www.thaiagj.org Thai Journal of Agricultural Science 2012, 45(3): 161-170 Association of ‘Candidatus Liberibacter asiaticus’, the Causal Agent of Citrus Huanglongbing in Murraya paniculata and Diaphorina citri in Thailand A. Jantasorn1, Y. Duan2, T. Puttamuk1, S. Zhang3 and N. Thaveechai1,* 1 Department of Plant Pathology, Faculty of Agriculture, Kasetsart University, Bangkok 10900, Thailand 2 USDA-ARS-USHRL, Fort Pierce, FL, USA 34945 3 University of Florida, IFAS-TREC, Homestead, FL, USA 33031-3314 *Corresponding author. Email: agrnpt@ku.ac.th Abstract Orange jasmine, Murraya paniculata, is a preferred alternative host for the Asian citrus psyllid, the primary vector of citrus Huanglongbing (HLB) disease caused by ‘Candidatus Liberibacter asiaticus’ (Las). M. paniculata plant samples and psyllids on the Murraya plants from ten diverse geographical regions of Thailand were collected and extracted for DNA to evaluate the presence and titers of Las by conventional PCR and two different methods of real-time PCR. The data showed variation of Las levels both in M. paniculata and psyllids in Thailand. Different titers among individual psyllid sample were observed in each province of Thailand. Samples from Chanthaburi province displayed the average titer level of HLB pathogen with Ct value of 21.85. The highest titer level was found in sample from Nakhon Pathom province with Ct values of 16.12. The titer of Las is therefore low in M. paniculata and associated psyllids. The results suggest that urban planting of M. paniculata may serve as a minor source of Las inoculum. Our work provides a first association of the infection frequency of Las on psyllid vector from and M. paniculata in Thailand which could be a potential source of inoculum for citrus HLB in Thailand. Introduction Citrus Huanglongbing (HLB), previously known as citrus greening is one of the most destructive disease on citrus in the world including Thailand. The causal agent of HLB, ‘Candidatus Liberibacter’, belongs to the alpha subdivision of the Proteobacteria, is restricted in phloem sieve tubes of infected plants and transmitted by psyllids, or by grafting or by dodder transmission (Zhou et al., 2007). Currently, three species of the pathogen, “Candidatus Liberibacter asiaticus” (Las), ‘Candidatus Liberibacter africanus’ (Laf), and ‘Candidatus Liberibacter americanus’ (Lam) are recognized based on 16S rRNA. ‘Candidatus Liberibacter asiaticus’, vectored by Asian citrus psyllid (ACP, Diaphorina citri), is the most prevalent in the world. In Asia, M. paniculata, an ornamental rutaceous shrub, is a preferred host for ACP. M. paniculata, and other species in this genus are widely distributed in commercial nurseries and grown as amenity trees. There is a potential risk for spreading of HLB disease through commercial Murraya spp. seedlings. Both D. citri and Las utilize a number of host plants besides cultivated Citrus spp. The D. citri has reported hosts from at least twenty-three genera within the family Rutaceae (Halbert and Manjunath, 2004, Pena et al., 2006), although germplasm varies in susceptibility to psyllid infestations. Bergera koenigii, Citrus macrophylla, “commercial citrus” and M. paniculata have been reported as preferred host plants of the psyllid (Halbert and Manjunath, 2004, Westbrook et al., 2011, Yang et al., 2006). In a study of four host species, the intrinsic rate of increase of the D. citri population was highest on young grapefruit (Citrus paradisi) (Tsai et al., 2000). ‘Ca. Liberibacter asiaticus’ has been isolated from ten Rutaceous genera (Deng et al., 2007, Folimonova et al., 2009, 162 A. Jantasorn et al. Halbert and Manjunath, 2004), and can also be transmitted to non-Rutaceaous plant species including dodder (Cuscuta campestris), tobacco (Nicotiana tobacum), tomato (Solanum lycopersicum) and periwinkle (Catharanthus roseus) in the laboratory using dodder transmission (Halbert and Manjunath, 2004, Zhou et al., 2007 ). Host range of the HLB disease may be limited by feeding preferences of the D. citri rather than by the physiological potential of the bacteria (Halbert and Manjunath, 2004). In Indonesia, M. paniculata seedling exposed to D. citri obtained from fieldgrown citrus tree showed typical external and internal symptom 10 months post-inoculation (Tirtawidjaja, 1981). In Thailand, however, no abnormalities were detected on orange jasmine and curry leaf (Berhgera koenigii) plants 8 months after infectious psyllids fed on