DOI: 10.1515/frp-2015-0001 Available online: www.lesne-prace-badawcze.pl Leśne Prace Badawcze / Forest Research Papers Marzec / March 2016, Vol. 77 (1): 5–13 e-ISSN 2082-8926 ORIGINAL RESEARCH ARTICLE Latitudinal variability of the radiation microclimate in artiicial forest gaps in Poland – the modelling perspective Leszek Bolibok1*, Michał Brach2, Stanisław Drozdowski1, Henryk Szeligowski1 Warsaw University of Life Sciences – SGGW, Faculty of Forestry, 1Department of Forest Silviculture, 2Department of Forest Management Planning, Geomatics and Forest Economics, ul. Nowoursynowska 159, 02–776 Warszawa, Poland *Tel. +48 22 5938101, fax +48 22 5938113, e-mail: leszek_bolibok@sggw.pl Abstract. The aim of the study was to characterize latitudinal changes in the radiative microclimate of small forest openings (artiicial gaps) under Polish conditions. The global, direct and diffuse radiation on the forest floor in gaps was modelled using the Solar Radiation tool in ArcGiS 10.2 Esri. The gaps were modelled as holes of elliptical shape (60 m x 40 m diameters) in flat terrain and with a depth of 20 to 30 meters to mimic the height of a surrounding tree stand. The range of global radiation diversity on an open and flat surface predicted by our model was comparable with indings of empirical studies. Theoretically, the investigated gaps in the northern-most part of Poland receive only 82% of global solar radiation, 74% direct and 90% of diffuse radiation compared to gaps in the most southern part of the country. The comparison with empirical data indicates that local values of the transmittance parameter of the atmosphere may have a large influence on the actual values of solar radiation and may partially mask the latitudinal impact. Nevertheless, the model constitutes a valuable tool for characterising solar radiation diversity in a gap and supports silvicultural decision-making. Keywords: radiation conditions, diffuse radiation, direct radiation, modelling, artiicial gap, latitude 1. Introduction Gap cutting is regularly used in practice, both as main regeneration cutting mode of as a part of more complex cutting systems. Important factors that influence the radiation microclimate in artiicial gaps include the dimensions size of the gap as well as their its relation to surrounding stand height. The radiation microclimate, including light conditions in the artiicial gap can be influenced to some extent by geographic latitude. In the same season of the year, the sun in its apparent motion in the sky takes higher position at sites located at lower latitudes (closer to the equator) than in those located further from the equator. The higher the position of the sun over the horizon, the larger portion of the forest floor within the artiicial gap receives direct solar radiation. The radiant energy emitted from the sun that reaches the top of the Earth’s atmosphere, comprises approximately 50% of the infrared region (near and far) (> 0.7 µm), about 40% of the visible region (0.4–0.7 µm), and about 10% of the UV region (< 0.4 µm) (Fu 2003). Increased accessibility of direct solar radiation to any section of the forest floor within the gap denotes higher availability of thermal energy. The latter influences air and soil temperature within the gap (Tomanek 1958; Carlson, Groot 1997; Prévost, Raymond 2012) as well as can indirectly affect soil humidity inside the gap (Gray et al. 2002; Ritter et al. 2005). Variability of growth conditions (temperature and humidity of upper soil layers), caused by solar radiation availability, can result in spatial variability of the density of natural regeneration (Minckler et al. 1973; Bolibok, Andrzejczyk 2008) or variability of the height of planted trees (Gray, Spies 1996; Bolibok et al. 2011). Determination of latitude effects on the radiation microclimate within forest artiicial gaps - important in view of improving techniques of gap regeneration cutting – is a task. empirically dificult to achieve. All the methodological pro- Submitted: 24.06.2015, reviewed: 17.10.2015, accepted after revision: 4.11.2015. © 2016 L. Bolibok et al. 6 L. Bolibok et al. / Leśne Prace Badawcze, 2016, Vol. 77 (1): 5–13 blems could not be solved, even if it was possible to establish experimental gaps with the same shape and area within forest stands identical in terms of the species composition and height, and at the same time - situated at a range of geographic latitudes. In Poland, one of the unavoidable problems would be altitudinal variability of the country. A part of solar radiation energy is reduced when passing through the atmosphere. Theoretically, forest openings formed at higher elevations at the same latitude, should be expected to receive more solar radiation when compared to those at lower elevations. In Poland, spatial variability of elevation a.s.l. makes it impossible to establish experimental forest openings in the conditions comparable in terms of altitude but different in terms of latitude. A helpful solution could be advanced models describing light conditions in the forest floor which can take into account the shade casted by the surrounding forest stand (Bolibok et al. 2013). Rich et al. (1995) showed how modelling could be used to study the effects of various parameters describing artiicial gap’s localisation and shape (geographic latitude, gap size, surrounding stand height) on light conditions inside a given forest opening. The influence of surrounding stand height, terrain coniguration (slope and aspect) on the radiation microclimate in forest openings under the conditions of central Poland was presented using such a model in the study of Bolibok at al. (2015). The aim of the present study is to analyse potential differentiation of the radiation microclimate within elliptical artiicial forest gaps, located at a range of latitudes in Poland, in view of available data on long-term insolation variability. As a tool for modelling of the radiation microclimate, there was used Solar Analyst software developed as an extension of ArcView Esri geographic information system software (Fu, Rich 2002). The analyses were performed with the implementation of Solar Analyst model, called in ArcMap ArcGIS 10.2 Esri as Solar Radiation tool. 2. Methods The concept of Solar Analyst originated from the computer program CANOPY, developed by Rich (1989) for determination of light conditions under tree canopy with the use of hemispherical photography. A hemispherical photograph depicting the canopy of a forest stand seen from a forest floor after accurate alteration can be used as a source of information concerning which parts of hemisphere are masked by tree crowns that get in the way of direct and diffuse solar radiation (Bolibok 2010). It could be assumed that Solar Analyst model generate for speciied locations on forest floor in gap virtual hemispherical images of the sky showing which fragments of hemisphere are obstructed by crowns of trees surrounding given artiicial gap. The calculations were based on the digital terrain model (DTM), which described the artiicial gap as a hollow in the terrain. Solar Analyst modelled the path of the sun on the sky, which allowed for determination of time intervals when tree crowns were not in the way of sunlight, in other words – the periods of time when direct radiation was available at a given spot within the gap. Generally the availability of diffuse radiation to a given spot on the forest floor is proportional to the part of unobscured hemisphere which which could be observed from this very spot. On the basis of aforesaid virtual hemispherical image also is possible estimation of the part of sky area which was not masked by tree crowns, thus determination of diffuse radiation availability. Basically, Solar Analyst software was developed for modelling relationships between land topography and the amount of available solar radiation. The model uses raster data and computes the values of solar radiation available at given pixel. The size of raster pixels can be adjusted according to the user’s needs. In the present study, light conditions within forest artiicial gaps were analysed on 200 × 200 m plots, with 0.5 m-long basic pixels. The gap was deined as a hollow designated in the centre of the plot, with the depth equal to the height of the surrounding stand. In such convention the modelled surface refers to upper canopy surface, thus the used model could rather be described as digital surface model (DSM). At the same time, it was assumed that both artiicial forest floor in artiicial gaps and the surface of upper canopy (land cover) were levelled horizontally (had no slope, and consequently – no aspect). There was made a that no solar radiance could either access the gap through the crowns of adjacent trees or be reflected from the trees toward the forest floor within the gap. This assumption was necessary because the algorithm used was not able to take into account the correction for light reflection and penetration within the canopy. Some of the measurements conducted in forest openings (Chen et al. 1993) showed that reflected light could amount to 12–17% of diffuse radiation registered within the gap. Solar radiation-transparency of tree crowns is complex phenomena and depends, among others, on the species and age of trees (Canham et al. 1994; Astrup, Larson 2006; Lefrançois et al. 2008) as well as weather conditions (Johnson, Smith 2006). Taking into consideration all of mentioned factors could hinder the assesment the effect of latitude on the radiation microclimate in the forest artiicial gap. Moreover, the used model also assumes that no solar radiation reflected from far-away elements of topography (e.g. mountains covered with snow) reach the gap floor. The analyses were performed on DTM representing forest artiicial gaps situated at a range of latitudes in Poland (from 49°N to 55°N). All DTM described forest artiicial gaps of the ecliptic shape, with E-W oriented longer axis. The ratio between the lengths of ellipse longer and shorter axes was 3:2 L. Bolibok et al. / Leśne Prace Badawcze, 2016, Vol. 77 (1): 5–13 (60 to 40 m, respectively), that is, likewise in real managed forest stands. In all the DTM, the same gap altitude (190 m a.s.l.) was assigned. The presumed height of the surrounding stand was 20 m or 30 m. Although in Poland, 190 m a.s.l. altitude is never observed (either along the seacoast or in the mountainous regions), the assumption of this very value was important in view of radiation microclimate modelling (Bolibok et al. 2013), beacause to some extend evens the length of solar radiation path (optical depth of the atmosphere) to the gap foor. This assumption did not cancel out the path elongation connected with the change of angle at which the sun’s rays strike the Earth’s surface at higher latitudes. Generally speaking, all the parameters of the gaps included in modelling were uniied, exclusive of latitude coordinates of gap location. Hence only this variable will be responsible for the observed differences between locations. The irst step in model development was determination of the amount of solar radiation available at the open area in studied localisation. Solar radiation striking the atmosphere comprises the major part of electromagnetic radiation spectrum and is conventionally referred to as the solar constant S – the total solar electromagnetic radiation per unit time and per unit area on a plane perpendicular to the rays, at the mean distance from the sun to the Earth. Even though S value slightly fluctuates, for the purpose of this study, in Solar Radiation tool it was speciied as a default value 1367 W / m2. The developed model also required inclusion of the value describing solar radiation absorbed during passing through the atmosphere. In the present study, the coeficient of solar radiation transmittance (quotient of global radiation striking the Earth divided by global radiation striking the upper layer of the atmosphere) was determined as 0.4, in accordance with the value deined for Warsaw (Bogdańska, Podogrocki 2000). Solar Analyst model provided information on global solar radiation energy available to selected points on the forest floor within the gap without specifying the amount of energy carried by the different ranges of the radiation spectrum, but estimates how much of this energy is carried by the direct solar radiation coming from the solar disk, and how much by the diffused radiation reaching from the sky). In open area total solar radiation energy is sum of energy carried by direct and diffused radiation. In Poland, the share of diffuse radiation in global radiation is 50% (Woś 1996). This share was assigned as a default value for each localisation analysed in the present study. Based on this information the computer program computed the values of potential amounts of direct and diffuse solar radiation. During the analysis of the radiation microclimate in the gap, program calculations took into account time intervals when elements of topography (forest stand surrounding the gap) masked the sun, and accordingly reduced the values of potential amounts of direct radiation. The energy carried by diffuse radiation, coming down from each sector of sky hemisphere, and its va- 7 riation of intensity depends mainly on the cloud cover and the angular height of the sun above the horizon. Diffuse radiation availability in the forest gap is also affected by the surrounding stands that overshadow some parts of horizon. When modelling it was summed that the diffused solar radiation reaching the gap floor from different sky hemisphere sectors has varied intensity described by t SOC (Standard overcast sky) model. In the model, the value of direct and diffused solar radiation energy are derived from solar constant - S and its value refers to the instantaneous density radiant flux expressed in W / m2. The model calculated the energy of various types of radiation in the indicated period, expressed in kWh / m2. Calculations were carried out for growing season. The beginning, end and duration of the growing season depend on the location of given area, therefore, taking the real length of growing season into consideration for selected locations would be an additional source of variation of results modifying effect of latitude. Thus, for all assumed locations, there was speciied the same length of growing season. The starting point were the parameters of the growing season from the area Rogów (Łódź Province), that is, from the beginning of 2 April and the end of 2 November (Chojnacka-Ożga 1999). Finally, to simplify the calculations it was assumed, that the growing season cover the period from 1 April to 31 October inclusively. 3. Results and Discussion The results of modelling of solar radiation availability to open flat areas at different latitudes in Poland are presented in Figure 1. In view of input parameter values, the model predicts that in the vegetation season, global solar radiation striking the open area ranges from 771.0 kWh / m² at the latitude 49°N to 879.5 kWh / m² at 55°N. The model predicts that global solar radiation at gaps situated in the north of Poland will be lower than that in the south of the country - in total by 12%. In the model obtained, direct solar radiation is more reduced when compared to diffuse radiation (by 15 and 9%, respectively). The obtained results on global solar radiation reaching the open area are comparable to those obtained by Bogdańska and Podogrocki (2000). The authors reported that in Poland, from 1 April to 31 October, global solar radiation ranged from 783 to 922 kWh / m². These values were obtained based on data gathered by 8 meteorological observatories established throughout the country (from Gdynia by the Baltic Sea to Kasprowy Wierch in the Tatra Mts.). The model (Figure 1) predicts gradual reduction of solar radiation with increasing geographic latitude. This is due to ever-increasing length of the path of solar radiation that passes through the atmosphere to reach the more northerly locations. An additional factor taken into account by the 8 L. Bolibok et al. / Leśne Prace Badawcze, 2016, Vol. 77 (1): 5–13 Figure supply of of different different kinds kinds of of solar solar radiation radiation on on received open areabyinopen different Figure 1. 1. The The outcome outcome of of modelling modelling of of latitudinal latitudinal changes changes in in supply area in different localisations localisationsbetween between49°N 49°Nand and55°N 55°N model is the length of the day. In the northern parts of Poland, annual daytime lasts 20 hours longer when compared to the southern regions, and these differences are more evident during summer months (Bogdańska, Podogrocki 2000). Empirical data indicate that in Poland, geographic latitude is not the major factor affecting solar radiation availability to open areas. Figure 2 presents spatial variability of solar radiation supply to the open area in the period 1 April -31 October in Poland. The igure was prepared based on data (a set of 1983–2005 monthly averages for selected measurement points) provided by the EUMETSAT Satellite Application Facility on Climate Monitoring (CM-SAF). These are the results of the analysis of satellite data, performed based on methodology by Mueller et al. (2009). Spatial variability of global solar radiation accessibility presented in Figure 2 is analogous to the yearly averages of global solar radiation reported by Miara et al. (1987) for the period 1956–1975. Solar Analyst model predictions are to some extent similar to spatial variability of global solar radiation currently observed in Poland. In general, with some exceptions, the northern part of the country (especially western parts of Poland’s Pomerania) receive less solar radiation when compared to southern Poland’s regions (Lublin Upland). The areas situated close to the Baltic Sea and those in mountainous regions show opposite trends. Relatively more solar radiation accesses coastal areas when compared to the mountains. On the scale of the whole country, there can be observed visible reduction of solar radiation along the East–West gradient. This is connected with spatial variability of another important factor - deinite sunshine duration, that is, the number of hours when the sun is not covered by clouds. The comparison of variability of global solar radiation and that of deinite sunshine duration observed in Poland (Koźmiński, Michalska 2001) shows that the effect of deinite sunshine duration at a local isolation (reliant upon spatial and time cloudiness variability) is stronger than that of geographic latitude. The differences between the outcome of modelling and the results obtained empirically do not call into question the use of Solar Analyst model, but rather highlight the importance of input of appropriate parameteres for computation. Indisputably, more matching results could be obtained with better adjusted values of the parameters used in the present study to local conditions, as the transmission coeficient value as well as the proportion of diffuse radiation are strongly related to local sunshine duration. Proper selection of model parameters is even more important when model outcom is used for interpretation of natural phenomena (eg. survival seedlings) in a particular growing season. In a given locality, there can occur signiicant quantitative differences in availability of global solar radiation, depending on the vegetation season. In incidental years, spatial variability of global solar radiation availability is contradictory to that observed on a regular basis (Figure 2, the years: 1987 and 2005). The above considerations are important in silvicultural practice. Owing to great spatial and time variability of deinite sunshine duration received within Poland’s area, no forest artiicial gap - even if it is supposedly of the most favourable size - can guarantee the optimum light and thermal conditions for forest regeneration. Nonetheless, the pursuit to optimise the parameters of forest artiicial gaps increases chances to form the optimum radiation microclimate. The effect of latitude on the total amount of solar radiation reaching the forest floor within the artiicial gap is presented in Figure 3. The graph shows that with increasing geographic latitude, solar radiation available to the forest floor within the gap is reduced more rapidly when compared to the open flat area. This is associated with the effect of surrounding tree stand. L. Bolibok et al. / Leśne Prace Badawcze, 2016, Vol. 77 (1): 5–13 9 Figure 2. Spatial diversity of global solar radiation intensity calculated on the basis of month averages (April till October) from years Figure 2. Spatial diversity of global solar radiation intensity calculated on the basis of month averages (April to October) from years 1983- 2005. Data on month averages for specific localisations (SIS METEOSAT 3, Monthly Mean, Version 001 © (2013) EUMESAT) were 1983–2005. Data on month averages for speciic localisations (SIS METEOSAT 3, Monthly Mean, Version 001 © (2013) EUMESAT) were prepared by EUMETSAT Satellite Application Facility on Climate Monitoring prepared by EUMETSAT Satellite Application Facility on Climate Monitoring. The largest solar radiation amount reaches the gap surrounded by 20-m-high tree stands, situated at 49°N, and solar radiation availability decreases with increasing latitude. Within artiicial gaps located at 55°N, available direct solar radiation is 82% of the reference value for the gap at 49°N. The reduction of diffuse radiation availability is lesser when compared to that of direct radiation, and at 55°N, it is up to 90% of the reference value. The amount of direct radiation decreases the most (down to 74%). There are two reasons behind the observed reduction of direct radiation. The irst mechanism is connected with the angular height of the sun above the horizon, which decreases with increasing latitudes. The lower is the sun position, the longer is the path of solar radiation through the atmosphere, and consequently solar radiation reaching the Earth’s surface is reduced (Bolibok et al. 2013). The second reason is associated with the effect of