successfully detected in M. paniculata trees
with the used of nested but not standard PCR (Li
and Ke, 2002). In USA, successful HLB
transmission was reported from citrus to M.
paniculata via psyllids (Damsteegt et al., 2011) and
from M. paniculata to citrus by the parasitic plant,
dodder (Zhou et al., 2007). One alternative host
species that has the potential to be especially
problematic for Citrus production is the ornamental
plant M. paniculata (Bove, 2006). M. paniculata is
an excellent host for D. citri. (Halbert and
Manjunath, 2004, Tsai et al., 2000, Tsai et al.,
2002). Because M. paniculata may flush frequently,
or in the case of regular hedging nearly
continuously, D. citri are able to reproduce on this
plant at times when they could not reproduce on
Citrus, which may increase the psyllid population
in nearby Citrus plantings (Pluke et al., 2008, Yang
et al., 2006). Concern about the potential for spread
of the vector and disease has led the state of Florida
to restrict the conditions for propagation and sale of
M. paniculata in the State (Clark, 2007), but no
programs to manage existing plantings have been
implemented. There are less information of citrus
HLB on an alternate host especially M. paniculata
and psyllid vector (D. citri) in Thailand. Therefore,
this study is to document the incidence of Las in M.
Thai Journal of Agricultural Science
paniculata as alternate host and insect vector
psyllid (D. citri) in Thailand and to determine the
importance of M. paniculata plant and D. citri as a
inoculum source of citrus HLB. The infection status
of Las in M. paniculata and D. citri that dwell on
M. paniculata was collected from central, eastern
and some samples from northern parts of Thailand.
We documented total infection and seasonal trends
using conventional PCR and two different qPCR
detection methods for Las.
Materials and Methods
Collection Murraya paniculata Plants
Characterization on symptom expression of
Huanglongbing naturally infected citrus and
relative plants were determined. The Murraya
samples from diverse geographical regions were
collected in Thailand. The collection sites of
Murraya plants were selected in provinces of the
Northern Region, the Central Plain and the Eastern
Region. All of the Murraya plants were established
from cutting or macrottings. Symptomatology of
Huanglongbing on Murraya appeared as the same
symptoms reported elsewhere including vein
yellowing and the leaf symptom similar to zinc
deficiencies and symptomless .
Collection of Psyllids
Adults of D. citri were collected from both
visually healthy and symptomatic plants belonging
to M. paniculata, and related genera from diverse
geographical regions in Thailand, such as
commercial groves, retail, resident sites and discount
garden centers in different provinces of Thailand.
Adult psyllids were collected using an aspirator. The
insects were catalogued and stored in 75% ethanol in
2 mL tube for further analysis of Las and non-Las
infections. The psyllids were assigned unique
sample number and stored at -20°C until processed.
DNA Extraction Methods
All DNA extractions were performed in a sterile
laminar flow hood. Crude extractions of psyllid
DNA were made using a modification of the
method described in De Barro and Driver (1997).
Psyllids were stored in 70% ethanol at 4°C from
the time of collection until DNA extraction was
performed. Individual psyllids were place in a 2
Vol. 45, No. 3, 2012
Causal agent of citrus huanglongbing in Thailand
mL screw-cap tube (USA Scientific, Ocala, FL)
containing approximately twelve 1.6-1.8 mm
zirconium silicate beads (Ceroglass, Columbia, TN)
and 150 µL of lysis buffer (5%1M KCl, 5%1M Tris
at pH 8.4, 0.45% Tween20, 0.45%NP40, 89.1%
autoclaved deionized water). Tubes were placed in a
FastPrep-24-system (MP Biomedicals, Solon, OH)
and homogenized for 30s at 6 m s-1. following
homogenization, 100 µL of liquid was transferred to
a clean 1.5 mL centrifuge tube (USA Scientific), and
placed in a water bath at 65°C for 15 min. Samples
were immediately placed on ice for at least 10 min,
and then centrifuged at 14,000 rpm for 5 min. the
supernatant was removed and stored at -20°C until
qPCR was performed.
Leaf midribs were used for DNA extraction from
M. paniculata because this tissue contains the
highest titers of Las in Citrus trees (Li et al., 2009).