them (Koizumi et al., 1996). These studies should be interpreted with caution since only visible symptom was evaluated but no specific technique for HLB detection was used for inoculated plant evaluation. In China, Las was successfully detected in M. paniculata trees with the used of nested but not standard PCR (Li and Ke, 2002). In USA, successful HLB transmission was reported from citrus to M. paniculata via psyllids (Damsteegt et al., 2011) and from M. paniculata to citrus by the parasitic plant, dodder (Zhou et al., 2007). One alternative host species that has the potential to be especially problematic for Citrus production is the ornamental plant M. paniculata (Bove, 2006). M. paniculata is an excellent host for D. citri. (Halbert and Manjunath, 2004, Tsai et al., 2000, Tsai et al., 2002). Because M. paniculata may flush frequently, or in the case of regular hedging nearly continuously, D. citri are able to reproduce on this plant at times when they could not reproduce on Citrus, which may increase the psyllid population in nearby Citrus plantings (Pluke et al., 2008, Yang et al., 2006). Concern about the potential for spread of the vector and disease has led the state of Florida to restrict the conditions for propagation and sale of M. paniculata in the State (Clark, 2007), but no programs to manage existing plantings have been implemented. There are less information of citrus HLB on an alternate host especially M. paniculata and psyllid vector (D. citri) in Thailand. Therefore, this study is to document the incidence of Las in M. Thai Journal of Agricultural Science paniculata as alternate host and insect vector psyllid (D. citri) in Thailand and to determine the importance of M. paniculata plant and D. citri as a inoculum source of citrus HLB. The infection status of Las in M. paniculata and D. citri that dwell on M. paniculata was collected from central, eastern and some samples from northern parts of Thailand. We documented total infection and seasonal trends using conventional PCR and two different qPCR detection methods for Las. Materials and Methods Collection Murraya paniculata Plants Characterization on symptom expression of Huanglongbing naturally infected citrus and relative plants were determined. The Murraya samples from diverse geographical regions were collected in Thailand. The collection sites of Murraya plants were selected in provinces of the Northern Region, the Central Plain and the Eastern Region. All of the Murraya plants were established from cutting or macrottings. Symptomatology of Huanglongbing on Murraya appeared as the same symptoms reported elsewhere including vein yellowing and the leaf symptom similar to zinc deficiencies and symptomless . Collection of Psyllids Adults of D. citri were collected from both visually healthy and symptomatic plants belonging to M. paniculata, and related genera from diverse geographical regions in Thailand, such as commercial groves, retail, resident sites and discount garden centers in different provinces of Thailand. Adult psyllids were collected using an aspirator. The insects were catalogued and stored in 75% ethanol in 2 mL tube for further analysis of Las and non-Las infections. The psyllids were assigned unique sample number and stored at -20°C until processed. DNA Extraction Methods All DNA extractions were performed in a sterile laminar flow hood. Crude extractions of psyllid DNA were made using a modification of the method described in De Barro and Driver (1997). Psyllids were stored in 70% ethanol at 4°C from the time of collection until DNA extraction was performed. Individual psyllids were place in a 2 Vol. 45, No. 3, 2012 Causal agent of citrus huanglongbing in Thailand mL screw-cap tube (USA Scientific, Ocala, FL) containing approximately twelve 1.6-1.8 mm zirconium silicate beads (Ceroglass, Columbia, TN) and 150 µL of lysis buffer (5%1M KCl, 5%1M Tris at pH 8.4, 0.45% Tween20, 0.45%NP40, 89.1% autoclaved deionized water). Tubes were placed in a FastPrep-24-system (MP Biomedicals, Solon, OH) and homogenized for 30s at 6 m s-1. following homogenization, 100 µL of liquid was transferred to a clean 1.5 mL centrifuge tube (USA Scientific), and placed in a water bath at 65°C for 15 min. Samples were immediately placed on ice for at least 10 min, and then centrifuged at 14,000 rpm for 5 min. the supernatant was removed and stored at -20°C until qPCR was performed. Leaf midribs were used for DNA extraction from M. paniculata because this