tree stand surrounding the artiicial gap. At higher geographic latitudes, even at noon, the sun is comparatively closer to the horizon line, and then the shadow of the trees growing on the southern edge of the gap is somewhat longer. This results in a decrease of the proportion of the area with highest insolation within the gap, that normally receives 10 L. Bolibok et al. / Leśne Prace Badawcze, 2016, Vol. 77 (1): 5–13 Figure 3. Modelling outcome potential latitude influenceonondiversity diversityofofsupplies suppliesofofdifferent differentkinds kindsof ofsolar solar radiation radiation on elliptical artiicial Figure 3. Modelling outcome of of potential latitude influence gaps with 60 and m,40 located between and 49°N 55°Nand and55°N surrounded by tree stand of height 20height and 3020m.and The30igures artificial gaps axes with length axes length 6040 and meters, located49°N between and surrounded by tree stand of meters.show October as aexpressed percent of changes sum of solarthe radiation receivedenergy by a gap in the by period between 1st April and 31st and expressed 31st October Thehow figures showsthe how changes sum of energy solar radiation received a gap in the period between 1st April byreceived the gap placed as aenergy percentreceived of energy by the on gap49°N. placed on 49°N. from 80 to 100% of direct radiation available at the open area at a given latitude (Figure 4). The reduction of the proportion of the area with the best sunlight conditions (from 18.38 % down to 10.7%), indicates that this sunny spot becomes smaller and smaller, and shifts northerly (Figure 5). Occasionally, it can move beyond the gap limits, and this can potentially affect the growth of young regeneration under the canopy situated north of the gap. In the case of small gaps, this can also indicate that most of direct solar radiation connected with the gap, actually does not get to the forest floor within the gap, and only reaches the canopy north of the gap (Canham et al. 1990). For silviculture practice this means, that in northern Poland, the forest floor under the canopy placed north of the gap will have better sunlight conditions when compared to southern regions of the country. Northerly shift of the most insolated gap part with increasing geographic latitude, is important in view of the growth of tree seedlings within the gap. According to Lieffers et al. (1999), as a result of the shift, two deinite gap zones, that is, that with better sunlight and that with better water and nutrient availability overlap to a lesser and lesser degree. The central position of the zone with higher water and nutrient availability is somewhat attributable to competitive effects of surrounding trees (Bolibok 2009), and it is hardly susceptible to changes of latitude. With increasing latitude, there increases the proportion of the most shaded part of the gap, (from 23.2% up to 30.9%), which receives less than 20% of direct solar radiation reaching the open area at a given latitude (Figure 5). This could be a beneicial factor for the soil with low water contents (Bolibok, Andrzejczyk 2008; Bolibok et al. 2011). In case of decline in the availability of diffused solar radiation acts only the mechanism associated with increasing radiation path through the atmosphere, and therefore the relative decrease in the energy content of the solar radiation is signiicantly smaller (Fig. 3) and is about 10%. Taking into account this value, there can be estimated that at the latitude 55°N, 26% of relative reduction of direct radiation in the gap comprises 16% of the reduction linked to the longer tree shade and 10% – to the effect of enlarged optical depth of the atmosphere. Increasing geographic latitude has no effect on the area share of gap sections which that receive certain proportion of diffuse radiation reaching the open area. Both, at 49°N and 55°N, the model showed no gap sections receiving less than 20% or more than 80% of diffuse solar radiation available at the open area. Regardless of geographic latitude, the model showed that within elliptical artiicial gaps (60 and 40 m axes) surrounded by 20-m-high tree stands, 58% of the gap area received from 41 to 60% of diffuse solar radiation observed in the open area (Figure 5). 4. Conclusion The main goal of the present study was to determine the effect of geographic latitude on the radiation microclimate within the forest artiicial gap. Two series of analyses, carried out on the gaps surrounded by 20 m- and 30 m-high tree stands showed that the distinctive size of the gap (diameter/ stand height ratio) had a substantial effect on the radiation climate in the gap. Geographic latitude indicated the lesser, however, distinctive effect. Latitude influence can be con- L. Bolibok et al. / Leśne Prace Badawcze, 2016, Vol. 77 (1): 5–13 11 Figure4.4.Modelling Modellingoutcome outcome supplies different kinds of solar radiation elliptical artiicial gaps length 60 and Figure ofofsupplies of of different kinds of solar radiation on on elliptical artificial gaps withwith axesaxes length 60 and 40 40 m supplies, located between 49°N49°N and 55°N and surrounded by tree standstand of height 20 and 30 m. The igures in the share of meters supplies, located between and 55°N and surrounded by tree of height 20 and 30 meters. The show figureschanges show how changes gap areaofreceiving levels of solar radiation. The levels are described as the percentasofthe solar energyofreceived by open space by in given the share gap areadifferent receiving different levels of solar radiation. The levels are described percent solar energy received localisation. open space in given localisation. ceivably reduced by apt delineation of the size of the artiicial gap. Nonetheless, in view of obtainable data on time and spatial variability of solar radiation availability under Poland’s conditions, in practice, there will always be present some risk. Fortunately, the repetitiveness of sunshine conditions is relatively stable in certain regions of Poland. The Solar Analyst model developed can serve as a tool for depiction of theoretical variability of solar radiation conditions within forest artiicial gaps. At the same time, the model could support decision making on silvicultural practices, pertinent to speciic parameters of gaps at given forest localisations. Conlict of interest The authors declare no potential conflict of interest. Acknowledgements and source of funding The study was conducted within the framework of the project OP-2710-4/U/10: Silvicultural planning in improving group selection stepwise cuttings, realised in 2010– 2014 and inanced by the Directorate General of State Forests, Poland. 12 L. Bolibok et al. / Leśne Prace Badawcze, 2016, Vol. 77 (1): 5–13 Figure5.5. Modelling Modeling outcome outcome of gaps with axes length Figure of spatial spatial diversity diversity of ofsupplies suppliesofofdifferent differentkinds kindsofofsolar solarradiation radiationononelliptical ellipticalartiicial artificial gaps with axes 60 and6040and meters, located between 49°N49°N and 55°N and surrounded by tree of height 20 or20 30ormeters. The The igures showshow how how changes length 40 meters, located between and 55°N and surrounded by stand tree stand of height 30 meters. figures the share gap area receiving different levels of solarofradiation. The levels are described as theaspercent of solar energy received by open changes theofshare of gap area receiving different levels solar radiation. The levels are described the percent of solar energy received by space in given localization in the between 1st April and and 31st 31 October. st open space in given localisation in period the period between 1st April October. References Astrup R., Larson B.C. 2006. Regional variability of species-speciic crown openness for aspen and spruce in western boreal Canada. Forest Ecology and Management 228: 241–250. DOI: 10.1016/j.foreco.2006.02.048. Bogdańska B., Podogrocki J. 2000. Zmienność całkowitego promieniowania słonecznego na obszarze Polski w okresie 1961– 1995, Meteorologia. Materiały Badawcze IMGW. Bolibok L. 2010. Zastosowanie zdjęć hemisferycznych do opisu struktury warstwy koron i modelowania warunków świetlnych pod okapem drzewostanów. Leśne Prace Badawcze 71(2): 175–188. DOI: 10.2478/v10111-010-0013-2. L. Bolibok et al. / Leśne Prace Badawcze, 2016, Vol. 77 (1): 5–13 Bolibok L. 2009. Regulacja warunków wzrostu odnowień na gniazdach – wpływ parametrów gniazd na oddziaływanie czynników biotycznych. Sylwan 153: 733–744. Bolibok L., Andrzejczyk T. 2008. Analiza zagęszczenia samosiewów brzozy i sosny na gniazdach na podstawie modelu promieniowania słonecznego. Sylwan 152: 10–19. Bolibok L., Andrzejczyk T., Drozdowski S., Szeligowski H. 2011. Wysokość siedmioletnich odnowień dębowych na gniazdach w różnych warunkach siedliskowych. Leśne Prace Badawcze 72(2): 163–170. Bolibok L., Brach M., Drozdowski S., Orzechowski M. 2013. Modelowanie warunków świetlnych na dnie lasu. Leśne Prace Badawcze 74(4): 335–344. Bolibok L., Brach M., Szeligowski H., Orzechowski M., 2015. Wpływ wysokości otaczającego drzewostanu, wystawy i pochylenia terenu na mikroklimat radiacyjny na gnieździe - wyniki modelowania. Sylwan 159: 813–823. Canham C.D., Burbank D.H., Pacala S.W., Finzi A.C. 1994. Causes and consequences of resource heterogeneity in forests: interspeciic variation in light transmission by canopy trees. Canadian Journal of Forest Research 24: 337–349. Canham C.D., Denslow J.S., Platt W.J., Runkle J.R., Spies T.A., White P.S. 1990. Light regimes beneath closed canopies and tree-fall gaps in temperate and tropical forests. Canadian Journal of Forest Research 20: 620–631. DOI: 10.1139/x90-084. Carlson D.W., Groot A., 1997. Microclimate of clear-cut, forest interior, and small openings in trembling aspen forest. Agricultural and Forest Meteorology 87: 313–329. DOI: 10.1016/ S0168-1923(95)02305-4. Chen J.M., Black T.A., Price D.T., Carter R.E. 1993. Model for Calculating Photosynthetic Photon Flux Densities in Forest Openings on Slopes. Journal of Applied Meteorology 32: 1656–1665. DOI: 10.1175/1520-0450(1993)032<1656:MFCPPF>2.0.CO;2. Chojnacka-Ożga L. 1999. Długość termicznego okresu wegetacyjnego w lasach doświadczalnych SGGW w Rogowie w latach 1926-1998, in: Klimatyczne uwarunkowania życia lasu. Konferencja naukowa, Zakopane 21–22.05.1999, 127–134. Fu P., Rich P.M. 2002. A geometric solar radiation model with applications in agriculture and forestry. Computers and Electronics in Agriculture 37: 25–35. DOI:10.1016/S0168-1699(02)00115-1. Fu Q., 2003. Radiation (SOLAR), in: Encyclopedia of Atmospheric Sciences (ed. J.R. Holton). Academic Press, Oxford, 1859–1863. Gray A.N., Spies T.A. 1996. Gap Size, Within-Gap Position and Canopy Structure Effects on Conifer Seedling Establishment. Journal of Ecology 84: 635–645. DOI: 10.2307/2261327. Gray A.N., Spies T.A., Easter M.J. 2002. Microclimatic and soil moisture responses to gap formation in coastal Douglas-ir forests. Canadian Journal of Forest Research 32: 332–343. DOI: 10.1139/x01-200. Translated by: Bożena Kornatowska 13 Johnson D.M., Smith W.K. 2006. Low clouds and cloud immersion enhance photosynthesis in understory species of a southern Appalachian spruce–ir forest (USA). American Journal of Botany 93: 1625–1632. Koźmiński C., Michalska B. (eds.) 2001. Atlas klimatycznego ryzyka uprawy roślin w Polsce. Akademia Rolnicza Uniwersytet Szczeciński, Szczecin. Lefrançois M.-L., Beaudet M., Messier C. 2008. Crown openness as influenced by tree and site characteristics for yellow birch, sugar maple, and eastern hemlock. Canadian Journal of Forest Research 38: 488–497. Lieffers V.J., Messier C., Stadt K.J., Gendron F., Comeau P.G. 1999. Predicting and managing light in the understory of boreal forests. Canadian Journal of Forest Research 29, 796–811. Miara K., Paszyński J., Grzybowski J. 1987. Zróżnicowanie przestrzenne bilansu promieniowani na obszarze Polski. Przegląd Geograiczny 59, 487–509. Minckler L.S., Woerheide J.D., Schlesinger R.C. 1973. Light, soil moisture, and tree reproduction in hardwood forest openings. North Central Forest Experiment Station, Forest Service, U.S. Dept. of Agriculture. Mueller R.W., Matsoukas C., Gratzki A., Behr H.D., Hollmann R. 2009. The CM-SAF operational scheme for the satellite based retrieval of solar surface irradiance — A LUT based eigenvector hybrid approach. Remote Sensing of Environment 113: 1012–1024. DOI: 10.1016/j.rse.2009.01.012 Prévost M., Raymond P. 2012. Effect of gap size, aspect and slope on available light and soil temperature after patch-selection cutting in yellow birch–conifer stands, Quebec, Canada. Forest Ecology and Management 274, 210–221. DOI: 10.1016/j. foreco.2012.02.020 Rich P.M., 1989. A manual for analysis of hemispherical canopy photography. Los Alamos National Laboratory. Rich P.M., Hetrick W.A., Saving S.C. 1995. Modeling Topographic Influences on Solar Radiation: A Manual for the SOLARFLUX Model. Ritter E., Starr M., Vesterdal L. 2005. Losses of nitrate from gaps of different sizes in a managed beech (Fagus sylvatica) forest. Canadian Journal of Forest Research 35: 308–319. DOI: 10.1139/x04-185. Tomanek J. 1958. Badania przebiegu temperatury, parowania i opadu w rębni gniazdowej. Sylwan 102: 13–31. Woś A. 1996. Zarys klimatu Polski. Wydawnictwo Naukowe UAM. Authors’ contribution L.B. – study concept, data analyses, manuscript preparation; M.B., S.D., H.Sz. – data analyses, manuscript preparation. DOI: 10.1515/frp-2015-0002 Available online: www.lesne-prace-badawcze.pl Leśne Prace Badawcze / Forest Research Papers Marzec / March 2016, Vol. 77 (1): 14–23 e-ISSN 2082-8926 ORIGINAL RESEARCH ARTICLE Effects of food source quality on the adults of Melolontha melolontha and M. hippocastani Danuta Woreta*, Sławomir Lipiński, Robert Wolski Forest Research Institute, Department of Forest Protection, ul. Braci Leśnej 3, Sękocin Stary, 05–090 Raszyn, Poland *Tel. +48 22 7150551, e-mail: D.Woreta@ibles.waw.pl Abstract. This paper presents the results of studies on the life span, survival, weight and fecundity of the forest cockchafer (Melolontha hippocastani, Fabricius, 1801) and the common cockchafer (Melolontha melolontha, Linnaeus, 1758) beetle feeding on Alnus glutinosa (L.) Gaertn., Betula pendula Roth., Carpinus betulus L., Fagus sylvatica L., Larix decidua Mill., Prunus serotina (Ehr.) Borkh., Quercus petraea (Matt.) Liebl., Quercus robur L., Robinia pseudoacacia L., Sambucus nigra L. and Sorbus aucuparia L. em. Hedl. The lifespan and weight of beetles as well as female fertility were examined in 2011 and 2013. Specimen for laboratory tests were collected in the ield shortly after leaving their overwintering sites in the soil and identical experimental protocols were applied to both examined species. 576 and 432 beetles were tested in 2011 and 2013, respectively. In 2011, beetles were feeding on A. glutinosa, B. pendula, F. sylvatica, L. decidua Q. petraea leaves and on C. betulus, P. serotina, R. pseudoacacia, S. aucuparia and S. nigra in 2013. Both years, beetles feeding on Q. robur leaves were examined as a control. Our results showed that feeding on leaves of Q. robur and Q. petraea had the largest positive impact on the life time, weight and fecundity of the studied beetles. Leaves of F. sylvatica and L. decidua also constituted an adequate food source for the development of M. melolontha. M. hippocastani, however, did not perform as well when feeding on these two tree species. Females of M. melolontha reared on leaves of B. pendula did not lay eggs. The following plant species had a negative impact on the survival and development of the collected specimen and female fertility: A. glutinosa, S. nigra, P. serotina and R. pseudoacacia. Neither beetle species fed on the leaves of A. glutinosa or S. nigra. Keywords: forest cockchafer, common cockchafer, forest pests, relative growth rate, mortality, food quality 1. Introduction Greater than before activity of the common cockchafer Melolontha melolontha (Linnaeus, 1758) as well as the forest cockchafer (Melolontha hippocastani, Fabricius, 1801) has been observed from the 1990s all over Europe (Zelger 1996; Brenner, Keller 1996; Strasser, Schinner 1996; Kronauer 2010; Švestka 2010), including Poland (Woreta 1995, 2015a). For quite a long time, both species have been a subject of interest of Poland’s scientists (Karpiński 1950) and forest managers (Rożyński 1926) as the major insect pests in periodical years. Recently cockchafers have become a particular concern due to their long-lasting outbreak in European forests (Ott et al. 2006; Kronauer 2007, 2010). Above all, abundant cockchafer populations in the forest environment bring about severe damage to the crops. Outbreak populations of cockchafer larvae (white grubs) seriously damage the roots of tree seedlings, which often leads to their death in forest nurseries and plantations. Furthermore, adult cockchafer beetles injure tree assimilation apparatus during their supplementary feeding in the canopy, hence, they decrease tree resilience and resistance to adverse environmental factors. In Poland, cockchafer beetles usually appear in May, and for two next months of the vegetation season, they feed in the crowns of deciduous trees, and at times – those coniferous (e.g. European larch). After swarming, females burry eggs deep in the soil. As soon as the irst egg-masses are laid, females fly back to tree crowns and continue feeding. The majority of cockchafer females deposit eggs in the course of several days. Hatching larvae stay in the soil and start feeding on the roots of trees and brushes. White grub control is quite a huge task, so numerous different methods have been applied to decrease their populations in forests (Woreta 1997, 2015b). As a result of ongoing cockchafer outbreak in Poland’s forests, there occur the so called ‘white grub permanent areas’, Submitted: 24.09.2015, reviewed: 21.10.2015, accepted after revision: 14.12.2015. © 2016 D. Woreta et al. D. Woreta et al. / Leśne Prace Badawcze, 2016, Vol. 77 (1): 14–23 i.e. the terrains where establishing any new forest plantation is relatively harder due to constant grub damage to the roots of planted seedling. On the whole, expanding cockchafer numbers have for years posed a threat both to young tree plantations and older deciduous stands. In consequence of the restrictions on the use of chemical pesticides (until recently, the only effective means to control the pest), there emerged an urgent need to identify new, non-chemical modes to control exceeding cockchafer populations. Consequently, the importance of biological, agro-technical and silviculture methods considerably increased in plant protection programs. The purpose of the present study was to enhance knowledge on adult cockchafer biology and ecology, based on the evaluation of effects of diet on cockchafer body weight, survival and fecundity. Better understanding of cockchafer biology, including its food preferences can help elaborating better control strategies to protect forests against exceeding populations of this pest. 2. Material and Methods 2.1. Biological material Biological material used in the study included: • forest cockchafer M. hippocastani adults (collected in the Forest District (FD) Jabłonna in 2011 and FD Radom in 2013), • common cockchafer M. melolontha adults (collected in FD Brzeziny in 2011 r. and FD Radom in 2013), • leafy shoots of: silver birch Betula pendula Roth., common beech Fagus sylvatica L., black elder Sambucus nigra L., black cherry Prunus serotina (Ehr.) Borkh., sessile oak Quercus petraea (Matt.) Liebl., pedunculate oak Quercus robur L., common hornbeam Carpinus betulus L., rowan Sorbus aucuparia L. em. Hedl., European larch Larix decidua Mill., black alder Alnus glutinosa (L.) Gaertn. and false acacia Robinia pseudoacacia L., collected in FD Chojnów as food for adult cockchafers tested. 2.2. Methodology The study was conducted in the years 2011 and 2013. Cockchafer adults were collected in the ield, subsequently to their emergence after overwintering in the soil. The collection of insects was performed for the duration of one day, immediately after obtaining information from ield observers about adult appearance. Further studies on cockchafer food preferences were carried out using the leaves of tree species growing in a given forest stand (including undergrowth). Taken as a whole, the leaves of 11 tree species were used in the study. In 2011 (5 May–29 June), the assessments of effects of a given diet on cockchafer females and males were performed 15 using the leaves of: silver birch, common beech, sessile oak, pedunculate oak, European larch and black alder. Altogether, 360 adult cockchafer beetles (180 specimens of forest cockchafer and 180 specimens of common cockchafer) were used for the assessments of life length and body weight gain. Tree shoots were kept in vials with water closed in glass containers covered with cotton mesh. In each container, there were placed 5 cockchafer females and 5 males. Each food treatment was repeated 3 times, i.e. 30 adult insects fed on the shoots of every tree species tested. The assessment of body weight gain was carried out 6 days after placing adults on food plants (5–11 May). All the tests on both cockchafer species were performed under glasshouse conditions. In 2013 (30 April–12 July), the assessments of food effects included pedunculate oak as the control host plant as well as black elder, black cherry, common hornbeam, rowan and false acacia. Altogether, 216 adult cockchafer beetles (108 specimens of each cockchafer species examined). Host plant shoots ixed in vials with water were placed into glass containers covered with cotton mesh. In every container, there were put cockchafer 6 adults (3 females and 3 males). Each experimental variant was repeated 3 times, i.e. on the whole 18 adult insects fed on the shoots of a given tree species tested. The assessment of body weight gain in forest cockchafer adults were performed after 6 days of feeding (30.04–06.05), and in common cockchafer - after 7 days of feeding (13.05–20.05). The observations were conducted under open-ield conditions. In both observation years (2011 and 2013), tree shoots were replaced twice a week - then fresh water was added to the vials and cockchafer survival was monitored. Insect weight was determined to 0.001 g using a balance AD 300 (Axis Ltd., Gdańsk, Polska). In 2011 and 2013, female fecundity was studied using in total 216 beetles (108 of each cockchafer species tested). First, females (4) and males (2) were placed into the glass containers - on the shoots of a given tree species tested (3 replications). After 11 and 10 days (2011 and 2013, respectively) of feeding together, from each treatment studied, there were randomly picked out 10 females and individually placed into new containers illed with sand (1/3 of container volume). Taking into account the fact that cockchafer females lay eggs in several-day intervals and feed in the meantime, the observed females were provided with food (leafy shoot of the tree species so far fed on - ixed in a vial with water). The shoots were replaced every 2 days. The numbers of laid eggs was assessed 3 weeks later. 