M. paniculata samples were extracted using a buffer
based extraction method as follows: 900 µl of
extraction buffer (for 1000 mL buffer: 12.1 g TrisBase, 18.61 g EDTA (pH of solution adjusted to 8.0
using 5 M NaOH to facilitate EDTA dissolution),
29.22 g NaCl, 25 g PVP; β-mercaptoethanol added
to buffer just before use at 0.7 mL mL-1) was added
to the tubes containing slingshot pellets and plant
sample, and the tubes were homogenized in a
FastPrep-24-system for 40 sec at 6 m s-1. following
homogenization, 40 µL of 20% SDS was added and
the samples were vortexed. Samples were placed in
a 65°C water bath for 30 min, and stirred by
inverting the tube every ten minutes. Samples were
removed from the water bath, centrifuged at 14,000
rpm for 10 min, and 700 µL of supernatant for each
sample was transferred to a new 1.5 mL centrifuge
tube. A volume of 220 µL of 5M KoAC was added
to the supernatant, and the samples were placed on
ice for at least 20 min. After removal from the ice,
the samples were centrifuged at 14,000 rpm for 10
min, and 650 µL of the upper aqueous layer was
transferred to a new 1.5 mL tube. A volume of 460
µL of cold 70% isopropyl alcohol was added to the
samples, the samples were vortexed, and placed on
ice for at least 5 min. After removal from the ice,
samples were vortexed at 14,000 rpm for 30 min at
4°C, the supernatant was discarded, and the pellet
was washed by placing 700 µL cold 70% ethanol in
the tubes for 15 min the liquid phase was discarded,
and the pellet was allowed to dry in a laminar flow
163
hood. Samples were resuspended in 100 µL
nuclease-free water (Qiagen, Valencia, CA).
Prior to qPCR analysis, the nucleic acid
concentration of all plant samples was determined
by spectrophotometry at a wavelength of 260 nm
using a Nanodrop-1000 detector (NanoDrop
Products, Wilmington, DE). Samples were diluted
in nuclease-free water so that 100 ng of DNA was
loaded per reaction for the rest of M. paniculata
samples. Plant samples were stored at -20°C until
qPCR was performed.
Conventional PCR Amplification
The CGO3F (RGG GAA AGA TTT TAT TGG
AG) and CGO5R (GAA AAT AYC ATC TCT
GAT ATC GT) primers set were used for
conventional PCR in this study. DNA amplification
was performed in a final volume of 20 µL
containing 10 µL of 2X buffer D (Epicentre
Biotechnologies, Madison, WI, USA), 250 nmol of
each forward/reverse primer, 1.25 units of Taq
DNA polymerase (New England BioLabs Inc.,
Ipswich, MA, USA), and 1 to 2 µL of genomic
template DNA from Las which was extracted from
midribs of orange jasmine, psyllid vectors and Las
cultures. Conditions of PCR preparation were
denaturation at 95°C for 3 min, followed by 35
cycles of amplification with denaturation at 94°C
for 45 sec, annealing at melting temperature at
52°C for 30 sec, and DNA extension at 72°C for 1
min with a final extension at 72°C for 10 min using
a thermocycler (Perkin- Elmer 9600/Applied
Biosystem, Bedford, MA). The PCR products were
separated by 1% agarose gel electrophoresis in
TAE buffer, the gel was stained with ethidium
bromide and amplified DNA bands were viewed
under UV-transilluminator.
PCR Detection of ‘Candidatus Liberibacter
Asiaticus’
All samples were assayed by qPCR with the
LJ900f/r series primers (5’-3’ sequences: forward
GCCGTTTTAACACAAAAGATGAATATC,
reverse ATAAATCAATTTGTTCTAGTTTACGAC)
described in Zhou et al. (2011) LJ900f/r primers
target the 1-12 tandem repeats of the hyvI and hyvII
genes of Las prophages, and were used because
they provide a high degree of sensitivity in a 1strep qPCR reaction. Briefly, 2 µL of the DNA
164
A. Jantasorn et al.
template from psyllid or 100ng of Murraya DNA
were used in a qPCR reaction totaling 15 µl using
the PerfeCTa SYBR Green FastMix 2x master mix
(Quanta Biosciences, Inc., Gaithersburge, MD),
and a reaction concentration of 600 nM forward
and 900 nM reverse primer, and nuclease-free
water. Reactions were run on Mastercycler
Realplex Real time PCR system (Eppendorf Inc.,
Hauppaugeny, NY, USA) with amplification
setting of: initial denaturation at 95°C for 5 min,
then 40 cycles of 95°C for 3 sec, followed by 62°C
for 30 sec. at the end of each run a disassociation
cycle of 95°C for 15 sec, 62°C for 1 min, and a
gradual ramp to 97°C for 15 s was performed. All
run included positive and at least four no template
controls. All samples were assigned at Ct value
based on the cycle when fluorescence exceeded
0.2∆Rn. samples that did not produce the correct
melt curve were assigned a value of undetermined.