tissue contains the highest titers of Las in Citrus trees (Li et al., 2009). M. paniculata samples were extracted using a buffer based extraction method as follows: 900 µl of extraction buffer (for 1000 mL buffer: 12.1 g TrisBase, 18.61 g EDTA (pH of solution adjusted to 8.0 using 5 M NaOH to facilitate EDTA dissolution), 29.22 g NaCl, 25 g PVP; β-mercaptoethanol added to buffer just before use at 0.7 mL mL-1) was added to the tubes containing slingshot pellets and plant sample, and the tubes were homogenized in a FastPrep-24-system for 40 sec at 6 m s-1. following homogenization, 40 µL of 20% SDS was added and the samples were vortexed. Samples were placed in a 65°C water bath for 30 min, and stirred by inverting the tube every ten minutes. Samples were removed from the water bath, centrifuged at 14,000 rpm for 10 min, and 700 µL of supernatant for each sample was transferred to a new 1.5 mL centrifuge tube. A volume of 220 µL of 5M KoAC was added to the supernatant, and the samples were placed on ice for at least 20 min. After removal from the ice, the samples were centrifuged at 14,000 rpm for 10 min, and 650 µL of the upper aqueous layer was transferred to a new 1.5 mL tube. A volume of 460 µL of cold 70% isopropyl alcohol was added to the samples, the samples were vortexed, and placed on ice for at least 5 min. After removal from the ice, samples were vortexed at 14,000 rpm for 30 min at 4°C, the supernatant was discarded, and the pellet was washed by placing 700 µL cold 70% ethanol in the tubes for 15 min the liquid phase was discarded, and the pellet was allowed to dry in a laminar flow 163 hood. Samples were resuspended in 100 µL nuclease-free water (Qiagen, Valencia, CA). Prior to qPCR analysis, the nucleic acid concentration of all plant samples was determined by spectrophotometry at a wavelength of 260 nm using a Nanodrop-1000 detector (NanoDrop Products, Wilmington, DE). Samples were diluted in nuclease-free water so that 100 ng of DNA was loaded per reaction for the rest of M. paniculata samples. Plant samples were stored at -20°C until qPCR was performed. Conventional PCR Amplification The CGO3F (RGG GAA AGA TTT TAT TGG AG) and CGO5R (GAA AAT AYC ATC TCT GAT ATC GT) primers set were used for conventional PCR in this study. DNA amplification was performed in a final volume of 20 µL containing 10 µL of 2X buffer D (Epicentre Biotechnologies, Madison, WI, USA), 250 nmol of each forward/reverse primer, 1.25 units of Taq DNA polymerase (New England BioLabs Inc., Ipswich, MA, USA), and 1 to 2 µL of genomic template DNA from Las which was extracted from midribs of orange jasmine, psyllid vectors and Las cultures. Conditions of PCR preparation were denaturation at 95°C for 3 min, followed by 35 cycles of amplification with denaturation at 94°C for 45 sec, annealing at melting temperature at 52°C for 30 sec, and DNA extension at 72°C for 1 min with a final extension at 72°C for 10 min using a thermocycler (Perkin- Elmer 9600/Applied Biosystem, Bedford, MA). The PCR products were separated by 1% agarose gel electrophoresis in TAE buffer, the gel was stained with ethidium bromide and amplified DNA bands were viewed under UV-transilluminator. PCR Detection of ‘Candidatus Liberibacter Asiaticus’ All samples were assayed by qPCR with the LJ900f/r series primers (5’-3’ sequences: forward GCCGTTTTAACACAAAAGATGAATATC, reverse ATAAATCAATTTGTTCTAGTTTACGAC) described in Zhou et al. (2011) LJ900f/r primers target the 1-12 tandem repeats of the hyvI and hyvII genes of Las prophages, and were used because they provide a high degree of sensitivity in a 1strep qPCR reaction. Briefly, 2 µL of the DNA 164 A. Jantasorn et al. template from psyllid or 100ng of Murraya DNA were used in a qPCR reaction totaling 15 µl using the PerfeCTa SYBR Green FastMix 2x master mix (Quanta Biosciences, Inc., Gaithersburge, MD), and a reaction concentration of 600 nM forward and 900 nM reverse primer, and nuclease-free water. Reactions were run on Mastercycler Realplex Real time PCR system (Eppendorf Inc., Hauppaugeny, NY, USA) with amplification setting of: initial denaturation at 95°C for 5 min, then 40 cycles of 95°C for 3 sec, followed by 62°C for 30 sec. at the end of each run a disassociation cycle of 95°C for 15 sec, 62°C for 1 min, and a gradual ramp to 97°C for 15 s was performed. All run included positive and at least four no template controls. All samples were assigned at Ct value based on the cycle when fluorescence exceeded 