2.3. Mathematical and statistical analyses Adult weight changes were assessed based on relative growth rate (RGR), calculated in line with the following formula (Lazarevic et al. 2002): 16 D. Woreta et al. / Leśne Prace Badawcze, 2016, Vol. 77 (1): 14–23 3. Results where: Mo and Mt –initial and inal insect weight (g), Tt-o – the number of days between initial and inal weight measurements. It was assumed that adult feeding was most intense in the irst week of insect culture, thus initial and inal weight measurements were carried within the period of 6–7 days. The differences of the mean RGR values obtained in adults feeding on different tree species were tested with the use of one-way ANOVA as well as one-way ANOVA on ranks (the Kruskal-Wallis non-parametric test). The differences between the mean numbers of eggs laid by females of the examined cockchafer species feeding on different host plants were tested with the use of Tukey’s HSD for equal sample sizes. 3.1. Effects of different forest tree species on cockchafer life span, weight gain and fecundity Life span The results of the analyses carried out on forest cockchafer adults in 2011, showed that when compared to other host plants tested, males feeding on black alder leaves lived for the shortest time (2 weeks). On beech leaves, 100% mortality of males was observed after 4 weeks of feeding, and males feeding on other tested tree species lived 5 weeks (Fig. 1A). Forest cockchafer females lived comparatively the longest on European larch shoots (up to 7 weeks), whereas females feeding on black alder lived for the shortest period of time (3 weeks) (Fig. 1B). Life span of common cockchafer males was also the shortest on black alder leaves – about 7 days (Fig. 2A), and on silver birch leaves, the observed males lived twice as long. The lon- Figure 1. The survival of adult males (A) and females (B) of the forest cockchafer feeding on leaves of different tree species in the laboratory in 2011 Figure 2. The survival of adult males (A) and females (B) of the may cockchafer feeding on the leaves of different tree species in the laboratory in 2011 D. Woreta et al. / Leśne Prace Badawcze, 2016, Vol. 77 (1): 14–23 gest life span was observed in males feeding on European larch foliage - 6 weeks. In the same way, common cockchafer females endured on European larch for the longest period of time (8 weeks), whereas on black alder – just for 3 weeks (Fig. 2B). In general, females of both tested cockchafer species lived 2 weeks longer than males. Body weight In the period between 5 and 11 May 2011, there were found no statistically signiicant effects of diet on RGR of forest cockchafer males (Fig. 3A). The highest weight gain was observed in females feeding on sessile oak leaves. When compared to other tree species tested (with the exception of pedunculate oak), RGR of forest cockchafer females feeding on sessile oak was signiicantly higher (Fig. 3B). The lowest male and female 17 RGR values (negative) were observed in specimens feeding on black alder, European larch and silver birch. At the same time, the highest RGR values in common cockchafer males were obtained in those feeding on sessile oak and European larch leaves. Males feeding on beech and silver birch leaves achieved lower RGR values, and no male survived on black alder leaves longer than 7 days (Fig. 4A). The results obtained showed no statistically signiicant differences. Similarly to forest cockchafer females, RGR values obtained in common cockchafer females were the highest in specimens feeding on both oak species tested, and the lowest (signiicantly different when compared to both oak species) - on the leaves of black alder and silver birch (Fig. 4B). European larch needles and common beech leaves represented medium quality food for the insects tested. Figure 3. Relative weight gain of males (A) and females (B) of the forest cockchafer feeding on the leaves of various tree species in the laboratory in the period 5–11 May 2011 Figure 4. Relative weight gain of males (A) and females (B) of the may cockchafer feeding on the leaves of various tree species in the laboratory in the period 5–11 May 2011 18 D. Woreta et al. / Leśne Prace Badawcze, 2016, Vol. 77 (1): 14–23 Fecundity The mortality and prompt decomposition of eggs deposited in sand observed during the tests on cockchafer female fecundity prevented drawing credible conclusions. Yet, healthy cockchafer eggs were found on host plant leaves (Fig. 5), at some stage of observations conducted on cockchafer life span (when no substrate for egg deposition was provided). The number of cockchafer egg-masses found on the leaves of host plants tested, indicated a relationship between feeding on a given plant species and fecundity. Under the conditions of the present study, the majority of egg-masses were found on the walls of the glass containers with European larch and oak shoots (Fig. 6). In all the containers with birch shoots, there was found just one egg-mass and in those with black alder - none. When compared to forest cockchafer, more egg-masses were found in the containers Figure 5. May cockchafer eggs on the leaves of beech with common cockchafer adults, who seemingly were less vulnerable to experimental conditions in the glasshouse, including increased temperatures during hot days. Common cockchafer females feeding on European larch foliage laid almost as many egg-masses as those on the shoots of common beech and both oak species. No egg-masses were found when females fed on silver birch and black alder leaves. 3.2. Effects of undergrowth tree species on cockchafer life span, weight gain and fecundity Life span The results obtained in 2013, showed the shortest life span (2 weeks) in forest cockchafer feeding on the leaves of black elder (females and males) and false acacia (males) (Fig. 7A, B). On the other hand, forest cockchafer females Rycina 6. Number of egg masses laid by females of M. melolontha and M. hippocastani depending on trees species on which they were feeding on Figure 7. The survival of adult males (A) and females (B) of the forest cockchafer feeding on the leaves of different plant species in ield conditions in 2013 D. Woreta et al. / Leśne Prace Badawcze, 2016, Vol. 77 (1): 14–23 19 feeding on rowan leaves lived longer than 70 days, i.e. about 3 weeks longer when compared to forest cockchafer specimens feeding on other host plant species tested. Forest cockchafer males lived the longest on the leaves of pedunculate oak (about 5 weeks). The average life span was 2 weeks longer in females when compared to that in males. Likewise, life span of common cockchafer adults (females and males) was the shortest when they fed on the leaves of black elder (Fig. 8A and B). The longest life (8 weeks) was observed in common cockchafer females feeding on common hornbeam and rowan leaves. During the irst 4 weeks of observations, female survival on oak leaves was 100%, but soon it rapidly decreased (Fig. 8B). In general, common cockchafer females and males lived longer on the leaves of pedunculate oak, rowan and common hornbeam when compared to other food plants tested. On the whole, common cockchafer females lived about 2 weeks longer when compared to males of this species. to other host plants tested. Negative RGR values were obtained in females feeding on black cherry and black elder leaves. During the observation period of 13–20 May, the highest body weight gain in common cockchafer males was observed in those feeding on the leaves of common hornbeam and pedunculate oak (Fig. 9A). The biggest weight drop was recorded in males feeding on the leaves of black elder and black cherry. However, the differences observed were not statistically signiicant. In common cockchafer females, positive RGR values were obtained for those feeding on the leaves of common hornbeam and pedunculate oak. Females feeding on the leaves of black elder, black cherry, false acacia and rowan showed negative RGR values, i.e. their body weight decreased in the period of 13–20 May. Body weight of females feeding on black elder, black elder and false acacia was signiicantly lower when compared to that of females feeding on pedunculate oak. (Fig. 10B). Body weight In the period of 30 April–6 May, the RGR values obtained were the highest in forest cockchafer males feeding on the leaves of pedunculate oak, common hornbeam and rowan. Negative RGR values were observed in forest cockchafer males feeding on the leaves of false acacia, black cherry and black elder (Fig. 9A). Nonetheless, these differences were not statistically signiicant. Differentiation of RGR values was more evident in females when compared to males. The highest RGR values were obtained in females feeding on sessile oak leaves (Fig. 9B). Except for the leaves of common hornbeam, RGR value in females feeding on sessile oak was signiicantly higher when compared Fecundity During the whole observation period, forest cockchafer females laid 209 eggs all in all. The highest numbers of eggs were laid in the glass containers (9 of 10) with pedunculate oak shoots, on average 14.3 eggs/container. This indicates that of all the host plants tested (11 tree and undergrowth species), pedunculate oak was the most valuable food for forest cockchafer females. The mean numbers of eggs laid by females feeding on other host plants tested (rowan – 4.4, black cherry – 1.9, common hornbeam – 0.4) were signiicantly lower when compared to pedunculate oak. (Fig.11A). Forest cockchafer females feeding on black elder and false acacia laid no eggs. Figure 8. The survival of adult males (A) and females (B) of the may cockchafer feeding on the leaves of various plant species in ield conditions in 2013 20 D. Woreta et al. / Leśne Prace Badawcze, 2016, Vol. 77 (1): 14–23 Figure 9. Relative weight gain of adult males (A) and females (B) of the forest cockchafer feeding on the leaves of various plant species in ield conditions in the period from 30 April to 6 May 2013 Figure 10. Relative weight gain of adult males (A) and females (B) of the may cockchafer feeding on the leaves of various plant species in ield conditions during the period from 13 to 20 May 2013 Under the conditions of the present study, common cockchafer females laid altogether 561 eggs and 434 of these were laid by females feeding on the leaves of pedunculate oak (on average 19.3 eggs/container) and common hornbeam (24.1 eggs/container). No statistical differences between oak and hornbeam were found as regards egg numbers laid (Fig. 11B). Similarly, no statistical differences were found between oak and rowan (7.8 eggs/container). There were laid eggs in two containers with females feeding on false acacia (on average - 3.1) and in one container with black cherry (on average - 1.8). Common cockchafer females laid no eggs only when fed on black elder leaves. There were found no statistical differences among mean egg numbers laid in the containers with rowan, false acacia, black cherry and black elder, however, all these were signiicantly lower when compared to the mean number of eggs laid by common cockchafer females feeding on common hornbeam shoots. 4. Discussion The assessment of cockchafer food preferences performed under the conditions of the present study comprised tree species that commonly occur in Poland’s forests, inclu- D. Woreta et al. / Leśne Prace Badawcze, 2016, Vol. 77 (1): 14–23 21 Rycina 11. The average number of eggs laid by females of (A)M. hippocastani and (B) M. melolontha depending on the species of plants, on which they were feeding on [Db – Quercus robur, Gb – Carpinus betulus, Rb – Robinia pseudoacacia, Jrz- Sorbus aucuparia, Czm – Prunus serotina, Bz – Sambucus nigra] ding understory. The results obtained showed that the type of diet was an important factor affecting cockchafers adults’ life processes. A number of the tree species tested provided the cockchafer species tested with valuable diet, whereas feeding on some - considerably decreased cockchafer vitality and fecundity, shortened life time or caused death due to starvation in extreme cases. Insects can be discouraged or attracted to potential host plants, depending on plant chemical composition. The main factor responsible for the approval of plant taste by insects is the content of sugars (essential food components) in plant tissues (Harborne 1997). Next to sugars, most needed food components are proteins, free amino acids, vitamins, phospholipids and microelements. Apart from biologically active compounds with imperative physiological roles in plants, there also occur the so called speciic substances. These are often secondary metabolites (Lewkowicz-Mosiej 2003), such as glycosides, alkaloids, saponins, flavonoids, bitter organic compounds, tannins, aromatic compounds, essential oils, terpenes, oils, organic acids, glucokinines, mucilage, phytohormones, mineral salts as well as vitamins (Sarwa 2001). As a general rule, relatively high concentrations of plant tannins (e.g. flavonoids) commonly occur in the leaves of woody plants and act as insect feeding deterrents (Harborne 1997). It is believed that glycosides and alcaloids have negative effects on insects, and are poisonous at high concentrations. Numerous secondary plant metabolites show strong toxicity against insects. In 1945, McIndoo enlisted 1180 plant species with a range of compounds toxic to insects, but the effects of the majority of them have not been up to date studied in depth. The toxins that have been alre- ady distinguished are for example: cyanogenic glycosides, glucosinolates, alkaloids, peptides, iridoids, furanocoumarins and saponins (Harborne 1997). Literature data indicate that cockchafer adults readily feed on deciduous tree species such as oak, birch, rowan, beech, hornbeam and maple as well as on coniferous European larch (Sierpiński 1975). Only under unusual conditions (e.g. in the environment with no other tree species in the vicinity), cockchafers feed on the leaves of lime (Tilia), alder (Alnus), viburnum (Viburnum), ash (Fraxinus) and black elder (Sambucus). What is the difference between the leaves chosen as food and those rejected? The answer to the question considers chemical composition of a given plant, leaf concentrations of a variety of chemical substances with either positive or negative effects on insects, and also – so far not identiied mechanisms. Nunberg (1934) refers to oak and birch leaves as diet preferred by cockchafer adults. In the present study, the leaves of pedunculate oak and sessile oak constituted well-balanced diets for the tested cockchafer species, with beneicial effects on adult body weight gain in the irst days after emergence and life span, as well as on the number of eggs laid by females. According to Kozłowski (2008), among all the host plant species tested thus far, oak is the one selected by the largest part of insect species (400 - in Poland, 1200 - all over the world). In our region, cockchafer adults emerge in the spring (April/May) and feed on young oak leaves – then with relatively low tannin concentration. At higher concentrations (increasing with leaf age), tannins act as insect repellents (Feeny1970). Young oak leaves are soft and consist of high amounts of amino acids along with peptides rather 22 D. Woreta et al. / Leśne Prace Badawcze, 2016, Vol. 77 (1): 14–23 than highly toxic substances, hence, they are particularly attractive diet for cockchafer adults (Kozłowski 2008). In the present study, beech leaves showed lesser quality as adult cockchafer food when compared to oak leaves. This could be due to not favorable for beech experimental conditions, e.g. occasionally too high daily temperatures in the glasshouse fatal for fragile beech foliage. Consequently, value of beech diet could be decreased when compared to other plant species tested as cockchafer food. Furthermore, beech leaves contain flavonoids, organic acids and beech bark – tannins (Podgórski, Podgórska 2009). Flavonoids act as deterrents, and are known as the most important barrier against insect feeding on angiosperms (Harborne 1997). The aforesaid factors could be the reason of the observed lower quality of beech diet. Leaf morphological features (e.g. size, thickness) and leaf surface shape (e.g. trichomes, issures, prickles) as well as wax coverage are important factors in the process of host plant selection (Malinowski 2008). When compared to foliage of other coniferous trees, European larch needles are soft and delicate. It would seem that these very features had beneicial effects on cockchafer adults under the conditions of the present study – females feeding on European larch needles lived rather long and laid quite a number of eggs. In the present study, the leaves of common hornbeam - the tree species readily chosen by adult cockchafers as host plant (Sierpiński 1975) – represented appropriate diet, but only for common cockchafer adults. Forest cockchafer females feeding on common hornbeam showed comparatively low fecundity, which conirms earlier results obtained by Woreta and Sukovata (2010). Adults of both cockchafer species tested in the present study consumed rowan leaves, however, the numbers of eggs laid by females were considerably lower when compared to females feeding on oak leaves. Rowan fruits contain: tannins, carotenoids, anthocyanins, vitamin C as well organic acids, including toxic parasorbic acid (Mazerant 1990; Serwa 2001). As a general rule, toxic compounds occur at different concentrations in all rowan tissues. Presumably, the presence of parasorbic acid in rowan leaves decreased their quality as cockchafer diet. Interestingly, silver birch leaves also showed low quality as diet for both cockchafer species observed. Forest cockchafer adults feeding on silver birch showed low body weight gain and fecundity, whereas common cockchafer adults did not accept silver birch leaves at all. These results conirm earlier conclusions by Woreta and Sukovata (2010). Silver birch leaves contain: flavonoids, saponins, essential oils, malic acid, citric acid, tannins, anthocyanins as well as mucilage (Kosiński, Krzyściak-Kosińska 2008). Black alder leaves contain: tannins, triterpenes, hyperoside (3-O-galactoside of quercetin), resins and essential oils (Podgórski, Podgórska 2009). Some of these compounds are known as toxic to insects. In Poland, silver birch produces new leaves already in April, and these can be temporarily eaten by early emerging forest cockchafer adults, before they begin feeding on oak leaves or the leaves of more preferred tree species. The results obtained showed unfavorable effects of black cherry and false acacia on cockchafer adults. Black cherry leaves, shoots, bark and seeds contain cyanogenic glicosydes. When the plant is injured (e.g. during insect feeding), the sugar part of the molecule is removed enzymatically and toxic hydrogen cyanide with bitter taste is released (Sarwa 2001; Olszewska 2007). Likewise, false acacia tissues are toxic, however, their concentrations in plant are considerably differentiated (Bohne, Dietze 2008). The group of active ingredients in false acacia flowers include organic acids, glycosides, essential oils as well as sugars (Sarwa 2001). The results of the present study showed that cockchafer adults did not even try to consume black alder and black elder leaves, although no other food was available. As mentioned before, black alder leaves contain hyperoside (Podgórski, Podgórska 2009), i.e. flavonoid with possible deterrent properties against cockchafers. Furthermore, black alder leaves among others contain resin, i.e. a complex mixture of among others terpenes, resin acids, alcohols, esters, hydrocarbons and phenols (Podbielkowski 1992), and probably these compounds discourage adult cockchafers from consuming black alder leaves. Equally, black elder leaves have strong smell and contain toxic cyanogenic glycoside – sambunigrin (Sarwa 2001; Wilgosz 2008), which most probably is responsible for preventing cockchafer feeding on this plant species. 5. Conclusions The present study was carried out with the aim to assess the effects of different host plant species on endurance, weight gain and fecundity of adult cockchafers. Food preferences of two cockchafer species (forest cockchafer M. hippocastani and common cockchafer M. melolontha) were tested with the use of tree species widespread in Poland’s forests (both in the canopy and undergrowth). The results obtained showed that the leaves of pedunculate oak as well as those of sessile oak constituted the most beneicial diets for both cockchafer species tested, in terms of their survival, body weight gain and fecundity. At the same time, common hornbeam and European larch foliages represented suitable diet for common cockchafer adults, and not as much – for forest cockchafer adults. Then again, the leaves of common beech and rowan were better diets for forest cockchafer adults when compared to common cockchafer. Silver birch provided low quality diet for forest cockchafers and had negative effects on common cockchafers. The females of the latter species laid no eggs when fed on silver birch leaves. Black cherry and false acacia showed negative effects on cockchafer adults studied. Black alder and black elder re- D. Woreta et al. / Leśne Prace Badawcze, 2016, Vol. 77 (1): 14–23 presented the poorest diets (hardly ever consumed) for both cockchafer species studied. The results obtained could be a basis for further research aiming at elaboration of environment friendly methods for successful control of abundant populations of forest insect pests. Conlict of interest No potential conflicts are declared by the authors. Acknowledgements and source of funding The study was carried out within the framework of a development project inanced by the National Centre for Research and Development (NCBR) (grant no. NR12-0096-10/2010) References Bohne B., Dietze P. 2008. Rośliny trujące. 