Any sample that amplified (at any cycle) and had
the correct melt profile was re-run in triplicate.
Samples that amplified and had the correct melt
profile in at least two of the three triplicate runs
were considered positive detections.
As a check for our results using LJ900f/r, all
psyllid and plant samples that tested positive by the
LJ900 primer as well as 50 randomly selected
negative samples of each type were run on the
HLBaspr primer 5’-3’ sequences: forward
TCGAGCGCGTATGCGAATACG,
reverse
GCGTTATCCCGTAGAAAAAGGTAG,
probe
AGACGGGTGAGTAACGCG
with
6carboxyfluorescein (6-FAM) reporter dye on the 5’
end and Iowa Black FQ on the 3’, IDT,
www.idt.com), with target the 16S rRNA of Las
(Li et al., 2006). These primers are among the most
common methods for diagnostic detection of Las,
and have been used to detect Las in D. citri (Lopes
et al., 2010) and M. paniculata (Damsteegt et al.,
2011). For HLBaspr, we ran a 15 µL reaction,
including TaqMan Universal PCR Mastermix
(Applied Biosystems, Beverly, MA, USA), a
reaction concentration of 0.4 mM each primer, and
a reaction concentration of 500nM probe, and
nuclease-free water. qPCR reaction were run on the
Mastercycler Realplex Real time PCR system
(Eppendorf Inc., Hauppaugeny, NY, USA) with
amplification setting of: initial denaturation at 95°C
for 5 min, followed by 40 cycles of 95°C for 3 sec,
Thai Journal of Agricultural Science
then by 60°C for 30 sec. All samples were assigned
at Ct value based on the cycle when fluorescence
exceeded 0.2∆Rn.
Results
Murraya paniculata Surveys
Total of 134 orange jasmine (Murraya
paniculata) trees were collected from diverse
geographical regions in Thailand. Mostly the
samples located in Central plain and some samples
located in Northern and Eastern plain of Thailand.
‘Ca. Liberibacter asiaticus’ was detected by
conventional PCR in ten samples from Pathum
Thani, Lop Buri, Bangkok, Rayong and
Chanthaburi provinces respectively. All the
remaining trees were infected by only on species of
liberibacter that positive with Las specific primer.
‘Ca. Liberibacter asiaticus’ was present in 7.46%
of all conventional PCR positive orange jasmine
trees (Table 1). The highest incidence of Las
infected Murraya trees was observed from Rayong
province (30%) in Eastern region whereas the
lowest incidence of Las was from Bangkok and
Pathum Thani provinces (6.6%) in the Central plain
region (Table 1). The positive samples of Las
infection from conventional PCR methods were
shown in Figure 2. Quantitative determination of
Las population for potential of infected Murraya
trees as a reservoir of liberibacter, was done by
qPCR to further analyse the DNA samples of all
surveyed trees. No obvious differences in size and
symptom severity of ‘Ca. Liberibacter asiaticus’
infected Murraya tree were observed between
locations and survey period at the time of sample
collection. Also, no visible differences were
detected between PCR positive and PCR negative
trees. However, visible differences in symptom
severity were found in samples infected by ‘Ca.
Liberibacter asiaticus’ from Rayong province and
Chanthaburi provinces. The symptom shown
yellow and wavy leaves which was similar to
nitrogen deficiency (Figure 1). Mottled leaves and
fruits with aborted seeds, both characteristics of
HLB in citrus were not observed in the PCR
positive Murraya trees. The yellowing of Murraya
leaves included a variety of chlorotic patterns, most
frequently that resembling nitrogen deficiency.
Vol. 45, No. 3, 2012
Causal agent of citrus huanglongbing in Thailand
165
Table 1 Detection of ‘Candidatus Liberibacter asiaticus’ by conventional PCR of Murraya paniculata collected
from different provinces of Thailand.