0.2∆Rn. samples that did not produce the correct melt curve were assigned a value of undetermined. Any sample that amplified (at any cycle) and had the correct melt profile was re-run in triplicate. Samples that amplified and had the correct melt profile in at least two of the three triplicate runs were considered positive detections. As a check for our results using LJ900f/r, all psyllid and plant samples that tested positive by the LJ900 primer as well as 50 randomly selected negative samples of each type were run on the HLBaspr primer 5’-3’ sequences: forward TCGAGCGCGTATGCGAATACG, reverse GCGTTATCCCGTAGAAAAAGGTAG, probe AGACGGGTGAGTAACGCG with 6carboxyfluorescein (6-FAM) reporter dye on the 5’ end and Iowa Black FQ on the 3’, IDT, www.idt.com), with target the 16S rRNA of Las (Li et al., 2006). These primers are among the most common methods for diagnostic detection of Las, and have been used to detect Las in D. citri (Lopes et al., 2010) and M. paniculata (Damsteegt et al., 2011). For HLBaspr, we ran a 15 µL reaction, including TaqMan Universal PCR Mastermix (Applied Biosystems, Beverly, MA, USA), a reaction concentration of 0.4 mM each primer, and a reaction concentration of 500nM probe, and nuclease-free water. qPCR reaction were run on the Mastercycler Realplex Real time PCR system (Eppendorf Inc., Hauppaugeny, NY, USA) with amplification setting of: initial denaturation at 95°C for 5 min, followed by 40 cycles of 95°C for 3 sec, Thai Journal of Agricultural Science then by 60°C for 30 sec. All samples were assigned at Ct value based on the cycle when fluorescence exceeded 0.2∆Rn. Results Murraya paniculata Surveys Total of 134 orange jasmine (Murraya paniculata) trees were collected from diverse geographical regions in Thailand. Mostly the samples located in Central plain and some samples located in Northern and Eastern plain of Thailand. ‘Ca. Liberibacter asiaticus’ was detected by conventional PCR in ten samples from Pathum Thani, Lop Buri, Bangkok, Rayong and Chanthaburi provinces respectively. All the remaining trees were infected by only on species of liberibacter that positive with Las specific primer. ‘Ca. Liberibacter asiaticus’ was present in 7.46% of all conventional PCR positive orange jasmine trees (Table 1). The highest incidence of Las infected Murraya trees was observed from Rayong province (30%) in Eastern region whereas the lowest incidence of Las was from Bangkok and Pathum Thani provinces (6.6%) in the Central plain region (Table 1). The positive samples of Las infection from conventional PCR methods were shown in Figure 2. Quantitative determination of Las population for potential of infected Murraya trees as a reservoir of liberibacter, was done by qPCR to further analyse the DNA samples of all surveyed trees. No obvious differences in size and symptom severity of ‘Ca. Liberibacter asiaticus’ infected Murraya tree were observed between locations and survey period at the time of sample collection. Also, no visible differences were detected between PCR positive and PCR negative trees. However, visible differences in symptom severity were found in samples infected by ‘Ca. Liberibacter asiaticus’ from Rayong province and Chanthaburi provinces. The symptom shown yellow and wavy leaves which was similar to nitrogen deficiency (Figure 1). Mottled leaves and fruits with aborted seeds, both characteristics of HLB in citrus were not observed in the PCR positive Murraya trees. The yellowing of Murraya leaves included a variety of chlorotic patterns, most frequently that resembling nitrogen deficiency. Vol. 45, No. 3, 2012 Causal agent of citrus huanglongbing in Thailand 165 Table 1 Detection of ‘Candidatus Liberibacter asiaticus’ by conventional PCR of Murraya paniculata collected from different provinces of Thailand. Location (province) Number of sample Central plain Bangkok Chainat Lop Buri Nakhon Pathom Pathum Thani Phetchaburi Samut Songkhram Saraburi Eastern plain Chanthaburi Chon Buri Rayong Trat Northern plain Chiang Mai Kamphaeng Phet Total No. Infected by ‘Ca. Liberibacter asiaticus’ (%) 30 3 5 20 30 3 2 5 2 2 15 10 6 0 3 (13.3) 4 (30) 0 2 1 134 (6.6) 0 1 (20) 0 2 (6.6) 0 0 0 0 0 10 (7.46) presence of Las and to evaluate the Las population levels. The number collected for each site and date was varied. Only 39 (16.8%) psyllids from 10 provinces were positive for Las by the LJ900 method. The Ct values for the psyllids where Las was detected using the LJ900 primers ranging from 17.57-29.87 (Table 2). The psyllids from which we isolated the highest number of copies of hyvI/hyvII also had a detectable number of copies of the 16S rRNA gene of Las. Fourty-two (18.1%) psyllids were positive for Las by using HLBaspr primers. The Ct values were highly variable with Ct values ranged from 16.12 to 36.74 using primers and probe targeting on 16S rRNA gene (Table 2). Figure 1 Murraya paniculata leaves with various degree of yellowing symptom of huanglongbing that tested positive for ‘Candidatus Liberibacter asiaticus’ by Conventional PCR. A and B the samples collected from Rayong province and C and D the samples collected from Chanthaburi province. Prevalence of Las in Psyllid Samples Over the course of the experiment, 232 psyllids samples collected from Murraya plants at different locations in Thailand were tested to determine the Prevalence of Las in Murraya paniculata Samples The Murraya samples covering all fourteen provinces in Thailand collected from the month of January, March, July, and August 2010 were retained in the analysis. Of these 44 samples, six tested positive for the hyvI/hyvII target DNA sequence. The positive samples represented in Pathum Thani, Nakhon Pathom, Chanthaburi, 166 A. Jantasorn et al. Thai Journal of Agricultural Science (A) M 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 (B) M 1 2 3 4 5 6 7 8 9 10 11 12 13 14 Figure 2 PCR detection of ‘Candidatus Liberibacter asiaticus’ isolated from Murraya paniculata leaves using Las-specific primers targeting the 16S rDNA. Lane 1 water control; lane 2 healthy plant control; lane 3 and 4 the samples collected from Chiang Mai province; lane 5 and 6 the samples collected from Chai Nat province; lane 7 and 8 the samples collected from Pathum Thani province; lane 9 the samples collected from Lop Buri province; lane 10 and 11 the samples collected from Chanthaburi province; lane 12 and 13 the samples collected from Samut Sakhon province; lane 14 and 15 Trat province; lane 16 Kamphaeng Phet province; lane 17 positive control; lane M 1kb DNA Ladder (Promega) (A). Lane M 1kb DNA Ladder (Promega); lane 1 and 2 the samples collected from Bangkok province; lane 3 and 4 the samples collected from Phetchaburi province; lane 5, 6 and 7 the samples collected from Rayong province; lane 8 and 9 the samples collected from Chon Buri province; lane 10 and 11 the samples collected from Nakhon Pathom province; lane 12, 13 and 14 the samples collected from Bangkok (B). Table 2 Detection of ‘Candidatus Liberibacter asiaticus’ from psyllids (Diaphorina citri) collected from different provinces of Thailand by two primer set of real-time PCR. Location (Province) Totals Bangkok Lop Buri Nakhon Pathom Pathum Thani Samut Sakhon Saraburi Chanthaburi Chon Buri Nakhon Nayok Kamphaeng Phet Total 27 23 22 24 20 24 27 20 22 23 232 1/ 2/ LJ900f/r1/ No. of positive Range of Ct values sample (Ct ≤30) 2 1 2 6 3 2 4 4 4 11 39 (16.8%) 28.69-28.98 29.85 19.39-27.93 27.16-29.65 25.45-29.31 28.61-29.40 17.57-29.87 24.36-29.93 25.65-29.44 24.40-29.76 Primers LJ900f/r target the hyvI/hyvII gene of Las prophages. Primer HLBaspr target 16S rRNA of Las. HLBaspr2/ No. of positive Range of Ct values sample (Ct ≤36.9) 6 3 1 3 1 4 6 2 2 14 42 (18.1%) 33.47-36.66 33.95-35.06 16.12 35.90-36.74 24.79 29.33-36.63 21.85-36.44 33.02-33.43 33.93-34.83 29.83-36.65 Vol. 45, No. 3, 2012 Causal agent of citrus huanglongbing in Thailand Rayong and Trat provinces. We were able to amplify 16S rRNA of Las from 20 of the 44 samples that some samples tested positive for hyvI/hyvII (Table 3). Discussion The presence of ‘Ca. Liberibacter asiaticus in Murraya in urban area was demonstrated. DNA sequence comparison revealed no variation in the 16S rRNA gene within each species, suggesting that the Murraya and citrus associated with liberibacters are probably the same. Although both citrus and Murraya was found to be host of ‘Ca. Liberibacter asiaticus’ in the cities, their responses to infection seemed to differ considerably. A few Murraya trees found infected in 2010 were observed for subsequent symptom development in the Rayong and Chanthaburi provinces. The damage to Murraya was much less severe than that on citrus. The presence of Las infection in M. paniculata samples using a detection method with the LJ900fr primers targeting on hyvI/hyvII prophage region was extremely low. Twenty of M. paniculata plant samples that amplified using the 16S rRNA primers had a high Ct value, similar to what we have