170 gatunków roślin ozdobnych i dziko rosnących. Warszawa, Bellona S.A., 128 s. Brenner H., Keller S. 1996. Protection of orchards from white grubs (Melolontha melolontha L.) by placements of nets. Integrated control of soil pests. IOBC/WPRS Bulletin 19(2): 79–82. Feeny P. 1970. Ecology 51: 565–581. Harborne J.B. 1997. Ekologia biochemiczna. Warszawa, Wydawnictwo Naukowe PWN, 351 s. Karpiński J.J. 1950. Zagadnienie walki z chrabąszczem za pomocą grzyba Beauveria densa Pic. Annales Universitatis. MCS Lublin – Polonia 2, 29–68. Kosiński M., Krzyściak-Kosińska R. 2008. Atlas ziół. Bielsko Biała, Pascal sp. z o.o., 272 s. Kozłowski. M.W. 2008. Wyspy obitości. Matecznik Białowieski 1, 8–10. Kronauer H. 2007. Zu viele Waldmaikäfer im Hardtwald bei Karlsruhe. AFZ der Wald 62(13): 692–694. Kronauer H. 2010. Massenvermehrung im Hessischen Ried. Prozessschutz für Waldmaikäer in Hessen. AFZ der Wald 65(6): 36–37. Lazarević J., Perić-Mataruga V., Stojković B., Tucić N. 2002. Adaptation of the gypsy moth to an unsuitable host plant. Entomologia Experimentalis et Applicata 102: 75–86. Lewkowicz-Mosiej T. 2003. Leksykon roślin leczniczych. Warszawa, Świat Książki, 368 s. Malinowski H 2008. Strategie obronne roślin drzewiastych przed szkodliwymi owadami. Leśne Prace Badawcze 69(2): 165–173. Mazerant A. 1990. Mała księga ziół. Warszawa, Wydawnictwo Związków Zawodowych, 280 s. McIndoo N.E. 1945. U.S. Dept. Agr. Bur. Entom. Plant Quareatine, ET 661, 286 s. Nunberg M. 1934. Chrabąszcz i jego zwalczanie. Instytut Badawczy Lasów Państwowych w Warszawie, seria C, nr 5. Translated by: Bożena Kornatowska 23 Olszewska. M. 2007. Quantitative hplc analysis of flavonoids and chlorogenic acid in the leaves and inflorescences of Prunus serotina Ehrh. Acta Chromatographic 19: 253–267. Ott A., Delb H., Mattes J., Schröter H. 2006. Erfolgreiche Regulierung eines Nebenflugstammes des Waldmaikäfers. AFZ der Wald 61(6): 312–315. Podbielkowski Z. 1992. Rośliny użytkowe. Warszawa, Wydawnictwa Szkolne i Pedagogiczne, 575 s. Podgórski A., Podgórska B. 2009. Drzewa w pomniki zaklęte. Drzewa pomnikowe w Rudzie Śląskiej. Katowice, KOS, 123 s. Rożyński F. 1926. W sprawie walki z chrząszczem majowym (Melolontha vulgaris). Przegląd Leśniczy: 32–38. Sarwa A. 2001. Wielki leksykon roślin leczniczych. Warszawa, Książka i Wiedza, 444 s. Sierpiński Z. 1975. Ważniejsze owady – szkodniki korzeni drzew i krzewów leśnych. Warszawa, PWRiL, 222 s. Strasser H., Schinner F. 1996. Current status of Melolontha melolontha control by the fungus Beauveria brongniartii in Austria. IOBC/WPRS Bulletin 19(2): 69–73. Szafer W., Kulczyński S., Pawłowski B. 1986. Rośliny polskie. Część 1. Warszawa, PWN, 464 s. Švestka M. 2010. Changes in the abundance of Melolontha hippocastani Fabr. and Melolontha melolontha (L.) (Coleoptera: Scarabeidae) in the Czech Republik in the period 2003–2009. Journal of Forest Science 56: 417–428. Wielgosz T. 2008. Wielka księga ziół polskich. Poznań. Publicat S.A., 344 s. Woreta D. 1995. Niepokojący wzrost znaczenia chrabąszczowatych w tym guniaka czerwczyka. Głos Lasu 8: 13–15. Woreta D. 1997. Możliwości ograniczania szkód powodowanych przez pędraki chrabąszczowatych (Melolonthinae) metodami niechemicznymi. Sylwan 5: 29–39. Woreta D. 2015a. Chrabąszcze Melolontha, w: Krótkoterminowa prognoza występowania ważniejszych szkodników i chorób infekcyjnych drzew leśnych w Polsce w 2015 r. Instytut Badawczy Leśnictwa, Analizy i Raporty 24, 82–83. Woreta D. 2015b. Control of cockchafer Melolontha spp. grubs – a review of methods. Folia Forestalia Polonica 57(1): 33–41. DOI: 10.1515/ffp-2015-0005. Woreta D., Sukovata L. 2010. Wpływ pokarmu na rozwój chrabąszcza kasztanowca (Melolontha hippocastani F.) (Coleoptera, Melolonthidae). Leśne Prace Badawcze 71(2): 195–199. DOI: 10.2478/v10111-010-0015-0. Zelger R.1996. The population dynamics of the cockchafer in South Tyrol since 1980 and the measures applid for control. IOBC/WPRS Bulletin 19(2): 109–113. Author’s contribution D.W. – conducting tests, study development, preparation of the manuscript, text revision; S.L. – conducting tests, study development, text revision; R.W. – conducting tests, text revision. DOI: 10.1515/frp-2015-0003 Available online: www.lesne-prace-badawcze.pl Leśne Prace Badawcze / Forest Research Papers Marzec / March 2016, Vol. 77 (1): 24–31 ORIGINAL RESEARCH ARTICLE e-ISSN 2082-8926 The vulnerability of silver ir populations to damage from late frosts Marcin Klisz1*, Szymon Jastrzębowski1, Joanna Ukalska2, Paweł Przybylski1, Jan Matras1, Marcin Mionskowski3 1 Forest Research Institute, Department of Silviculture and Genetics of Forest Trees, ul. Braci Leśnej 3, Sękocin Stary, 05–090 Raszyn, Poland; 2Warsaw University Of Life Sciences – SGGW, Department of Econometrics and Statistics, Division of Biometrics, ul. Nowoursynowska 159, 02–776 Warszawa, Poland; 3Forest Research Institute, Department of Forest Resources Management, ul. Braci Leśnej 3, Sękocin Stary, 05–090 Raszyn, Poland *Tel. +48 22 71 50 352, fax +48 22 7200397, e-mail: m.klisz@ibles.waw.pl Abstract. The aim of the study was to determine the vulnerability of selected silver ir populations to damage from late frost in the climatic conditions of south-eastern Poland. To determine the vulnerability of apical and lateral shoots to damage caused by late frosts, we observed four test plots in 2009 and 2014, each containing progenies of selected seed stands. Our statistical analyses were based on a model incorporating the following variables: site, year, type of frost damage, population as well as the possible interaction between these variables. Signiicant differences between the populations were found in terms of their sensitivity to damage from low temperature occurring during the growth period. Furthermore, we indirectly demonstrated differences in the severity of late frost on the experimental plots, as well as the intensity and variability of late frost shoot damage. Based on these results, we divided the studied populations into two groups of low (EF, KRA1 and NAR) and high (LES2 and BAL2) sensitivity to late frost damage. Keywords: adaptation, environmental stress, frost damage, testing program, Abies alba 1. Introduction In choosing forest trees, testing the progeny of selected populations and genotypes in ield experiments plays a key role in understanding their adaptive potential in the context of predicted and observed climate changes (Ledig, Kitzmiller 1992; Hanewinkel et al. 2012). Testing populations of forest trees helps to determine their adaptivity, direction and scope of change, as well as to evaluate the flexibility of the provenance in a variable environment (Aitken, Whitlock 2013). The earliest attempts to deine the genetic variability of adaptive traits of forest trees based on experiments of Scots pine provenances were made by Philippe Pierre Andre de Vilmorin in the irst half of the nineteenth century (see Langlet 1971). However, the irst ield experiments using a layout for provenance trials with replications were set up in Sweden in the irst half of the 1930s (Langlet 1934). In Poland, provenance plots using a classic layout were established 30 years later. However, these experiments tested only part of the seed base (Barzdajn 2009). The oldest provenance plots of silver ir were established in Rogów in 1961 (Gunia 1986; Szeligowski et al. 2011). The results of measurements and observations conducted by Gunia (2006) and Bąk (2007) show a great degree of variability in the analysed population in terms of growth and qualitative characteristics. The system of ield trials involving different environmental conditions to test populations representing a wide range of natural species allows us to gain a better understanding of the character of the genetic variation of adaptive traits than under conditions of natural growth (Aitken, Hannerz 2001). According to the premises of the program testing the progeny of forest trees, 37 progeny testing plots of 78 populations and 298 mother trees of silver ir from all four regions of testing were established in Poland as of 2015, covering the entire range of this species in the country (Fig. 1). In test region IV (south-east 2), one population set is being tested Submitted: 09.09.2015, reviewed: 13.10.2015, accepted after revision: 30.10.2015. © 2016 A. Klisz et al. A. Klisz et al. / Leśne Prace Badawcze, 2016, Vol. 77 (1): 24–31 (progeny of 15 selected stands) in parallel with the national standard, regional standard and local standards (Fig. 2). The experimental layout includes four trial plots having different conditions of altitude, exposure and soil fertility (Fig. 3). The study subjects are assessed for their adaptation to adverse growing conditions, among other factors, which in the present experiment is expressed by a reduced susceptibility to bud and needle damage due to freezing temperatures. The results presented are among the irst on the assessment of the sensitivity of irs to late frosts. The testing program focused on quantitative traits (Sabor et al., 2004) in studying the adaptation of the progeny of selected seed stands and mother trees to different growth conditions. For this reason, the ield trials assess only spring bud burst, whereas susceptibility to frost damage is assessed only in the event of its occurrence. Artiicial freezing tests combined with their veriication in ield trials have not been included in the testing program, even for such a low temperature sensitive species as silver ir (Dolnicki 2003). The location of the silver ir progeny test plots in south-eastern Poland takes into account the risk of frost in mountainous areas because of the coniguration and cover of the terrain (Koźniński 1974). This was conirmed by the periodic occurrence of late frosts at all test plots. Studies on silver ir conducted to date were mainly concerned with learning about the physiological mechanisms of acquiring frost resistance and how this changes over time (Dolnicki 2003; Sarvaš 2004). The issue of the variability in a silver ir population of its susceptibility to damage from 25 late frosts is still insuficiently explored (Ivankovic et al. 2007). The aim of this work is to select populations of silver ir that can best adapt to the growing conditions of south-eastern Poland and are characterised by a signiicantly higher resistance to late frosts in their irst years of growth. 2. Materials and methods The tested progeny of selected ir stands represent populations from eight districts of the Regional Directorate of State Forests in Krosno (Table. 1). The trial plots were established in 2009 in the districts of Cisna (CIS) – N49°09’60’’, E22°27’57’’; Komańcza (COM) – N49°22’82’’, E22°00’97’’; Bircza (BIR) – N49°38’24 , E22°29’34 and Lesko (LES) – N49°29’51’’, E22°17’36’’ (Fig. 2), each with an area of 225 m2 in a randomised block design with four replications. All experimental plots were established under the cover of European larch planted two years earlier. Habitat conditions at the test plots are varied (respectively: CIS – LGśw, COM – LGśw, BIR – Lwyżśw LES – Lwyżśw), but meet the trophic requirements of the test species. In terms of regionalisation, the natural-forest areas are situated in the Carpathian region, in the mesoregions of the Przemyskie Uplands (BIR), Dukla (COM), the Low Bieszczady (LES), the High Bieszczady (CIS) (Zielony, Kliczkowska 2012). Seedlings with a covered root system (1.5 / 1.5 K) were used to establish the crop and were planted in 1.5 × 1.5 m2. Each population was represented by 400 seedlings (100 for each replication). Table 1. Characteristics of tested populations Population ID Forest Base Material Regional Directorate of State Forest Forest District Provenance region BAL2 11626 Krosno Baligród 806 BIR1 27146 Krosno Bircza 804 KRA1 11270 Krosno Krasiczyn 804 KRA2 11271 Krosno Krasiczyn 804 LES1 30320 Krosno Lesko 806 LES2 30326 Krosno Lesko 806 LES3 30327 Krosno Lesko 806 LES5 30329 Krosno Lesko 806 LUT1 30205 Krosno Lutowiska 806 LUT2 30212 Krosno Lutowiska 806 LZD MP/2/45114/06 Kraków LZD Krynica 803 NAR 10995 Krosno Narol 606 RYM1 36145 Krosno Rymanów 806 RYM2 36146 Krosno Rymanów 806 STU 10691 Krosno Stuposiany 806 26 A. Klisz et al. / Leśne Prace Badawcze, 2016, Vol. 77 (1): 24–31 Late frosts occurred twice (in 2009 and 2013) in the seven years since the tested crops were planted, causing damage to the apical and lateral shoots of the ir. Variability in the degree and nature of the damage was observed in terms of both the experimental plots as well as the tested populations. The type of damage was determined immediately after the frost occurrence. A three-degree scale was used to assess damage during ield observations to determine the extent of damage to the shoots (intact trees, damaged lateral shoots, damaged apical shoot). In this study, we analysed the observations of damage to the lateral shoots and apical shoot. In order to determine the proportion of trees experiencing different types of damage, we determined the frequency of such damage for individual provenances. To determine the variation in the type of damage among the test plots and tested populations of ir, we used the general linear model, combining a cross classiication with a hierarchical one (Oktaba 1980): plot year type of damage population and the effect of nested blocks in the interaction of site year: Figure 1. Testing regions for Selected Seed Stands of silver ir: I – Middle Eastern, II – South Western, III – South Eastern 1, IV – South Eastern 2 Figure 2. Location of tested population and experimental plots (BIR – Bircza Forest District, LES – Lesko Forest District, KOM – Komańcza Forest District, CIS – Cisna Forest District) A. Klisz et al. / Leśne Prace Badawcze, 2016, Vol. 77 (1): 24–31 27 Figure 3. Elevation gradient and geographical directions of exposure of experimental plots. MGZ – mountain grassland zone, DFZ – lower mountain decidous forest zone, FZ – foothills zone. Other designation as in Figure 2. Fijklm=µ + Si + Yj + FTk + Pl + SYij + SFTik +YFTjk+ SPil + YPjl + FTPkl + SYFTijk + SYPijl +SFTPikl + YFTPjkl + Bm(SYij) + Eijklm where: Fijkm – percentage of frost damage of site i, in year j and type of damage k, µ – overall average, Si – effect of site i, Yj – effect of year j, FTk – effect of type of damage k, Pl – effect of population l, SYij – interaction of site i and year j, SFTik – interaction of site i and type of damage k, SPil – interaction of site i and population l, YPjl – interaction of year j and population l, FTPkl – interaction of type of damage k and population l, YFTik – interaction of year j and type of damage k, SYFTijk – interaction of site i, year j and type of damage k, SYPijl – interaction of site i, year j and population l, SFTPikl – interaction of site i, type of damage k and population l, YFTPjkl – interaction of year j, type of damage k and population l Bm(SYij) – effect of nested block m in the interaction, site i and year j, Eijklm – random error. The analysis was based on data obtained from the Bliss transformation. Homogeneous groups were determined using Tukey’s Honestly Signiicant Difference (HSD) test. Statistical analyses were performed using the GLM procedure of SAS (SAS Institute 2011). 3. Results The analysis of variance conirmed signiicance differences in the rates of the occurrence of frost damage among the tested populations (p = 0.002), sites (p 0.001), the years 2009 and 2014 (p 0.001), and the second and third types of damage (p 0.001). At the same time, the signiicance of the interaction was conirmed for: type of damage population, type of damage site, type of damage year and site year (in all cases p 0.001). The analyses conducted also conirmed the signiicance of the interaction between type of frost damage and year of occurrence and the tested populations with the site, respectively: p = 0.001 and p < 0.001 (Table 2). The analysis of variance demonstrated a signiicant difference in the frequency of the incidence of the second and third types of damage, which was conirmed in the majority of the tested populations. Only the LZD population (the national standard) was characterised by the same number of trees with damaged lateral shoots and apical shoot (Fig. 4). For most of the remaining tested populations, the third damage type (damaged apical shoot) was observed signiicantly more frequently than the second damage type (damaged lateral shoots). The difference in the frequency of damage types between the LES1 and NAR populations was not statistically signiicant. The analysis of the frequency of the occurrence of both frost damage types observed in 2009 and 2014 showed a different trend for damage to the apical shoots and lateral shoots. The frequency of the second damage type (damaged lateral shoots) was similar in both late frost years for most of the tested populations. The proportion of damaged trees in 2009 was signiicantly greater than in 2014 only for the LZD population (the national standard). At the same time, the trees of the KRA1 population had the least frequently observed second damage type (Fig. 5). The opposite trend was found for the frequency of the third damage type (damaged apical shoot). All populations showed a signiicantly greater frequency of damage to the apical shoot from the late frost of 2009 compared to the 2014 frost. In the case of the 2009 late frost, the third damage type was least like to have been observed on the trees of the LZD population. The late frosts of 2014 most heavily damaged the LES2 population, but the difference in the frequency of damage to the remaining populations (except for LZD) was not statistically conirmed. In 2014, the frequency of damage to the apical shoot of the tested populations was more evenly distributed and no signiicant differences were found among populations. A. Klisz et al. / Leśne Prace Badawcze, 2016, Vol. 77 (1): 24–31 28 Table 2. Analysis of variance Sum of squares Deegres of freedom Mean square F-statistic p-value 6.58 1 6.58 367.09 <0.001 Population 0.62 14 0.04 2.47 0.002 Site 3.29 3 1.10 61.26 <0.001 36.32 1 36.32 2026.32 <0.001 1.07 14 0.08 4.27 <0.001 Source of variation Type of frost damage Year Type of frost damage population Type of frost damage site 0.84 3 0.28 15.6 <0.001 Type of frost damage year 34.46 1 34.46 1922.28 <0.001 0.81 42 0.02 1.07 0.352 0.32 14 0.02 1.27 0.218 3.3104 3 1.10 61.55 <0.001 Population × site Population Site year year Type of frost damage population site 0.93 42 0.02 1.24 0.145 Type of frost damage population year 0.80 14 0.06 3.17 0.001 Type of frost damage site Population site Block (site year) Error year year 3.75 3 1.25 69.69 <0.001 0.31 42 0.01 0.42 0.999 1.46 24 0.06 3.39 <0.001 13.23 738 0.02 Figure 4. Transformed average for frequency of late frost damage of silver ir populations (both years); error bars means HSD Tukey; continuous line – 3rd damage type; dotted line – 2nd damage type. 4. Discussion The risk of frost damage depends both on the increase in average annual temperature and the impact of climate change on the incidence (frequency and scale) of short-term temperature fluctuations (Beuker et al., 1998). Populations of conifer species growing in variable mountain environments exhibit greater interpopulation variation than popula- tions growing in a more homogeneous environment (Aitken, Hannerz 2001), so the selection of mountain populations of silver ir for resistance to frost damage can probably improve their adaptive potential (Dolnicki, Kuchciński 2003). According Sabora (1999), the genetic value of silver ir from the Polish Carpathians region provides the basis for attempting to select a population that is best able to adapt to growing in mountainous areas characterised by the frequent A. Klisz et al. / Leśne Prace Badawcze, 2016, Vol. 77 (1): 24–31 29 Figure 5. Transformed average for frequency of late frost damage (2nd damage type – side shoots, 3rd damage type – apical shoots) of silver ir populations in subsequent years; error bars means HSD Tukey. Continuous line means late frost in 2014; dotted line means late frost in 2009. occurrence of late frosts. Assessing the adaptive potential of this species to environmental conditions differing from its place of origin is based on observations conducted in provenance areas and in experimental plots testing the progeny of excluded seed stands and mother trees (Barzdajn 2009; Kowalkowski 2013; Skrzyszewska 2013). So far, Poland has not conducted research on the population’s genetic variability in terms of frost hardiness under controlled growth conditions. Past studies on the adaptive potential of silver ir populations from Poland examined characteristics providing indirect evidence of its susceptibility to damage, such as height, survivability and the phenology of bud development (Kempf, Sabor 2009; Skrzyszewska 2010; Szeligowski et al. 2011). Genetic variability of frost hardiness has been directly conirmed for other conifer species by studies based both on ield trials as well as artiicial freezing tests (Dormling 1982; Hannerz 1994; Simpson 1994; Aitken, Adams 1997; Beuker et al. 1998; Dolnicki, Kraj 1998; Andersson, Fedorkov 2004; Langvall 2011). The results of these studies suggest that the silver ir also has an adaptive potential, conditioned genetically, of resistance to tissue damage caused by periodic frosts during the growing season. The temperature limit, below which trees are damaged by frost, depends on many factors: the seasonal variation of the frost hardiness of trees, the duration