Location (province)
Number of sample
Central plain
Bangkok
Chainat
Lop Buri
Nakhon Pathom
Pathum Thani
Phetchaburi
Samut Songkhram
Saraburi
Eastern plain
Chanthaburi
Chon Buri
Rayong
Trat
Northern plain
Chiang Mai
Kamphaeng Phet
Total
No. Infected by ‘Ca.
Liberibacter asiaticus’ (%)
30
3
5
20
30
3
2
5
2
2
15
10
6
0
3 (13.3)
4 (30)
0
2
1
134
(6.6)
0
1
(20)
0
2
(6.6)
0
0
0
0
0
10 (7.46)
presence of Las and to evaluate the Las population
levels. The number collected for each site and date
was varied. Only 39 (16.8%) psyllids from 10
provinces were positive for Las by the LJ900
method. The Ct values for the psyllids where Las
was detected using the LJ900 primers ranging from
17.57-29.87 (Table 2). The psyllids from which
we isolated the highest number of copies of
hyvI/hyvII also had a detectable number of copies of
the 16S rRNA gene of Las. Fourty-two (18.1%)
psyllids were positive for Las by using HLBaspr
primers. The Ct values were highly variable with
Ct values ranged from 16.12 to 36.74 using primers
and probe targeting on 16S rRNA gene (Table 2).
Figure 1 Murraya paniculata leaves with various degree of
yellowing symptom of huanglongbing that tested positive for
‘Candidatus Liberibacter asiaticus’ by Conventional PCR. A
and B the samples collected from Rayong province and C and
D the samples collected from Chanthaburi province.
Prevalence of Las in Psyllid Samples
Over the course of the experiment, 232 psyllids
samples collected from Murraya plants at different
locations in Thailand were tested to determine the
Prevalence of Las in Murraya paniculata
Samples
The Murraya samples covering all fourteen
provinces in Thailand collected from the month of
January, March, July, and August 2010 were
retained in the analysis. Of these 44 samples, six
tested positive for the hyvI/hyvII target DNA
sequence. The positive samples represented in
Pathum Thani, Nakhon Pathom, Chanthaburi,
166
A. Jantasorn et al.
Thai Journal of Agricultural Science
(A)
M 1 2 3 4
5 6 7 8 9 10 11 12 13 14 15 16 17
(B)
M
1 2
3
4
5
6
7 8
9 10 11 12 13 14
Figure 2 PCR detection of ‘Candidatus Liberibacter asiaticus’ isolated from Murraya paniculata leaves using Las-specific
primers targeting the 16S rDNA. Lane 1 water control; lane 2 healthy plant control; lane 3 and 4 the samples collected from
Chiang Mai province; lane 5 and 6 the samples collected from Chai Nat province; lane 7 and 8 the samples collected from
Pathum Thani province; lane 9 the samples collected from Lop Buri province; lane 10 and 11 the samples collected from
Chanthaburi province; lane 12 and 13 the samples collected from Samut Sakhon province; lane 14 and 15 Trat province;
lane 16 Kamphaeng Phet province; lane 17 positive control; lane M 1kb DNA Ladder (Promega) (A). Lane M 1kb DNA
Ladder (Promega); lane 1 and 2 the samples collected from Bangkok province; lane 3 and 4 the samples collected from
Phetchaburi province; lane 5, 6 and 7 the samples collected from Rayong province; lane 8 and 9 the samples collected from
Chon Buri province; lane 10 and 11 the samples collected from Nakhon Pathom province; lane 12, 13 and 14 the samples
collected from Bangkok (B).
Table 2 Detection of ‘Candidatus Liberibacter asiaticus’ from psyllids (Diaphorina citri) collected from different
provinces of Thailand by two primer set of real-time PCR.
Location
(Province)
Totals
Bangkok
Lop Buri
Nakhon Pathom
Pathum Thani
Samut Sakhon
Saraburi
Chanthaburi
Chon Buri
Nakhon Nayok
Kamphaeng Phet
Total
27
23
22
24
20
24
27
20
22
23
232
1/
2/
LJ900f/r1/
No. of positive
Range of Ct values
sample
(Ct ≤30)
2
1
2
6
3
2
4
4
4
11
39 (16.8%)
28.69-28.98
29.85
19.39-27.93
27.16-29.65
25.45-29.31
28.61-29.40
17.57-29.87
24.36-29.93
25.65-29.44
24.40-29.76
Primers LJ900f/r target the hyvI/hyvII gene of Las prophages.