observed in running these primers against other species of bacteria (unpublished). The only some sample in this experiment that would be considered positive with low Ct value by 16S rRNA detection method was psyllid where amplification was detected using the HLBaspr primers. There are conflicting reports about whether transovarial transmission of Las occurs in D. citri (Pelz-Stelinski et al., 2010 and Xu et al., 1988). If transovarial transmission occurs, it is possible that this infection originated from an infected female that migrated to M. paniculata from citrus. M. paniculata infections were detected when using primers targeting the bacterial 16S rRNA gene than with using primers targeting the hyvI/hyvII tandem repeat sequence. The discrepancies between the two primer sets could occur for several reasons. The most likely is that more infections were detected using the 16S rRNA primers because of higher sensitivity of that method and 16S rRNA regions are the best characterized regions, highly conserved among the species of ‘Candidatus Liberibacter spp. The M. paniculata plants were 167 positive with high Ct value by 16S rRNA primer. This suggests that ‘Ca. Liberibacter asiaticus’ either was decreased multiplying in plant or that M. paniculata is not a good alternate host for Las which may contain some inhibitors. The rate of Las infection of D. citri that developed on M. paniculata is low relative to that of D. citri that develop on citrus, and also lower than infection rates published for the potato-tomato psyllid, Bactericera cockerelli and another Liberibacter species, ‘Candidatus Liberibacter solanacearum’ (Liefting et al., 2008). Using conventional and quantitative PCR, the infection level of D. citri collected from infected citrus in the field is 45-82% (Ammar et al., 2011; Hung et al., 2004; Subandiya et al., 2000). The infection rate of Bactericera cockerelli with ‘Ca. Liberibacter solanacearum’ was 19-20% when the psyllids were collected directly from their host plants (Wen et al., 2010). The low rate of infection and level of bacterial titer in both plant and a psyllid sample raises the possibility that M. paniculata may have a unique resistance trait for Las. Some citrus cultivars do not display severe symptoms when they contact Las but they have a bacterial load similar to diseased citrus (Folimonova et al., 2009) and several orders of magnitude higher than we found in M. paniculata. The fact that M. paniculata has both a low level of infection and a low titer of bacteria in infected plants despite psyllid movement to and from citrus and high levels of HLB incidence in the local citrus population indicates that a trait of the plant may be restricting reproduction or movement of the bacteria. The bacterium appear to remain at a low titer in the psyllids originated on M. paniculata despite the fact that Las has been reported to replicate in D. citri (Hung et al., 2004, Inoue et al., 2009). In addition to citrus, M. paniculata (orange jasmine) is a preferred host of D. citri, and retail trade in this ornamental shrub is strongly implicated in the distribution of D. citri. M. paniculata is reported to be a cryptic or largely asymptomatic host of “Ca. Liberibacter” (Clark, 2007), but another report concludes that the bacteria cannot replicate in M. paniculata (Anonymous, 2011). The epidemiological significance of Murraya as a host for the HLB pathogen is therefore unclear. The taxonomy of Murraya paniculata is uncertain wild 168 A. Jantasorn et al. Thai Journal of Agricultural Science Table 3 Detection of ‘Candidatus Liberibacter asiaticus’ from Murraya paniculata collected from different provinces of Thailand by real time PCR. Location (Province) Bangkok Lop Buri Nakhon Pathom Pathum Thani Samut Sakhon Samut Songkhram Saraburi Chanthaburi Chon Buri Nakhon Nayok Rayong Trat Kamphaeng Phet Total Total 5 1 5 6 1 1 2 9 2 2 4 4 2 44 LJ900f/r No. of positive Range of Ct sample values (Ct ≤30) 0 0 1 29.11 1 26.88 0 0 0 2 25.69-29.45 0 0 1 29.17 1 29.25 0 6 (13.6%) M. paniculata is distributed across Southeast Asia including India, Ceylon, Burma, China, Taiwan, the Malay Peninsula, Philippines, and the Melanesian Island (Swingle et al., 1967). The wild plant has been brought into cultivation at least two times (Mabberley, 1998). Although, the authors of the study stated that further analysis was necessary before dividing the group into two species. Regardless of origin, the domesticated plant often referred