of sustained frosts, sun exposure and the pace of temperature drops (Hannerz 1994). Bearing in mind the location of the experimental plots (Fig. 3), it should be assumed that these factors strongly differentiate the impact of late frosts on the type and intensity of the resulting damage. The lack of monitoring of local weather conditions does not allow the assumptions listed above to be directly veriied and the use of multi-year meteorological data in mountainous regions does not provide the basis for determining the actual intensity of the frosts (Aitken, Adams, 1997). The variability of the intensity of late frosts related not only to the sites of the experimental plots, but also to the year in which they occurred. Evidence of this is seen in both the signiicantly different numbers of damaged trees as well as the proportion of trees with damaged lateral shoots and apical shoot (Fig. 5). A signiicantly lower proportion of trees with a damaged apical shoot in 2014 compared to 2009 could have occurred because of both a lower intensity of the frost in 2014, as well as a lower susceptibility of the trees to damage related to the acclimatization of the tested population. The diverse response of trees to frost could also have been influenced by the ambient conditions occurring prior to the growing season, responsible for the timing of bud development (Dormling 1982). Comparing the proportion of apical shoot damage among the tested populations in both analysed years allows the statistically signiicant differences between populations and between the years of frost to be observed. In 2009, the LZD population, serving as the national standard in the pro- 30 A. Klisz et al. / Leśne Prace Badawcze, 2016, Vol. 77 (1): 24–31 geny testing program, was the most resistant to this type of damage. Susceptibility to frost damage at a juvenile age is one of the important characteristics that may affect the viability of the crops. Reduced susceptibility of LZD tree stand progeny to late frosts may indicate a high degree of adaptivity in this population. The interpopulation variation of frost hardiness observed in the irst year of growth of the trees was greatly reduced after six years. It is true that the LZD population continued to be characterised by a low degree of apical shoot damage, but similar values were also reached by populations from locations which were the farthest away from the test sites: KRA1 and NAR (Fig. 5). This pattern is conirmed by the general theory characterizing local provenances as suboptimal populations (Matyas. Yeatman 1992). Perhaps this observed trend was associated with a later seedling bud burst of the LZD population in 2009, while in 2014, the remaining populations acquired resistance to late frosts, reaching a height above which the phenomenon of frost no longer affects the development of apical buds. During research into the frost hardiness of spruce, Danusevicius and his team (1999) observed a greater degree of frost damage in older trees. They explained this pattern by the greater surface of the assimilation apparatus in older (higher) plants leading to a loss of water. The authors of this study believe that due to the ambiguity of Anderson and Fedorkova’s (2004) results which discuss the influence of seedling height on susceptibility to frost damage, the study should take into account both quantitative traits as well as the adaptive potential of seedlings. For this reason, the test results of the progeny of selected silver ir tree stands and mother trees should also relate to both quantitative traits as well as their adaptive potential. Selection for adaptivity aims to deine the best trees in terms of resistance to damage from frost and population, as well as to deine the target environmental conditions for their use (Aitken, Hannerz 2001). The presented approach to selecting silver ir for mountainous conditions is justiied due to the wide variability of environmental conditions. 5. Conclusions • The population of silver ir in the south-eastern testing (second) region most susceptible to damage from late frosts in the irst year of growth was the tree stand selected from the Forest Experimental Station (LZD) in Krynica. • After six years of growth in the south-eastern testing (second) region, the progeny of tree stands selected from the Forest Districts of Krasiczyn and Narol (No. RLMP LP respectively 11270 and 10995) exhibited the lowest susceptibility to damage from late frosts. • Assessing the course of a reaction to environmental stimuli of silver ir populations under mountain climate conditions characterised by frequent occurrences of late frost requires the continuous monitoring of microclimate conditions occurring at the experimental plots. Conlicts of interest The authors declare that no potential conflicts of interest exist. Acknowledgements and source of funding The study was funded by the State Forests National Forest Holding as part of research project BLP-375. References Aitken S., Adams W.T. 1997. Spring cold hardiness under strong genetic control in Oregon populations of Pseudotsuga menziesii var. menziesii. Canadian Journal of Forest Research 27(11): 1773–1780. DOI: 10.1139/cjfr-27-11-1773. Aitken S.N., Hannerz M. 2001. Genecology and gene resource management strategies for conifer cold hardiness. in: Conifer cold hardiness (eds. F.J. Birgas. S.J. Colombo). Springer Science+Business Media Dordrecht. 23–53. ISBN: 9789048155873. Aitken S.N., Whitlock M.C. 2013. Assisted gene flow to facilitate local adaptation to climate change. Annual Review of Ecology. Evolution. and Systematics 44(1): 367–388. DOI: 10.1146/ annurev-ecolsys-110512-135747. Andersson B., Fedorkov A. 2004. Longitudinal differences in Scots pine frost hardiness. Silvae Genetica 53(2): 76–80. Barzdajn W. 2009. Adaptation of different silver ir (Abies alba Mill.) provenances to the conditions of the Sudetes. Forest Research Papers 70(1): 49–58. Beuker E., Valtonen E., Repo T. 1998. Seasonal variation in the frost hardiness of Scots pine and Norway spruce in old provenance experiments in Finland. Forest Ecology and Management 107(1-3): 87–98. DOI: 10.1016/S0378-1127(97)00344-7. Danusevicius D., Jonsson A., Eriksson G. 1999. Variation among open-pollinated families of Picea abies (L.) Karst. in response to simulated frost desiccation. Silvae Genetica 48(3-4): 158–167. Dolnicki A., Kuchciński L. 2003. Wstępne badania nad mrozoodpornością jodły pospolitej (Abies alba Mill.) w Górach Świętokrzyskich. Sylwan 8: 84–92. Dolnicki A., Kraj W. 1998. Dynamics of frost resistance in various provenances of Abies grandis Lindl. Acta Societatis Botanicorum Poloniae 67(1): 51–58. DOI: http://dx.doi.org/10.5586/ asbp.1998.006. Dormling I. 1982. Frost resistance during bud flushing and shoot elongation in Picea abies. Silva Fennica 16: 167–177. A. Klisz et al. / Leśne Prace Badawcze, 2016, Vol. 77 (1): 24–31 Hannerz M. 1994. Predicting the risk of frost occurrence after budburst of Norway spruce in Sweden. Silva Fennica 28(4): 243–249. Hanewinkel M., Cullmann D., Schelhaas M.-J., Nabuurs G.-J., Zimmermann N.E. 2012. Climate change may cause severe loss in the economic value of European forest land. Nature Climate Change 3(3): 203–207. DOI: 10.1038/nclimate1687. Ivanković M., Marjanovic H., Franjic J. 2007. Variability of Silver ir (Abies alba Mill.) provenances in the number of lateral buds on terminal sprout and damage by the late frost. Periodicum Biologorum 109(1): 55–59. Kempf M., Sabor J. 2009. Ocena zmienności cech adaptacyjnych pięcioletniej jodły pospolitej pochodzeń objętych ochroną na powierzchniach zachowawczych Karpackiego Banku Genów. Sylwan 153(10): 651–661. Kowalkowski W. 2013. Adaptacja i wzrost potomstwa drzewostanów jodły pospolitej ( Abies alba Mill .) na uprawie testowej w Nadleśnictwie Złotoryja. Forestry Letters 104: 67–74. Koźniński Cz. 1974. Przygruntowe przymrozki w Polsce w latach 1963–1972. Poznań– Warszawa. PWN. 52 s. Langlet O. 1936. Proveniensfragan i ny belysning. Skogen 21(11): 1–8. Langlet O. 1971. Two hundred years genecology. Taxon 20(5): 653–721. Langvall O. 2011. Impact of climate change, seedling type and provenance on the risk of damage to Norway spruce (Picea abies (L.) Karst.) seedlings in Sweden due to early summer frosts. Scandinavian Journal of Forest Research 26: 56–63. DOI: 10.1080/02827581.2011.564399. Ledig T.F., Kitzmiller J.H. 1992. Genetic strategies for reforestation in the face of global climate change. Forest Ecology and Management 50(1-2): 153–169. DOI: 10.1016/j. jenvman.2014.07.030. Matyas C., Yeatman C.W. 1992. Effect of geographical transfer on growth and survival of jack pine (Pinus banksiana Lamb.) populations. Silvae Genetica 41: 370–376. Oktaba W. 1980. Metody statystyki matematycznej w doświadczalnictwie. PWN. Warszawa. 488 s. Sabor J. 1999. Wartość genetyczna jodły karpackiej. Zeszyty Naukowe Akademii Rolniczej w Krakowie 61: 29–41. Translated by: Barbara Przybylska 31 Sabor J., Barzdajn W., Blonkowski S., Chałupka W., Fonder W., Giertych M. 2004. Program testowania potomstwa wyłączonych drzewostanów nasiennych. drzew doborowych. plantacji nasiennych i plantacyjnych upraw nasiennych. Dyrekcja Generalna Lasów Państwowych. Warszawa. Sarvaš M. 2004. Changes in cold hardiness of silver ir and larch bare-rooted seedlings during autumn and spring. Journal Forest Science 50(5): 237–242. SAS Institute Inc. 2011. SAS/STAT 9.3 User’s Guide. Cary. NC: SAS Institute Inc. Simpson D.G. 1994. Seasonal and geographic origin effects on cold hardiness of white spruce buds. foliage. and stems. Canadian Journal of Forest Research 24(5): 1066–1070. Skrzyszewska K. 2010. Variability of spring flushing in silver ir (Abies alba Mill.) of Polish provenances tested in the Jd PL 86/90 provenance test. Annals of Warsaw University of Life Sciences – SGGW. Forestry and Wood Technology 73: 65–73. Skrzyszewska K. 2013. Wartość selekcyjna jodły pospolitej (Abies alba Mill.) polskich pochodzeń w okresie juwenilnego wzrostu w zróżnicowanych warunkach siedliskowych. Zeszyty Naukowe Akademii Rolniczej w Krakowie 377: 7–313. Szeligowski H. Bolibok L. Buraczyk W. Drozdowski S. 2011. Characteristics of silver ir (Abies alba Mill.) in a provenance trial in Rogów. Forest Research Papers 72(3): 225–31. DOI 10.2478/v10111-011-0022-9. Wieteska S. 2011. Ryzyko występowania przymrozków w polskiej streie klimatycznej. Acta Universitatis Lodziensis 259: 143–157. Zielony R.. Kliczkowska A. 2012. Regionalizacja przyrodniczoleśna Polski 2010. Warszawa. Centrum Informacyjne Lasów Państwowych. 315–328. ISBN: 978-83-61633-62-4. Authors’ contribution M.K. – data collection and its statistical analysis, preparation of the manuscript, coordinating the work; Sz.J. – initial preparation, data collection, text corrections; J.U. – statistical analysis of the data, text corrections; P.P. – data collection, text corrections; J.M. – concept and premises of the study; M.M. – cartographic editing, text corrections. DOI: 10.1515/frp-2015-0004 Available online: www.lesne-prace-badawcze.pl Leśne Prace Badawcze / Forest Research Papers Marzec / March 2016, Vol. 77 (1): 32–41 ORIGINAL RESEARCH ARTICLE e-ISSN 2082-8926 The dynamics of northern red oak (Quercus rubra L.) in managed forests of central Poland Damian Głowacki, Małgorzata Sławska*, Marek Sławski Warsaw University of Life Sciences, Faculty of Forestry, Department of Forest Protection and Ecology, ul. Nowoursynowska 159, bld. 34, 02–776 Warszawa, Poland *Tel. +48 22 5938153, e-mail: malgorzata_slawska@sggw.pl Abstract. Based on data obtained from the Information System of Polish State Forests (SILP), we compiled a register of segments with northern red oak within the area of the Grotniki Forest District. For all of these stands, the cover of Q. rubra in the tree, understory (undergrowth and shrub layer) and herb layer was determined for at least three points and then rated on a ten-point scale (1st class – 10%, 2nd class – 20%, etc.). The current distribution of Q. rubra in all forest layers was analysed with respect to the type of forest habitat and stand age. Additionally, a prosperity index of northern red oak was calculated separately for two Forest Inspectorates and for all forest habitat types. The divisions with Q. rubra in the Grotniki Forest District comprise a total area of 4,845,86 hectares, which represents 33% of the forest district’s area. In the Grotniki Forest Inspectorate 3,447,75 hectares (38% of the forested area) and in the Glowno Forest Inspectorate 1,398,11 hectares (25%) were inventoried. In all layers of the stands, the second and the third classes of coverage were the most commonly recorded, while Q. rubra covered the largest surface area in the herb layer, which conirms that this species is spread continuously in the forest district’s stands. In the Grotniki Forest Inspectorate, Q. rubra occurred most frequently in stands of the third age class, whereas in the Głowno Forest Inspectorate stands of the fourth age class had the highest rate of occurrence. The forest habitat in which Q. rubra achieved the highest prosperity index is a moderately humid mixed coniferous forest. Keywords: northern red oak, stand layers, cover class, forest habitat type, prosperity index 1. Introduction Northern red oak (Quercus rubra), black cherry (Prunus serotina) and false acacia (Robinia pseudoacacia) are the most common alien tree species in Poland’s forests (Chmura 2004; Czerepko 2008; Gazda, Augustynowicz 2012). They occur in both managed and protected forests, especially in degraded or transformed habitats (Adamowski et al. 2002; Chmura 2004; Matuszkiewicz et al. 2007; Gazda, Augustynowicz 2012; Woziwoda et al. 2014b). Incidence of alien woody species in forest ecosystems is most often perceived as a threat to native phytocoenoses and biodiversity (Król 1988; Szwagrzyk 2000; Kohli et al. 2008; Riepšas, Straigyt 2008; Tokarska-Guzik et al. 2012; Chmura 2013; Woziwoda et al. 2014a). Hence, data on aliens and monitoring of their populations are crucial in the assessment of impacts of invasive species on forest ecosystems (Gazda 2012; Chmura 2013; Woziwoda et al. 2014b). In Poland, northern red oak Q. rubra L. used to be planted as admixture in the 1800s–1900s, mainly for the purpose of increasing timber production and forest species richness in our region. Now, 200 years after the introduction, northern red oak trees occur throughout Poland’s forests, and in some areas, they form single-species stands. The history of the introduction of Q. rubra into Poland’s forests was studied by Woziwoda et al. (2014b) with the use of data on the age of forest stands compiled by the Information System of Polish State Forests (SILP). Currently, in the State Forests, tree stands with northern red oak as a dominant or admixture species cover altogether 14,300 ha, which is 0.16% of the total forest area managed by the State Forests National Forest Holding. At the same time, SILP data indicates more than 80,000 Q. rubra sites docu- Submitted: 17.11.2015, reviewed: 04.12.2015, accepted after revision: 18.12.2015. © 2016 D. Głowacki et al. D. Głowacki et al. / Leśne Prace Badawcze, 2016, Vol. 77 (1): 32–41 mented in all the Regional Directorates of State Forests. This conirms widespread occurrence of Q. rubra in Poland’s forests, also reported by Woziwoda et al. (2014b). The paper by these authors provides information on the area covered by northern red oak in different regions of the country and data on Q. rubra proportions in regional forests as well as those on the age and habitats of the stands with northern red oak. Generally, Q. rubra is most abundant in the southern and western parts of Poland, where solid stands of this species are often observed on the areas larger than 5 ha. Forest stands in southern provinces show the highest shares of northern red oak, that is, Silesia, Lesser Poland, Opole Province and Lower Silesia (1.04%, 0.56%, 0.39% and 0.28%, respectively). In central Poland, the average percentage of Q. rubra in the State Forests ranges from 0.11% to 0.16%, except for the Łódź Province (0.23%) (Woziwoda et al. 2014b). The comparison of data on the present-day occurrence of Q. rubra and that in the mid-1900s carried out by Białobok and Chylarecki (1965) showed a gradual increase in northern red oak growing area in Poland (Gazda, Augustynowicz 2012). Potential beneits and risks because of non-native woody species in Poland’s forests have been argued for more than 20 years (Król 1988; Danielewicz 1993; Szwagrzyk 2000; Kohli et al. 2008; Danielewicz, Wiatrowska 2014; Zubkowicz 2012; Kuc et al. 2012; Chmura 2013). Notwithstanding the issues already addressed, according to the data of the Institute of Nature Conservation (the Polish Academy of Sciences), the status of Q. rubra in Poland can be described as follows: northern red oak occurs as an alien species on more than 1,000 sites all over the country, with specimen numbers ranging from a few to great numbers in solid stands, and its population has been gradually increasing (http://www.iop.krakow.pl/ias/ gatunki/142). In the database of the European and Mediterranean Plant Protection Organization (EPPO), Q. rubra has been classiied as a medium invasive plant in Europe, taking into account its spread capacity and ability to build dense enduring populations (http://www.NOBANIS.org). In Poland’s forests, both protected and managed, natural regeneration of Q. rubra has been more and more observed (Gazda, Szlaga 2008; Gazda, Fijała 2010, Fyałkowska et al. 2015). All the aforementioned facts draw attention to the necessity to undertake studies on dynamics of Q. rubra spread in our forests. When compared to protected forests, those managed seem to be more vulnerable to Q. rubra expansion, because as a general rule, woody alien species are introduced into forests because of human activities aiming at economic gains. The main objective of the present study was to assess Q. rubra expansion in central Poland’s managed forests and to determine the size of the area of natural regeneration of this alien species at a forest district level. The Grotniki Forest District was chosen as a study area, for the reason that in the 1900s, northern red oak in different forest habitats was 33 abundantly planted. The study also included an attempt to determine forest habitats with the highest rate of Q. rubra spread. The research conducted represents the irst step of the monitoring programme on this alien species undertaken in Poland’s managed forests. 2. Methods The Grotniki Forest District is situated in the central part of the Regional Directorate of State Forests in Łódź. The eastern part of the District is located in the Wzniesienia Łódzkie region, western (in the Wysoczyzna Łaska region) and northern (in the Równina Błońska region). In the District, rust soils (68.6%) prevail; however, substantial proportions of podzols (12.8%) and gley soils (5.89%) also occur. Fresh (moderately humid) forest sites (82.67%) prevail. Wet sites comprise 14.81%, and the percentage of other forest sites is quite small (bog sites, 1.45%; flood sites, 0.84%; arid sites, 0.23%). In total, deciduous forest sites comprise 50.05% of the Grotniki Forest District area, and coniferous forest sites 49.95%. The proportions of forest site types are as follows: mixed 32.79% of fresh deciduous forest, 28.15% of mixed fresh coniferous forest, 13.39% of fresh coniferous forest, 8.34% of fresh deciduous forest, 6.90% of mixed wet coniferous forest and 5.94% of mixed wet deciduous forest. A variety of forest site types makes the Grotniki Forest District an exceptional area for studying Q. rubra spread. Forests established on post-agricultural lands cover 5,700 ha, which amounts for almost 40% of the District’s forests. Within the Grotniki Inspectorate, post-agricultural soils constitute 47%, and in the Głowno Inspectorate, 28%. In the species composition, Scots pine dominates, which covers about 80% of the total area of the District studied (Forest Management Plan 2013 – Plan Urządzenia Lasu 2013). The Grotniki Forest District database comprising information on 1,473 forest segments with Q. rubra was built based on the SILP records. Each segment was evaluated with regard to Q. rubra cover in the following forest layers: young natural regeneration in the herb layer, understory (undergrowth and shrub layer) and canopy (tree layer). The evaluation was carried out diagonally between two points 50 m apart (or 100 m in the case of larger Q. rubra segments). The assessment area comprised forest layers within sight of the examiner. Q. rubra cover was expressed as the percentage (whole numbers). In each of the segments, at least three assessment points were designated (in larger segments, maximum seven). Field works were performed in the period of August–November 2014. For all the segments studied, the mean values of Q. rubra cover (area of its occurrence in the forest layers examined) were computed. On the basis of the results obtained, ZRQr index of natural Q. rubra regeneration was calculated, which 34 D. Głowacki et al. / Leśne Prace Badawcze, 2016, Vol. 77 (1): 32–41 depicts the actual area (ha) covered by naturally spreading young generation of Q. rubra. ZRQr index values were obtained as the products of multiplication of the area (ha) of a given segment and the mean value of Q. rubra cover (% expressed as decimal value) within this very segment. Analogous calculations concerning the actual area taken up by Q. rubra in understory and the total crown projection area of this species in the District’s stands were performed. The analysis of the occurrence of northern red oak in different forest layers depending on stand-site conditions included data on the type of forest site and stand age obtained from the current Forest Management Plan of the Grotniki Forest District. The results were presented in igures prepared separately for Grotniki and Głowno Inspectorates, so as to better illustrate spatial distribution of Q. rubra within the area of the District. The forest sites with minor incidence of this species were not incorporated in the igures presented in the paper. Dynamics of Q. rubra spread in different forest habitats was evaluated with the use of the species prosperity index (WP) developed for the present study as the following quotient: WP = ZRQr / UTSL where ZRQr is the proportion of the area covered by Q. rubra in a forest habitat in the total area covered by this species in a given inspectorate (%), UTSL is the proportion a forest habitat area in the total forest area in a given inspectorate. WP index was computed for lower stand layers, that is, young natural regeneration, undergrowth and brush layers in all the forest sites in the Grotniki and Głowno Inspectorates. It was concluded that the obtained index value above 1 denoted good site conditions for Q. rubra growth and spread. At the same time, it was assumed that planted in the past northern red oaks and now observed in the canopy (tree layer) were the main producers of seeds, whereas young specimens in the lower forest layers (irrespective of their origin – planted or self-sown) would be presumably involved in seed dispersal in the future. Therefore, the proportion of Q. rubra in the undergrowth and brush forest layers was also reflected on in the assessments of this species spread within the District. All the calculations were performed using Microsoft Excel Software 2010. 