Primer HLBaspr target 16S rRNA of Las.
HLBaspr2/
No. of positive
Range of Ct values
sample
(Ct ≤36.9)
6
3
1
3
1
4
6
2
2
14
42 (18.1%)
33.47-36.66
33.95-35.06
16.12
35.90-36.74
24.79
29.33-36.63
21.85-36.44
33.02-33.43
33.93-34.83
29.83-36.65
Vol. 45, No. 3, 2012
Causal agent of citrus huanglongbing in Thailand
Rayong and Trat provinces. We were able to
amplify 16S rRNA of Las from 20 of the 44
samples that some samples tested positive for
hyvI/hyvII (Table 3).
Discussion
The presence of ‘Ca. Liberibacter asiaticus in
Murraya in urban area was demonstrated. DNA
sequence comparison revealed no variation in the
16S rRNA gene within each species, suggesting
that the Murraya and citrus associated with
liberibacters are probably the same. Although both
citrus and Murraya was found to be host of ‘Ca.
Liberibacter asiaticus’ in the cities, their responses
to infection seemed to differ considerably. A few
Murraya trees found infected in 2010 were
observed for subsequent symptom development in
the Rayong and Chanthaburi provinces. The
damage to Murraya was much less severe than that
on citrus. The presence of Las infection in M.
paniculata samples using a detection method with
the LJ900fr primers targeting on hyvI/hyvII
prophage region was extremely low. Twenty of M.
paniculata plant samples that amplified using the
16S rRNA primers had a high Ct value, similar to
what we have observed in running these primers
against other species of bacteria (unpublished). The
only some sample in this experiment that would be
considered positive with low Ct value by 16S
rRNA detection method was psyllid where
amplification was detected using the HLBaspr
primers. There are conflicting reports about
whether transovarial transmission of Las occurs in
D. citri (Pelz-Stelinski et al., 2010 and Xu et al.,
1988). If transovarial transmission occurs, it is
possible that this infection originated from an
infected female that migrated to M. paniculata from
citrus. M. paniculata infections were detected when
using primers targeting the bacterial 16S rRNA
gene than with using primers targeting the hyvI/hyvII
tandem repeat sequence. The discrepancies between
the two primer sets could occur for several reasons.
The most likely is that more infections were
detected using the 16S rRNA primers because of
higher sensitivity of that method and 16S rRNA
regions are the best characterized regions, highly
conserved among the species of ‘Candidatus
Liberibacter spp. The M. paniculata plants were
167
positive with high Ct value by 16S rRNA primer.
This suggests that ‘Ca. Liberibacter asiaticus’ either
was decreased multiplying in plant or that M.
paniculata is not a good alternate host for Las
which may contain some inhibitors.
The rate of Las infection of D. citri that
developed on M. paniculata is low relative to that
of D. citri that develop on citrus, and also lower
than infection rates published for the potato-tomato
psyllid, Bactericera cockerelli and another
Liberibacter species, ‘Candidatus Liberibacter
solanacearum’ (Liefting et al., 2008). Using
conventional and quantitative PCR, the infection
level of D. citri collected from infected citrus in the
field is 45-82% (Ammar et al., 2011; Hung et al.,
2004; Subandiya et al., 2000). The infection rate of
Bactericera cockerelli with ‘Ca. Liberibacter
solanacearum’ was 19-20% when the psyllids were
collected directly from their host plants (Wen et al.,
2010). The low rate of infection and level of
bacterial titer in both plant and a psyllid sample
raises the possibility that M. paniculata may have a
unique resistance trait for Las. Some citrus
cultivars do not display severe symptoms when
they contact Las but they have a bacterial load
similar to diseased citrus (Folimonova et al., 2009)
and several orders of magnitude higher than we
found in M. paniculata. The fact that M. paniculata
has both a low level of infection and a low titer of
bacteria in infected plants despite psyllid movement
to and from citrus and high levels of HLB incidence
in the local citrus population indicates that a trait of
the plant may be restricting reproduction or
movement of the bacteria. The bacterium appear to
remain at a low titer in the psyllids originated on M.
paniculata despite the fact that Las has been
reported to replicate in D. citri (Hung et al., 2004,
Inoue et al., 2009).