to as species or cultivar exotica (Mabberley, 1998). Samuel et al., (2001) suggested that M. paniculata and M. exotica should be separated based on differences in non-coding plastid DNA sequence, but bootstrap support for this division was low. We describe the plants that we collected in this study as M. paniculata. This survey documents demonstrated very low rate of Las infection in urban planting of M. paniculata and D. citri fed on these plants, much lower than occur in citrus and psyllids from citrus. In the few case where plant and psyllid samples tested positive, only low titers of the pathogen were present. These results suggest that urban planting of M. paniculata may play only a minor role as a direct reservoir of Las for HLB infection in citrus. The failure to find any symptoms could be specifically associated with low titer of liberibacter in the natural infected trees or M. paniculata contains a resistant trait to HLB. HLBaspr No. of positive Range of Ct sample values (Ct ≤36.9) 0 1 27.89 4 33.27-34.11 4 32.44-34.60 0 0 1 28.20 3 32.09-35.33 0 1 30.91 3 27.36-36.45 3 32.23-36.43 0 20 (45.5%) Acknowledgments This work was supported financially by the Royal Golden Jubilee Ph.D. program through Thailand Research Fund (TRF). We thank USDAARS-USHRL, Fort Pierce, FL, USA for use of research facilities, Christina Latza for technical support and especially Dr. Lijuan Zhou for vulnerable advice. References Ammar, E-D., R.G.J. Shatters, C. Lynch and D.G. Hall. 2011. Detection and relative titer of Candidatus Liberibacter asiaticus in the salivary glands and alimentary canal of Diaphorina citri (Hemiptera: Psyllidae) vector of citrus huanglongbing disease. Ann. Entomol. Soc. Ann. 104: 526-533. Anonymous. 2011 Citrus Health Response Program, Known Distribution of Citrus Canker/Citrus Greening (HLB) in Florida. Florida Division of Plant Industry.http://www.freshfromflorida.com/pi/chrp/Ar cReader/ArcReader.html Accessed on 11 July 2011. Bove, J.M. 2006. Huanglongbing: a destructive, newlyemerging, century-old disease of citrus. J. Plant Pathol. 88 (1):7-37. Clark, R.A. 2007 Notice of intent to add orange jasmine to the citrus greening host list. Florida Department of Agriculture and Consumer Services Division of Plant Industry.http://www.doacs.state.fl.us/pi/chrp/greenin g/Orange_jasmine_Notice_2.pdf accessed 30 August 2010. Vol. 45, No. 3, 2012 Causal agent of citrus huanglongbing in Thailand Damsteegt, V.D., E.N. Postnikova, A.L. Stone, M. Kuhlmann, C. Wilson, N.W. Schaad, R.H. Brlansky and W.L. Schneider. 2010. Murraya paniculata and related species as potential hosts and inoculum reservoirs of 'Candidatus Liberibacter asiaticus', causal agent of huanglongbing. Plant Dis. 94: 528533. de Barro, P.J. and F. Driver. 1997. Use of RAPD PCR to distinguish the B biotype from other biotypes of Bemisia tabaci (Gennadius) (Hemiptera: Aleyrodidae). Aust. J. Entomol. 36: 149-152. Deng, X., G. Zhou, H. Li, J. Chen and E.L. Civerolo. 2007. Detection of Candidatus Liberibacter asiaticus from wampee (Clausena lansium Skeels) by nested PCR. Plant Health Prog. Folimonova, S.Y., C.J. Robertson, S.M. Garnsey, S. Gowda and W.O. Dawson. 2009. Examination of the responses of different genotypes of citrus to huanglongbing (citrus greening) under different conditions. Phytopathology 99: 1346-1354. Halbert, S.E. and K.L. Manjunath. 2004. Asian citrus psyllids (Sternorrhyncha: Psyllidae) and greening disease of citrus: a literature review and assessment of risk in Florida. Fla. Entomol. 87: 330-353. Hung, T.H., S.C. Hung, C.N. Chen, M.H. Hsu and H.J. Su. 2004. Detection by PCR of Candidatus Liberibacter asiaticus, the bacterium causing citrus huanglongbing in vector psyllids: application of the study of vector-pathogen relationship. Plant Pathol. 53: 96-102. Inoue, H., J. Ohnishi, T. Ito, K. Tomimura, S. Miyata, T. Iwanami and W. Ashihara. 2009. Enhanced proliferation and efficient transmission of Candidatus Liberibacter asiaticus by adult Diaphorina citri after acquisition feeding in the nymphal stage. Ann. Appl. Biol. 155: 29-36. Koizumi, M., M. Prommintra and Y. Ohtsu. 1996. Wood apple, Limonia acidissima: a new host for the huanglongbing (greening) vector, Diaphorina citri, pp. 271-275. In J.V. da Graca, P. Moreno, R.K. Yokomi, eds., Proceeding of the thirteenth Conference of the International Organization of Citrus Virologist, 1996. Riverside, CA, USA:IOCV. Liefting, L.W., Z.C. Perez-Egusquiza, G.R.G. Clover and J.A.D. Anderson. 