3. Results In the Grotniki Forest District, the segments with northern red oak comprised 4,845.86 ha, that is, 33% of the total area of the District. In the Grotniki and Głowno Inspectorates, 3,447.75 ha and 1,398.11 ha of the segments were examined, respectively. The majority of stands with Q. rubra occurred in the Forest Sub-district : Krzemień (820 ha), Smulsko (692 ha), Głowno (567 ha) and Chrośno (566 ha) (Fig. 1). In both inspectorates, Q. rubra occurred in all stand layers (Figs. 2 and 3), usually concurrently in the herb, undergrowth, brush and tree layers (20–30% ubiquitously). In both inspectorates, forest segments with Q. rubra were most often situated in fresh mixed deciduous and fresh mixed coniferous habitats. In the Grotniki Inspectorate, a considerable proportion of Q. rubra in fresh coniferous forest habitat was also observed (Fig. 2). In general, within the area of the entire District, Q. rubra was observed in middle-aged and older stands: in the Grotniki Inspectorate, mostly in the stands of third age class, and in the Głowno Inspectorate, in those of fourth age class (Fig. 4). At the same time, within the whole examined area, Q. rubra was hardly ever observed in forest stands of irst class of age. The calculated ZRQr indexes showed that in the Grotniki Inspectorate, Q. rubra took up 628.19 ha in the tree layer, whereas in the Głowno Inspectorate, 219.10 ha. In the Grotniki Inspectorate and Głowno Inspectorate taken as a whole, Q. rubra areas in undergrowth and brush layers were 597.13 and 230.46 ha, respectively. Q. rubra young natural regeneration occurred on 686.67 ha in the Grotniki Inspectorate and 250.19 ha in the Głowno Inspectorate. Figure 1. The area of stands with Q. rubra in particular forest sub-districts in Grotniki and Głowno Inspectorates. Numbers of forest sub-districts in Grotniki Forest Inspectorate: 1 – Smulsko, 2 – Bełdów, 3 – Chrośno, 4 – Krzemień, 5 – Zimna Woda, 6 – Chociszew, 7 – Sokolniki, 8 – Zgierz and in Głowno Forest Inspectorate: 9 – Szczawin, 10 – Wole Błędowa, 11 – Głowno, 12 – Polesie, 13 – Gieczno D. Głowacki et al. / Leśne Prace Badawcze, 2016, Vol. 77 (1): 32–41 35 * Explanations of forest habitat type see table 1, 2. Figure 2. Area of forest subcompartments with Q.rubra of different cover class in crown layer, undergrowth and shrub layer and natural seedling on chosen forest habitat types in Grotniki and Głowno Forest Inspectorates. Cover classes: 1 – 10%, 2 – 20%, 3 – 0%, 4 – 40%, 5 – 50%, 5 – more than 50% The values of species prosperity index (WP), calculated separately for forest habitats in the two inspectorates examined, are presented in Tables 1 and 2. With regard to young natural regeneration of Q. rubra in both inspectorate, the highest WP values were obtained in fresh mixed coniferous forest (1.88 in Głowno and 1.28 in Grotniki). In the Głowno Inspectorate, WP values above 1 were also obtained in the following sites: fresh deciduous forest (1.27), fresh coniferous forest (1.09) and fresh mixed deciduous forest (1.05). In the Grotniki Inspectorate, the WP value was above 1 only in fresh deciduous forest (1.06). In both inspectorates, the highest WP values concerning Q. rubra in forest understory were obtained in fresh mixed coniferous forest (1.76 in Głowno and 1.34 in Grotniki). At the same time, in the Głowno Inspectorate, WP values were higher than 1 also in fresh coniferous forest and fresh mixed deciduous forest (1.25 and 1.10, respectively). 36 D. Głowacki et al. / Leśne Prace Badawcze, 2016, Vol. 77 (1): 32–41 Figure 3. Area of forest subcompartments with Q.rubra of different cover classes in crown layer, undergrowth and shrub layer and natural seedling in stands of different age classes in Grotniki and Głowno Forest Inspectorates. Cover classes: 1 – 10%, 2 – 20%, 3 – 30%, 4 – 40%, 5 – 50%, 5 – more than 50% 4. Discussion In Poland, the issue of occurrence of alien woody species in forests has been addressed in geobotanical studies (Matuszkiewicz et al. 2007; Tokarska-Guzik 2005; Myśliwy 2014) as well as those on phytocoenosis degradation (Król 1988; Chmura 2013). A number of alien species most often occurring in Poland’s forests have been described in speciic reports on invasive species spread (Gazda, Augustynowicz 2012; Woziwoda et al. 2014b), based on SILP database that comprises compre- hensive information on Poland’s forests – compiled in line with forest management methodology included in the formal Forest Management Guidelines (Instrukcja Urządzania Lasu). According to the forest appraisal data (age class area, dominant species), in the Grotniki Forest District, tree stands with prevailing northern red oak cover 13.85 ha in the Grotniki Inspectorate and only 3.39 ha in the Głowno Inspectorate, that is, 0.15% and 0.06% of the sub-districts’ areas, respectively (Forest Management Plan as of 1.01.2014). On the basis of the SILP data, Gazda and Augustynowicz D. Głowacki et al. / Leśne Prace Badawcze, 2016, Vol. 77 (1): 32–41 37 Table 1. Prosperity index (WP) of natural regeneration of Q.rubra on various forest habitat types in Grotniki and Głowno Forest Inspectorates. Explanations of abbreviations: TSL – forest habitat type, ZRQr – share of area with Q.rubra on forest habitat types, UTSL – share of forest habitat types in inspectorate's forest area. Seedlings Forest Inspectorate Forest Inspectorate TSL ZRQr (%) UTSL (%) WP ZRQr (%) UTSL (%) WP Bśw MHC 8.15 10.50 0.78 19.68 18.01 1.09 Bw HC 0.07 0.26 0.28 1.04 2.16 0.48 BMśw MHMC 42.58 33.29 1.28 37.49 19.89 1.88 BMw HMC 1.40 1.84 0.76 7.44 15.00 0.50 LMśw MHMD 40.56 38.11 1.06 25.53 24.26 1.05 LMw HMD 0.31 3.63 0.09 2.01 9.64 0.21 LMb BMD 0.00 0.11 0.01 0.00 0.04 0.00 Lśw MHD 6.87 10.23 0.67 6.73 5.30 1.27 Lw HD 0.02 0.39 0.06 0.03 1.95 0.01 Ol AB 0.02 0.82 0.02 0.04 1.51 0.03 OlJ AAS 0.02 0.70 0.03 0.00 1.06 0.00 * MHC – Moderately Humid Coniferous Forest; HC – Humid Coniferous Forest; MHMC – Moderately Humid Mixed Coniferous Forest; HMC – Humid Mixed Coniferous Forest; MHMD – Moderately Humid Mixed Deciduous Forest; HMD – Humid Mixed Deciduous Forest; BMD – Bog Mixed Deciduous Forest; MHD – Moderately Humid Deciduous Forest; HD – Humid Deciduous Forest; AB – Alder Bog Forest; AAS – Ash-alder Streamside Forest. (2012) estimated the area of solid Q. rubra stands in every part of Poland’s State Forests as 3,900 ha. As said by Woziwoda et al. (2014b), within the State Forests, stands with Q. rubra as a dominant or admixture species cover in total 14,300 ha, and their proportion in the forest cover is no more than 0.16%. In view of the aforementioned statistics, Q. rubra resources in the Grotniki Forest District represent the countrywide average. Within the Grotniki Forest District area, 1,473 forest segments with Q. rubra occurring in forest herb layer, understory and canopy were examined. The results of the surveys carried out in the segments showed a real picture of the occurrence of this species at a level of the studied District. It was found that the segments with northern red oak covered 4,845.86 ha, that is, 33% of the District’s entire area. When compared to the average in the State Forest, the value obtained is sixfold higher. According to the SILP data, Q. rubra forest segments in total constitute 5% of the State Forests area (Gazda, Augustynowicz 2012). At the same time, Gazda and Augustynowicz (2012) reported that Q. rubra occurs most frequently (77% segments) as individual trees or small groups. The paper by these authors also includes the maps of Q. rubra occurrence in the forest layers (tree, brush, undergrowth and young natural regeneration) at a forest district level. These show that northern red oak commonly occurs in higher forest layers and is observed in the herb layer only in some forest districts – mainly in western and southern parts of Poland. In the forest segments examined in the Grotniki Forest District, northern red oak was observed in all the forest lay- D. Głowacki et al. / Leśne Prace Badawcze, 2016, Vol. 77 (1): 32–41 38 Table 2. Prosperity index (WP) of understory of Q.rubra (undergrowth and shrub layer) on various forest habitat types in Grotniki and Głowno Forest Inspectorates. Explanations of abbreviations: TSL – forest habitat type, ZRUQr – share of stands with Q.rubra on forest habitat types, TSL – share of forest habitat types in inspectorate's forest area. Understory Forest Inspectorate Forest Inspectorate TSL ZRQr (%) UTSL (%) WP ZRQr (%) UTSL (%) WP Bśw MHC 10.52 10.50 1.00 22.57 18.01 1.25 Bw HC 0.14 0.26 0.53 1.45 2.16 0.67 BMśw MHMC 44.45 33.29 1.34 35.04 19.89 1.76 BMw HMC 1.25 1.84 0.68 8.24 15.00 0.55 LMśw MHMD 37.33 38.11 0.98 26.67 24.26 1.10 LMw HMD 0.26 3.63 0.07 1.42 9.64 0.15 LMb BMD 0.00 0.11 0.00 0.00 0.04 0.00 Lśw MHD 5.94 10.23 0.58 3.98 5.30 0.75 Lw HD 0.05 0.39 0.13 0.06 1.95 0.03 Ol AB 0.04 0.82 0.05 0.58 1.51 0.38 OlJ AAS 0.01 0.70 0.02 0.00 1.06 0.00 * MHC – Moderately Humid Coniferous Forest; HC – Humid Coniferous Forest; MHMC – Moderately Humid Mixed Coniferous Forest; HMC – Humid Mixed Coniferous Forest; MHMD – Moderately Humid Mixed Deciduous Forest; HMD – Humid Mixed Deciduous Forest; BMD – Bog Mixed Deciduous Forest; MHD – Moderately Humid Deciduous Forest; HD – Humid Deciduous Forest; AB – Alder Bog Forest; AAS – Ash-alder Streamside Forest. ers examined, and usually, it occurred concurrently in the tree, brush, undergrowth and herb layers. The largest area was taken up by the youngest Q. rubra generation – spreading out spontaneously. Hence, in all the forest segments with northern red oak in higher forest layers, the process of its natural regeneration has also been ongoing. Taking into consideration the area taken up by Q. rubra in the District observed (one-third of the total area), the high proportion of this species is worth considering. The actual area covered by the alien youngest generation can be even larger, as the segments marked in SILP database were only examined. Gazda and Fijała (2010) observed Q. rubra natural regeneration in the Niepołomice Forest also in the stands where this species was not found in the canopy. On moderately fertile forest sites in Lithuania, numerous young Q. rubra specimens were observed 100 m from parental stands and individual seedlings even further (Straigyt , alkauskas 2012). Thus, similar patterns of natural regeneration spread can be expected within the area of the Grotniki Forest District as well. In tree stands of the Grotniki Forest District, a non-uniform distribution of Q. rubra young natural regeneration (average proportion in the segments examined: 20%) was observed. As Q. rubra segments take up one-third of the total forest area in the District, it was assumed that the youngest generation comprised about 6.6%. Such abundant natural regeneration of alien species observed in managed forests is not unusual in view of studies carried out in other regions of Europe. Considerably high populations of northern red oak young specimens were recorded in Germany and France, both in lowland and highland areas (Steiner et al. 1993; Vor 2005; Major et al. 2013). Young D. Głowacki et al. / Leśne Prace Badawcze, 2016, Vol. 77 (1): 32–41 natural regeneration of Q. rubra was unevenly distributed in forest stands observed in Germany; however, in some regions, dense vegetation carpets were observed. Average seedling density observed by Vor (2005) was 20 specimens/m2, and that reported by Major at al. (2013) was 24 specimens/m2. In France, Q. rubra seedlings formed even more dense cover, ranging from 21 to 40 specimens/m2 (Steiner et al. 1993). In Poland, detailed studies on natural regeneration of alien woody species in managed forests were carried out on circular plots in the Niepołomice Forest (southern Poland) (Gazda, Szlaga 2008; Gazda, Fijała 2010). The methodology used in this study was different from that used in the present study; therefore, only approximate comparison could be performed. Nonetheless, the results obtained by the authors cited highlight interesting aspects of Q. rubra spread. Northern red oak (young natural regeneration and mature trees) was the most abundant alien species in wet deciduous forest habitats (northern complex of the Forest), in terms of population and site numbers observed in 1-are circular plots. On the other hand, in coniferous mixed forest (southern complex), natural Q. rubra regeneration was observed only in 1 in 10 plots examined, and no mature trees of this species were found in the canopy surveyed within the area of the study plots (Gazda, Fijała 2010). In the Niepołomice Forest, Q. rubra young natural regeneration and undergrowth are most often observed in the stands with single or a few mature trees of this species. Within the plots surveyed, Q. rubra natural regeneration under same species mature trees comprised up to several dozen specimens, and these were the youngest trees only (Gazda, Fijała 2010). Studies by other authors showed that O. rubra young natural regeneration deteriorate in solid parental stands, and therefore, brush layer of this species is almost never observed in solid parental stands (Bellon et al. 1977; Jaworski 1995). In the Grotniki Forest District, the proportion of forest stands with dominant northern red oak was diminutive, and generally, the species occurred as admixture. According to the present knowledge, such status supports further spreading of Q. rubra throughout forest stands. In the Grotniki Inspectorate, Q. rubra occurred most frequently in the stands of the third class of age in all the forest layers examined, whereas in the Głowno Inspectorate, it occurred in the stands of the fourth class of age. In such stands, northern red oak shows high intensity of seed production, followed by the development of numerous seedlings. The occurrence of Q. rubra young specimens in the herb layer does not assure the incidence of this species in expected mature stands; nevertheless, it increases species chances to survive (e.g. in case of disturbances because of strong winds or pest infestations). Furthermore, dense young natural regeneration of this alien species supports its endurance, as it holds back the development of native brush and tree species (Bzdęga et al. 2012). In Poland, northern red oak was planted on a variety of soils: from dry and unfertile coniferous to rich deciduous sites 39 including floodplains. According to SILP data, the majority of present-day forest stands with Q. rubra grow on the following forest sites: fresh mixed deciduous forest, mixed coniferous forest and fresh deciduous forest (Woziwoda et al. 2014b). In the Grotniki Forest District, forest segments with Q. rubra were located mainly in fresh mixed deciduous and mixed coniferous stands. In the Głowno Inspectorate, the segments with Q. rubra were also recorded in fresh coniferous stands. Both the age structure and site characteristics of the stands with Q. rubra indicate that these forests were established on post-agricultural soils afforested later than the year 1945 (after the World War II). In fact, almost 40% of forests in the Grotniki Forest District grow on post-agricultural lands. Such habitats are especially vulnerable to invasive alien species, considering soil degradation and biodiversity reduction – largely attributable to unnaturally stimulated succession because of human activity (Sierota, Zachara 2011), One of the aims of the present study was to identify forest habitats with the highest rate of spontaneous spread of Q. rubra. Methodological obstacles during the assessment of natural regeneration of this species were connected with the fact that at irst, great abundance of Q. rubra seedlings in the herb forest layer most often declines with time. Under the conditions of the present study, it was not possible to distinguish which parts of the undergrowth and brush layers had been planted and which had regenerated naturally. However, regardless of their origin, Q. rubra young trees are a potential source of future seeds and offshoots, and that is why, the species prosperity index WP was calculated for trees in the lower stand layers. The highest WP values were obtained in fresh mixed coniferous forest in all the layers observed (herb, undergrowth and brush layers). Higher index values were obtained in the Głowno Inspectorate. In view of the results obtained, it can be concluded that fairly fertile and moderately wet habitats offer the best conditions for the development and spread of northern red oak. The lack of competitors can be a favourable factor in the development Q. rubra seedlings under the conditions of fresh mixed coniferous forest. Another habitat vulnerable to Q. rubra spread was fresh mixed deciduous forest, where the WP value obtained was higher when compared to other forest segments with Q. rubra. Additionally, in the Głowno Inspectorate, the WP values obtained were higher than 1 in the undergrowth and brush layers of fresh coniferous forest. Taking into account conditions of the Forest District Grotniki, the proportion of northern red oak in the Grotniki Inspectorate (38% of the total forest inspectorate area) was larger than that in the Głowno inspectorate (25 %). Nevertheless, Q. rubra spread in the sub-district Głowno was comparatively more extended. In the Grotniki inspectorate, afforested post -agricultural lands constitute almost 50%, and the present-day proportion of Q. rubra in the canopy indicates that in the past, this species was an important admixture species in afforested 40 D. Głowacki et al. / Leśne Prace Badawcze, 2016, Vol. 77 (1): 32–41 areas. Abundant occurrence of northern red oak on degraded sites indicates favourable conditions for its spread. On the other hand, in the Grotniki Inspectorate, the area taken up by Q. rubra young natural regeneration calculated with reference to the proportion of Q. rubra mature trees (producing seeds) was smaller (9.3%) when compared to that (14.2%) in the Głowno Inspectorate (with 28% afforested post-agricultural lands). In view of the aforesaid differences, it is quite possible that a higher proportion of coniferous forest sites along with a greater diversity of forest habitats in the Głowno Inspectorate (Table 1) supported enhanced spread of Q. rubra. In closing, one more aspect of the existence of woody alien species in forests should be underlined. In the Grotniki Forest District, the highest proportion of northern red oak was observed in fresh mixed deciduous or fresh mixed coniferous forests. These are habitats where a variety of native tree species can successfully form the undergrowth forest layer as well as play a role of admixture species. Eutrophication of forest ecosystems – recently increasing in Poland – enhances the growth of deciduous tree species. In the meantime, the presence of northern red oak in the lower forest layers can effectively hinder the process. Staringer et al. (2003) showed plant biodiversity loss in forests with alien woody species in understory vegetation. Even though decreased plant biodiversity has no direct effect on economic forest productivity, it plays an important role in biological resilience of forest communities. 