In addition to citrus, M. paniculata (orange
jasmine) is a preferred host of D. citri, and retail
trade in this ornamental shrub is strongly implicated
in the distribution of D. citri. M. paniculata is
reported to be a cryptic or largely asymptomatic
host of “Ca. Liberibacter” (Clark, 2007), but
another report concludes that the bacteria cannot
replicate in M. paniculata (Anonymous, 2011). The
epidemiological significance of Murraya as a host
for the HLB pathogen is therefore unclear. The
taxonomy of Murraya paniculata is uncertain wild
168
A. Jantasorn et al.
Thai Journal of Agricultural Science
Table 3 Detection of ‘Candidatus Liberibacter asiaticus’ from Murraya paniculata collected from different provinces
of Thailand by real time PCR.
Location (Province)
Bangkok
Lop Buri
Nakhon Pathom
Pathum Thani
Samut Sakhon
Samut Songkhram
Saraburi
Chanthaburi
Chon Buri
Nakhon Nayok
Rayong
Trat
Kamphaeng Phet
Total
Total
5
1
5
6
1
1
2
9
2
2
4
4
2
44
LJ900f/r
No. of positive
Range of Ct
sample
values (Ct ≤30)
0
0
1
29.11
1
26.88
0
0
0
2
25.69-29.45
0
0
1
29.17
1
29.25
0
6 (13.6%)
M. paniculata is distributed across Southeast Asia
including India, Ceylon, Burma, China, Taiwan, the
Malay Peninsula, Philippines, and the Melanesian
Island (Swingle et al., 1967). The wild plant has
been brought into cultivation at least two times
(Mabberley, 1998). Although, the authors of the
study stated that further analysis was necessary
before dividing the group into two species.
Regardless of origin, the domesticated plant often
referred to as species or cultivar exotica
(Mabberley, 1998). Samuel et al., (2001) suggested
that M. paniculata and M. exotica should be
separated based on differences in non-coding
plastid DNA sequence, but bootstrap support for
this division was low. We describe the plants that
we collected in this study as M. paniculata.
This survey documents demonstrated very low
rate of Las infection in urban planting of M.
paniculata and D. citri fed on these plants, much
lower than occur in citrus and psyllids from citrus.
In the few case where plant and psyllid samples
tested positive, only low titers of the pathogen were
present. These results suggest that urban planting of
M. paniculata may play only a minor role as a
direct reservoir of Las for HLB infection in citrus.
The failure to find any symptoms could be
specifically associated with low titer of liberibacter
in the natural infected trees or M. paniculata
contains a resistant trait to HLB.
HLBaspr
No. of positive
Range of Ct
sample
values (Ct ≤36.9)
0
1
27.89
4
33.27-34.11
4
32.44-34.60
0
0
1
28.20
3
32.09-35.33
0
1
30.91
3
27.36-36.45
3
32.23-36.43
0
20 (45.5%)
Acknowledgments
This work was supported financially by the
Royal Golden Jubilee Ph.D. program through
Thailand Research Fund (TRF). We thank USDAARS-USHRL, Fort Pierce, FL, USA for use of
research facilities, Christina Latza for technical
support and especially Dr. Lijuan Zhou for
vulnerable advice.
References
Ammar, E-D., R.G.J. Shatters, C. Lynch and D.G. Hall.
2011. Detection and relative titer of Candidatus
Liberibacter asiaticus in the salivary glands and
alimentary canal of Diaphorina citri (Hemiptera:
Psyllidae) vector of citrus huanglongbing disease.
Ann. Entomol. Soc. Ann. 104: 526-533.
Anonymous. 2011 Citrus Health Response Program,
Known Distribution of Citrus Canker/Citrus
Greening (HLB) in Florida. Florida Division of Plant
Industry.http://www.freshfromflorida.com/pi/chrp/Ar
cReader/ArcReader.html Accessed on 11 July 2011.
Bove, J.M. 2006. Huanglongbing: a destructive, newlyemerging, century-old disease of citrus. J. Plant
Pathol. 88 (1):7-37.
Clark, R.A. 2007 Notice of intent to add orange jasmine
to the citrus greening host list. Florida Department of
Agriculture and Consumer Services Division of Plant
Industry.http://www.doacs.state.fl.us/pi/chrp/greenin
g/Orange_jasmine_Notice_2.pdf accessed 30 August
2010.