2008. A new ‘Candidatus Liberibacter’ species in Solanum tuberosum in New Zealand. Plant Dis. 92: 1474-1474. Li, W., L. Levy and J.S. Hartung. 2009. Quantitative distribution of 'Candidatus Liberibacter asiaticus' in citrus plants with citrus huanglongbing. Phytopathology 99: 139-144. Li, W., J.S. Hartung and L. Levy. 2006. Quantitative real-time PCR for detection and identification of Candidatus Liberibacter species associated with citrus huanglongbing. J. Microbiol. Meth. 66: 104115 Li, T. and C. Ke. 2002. Detection of the bearing rate of Liberibacter asiaticum in citrus psylla and its host plant Murraya paniculata by nested PCR. Acta Phytophylacica Sinica 29: 31-35. 169 Lopes, S.A., G.F. Frare, L.E.A. Camargo, N.A. Wulff, D.C. Teixeira, R.B. Bassanezi, G.A.C. Beattie and A.J. Ayres. 2010. Liberibacters associated with orange jasmine in Brazil: incidence in urban areas and relatedness to citrus liberibacters. Plant Pathol. 59: 1044-1053. Mabberley, D.J. 1998. Australian Citreae with notes on other Aurantioideae (Rutaceae). Telopea 7: 333-344. Pelz-Stelinski, K.S., R.H. Barlansky, T.A. Ebert and M.E. Rogers. 2010. Transmission parameters of Candidatus Liberibacter asiatcus by Asian citrus psyllid (Hemiptera: Psyllidae). J. Econ. Entomol. 103: 1531-1541. Pena, J.E., C.M. Mannion, B.J. Ulmer and S.E. Halbert. 2006. Jackfruit, Artocarpu445 sheterophylus, is not a host of Diaphorina citri (Homoptera: Psyllidae) in Florida. Fla. Entomol. 89: 412-413. Pluke, R.W.H., J.A. Qureshi and P.A. Stansly. 2008. Citrus flushing patterns, Diaphorina citri (Hemiptera: Psyllidae) populations and parasitism by Tamarixia radiata (Hymenoptera: Eulophidae) in Puerto Rico. Fla. Entomol. 91: 36-42. Samuel, R., F. Ehrendorfer, M.W. Chase and H. Greger. 2001. Phylogenetic analyses of Aurantiodeae (Rutaceae) based on non-coding plastid DNA sequences and phytochemical features. Plant Biol. 3: 77-87. Subandiya, S., N. Nikoh, S. Tsuyumu, S. Somowiyarjo and T. Fukatsu. 2000. Complex endosymbiotic microbiota of the citrus psyllid Diaphorina citri (Homoptera: Psyllidae). Zoo Sci. 17: 983-989. Swingle, W.T. and P.C. Reece. 1967. The botany of citrus and its wild relatives. Page available online at http://websites.lib.ucr.edu/agnic/webber/Vol1/Vol1T P.html Tirtawidjaja, S. 1981. Insect, dodder and seed transmission of citrus vein phloem degeneration (CVPD), pp. 469-471. Proceedings of the fourth International Society of Citriculture Congress. Tokyo, Japan, 1981. International Society of Citriculture. Tsai, J.H. and Y.H. Liu. 2000. Biology of Diaphorina citri (Homoptera: Psyllidae) on four host plants. J. Econ. Entomol. 93: 1721-1725. Tsai, J.H., J.J. Wang and Y.H. Liu. 2002. Seasonal abundance of the Asian citrus psyllid, Diaphorina citri (Homoptera: Psyllidae) in southern Florida. Fla. Entomol. 85: 446-451. Wen, A., X. Wang, R.M. Harveson, J.D. Bradshaw and N. Gudmestad. 2010. Frequency of “Candidatus Liberibacter asiaticus” in potato psyllid and Solanaceaous weeds, pp. 154-158. In F. Workneh and C.M. Rush, eds., Proceedings of the 10th Annual Zebra Chip Reporting Session, Texas A&M University, Dallas, TX. Westbrook, C.J., D.G. Hall, E. Stover, Y.P. Duan and R.F. Lee. 2011. Colonization of Citrus and Citrusrelated germplasm by Diaphorina citri (Hemiptera: Psyllidae). Hort. Science 46: 1-9. 170 A. Jantasorn et al. Xu, C.,Y. Tia, K. Li, and C. Ke 1988 . Further study of transmission of citrus huanglongbing by a psyllid, Diaphornina citri Kuwayama, pp. 243-248. Proceeding of the 10th Conferences, International Organization of Citrus Virologists. Riverside, California. Yang, Y., M. Huang, G.A. C.Beattie, Y. Xia, G. Ouyang, and J. Xiong. 2006. Distribution, biology, ecology and control of the psyllid Diaphorina citri Kuwayama, a major pest of citrus: a status report for China. Int. J. Pest Management 52: 343-352. Thai Journal of Agricultural Science Zhou, L., C.A. Powell, M.T. Hoffman, W. Li, G. Fan, B. Liu, H. Lin and Y. Duan. 2011. Diversity and plasticity of the intracellular plant pathogen and insect symbiont, 'Candidatus Liberibacter asiaticus', revealed by hyper variable prophage genes with intragenic tandem repeats. Appl. Environ. Microb. 77: 6663-6673. Zhou, L.J., D.W. Gabriel, Y.P. Duan, S.E. Halbert and W.N. Dixon. 2007. First report of dodder transmission of huanglongbing from naturally infected Murraya paniculata to citrus. Plant Dis. 91: 227. Manuscript received 5 March 2012, accepted 16 November 2012 Now online at http://www.thaiagj.org