5. Conclusion The results of the study showed that in the Grotniki Forest District, Q. rubra occurred on one-third of the District’s area as a vital component of all stand layers. The largest areas of the inspectorates (Grotniki and Głowno) were taken up by Q. rubra young natural regeneration, which indicates spontaneous spread of this species in the District. The area taken up by Q. rubra young natural regeneration calculated with reference to the proportion of Q. rubra mature trees (producing seeds) in the Grotniki and Głowno inspectorates was 9.3% and 14.2%, respectively. Northern red oak showed the highest values of prosperity index (WP) in fresh mixed coniferous forest in both young natural regeneration and understory vegetation (undergrowth and brush layers). Higher WP values were observed in understory vegetation in the Głowno Inspectorate when compared to the Grotniki Inspectorate. It seems that fairly fertile and, at the same time, moderately wet forest habitats offer optimal conditions for Q. rubra spread. Taking into consideration the age structure of stands as well as a variety of forest habitats in the Forest District Grotniki, an increase in the northern red oak proportion can be expected. In view of current knowledge, enhanced spread of invasive alien species can disturb and di- minish plant communities in forest ecosystems. This problem concerns not only forest stands with Q. rubra as a dominant or admixture species in State Forest (according to SILP database – in total 14,300 ha, Woziwoda et al. 2014b). The results obtained on this alien species in the Forest District Grotniki indicate an increasingly challenging problem. Conlict of interest No potential conflicts are declared by the authors. Gratitude and source of funding The authors would like to heartily thank the reviewers of this paper for their comprehensive review and valuable comments. The study was inancially supported by research grant of the Department of Forest Protection and Ecology of the Warsaw Agricultural University. References Adamowski W., Dvorak l., Ramanjuk I. 2002. Atlas of alien woody species of the Białowieża Forest. Phytocoenosis 14 (N.S.), Supplementum Cartographiae Geobotanicae 14: 1–303. Bellon S., Tumiłowicz J., Król, S. 1977. Obce gatunki drzew w gospodarstwie leśnym. Państwowe Wydawnictwo Rolnicze i Leśne. Warszawa. Białobok S., Chylarecki, H. 1965. Badania nad uprawą drzew obcego pochodzenia w Polsce w warunkach środowiska leśnego. Arboretum Kórnickie 10: 211–276. Bzdęga K., Pajdak E., Tokarska-Guzik B., Chmura D., Woźniak G. 2012. Zależność odnawiania się rodzimych gatunków roślin od rodzaju i wielkości nekromasy w lasach mieszanych z dominacją inwazyjnego dębu czerwonego, in: Obce gatunki w lasach. Materiały VIII Konferencji Naukowej: Aktywne Metody Ochrony Przyrody w zrównoważonym leśnictwie. Rogów, 29–30.03.2012r. Chmura D. 2004. Penetration and naturalisation of invasive alien plant species (neophytes) in woodlands of the Silesian Upland (Southern Poland). Nature Conservation 60: 3–11. Chmura D. 2009. Differences in invasiveness of alien woody plants in forest communities of the Silesian Upland (Southern Poland).The role of geobotany in biodiversity conservation, University of Silesia, Katowice, 297–302. Chmura D. 2013. Impact of alien tree species Quercus rubra L. on understory environment and flora: a study of the Silesian Upland (Southern Poland). Polish Journal of Ecology 61(3): 431–442. Danielewicz W. 1993. Występowanie drzew i krzewów obcego pochodzenia jako problem ochrony przyrody w rezerwatach i parkach narodowych. Przegląd Przyrodniczy 4(3): 25–32. Danielewicz W., Wiatrowska B. 2014. Inwazyjne gatunki drzew i krzewów w lasach Polski. Peckiana 9: 59–67.Fyałkowska K., D. Głowacki et al. / Leśne Prace Badawcze, 2016, Vol. 77 (1): 32–41 Wroniewski M.R., Obidziński A. 2015. Gatunki roślin obcego pochodzenia w Puszczy Ladzkiej. Studia i Materiały CEPL w Rogowie 42(1): 95–109. Gazda A. 2012. Stan badań nad obcymi gatunkami drzew w polskich lasach taksonów. Studia i Materiały CEPL w Rogowie 33(4): 44–60. Gazda A., Augustynowicz P. 2012. Obce gatunki drzew w polskich lasach gospodarczych. Co wiemy o puli i o rozmieszczeniu wybranych taksonów. Studia i Materiały CEPL w Rogowie 33(4): 53–61. Gazda A., Fijała M. 2010. Obce gatunki drzewiaste w południowym kompleksie Puszczy Niepołomickiej. Sylwan 154(5): 333–340. Gazda A., Szlaga A. 2008. Obce gatunki drzewiaste w północnym kompleksie Puszczy Niepołomickiej. Sylwan 152(4): 58–67. Jaworski, A. 1995. Charakterystyka hodowlana drzew leśnych. Gutenberg. Kraków, 237 s. ISBN 83-86310-03-0. Kohli R.K., Jose S., Singh, H.P., Batish, D.R. (eds.). 2008. Invasive plants and forest ecosystems. CRC Press, 456 s. ISBN-13:978-1-4200-4337-2. Król S. 1988. Synantropizacja itocenoz leśnych przez introdukcję obcych gatunków drzew. Wiadomości Botaniczne 32(2): 115–124. Kuc M., Piszczek M., Janusz A. 2012. Znaczenie dęba czerwonego w ekosystemie leśnym i rachunku ekonomicznym nadleśnictw Regionalnej Dyrekcji Lasów Państwowych w Katowicach. Studia i Materiały CEPL 33(4): 152–159. Major K.C., Nosko P., Kuehne C., Campbell D., Bauhus J. 2013. Regeneration dynamics of non-native northern red oak (Quercus rubra L.) populations as influenced by environmental factors: A case study in managed hardwood forests of southwestern Germany. Forest Ecology and Management 291: 144– 153. DOI 10.1016/j.foreco.2012.12.006. Matuszkiewicz J.M., Solon J., Orzechowski M., Kozłowska A., Różański W., Szczygielski M., Kowalska A. 2007. Geobotaniczne rozpoznanie tendencji rozwojowych zbiorowisk leśnych w wybranych regionach Polski. Monograie IGiPZ PAN, 8, 980 s. Myśliwy M. 2014. Plant invasion across different habitat types at floristic survey. Applied Ecology and Environmental Research 12(1): 193–207. Riepšas E., Straigyt L. 2008. Invasiveness and ecological effects of red oak (Quercus rubra L.) in Lithuanian forests. Baltic Forestry 14(2): 122–130. Sierota Z., Zachara T. 2011. Drzewostany na gruntach porolnych – dawniej i dziś, in: Zmiany w środowisku drzewostanów sosnowych na gruntach porolnych w warunkach przebudowy częściowej oraz obecności grzyba Phlebiopsis giganea (red. Z. Sierota ). Prace Instytutu Badawczego Leśnictwa, Rozprawy i Monograie 17: 15–22. Staringer U., Kowarik I., Rode M., Schepker H. 2003. From desirable plant to pest do accepted addition to flora? The perception Translated by: Bożena Kornatowska 41 of alien tree species through centuries. Biological Invasions 5: 232–335. Steiner K.C., Abrams M.D., Bowersox T.W. 1993. Advance reproduction and other stand characteristics in Pennsylvania and French stands of northern red oak, in: Proceedings of the 9th Central Hardwood Forest Conference; General Technical Report NC-161. U.S. Department of Agriculture, Forest Service, North Central Forest Experiment Station, 473–483. Straigyté L., Žalkauskas R. 2012. Effect of climate variability on Quercus rubra phenotype and spread in Lithuanian forests. Dendrobiology 67: 79–85. Szwagrzyk J. 2000. Potencjalne korzyści i zagrożenia związane z wprowadzaniem do lasów obcych gatunków drzew. Sylwan 144(2): 99–106. Tokarska-Guzik B. 2005. The establishment and spread of alien plant species (kenophytes) in the flora of Poland. Wydawnictwo Uniwersytetu Śląskiego, Katowice, 192 s. Tokarska-Guzik B., Dajdok Z., Zając M., Zając A., Urbisz A., Danielewicz W., Hołdyński Cz. 2012. Rośliny obcego pochodzenia w Polsce ze szczególnym uwzględnieniem gatunków inwazyjnych. Generalna Dyrekcja Ochrony Środowiska, Warszawa, 197 s. ISBN 978-83-62940-34-9. Vor T. 2005. Natural regeneration of Quercus rubra L. (Red Oak) in Germany. Neobiota 6: 111–123. Woziwoda B., Kopeć D., Witkowski J. 2014a. The negative impact of intentionally introduced Quercus rubra L. on a forest community. Acta Societatis Botanicorum Poloniae 83(1): 39–49. DOI: 10.5586/asbp.2013.035. Woziwoda B., Potocki M., Sagan J., Zasada M., Tomusiak R., Wilczyński S. 2014b. Commercial forestry as a vector of alien tree species – the case of Quercus rubra L. Introduction in Poland. Baltic Forestry 20(1): 131–141. Zubkowicz R. 2012. Gatunki obce i inwazyjne – Wywiad z Wojciechem Solarzem z IOP w Krakowie. Las Polski 6: 20–21. Other sources http://www.iop.krakow.pl/ias/gatunki/142 [2.02.2015]. http://www.NOBANIS.org [12.02.2015]. Plan Urządzenia Lasu sporządzony na lata od 2014–2023 dla Nadleśnictwa Grotniki w RDLP w Łodzi na podstawie stanu lasu w dniu 1 stycznia 2014 r. Opis ogólny lasów nadleśnictwa (elaborat). BULiGL, Warszawa, Wydział Produkcyjny w Łodzi. Authors’ contribution D.G. – ield works, database, M.Ska – study conception, analysis of data and literature, preparation of manuscript, text editing, M.Ski – methodology, text editing. DOI: 10.1515/frp-2015-0005 Available online: www.lesne-prace-badawcze.pl Leśne Prace Badawcze / Forest Research Papers Marzec / March 2016, Vol. 77 (1): 42–49 e-ISSN 2082-8926 ORIGINAL RESEARCH ARTICLE Density of red squirrels and their use of non-native tree species in the Rogów Arboretum Dagny Krauze-Gryz1*, Kinga Mazur1, Jakub Gryz2 1 Warsaw University of Life Sciences – SGGW, Faculty of Forestry, ul. Nowoursynowska 159, 02–776 Warszawa, Poland; 2Forest Research Institute, Department of Forest Ecology, Sękocin Stary, ul. Braci Leśnej 3, 05–090 Raszyn, Poland *Tel. +48 22 5938145, e-mail: dagny.krauze@wl.sggw.pl Abstract. The aim of the study was to compare the densities of red squirrel (Sciurus vulgaris) in the arboretum and a neighbouring forest and to investigate which tree species the squirrels used. The study was conducted in the area of the Rogów Arboretum (53.76 ha) and the so-called Zimna Woda and Wilczy Dół forest complexes (altogether 536 ha), all being part of an Experimental Forest Station in Rogów. The density of squirrels in the arboretum and the neighbouring forest was estimated and compared by means of snow tracks on transect routes. Changes in the abundance of squirrels throughout one year as well as their behaviour were determined on the basis of direct observations along transects running through the arboretum. More than half of the area of the arboretum was searched in order to record feeding signs of squirrels. Additionally, trees with bark stripping were recorded. The density of snow tracks was higher in the arboretum (0.19 tracks/100 m/24 h) than in the neighbouring forest (0.09 tracks/100 m/24 h). The largest number of observations of red squirrels along transects was made between February and April, in July and August and in October and November. In about half of the cases, squirrels were feeding on one of six non-native tree species (most often on cones of Macedonian pine, Pinus peuce). Feeding signs were found on 39 plots (17%) and 16 different tree species. The most numerous feeding signs were found on plots with Douglas ir (Pseudotsuga menziesii) and also on plots with the western hemlock (Tsuga heterophylla), Swiss pine (Pinus cembra), mountain silverbell (Halesia monticola) as well as shagbark (Carya ovata) and shellbark hickories (C. laciniosa). On eight plots, trees with signs of bark stripping were found, most commonly on Sawara cypress (Chamaecyparis pisifera). Its soft bark was probably used to build dreys. In the area of the arboretum, the natural food sources (seeds of native trees) are supplemented with numerous non-native tree species, which seeds are also consumed by squirrels. The highly abundant and diverse food sources promote a higher density of the red squirrel in the area of the arboretum. Additionally, when tree seeds are scarce in the neighbouring forest, squirrels migrate into the arboretum. Keywords: Sciurus vulgaris, live traps, snow tracking, visual counts, feeding signs, bark stripping 1. Introduction Red squirrel could primarily be found in forests of northern Eurasia (Shar et al. 2008). It is a very flexible species, which can easily adapt to mild environmental changes. That is why red squirrel could be found in natural forests (Stachura et al. 2004) and also in small wooden areas on agricultural lands (Wauters 1997) as well as city parks (Babińska-Werka, Żółw 2008; Krauze-Gryz et al., unpublished.), where squirrels feed on various types of food offered by people (Krauze-Gryz, Gryz 2015). Red squirrel consumes variety of foods. Its diet depends on the environ- ment where squirrel is found and also changes throughout the year depending on food availability (Krauze-Gryz, Gryz 2015). However, red squirrel more highly prefers seeds of coniferous and broadleaved trees, whilst squirrel population density fluctuates depending on the seed availability (Lurz et al. 1995;Wauters et al. 2008). Red squirrel population densities are higher in places where food availability is steady throughout the year (Wauters et al. 2008). During the periods when main food supply of tree seeds is low, red squirrels try to locate the more productive tree groups within their forest, increase their home ranges or migrate (Lurz et al. 2000;Wauters et al. 2005). Submitted: 26.08.2015, reviewed: 09.11.2015, accepted after revision: 24.11.2015. © 2016 D. Krauze-Gryz et al. D. Krauze-Gryz et al. / Leśne Prace Badawcze, 2016, Vol. 77 (1): 42–49 The Rogów Arboretum is a vast area presenting a rich food base, which includes tree seeds from native and introduced species. High species diversity of trees producing seeds in different terms results in a more stable supply of food within the arboretum area compared to the surrounding forests. It could be predicted that during the years with low yields of seeds produced by the main forest species making up the surrounding to arboretum forests, squirrels from those areas would shift to the arboretum area in search of food supply. It could also be assumed that because of the rich food supply, red squirrel densities within the arboretum could be higher than those in surrounding forests. The goal of the current study was to compare densities of red squirrels within the arboretum with squirrel densities in nearby forests, as well as identifying which non-native tree species are used by squirrels and in which way (feeding on seeds, bark stripping). 2. Study area The research was conducted within the area of the arboretum (53.76 ha) and also in the neighbouring Zimna Woda and Wilczy Dół forest complexes (altogether 536 ha) which are part of the Experimental Forest Station in Rogów. The arboretum was founded in 1925. Fragments of the forest that existed before the arboretum was organised include 150-year old pines (Pinus sylvestris) and also spruces (Picea abies), oaks (Quercus spp.) and European hornbeam (Carpinus betulus). The arboretum has the collection of tree species (from 2,837 taxa), tropical plants (growing in the greenhouse), herbaceous and alpine species. Forest experimental areas cover the signiicant part of the arboretum (in total 18 ha), where 75 non-native tree species are growing (including 50 coniferous species). Undeveloped part of the arboretum is covered by the 80-year old forest with pine being the dominant tree species (Tumiłowicz 1993; http://arboretum.sggw.pl). Pine is also a dominant tree species of the commercial forest that stands neighbouring the arboretum with oak and larch (Larix spp.) which have signiicant shares in those forests. Stands with multiple tree species are more common. Both in the arboretum and in nearby forest complexes, fresh broadleaved and fresh mixed broadleaved site types prevail (Zielony 1993). 3. Methods 3.1. Comparison of red squirrel densities in the arboretum and nearby forest complexes In December 2014 and January 2015 (during ive days altogether), observations were conducted on transects with the length from 200 to 1,000 m located evenly in the area of the arboretum (11 transects with the combined length of 6,850 43 m) and in nearby commercial forests (19 transects with the combined length of 13,000 m). Total length of the observation trails amounts to 8,600 m in the arboretum and 19,100 m in the commercial forests. The number of snow tracks left by red squirrels was registered on 100-m trail sections. Based on those observations, snow track density was calculated (N/100 m/day) for the arboretum and also for the commercial forests. The observations in arboretum and the commercial forests were conducted on the same day in order to minimise the influence of factors such as snow depth and surrounding temperature on red squirrel activity as well as study results. 3.2. The use of non-native tree species by red squirrel Direct squirrel observations Five evenly located transects with the width of 40 m (Babińska-Werka, Żółw 2008) and the length of 500–900 m (3600 m in total) were laid down in the arboretum (Fig. 1). Observations covered the area of about 14.4 ha, which is about 27% of the total arboretum area. Control observations were conducted from April 2014 to March 2015, averaging two times per month (29 control observations in total). Observations were done in the morning (from 7:30 to 11:30) under favourable weather conditions, which represents the time of peak squirrel activity (Wauters, Dhondt 1987; Bosch, Lurz 2012). The number of squirrels, their behaviour and also a tree species where squirrel was located were noted. Registering feeding signs The developed part of the arboretum is divided into sectors with different areas (Fig. 1). The search for feeding signs of red squirrels was conducted during seven control observations (in April, May, September and November of 2014) within the arboretum sectors. Study plots were set along the transect routes about 20 m apart from each other. Conifer cones or shells of broadleaved tree seeds with signs of red squirrel feeding were registered. The areas with mature trees producing seeds were selected. The areas with very young trees not producing seeds, areas covered with dense shrub vegetation hindering observations, as well as areas with herbaceous and ornamental vegetation not used by red squirrels were avoided. In total, 228 plots were controlled, which amounts to 63% of all plots within the arboretum area (Fig. 1). Bark stripping Control observations intended for study of the use of bark by red squirrels were conducted in May 2015. Moving along the ive transect routes (Fig. 1), observers noted trees with bark damaged by red squirrels. Furthermore, the number of all trees of a given species was counted as well as those trees damaged by squirrels. 44 D. Krauze-Gryz et al. / Leśne Prace Badawcze, 2016, Vol. 77 (1): 42–49 Figure 1. Studied plots in the area of Rogów Arboretum and transect routes for direct observations of red squirrels D. Krauze-Gryz et al. / Leśne Prace Badawcze, 2016, Vol. 77 (1): 42–49 Data analysis The difference between snow track densities in the arboretum and commercial forests was assessed by Student’s t-test. Normal distribution was tested by the Shapiro–Wilk test. Statistical analysis was implemented by using the Past3 programme. 4. Results 4.1. Red squirrel densities in the arboretum and the commercial forests The average snow track density in the arboretum was higher and equal to 0.19 tracks/100 m/day, whilst in neighbouring forest, it was equal to 0.09/100 m/day (t = 2.4; p < 0.05). 4.2. The use of non-native tree species by red squirrels Direct observations Red squirrels were observed in total 59 times on transect routes. Observations were not distributed evenly (Fig. 1). Most of the observations (30 cases) were done on the irst transect, whilst there were no red squirrel observation on the ifth transect. About half of the observed squirrels were foraging (29 cases), including 5 cases of foraging on the ground. In the remaining cases, the animals were showing breeding behaviour, moving in tree crowns or on the ground, resting, or water from tree stump. Red squirrels feeding on tree seeds were observed on Macedonian pine (Pinus peuce) (eight observations), Scots pine (Pinus sylvestris L.) (four observations), eastern black walnut (Juglans nigra) (four observations), mountain silverbell (Halesia monticola) (three observations), white walnut (Juglans cinerea) (two observations), shellbark hickory (Carya laciniosa) (two observations), common hazel (Corylus avellana) (one observation). On the ground, red squirrels were foraging under lime trees (Tilia spp.) (three observations) and dawn redwood (Metasequoia glyptostroboides) (two observations.). One-ifth (12 squirrels) was observed on ir trees: Caucasian (Abies nordmanniana), noble (Abies procera), Greek (Abies cephalonica) and Nikko (Abies homolepis); however, in none of those cases, squirrels were foraging. The number of red squirrels observed on transect trails has been changing throughout the year (Table 1). On an average during one daily control, two squirrels were seen, with the maximum seen in February (4.3 observations/control) and minimum in January and May (0.5 observations/control). More often red squirrels were seen in the arboretum from February to April (3.0–4.3 observations/control), followed by the period of July–August (1.8–2.5 observations/control) and then by October-November (2.3–3.0 observations/control). The share of foraging squirrels was different (Table 1). In January and February, there were no foraging individuals, in March 45 Table 1. Number of observations of red squirrels and their behaviour as based on direct observations along transects in the area of Rogów Arboretum Month Behaviour Feeding Others n controls n observations/ control 01 1 2 0.5 02 13 3 4.3 03 1 6 2 3.5 04 2 1 1 3.0 1 2 0.5 1 1 2 1.0 3 4 1.8 2 2.5 05 06 07 4 08 5 09 2 1 2 1.5 10 2 4 2 3.0 11 5 2 3 2.3 12 2 2 4 1.0 Total 24 35 29 2.0 only one out of six observed animals was foraging. In June, October and December, half of the observed squirrels were foraging, and during the remaining months (April, July, September and November), the majority of the observed squirrels were foraging. In August, red squirrels were seen ive times and all those times squirrels were foraging. Feeding signs Feeding signs were found on 39 study plots (17% plots studied), where red squirrels used 16 non-native tree species (Fig. 1, Table 2). Besides that, there were multiple signs of squirrel feeding on cones of Scots pine and Norway spruce (P. abies). Most of the studied plots had Douglas ir (Pseudotsuga menziesii) on them, whilst on most of those plots (10 out of 11), there were feeding signs on Douglas ir cones. Red squirrel feeding signs were often found on cones of Macedonian pine (on four plots), western hemlock (Tsuga heterophylla) and Swiss pine (Pinus cembra) (on three plots), and amongst broadleaved species on mountain silverbell (on ive plots) and seeds of shagbark hickory (Carya ovata) and shellbark hickory (C. laciniosa) (on three plots). There were no red squirrel feeding signs on 198 study plots. Sixty seven of those plots had a non-native tree species as a dominant (Table 3). Remaining 13 plots had native tree species being dominant (Scots pine in 10 plots, Norway spruce in 1 plot, Scots elm (Ulmus glabra) in 1 plot and European white elm (Ulmus laevis) in 1 plot). On 109 study plots with no feeding signs of red squirrels, it was not possible to determine a dominant tree species. D. Krauze-Gryz et al. / Leśne Prace Badawcze, 2016, Vol. 77 (1): 42–49 46 Table 2. Alien tree species with feeding signs of red squirrels on their seeds, recorded during controls of the plots in the arboretum *native species outside its natural range Bark stripping Eight study plots had trees with bark stripped by red squirrels. Six of them had western red cedar (Thuja plicata) as a dominant species. The damages were noted on 19.4% of trees (n = 418). The bark damage often occurred on sawara cypress (Chamaecyparis pisifera), which is present in two study plots (36%, n = 125). Bark stripping was also observed on Japanese red cedar (Cryptomeria japonica) (on four out of four trees) and dawn redwood (M. glyptostroboides) (on one out of four trees). There was also one case of bark stripping on Père David’s maple (Acer davidii subsp. grosser). 