Vol. 45, No. 3, 2012
Causal agent of citrus huanglongbing in Thailand
Damsteegt, V.D., E.N. Postnikova, A.L. Stone, M.
Kuhlmann, C. Wilson, N.W. Schaad, R.H. Brlansky
and W.L. Schneider. 2010. Murraya paniculata and
related species as potential hosts and inoculum
reservoirs of 'Candidatus Liberibacter asiaticus',
causal agent of huanglongbing. Plant Dis. 94: 528533.
de Barro, P.J. and F. Driver. 1997. Use of RAPD PCR to
distinguish the B biotype from other biotypes of
Bemisia
tabaci
(Gennadius)
(Hemiptera:
Aleyrodidae). Aust. J. Entomol. 36: 149-152.
Deng, X., G. Zhou, H. Li, J. Chen and E.L. Civerolo.
2007. Detection of Candidatus Liberibacter asiaticus
from wampee (Clausena lansium Skeels) by nested
PCR. Plant Health Prog.
Folimonova, S.Y., C.J. Robertson, S.M. Garnsey, S.
Gowda and W.O. Dawson. 2009. Examination of the
responses of different genotypes of citrus to
huanglongbing (citrus greening) under different
conditions. Phytopathology 99: 1346-1354.
Halbert, S.E. and K.L. Manjunath. 2004. Asian citrus
psyllids (Sternorrhyncha: Psyllidae) and greening
disease of citrus: a literature review and assessment
of risk in Florida. Fla. Entomol. 87: 330-353.
Hung, T.H., S.C. Hung, C.N. Chen, M.H. Hsu and H.J.
Su. 2004. Detection by PCR of Candidatus
Liberibacter asiaticus, the bacterium causing citrus
huanglongbing in vector psyllids: application of the
study of vector-pathogen relationship. Plant Pathol.
53: 96-102.
Inoue, H., J. Ohnishi, T. Ito, K. Tomimura, S. Miyata, T.
Iwanami and W. Ashihara. 2009. Enhanced
proliferation and efficient transmission of
Candidatus Liberibacter asiaticus by adult
Diaphorina citri after acquisition feeding in the
nymphal stage. Ann. Appl. Biol. 155: 29-36.
Koizumi, M., M. Prommintra and Y. Ohtsu. 1996. Wood
apple, Limonia acidissima: a new host for the
huanglongbing (greening) vector, Diaphorina citri,
pp. 271-275. In J.V. da Graca, P. Moreno, R.K.
Yokomi, eds., Proceeding of the thirteenth
Conference of the International Organization of
Citrus Virologist, 1996. Riverside, CA, USA:IOCV.
Liefting, L.W., Z.C. Perez-Egusquiza, G.R.G. Clover
and J.A.D. Anderson. 2008. A new ‘Candidatus
Liberibacter’ species in Solanum tuberosum in New
Zealand. Plant Dis. 92: 1474-1474.
Li, W., L. Levy and J.S. Hartung. 2009. Quantitative
distribution of 'Candidatus Liberibacter asiaticus' in
citrus
plants
with
citrus
huanglongbing.
Phytopathology 99: 139-144.
Li, W., J.S. Hartung and L. Levy. 2006. Quantitative
real-time PCR for detection and identification of
Candidatus Liberibacter species associated with
citrus huanglongbing. J. Microbiol. Meth. 66: 104115
Li, T. and C. Ke. 2002. Detection of the bearing rate of
Liberibacter asiaticum in citrus psylla and its host
plant Murraya paniculata by nested PCR. Acta
Phytophylacica Sinica 29: 31-35.
169
Lopes, S.A., G.F. Frare, L.E.A. Camargo, N.A. Wulff,
D.C. Teixeira, R.B. Bassanezi, G.A.C. Beattie and
A.J. Ayres. 2010. Liberibacters associated with
orange jasmine in Brazil: incidence in urban areas
and relatedness to citrus liberibacters. Plant Pathol.
59: 1044-1053.
Mabberley, D.J. 1998. Australian Citreae with notes on
other Aurantioideae (Rutaceae). Telopea 7: 333-344.
Pelz-Stelinski, K.S., R.H. Barlansky, T.A. Ebert and
M.E. Rogers. 2010. Transmission parameters of
Candidatus Liberibacter asiatcus by Asian citrus
psyllid (Hemiptera: Psyllidae). J. Econ. Entomol.
103: 1531-1541.
Pena, J.E., C.M. Mannion, B.J. Ulmer and S.E. Halbert.
2006. Jackfruit, Artocarpu445 sheterophylus, is not a
host of Diaphorina citri (Homoptera: Psyllidae) in
Florida. Fla. Entomol. 89: 412-413.
Pluke, R.W.H., J.A. Qureshi and P.A. Stansly. 2008.
Citrus
flushing
patterns,
Diaphorina
citri
(Hemiptera: Psyllidae) populations and parasitism by
Tamarixia radiata (Hymenoptera: Eulophidae) in
Puerto Rico. Fla. Entomol. 91: 36-42.
Samuel, R., F. Ehrendorfer, M.W. Chase and H. Greger.
2001. Phylogenetic analyses of Aurantiodeae
(Rutaceae) based on non-coding plastid DNA
sequences and phytochemical features. Plant Biol. 3:
77-87.
Subandiya, S., N. Nikoh, S. Tsuyumu, S. Somowiyarjo
and T. Fukatsu. 2000. Complex endosymbiotic
microbiota of the citrus psyllid Diaphorina citri
(Homoptera: Psyllidae). Zoo Sci. 17: 983-989.
Swingle, W.T. and P.C. Reece. 1967. The botany of
citrus and its wild relatives. Page available online at
http://websites.lib.ucr.edu/agnic/webber/Vol1/Vol1T
P.html
Tirtawidjaja, S. 1981. Insect, dodder and seed
transmission of citrus vein phloem degeneration
(CVPD), pp. 469-471. Proceedings of the fourth
International Society of Citriculture Congress.
Tokyo, Japan, 1981. International Society of
Citriculture.
Tsai, J.H. and Y.H. Liu. 2000. Biology of Diaphorina
citri (Homoptera: Psyllidae) on four host plants. J.
Econ. Entomol. 93: 1721-1725.
Tsai, J.H., J.J. Wang and Y.H. Liu. 2002. Seasonal
abundance of the Asian citrus psyllid, Diaphorina
citri (Homoptera: Psyllidae) in southern Florida. Fla.
Entomol. 85: 446-451.
Wen, A., X. Wang, R.M. Harveson, J.D. Bradshaw and
N. Gudmestad. 2010. Frequency of “Candidatus
Liberibacter asiaticus” in potato psyllid and
Solanaceaous weeds, pp. 154-158. In F. Workneh
and C.M. Rush, eds., Proceedings of the 10th Annual
Zebra Chip Reporting Session, Texas A&M
University, Dallas, TX.
Westbrook, C.J., D.G. Hall, E. Stover, Y.P. Duan and
R.F. Lee. 2011. Colonization of Citrus and Citrusrelated germplasm by Diaphorina citri (Hemiptera:
Psyllidae). Hort. Science 46: 1-9.
170
A. Jantasorn et al.
Xu, C.,Y. Tia, K. Li, and C. Ke 1988 . Further study of
transmission of citrus huanglongbing by a psyllid,
Diaphornina citri
Kuwayama, pp. 243-248.
Proceeding of the 10th Conferences, International
Organization of Citrus Virologists. Riverside,
California.
Yang, Y., M. Huang, G.A. C.Beattie, Y. Xia, G. Ouyang,
and J. Xiong. 2006. Distribution, biology, ecology
and control of the psyllid Diaphorina citri
Kuwayama, a major pest of citrus: a status report for
China. Int. J. Pest Management 52: 343-352.
Thai Journal of Agricultural Science
Zhou, L., C.A. Powell, M.T. Hoffman, W. Li, G. Fan, B.
Liu, H. Lin and Y. Duan. 2011. Diversity and
plasticity of the intracellular plant pathogen and
insect symbiont, 'Candidatus Liberibacter asiaticus',
revealed by hyper variable prophage genes with
intragenic tandem repeats. Appl. Environ. Microb.
77: 6663-6673.
Zhou, L.J., D.W. Gabriel, Y.P. Duan, S.E. Halbert and
W.N. Dixon. 2007. First report of dodder
transmission of huanglongbing from naturally
infected Murraya paniculata to citrus. Plant Dis. 91:
227.
Manuscript received 5 March 2012, accepted 16 November 2012
Now online at http://www.thaiagj.org