5. Discussion With the use of the relative quantiication method, snow tracking on transects, it was possible to conclude that red squirrel density in the arboretum was higher than that in the forests adjacent to it. It could result from influx of individuals from the surrounding areas during the time of food scarcity (Wauters et al. 2005). Besides, it could be assumed that rich food base from numerous coniferous and broadleaved tree species (such as walnuts and hickories) allows for higher squirrel densities. The number of observed red squirrels in the arboretum was variable. Three culminations in squirrel quantities were ob- served in winter and early spring (February–April), summer (July–August) and autumn (October–November). Although the width of observation pass was chosen in a way limiting the error related to changing possibilities of squirrel observations linked to vegetation density, the probability of squirrel spotting in tree crowns is higher during bare tree season (Babińska-Werka, Żółw 2008). The number of red squirrels observed on transects could also depend on seasonal variations in their abundance, which peaks in autumn after the end of reproductive season. Squirrel numbers could also be affected by seasonal changes in activities of animals, which is lower during winter when temperatures are low (Wauters, Dhondt 1987; Bosch, Lurz 2012). In the Łazienki Park in Warsaw, signiicantly higher numbers of red squirrels were observed on transects in autumn and winter (Babińska-Werka, Żółw 2008), whilst in the Skaryszewski Park in Warsaw, it was higher in spring (from March to April) and later in summer and autumn (from August to November) (Prus 2014). The pattern observed by the discussed study partially agree with the data from the Skaryszewski Park (the average number of animals observed during a single control observation was higher in spring and autumn). The additional peak in number of red squirrels during summer could be explained by the influx of individuals from surrounding forest areas at the time of seed ripening on walnuts or hickories. D. Krauze-Gryz et al. / Leśne Prace Badawcze, 2016, Vol. 77 (1): 42–49 Table 3. Tree species dominating on plots where no feeding signs of red squirrels were found 47 48 D. Krauze-Gryz et al. / Leśne Prace Badawcze, 2016, Vol. 77 (1): 42–49 The majority of 16 tree species on which red squirrel feeding signs were observed in the Rogów arboretum do not grow naturally within red squirrel distribution area. They include Douglas ir and western hemlock, species originating from North America, on which most of the feeding signs were found, and also dragon spruce (Picea asperata), eastern white pine (Pinus strobus) as well as Armand pine (Pinus armandii). It is known that seeds of coniferous trees constitute a basic diet of red squirrels living in boreal forests (Krauze-Gryz, Gryz 2015). Numerous feeding signs were also found on eastern black walnut (Juglans nigra) and white walnut (Juglans cinerea) as well as on shellbark and shagbark hickories originating from the United States. Indeed, red squirrels readily select nuts (walnuts and hazelnuts) as their source of food in both broadleaved and mixed forests, likewise as food presented to them by people in city parks (Moller 1983; Krauze-Gryz, Gryz 2015). Black pine (Pinus nigra) deserves a special attention amongst species used by red squirrels as their food source. Its seeds (besides Scots pine) constituted a basic diet of squirrels in Belgium (Wauters, Dhondt 1987; Wauters et al. 1992), the Formby Nature Reserve in England (Shuttleworth 1997), and also in Japan (Lee 2002). Also the seeds of Swiss pine (P. cembra) were listed as a key food source of squirrels in Russia (Moller 1983). Red squirrel foraging was not conirmed on 39 species. Some of them, such as lodgepole pine (Pinus contorta) constitute food basis of squirrels in some areas (Bosch, Lurz 2012). It is also known that squirrels readily eat seeds of Korean pine (Pinus koraiensis) (Lee 2002) and also spruces (Moller 1983). No feeding signs of squirrels were found on acorns or larch cones, although they could be eaten by squirrels (Bosch, Lurz 2012; Krauze-Gryz, Gryz 2015). Similarly, squirrels did not consume maple seeds (two species) or ash (Fraxinus spp.) seeds (two species), even though they could be used by squirrels. For example, squirrels in Japan ate seeds of mono maple (Acer mono) (Lee 2002) and those in Italy ate seeds of ield maple (Acer campestre) (Wauters et al. 2001). The lack of feeding signs on the above species (and also on other trees, which produce seeds consumed by squirrels, such as beeches (Moller 1983) or magnolias (Lee 2002)) could be explained by the short study interval. It is possible that study did not correspond to the year of abundant seed production for those species. It may also be likely that within understory vegetation, it was hard to notice cone remains or seeds. Amongst the species with no feeding signs of squirrels were also 11 ir species. In Japan, squirrels were foraging on the mentioned above Sakhalin pine (Abies sachalinensis) (Lee 2002) and in Russia on European silver ir (Abies alba) (Moller 1983). However, Rubino et al. (2012) suggested that because of high amount of tannins and terpenes in silver ir seeds, squirrels avoided those seeds. Red squirrels strip bark from trunks and tree branches and eat cambium. It is more common in the case of larches, Scots pine, Norway spruce, silver birch (Betula pendula), Europe- an beech (Fagus sylvatica) and also sycamore maple (Acer pseudoplatanus). Such behaviour could also be connected with foraging on fungi growing under the bark (Krauze-Gryz, Gryz 2015). Squirrels also strip the bark whilst collecting phloem for construction of their dreys. In Poland, red squirrels often use basswood (Tilia cordata) phloem stripped from young branches for the construction of dreys (Krauze-Gryz D., personal observations). In the arboretum, red squirrels stripped peeling patches of bark from western red cedar (T. plicata), sawara cypress (C. pisifera) or dawn redwood (M. glyptostroboides). Their bark is elastic and easily peeled from the tree trunk, possibly being a good source of material for a drey construction. 6. Conclusions 1. Red squirrel density in the arboretum was higher than that in nearby commercial forests. It could result from the influx of individuals during the season with scarce food. Besides, rich food base (native tree species as well as numerous broadleaved and coniferous non-native species fruiting in different terms) could support higher densities of red squirrels. 2. The numbers of red squirrels observed in arboretum has been changing throughout the year. This could be explained by the population dynamics (reproduction), limited activity of squirrels during low temperature and also changing observation conditions throughout the year (vegetation density). However, it could also result from influx of animals to the area of the arboretum during the time of seed ripening (walnuts and hickories). 3. Red squirrels were foraging not only on tree species growing naturally in Poland but also on non-native tree species, such as those originating from North America. This shows flexibility of the studied species. 4. There were no feeding signs on tree species, which according to the literature, produce seeds possibly used by squirrels. This could be explained by short study period (study did not correspond to abundant seed production), a very young tree age, or dificulty in inding required feeding signs (small seeds, dense understory vegetation). 5. Soft, elastic, peeling tree bark was likely used by squirrels as a material for drey construction. Conlict of interest The authors declare the absence of potential conflicts. Acknowledgements and source of funding The authors would like to thank Mr. Piotr Banaszczak, the head of the Rogów Arboretum, for helping in conducting this research and also for valuable information on the topic of red squirrel foraging. D. Krauze-Gryz et al. / Leśne Prace Badawcze, 2016, Vol. 77 (1): 42–49 References Babińska-Werka J., Żółw M. 2008. Urban populations of the red squirrel (Sciurus vulgaris) in Warsaw. Annales Zoologici Fennici 45: 270–276. DOI: 10.5735/086.045.0405. Bosh S., Lurz P. 2012. The Eurasian red squirrel. Westarp Wissenschaften, Hohenwarsleben, Germany. ISBN-978-3-89432-258-8. Krauze-Gryz D., Gryz J. 2015. A review of the diet of the red squirrel (Sciurus vulgaris) in different types of habitats, in: Red squirrels: ecology, conservation & management in Europe (eds. C.M. Shuttleworth, P.W.W. Lurz, M.W. Hayward). European Squirrel Initiative, s. 39–50. ISBN-978-0-9547576-1-8. Lee T.H. 2002. Feeding and hoarding behaviour of the Eurasian red squirrel Sciurus vulgaris during autumn in Hokkaido, Japan. Acta Theriologica 47: 459–470. DOI: 10.1007/BF03192470. Lurz P.W.W., Garson P.J., Rushton S.P. 1995. The ecology of squirrels in spruce dominated plantations: implications for forest management. Forest Ecology and Management 79: 79–90. DOI: 10.1016/0378-1127(95)03617-2 Lurz P.W.W., Garson P.J., Wauters L.A. 2000. Effects of temporal and spatial variations in food supply on the space and habitat use of red squirrels (Sciurus vulgaris L.). Journal of Zoology 251: 167–178. DOI: 10.1111/j.1469-7998.2000.tb00601.x. Moller H. 1983. Foods and foraging behavior of red (Sciurus vulgaris) and grey (Sciurus carolinensis) squirrels. Mammal Review 13: 81–98. DOI: 10.1111/j.1365-2907.1983.tb00270.x. Prus M. 2014. Liczebność i zagęszczenie wiewiórki pospolitej (Sciurus vulgaris) w Parku Skaryszewskim w Warszawie. Praca inżynierska wykonana w Samodzielnym Zakładzie Zoologii Leśnej i Łowiectwa SGGW w Warszawie. Rubino F.M., Martinoli A., Pitton M., Di Fabio D., Caruso E., Bani S., Tosi G., Wauters LA., Martinoli A. 2012. Food choice of Eurasian red squirrels and concentrations of antipredatory secondary compounds. Mammalian Biology 77: 332–338. DOI 10.1016/j.mambio.2012.01.003. Shar S., Lkhagvasuren D., Bertolino S., Henttonen H., Kryštufek B., Meinig H. 2008. Sciurus vulgaris. The IUCN Red List of Threatened Species. Version 2015.2. www.iucnredlist.org. Downloaded on 26 August 2015. Shuttleworth C.M. 1997. The effect of supplemental feeding in the diet, population density and reproduction of red squirrels (Sciurus vulgaris), in: The conservation of red squirrels, Sciurus vulgaris L. (eds. J. Gurnell, P. Lurz). People’s Trust for Endangered Species, London, UK, s. 13–24. Translated by: Olga Zyrina 49 Stachura K., Niedziałkowska M., Bartoń K. 2004. Biodiversity of forest mammals, in: Essays on mammals of Białowieża Forest (eds. B. Jędrzejewska, M. Wójcik). Mammal Research Institute, Polish Academy of Sciences, Białowieża, s. 13–24. ISBN-83-907521-1-5. Tumiłowicz J. 1993. Arboretum, in: Warunki przyrodnicze lasów doświadczalnych SGGW w Rogowie (ed. R. Zielony). Wydawnictwo SGGW, Warszawa, s. 164–167. ISBN-83-00-02782-3. Wauters L.A. 1997. The ecology of red squirrels in fragmented habitats: a review. in: The conservation of red squirrels, Sciurus vulgaris L. (eds. J. Gurnell, P. Lurz). People’s Trust for Endangered Species, London, UK, s. 5–12. Wauters L.A., Dhondt A.A. 1987. Activity budget and foraging behaviour of the red squirrel (Sciurus vulgaris Linnaeus, 1758) in coniferous habitat. Zeitschrift für Säugetierkunde 52: 341–353. Wauters L.A., Gurnell J., Martinoli A., Tosi G. 2001. Does interspeciic competition with introduced grey squirrels affect foraging and food choice of Eurasian red squirrels? Animal Behaviour 61: 1079–1091. DOI: 10.1006/anbe.2001.1703. Wauters L., Swinnen C., Dhondt A.A. 1992. Activity budget and foraging behaviour of red squirrels (Sciurus vulgaris) in coniferous and deciduous habitats. Journal of Zoology 277: 71–86. DOI: 10.1111/j.1469-7998.1992.tb04345.x. Wauters L.A., Bertolino S., Adamo M., van Dongen S., Tosi G. 2005. Food shortage disrupts social organization: the case of red squirrels in conifer forests. Evolutionary Ecology 19: 375– 404. DOI: 10.1007/s10682-005-8311-5. Wauters L.A., Githiru M., Bertolino S., Molinari A., Tosi G., Lens L. 2008. Demography of alpine red squirrel populations in relation to fluctuations in seed crop size. Ecography 31: 104–114. DOI: 10.1111/j.2007.0906-7590.05251.x. www.arboretum. sggw.pl. [26.08.2015] Zielony R. 1993. Siedliskowe typy lasu, in: Warunki przyrodnicze lasów doświadczalnych SGGW w Rogowie (ed. R. Zielony). Wydawnictwo SGGW, Warszawa, s. 89–108. ISBN-83-00-02782-3. Authors’ contribution D.K-G – study conception, paper conception, statistical analyses, a igure, literature review, writing the paper; K.M. – reining the method of the ield studies, ield studies, data analysis; J.G. – study conception, ield studies, writing the paper. DOI: 10.1515/frp-2015-0006 Available online: www.lesne-prace-badawcze.pl Leśne Prace Badawcze / Forest Research Papers Marzec / March 2016, Vol. 77 (1): 50–55 e-ISSN 2082-8926 ORIGINAL RESEARCH ARTICLE Economic methods for the utilisation of logging residues Tomasz Gałęzia Pomorze Forest District, Pomorze 8, 16–506 Giby, Poland Tel. +48 87 5165786, fax +48 87 5165052, e-mail: tomasz.galezia@bialystok.lasy.gov.pl Abstract. There are several ways of using logging residues, and the two most common ones in the State Forests are wood chip production for energy purposes by mobile machinery and crushing by tractor-powered crushers. In this research, an economybased approach was used to compare these methods and assess whether chip production is superior to crushing for clearing a felling area. The average revenues from the sale of wood biomass in the form of wood chips and the average costs of crushing in the Pomorze Forest District were analysed for the period from January 2012 until June 2014. Both revenues and costs (such as fuel, operator’s wage, piling costs, depreciation, insurance and garaging costs) were extracted from the State Forests’ database using data-mining software. The highest price for wood biomass was achieved in 2012 (104.00 PLN m-3), and the lowest one was reached in 2014 (16.00 PLN m-3). Revenues amounted to 1,353.87 PLN ha-1 on an average, whilst the average logging eficiency was 25.60 m3 ha-1 with a share of logging residues compared to the total logged volume of 11.14%. The highest costs for crushing (1,894.14 PLN ha-1) incurred for clearing gaps in a stand after removing spruces infested with bark beetles. Labour productivity in this case was 0.07 ha pmh-1. Signiicantly lower costs (1,256.42 PLN ha-1) and greater productivity (0.16 ha pmh-1) were achieved when clearing clear-cut areas. Considering the above results, it is recommended to compress the logging residues into chips instead of crushing them. The removal of the residues from clear-cut sites may additionally affect forest health positively. Keywords: crushing, wood chip production, logging residues 1. Introduction Supporting continuity of forest existence is a basis of sustainable forest management. According to the Forest Act (1991), such management includes harvesting of timber material. The two most common timber harvesting methods in Poland – short-stem system and long-stem system – include delimbing of trees at the landing. In order to conduct future reforestation, the harvesting site should be cleared of logging residues. Whilst during the selection of residue utilisation method, it would be important to consider various economic and environmental aspects (Pierovich, Smith 1973). Until recently, logging residue has been burned; however, such method was discontinued because of its negative impact on natural environment (Wojtkowiak et al. 2003a, b). Crushing of logging residue and mixing it with soil using tractor-powered chippers (Maksymiak 2008) is a more environmentally friendly way of residue utilisation. However, such method of logging residue utilisation is quite costly (Różański, Jabłoński 2002). In the recent years, the need to comply with the European Union directives, which oblige Poland to receive 15% of energy from the renewable energy sources in 2020 (Directive 2009/28/WE 2009), resulted in increased interest of logging residue utilisation for the purposes of energy production (Sadowski et al. 2012). This procedure could also guarantee forest districts additional revenues from sales of residue material. Previous research assumed that utilisation of logging residue as energy woodchips is more proitable than their chipping. Submitted: 07.10.2014, reviewed: 20.01.2015, accepted after revision: 23.11.2015. © 2016 T. Gałęzia T. Gałęzia / Leśne Prace Badawcze, 2016, Vol. 77 (1): 50–55 The goal of current work was to evaluate whether energy wood chip production or crushing of logging residue is more economically proitable. Moreover, the study also researches the factors affecting the costs of logging residue crushing as well as their actual share within the total volume of harvested timber. 2. Materials and methods The research was conducted in the Pomorze Forest District (Regional Directorate of the State Forests in Białystok). The data on costs and proits was obtained using the Information System of the State Forests (SILP) as well as the data exploration software SAP Business Objects. The analysis included the years 2012 and 2013 as well as the irst half of 2014. Selling leftover logging residue in a form of energy biomass in order to prepare forest sites for regeneration is a primary activity implemented by the Pomorze Forest District. The raw material is auctioned using the Internet application ‘e-drewno’. Clearing of residue to a degree that allows conducting soil preparation activities for forest regeneration is a mandatory condition of site inspection after biomass collection by the buyer. The amount of proits from energy biomass sales was calculated as a product of residue volume collected from a given site (marked as ZO, which stays for irewood particles) to the price shown on the contract signed with a buyer. In cases when it was not possible to sell residue, the areas were cleaned up by the forest district services. A combination of a forestry mulcher AHWI FM600 fed by the tractor Valtra T-190 was used for such purposes (Table 1). Both types of machinery are the property of forest district and were bought in 2006. Table 1 presents technical speciications of that equipment. Cost analysis of logging residue chipping involved two groups: ixed and variable costs. Variable costs included costs of the fuel consumed by tractor, salary of a tractor operator and costs of residue stacking. Within the Information System of the State Forests, the above costs are directly linked to a given position of the plan or the address of forest site where logging residue was crushed. Variable costs also included costs of lubricants, oils and other exploitation material and maintenance. Those costs were under equipment position of the annual plan (related to a tractor or a mulcher). They, however, were re-calculated per hour of machinery operation (h) estimated by work time of equipment on a given site, which was then proportionally added to other variable costs presented in the plan and corresponding to speciic logging sites. Similar calculations were done for ixed costs that included amortization costs, costs of insurance and machinery storage (half of the property tax related to storage building was used, because another tractor was stored there as well) (Table 2). 51 Table 1. Basic technical speciications of machines for utilising logging residues Valtra T-190 Maximal power 154.5 kW (210 HP) Nominal engine rpm 2.100 rpm Engine capacity 7.400 cm3 Number of cylinders 6 PTO shaft rpm 540 rpm Weight 5.950 kg Length 5.151 mm Height 2.931 mm Wheelbase 2.750 mm Number of gears foreward 36 Number of reverse gears 36 AHWI FM600 Required power of tractor Number of PTO rpm 132.4–169.2 kW (180–230 HP) 1.000 rpm Weight 3.030 kg Operational width 2.300 mm Total width 2.750 mm Number of working elements 54 pcs. 3. Results More than 1,500 m3 of wood in the form of energy woodchips were collected during the period from January 2012 to June 2014. They were harvested by several different contractors. All the companies possessed chipping units that consisted of chippers attached to forwarders. In 2012, 209.88 m3 of energy biomass was sold from 6 forest sites at the unit price of 104.00 PLN m-3, and in 2013, 793.15 m3 from 10 forest sites at the price of 47.00 PLN m-3, whilst during the irst half of 2014, 507.61 m3 from 7 sites at the price of 16.00 PLN m-3. The average yield from unit area was 25.6 m3 ha-1, which on an average amounted to 11.14% of total harvested timber volume. These numbers varied according to the forest habitat type (Figure 1). At the same time, on some logging sites, forest district had to use logging residue on its own. In 2012, crushing of logging residue was implemented on 11 clear-cuts (IB), 5 shelterwood harvest sites (IIIA, IIIB) and 1 bark beetle gap. In 2013, the number of harvesting sites were, respectively, 13, 2 and 4, and in 2014, the work was conducted only on 7 clear-cuts. Cost analysis indicated that logging residue crushing costs were the 52 T. Gałęzia / Leśne Prace Badawcze, 2016, Vol. 77 (1): 50–55 Table 2. Fixed costs of machines for utilising logging residues Valtra T-190 AHWI FM600 2006 2006 Initial value 357,889.00 PLN 140,830.00 PLN Current value 375,531.28 PLN 140,830.28 PLN 14% 14% Year of manufacture Depreciation rate Depreciation 26.08 PLN h 9.78 PLN h-1 Insurance 0.10 PLN h-1 0.11 PLN h-1 Garaging costs 0.01 PLN h-1 0.01 PLN h-1 -1 highest on bark beetle gaps. The average costs of chipping were 1,894.14 PLN ha-1, and work eficiency was 0.07 ha mth-1. The costs of crushing on shelterwood harvest sites were similarly high (1,858.60 PLN ha-1), whilst work eficiency was slightly higher, 0.10 ha mth-1. The lowest costs (1,256.42 PLN ha-1) and the highest work eficiency (0.16 ha mth-1) were observed on clearcutting sites. Variable costs dominated the structure of general costs (between 61% and 65%), amongst which the largest share belonged to fuel costs (61%). The amortisation costs dominated within ixed costs reaching the monthly value of 6,024.21 PLN, which comprised 95% of the ixed costs. The average logging residue crushing costs per unit area were the lowest on shelterwood harvesting sites in 2013 (1,000.98 PLN ha-1), whilst the highest on bark beetle gaps in 2013 (2320.82 PLN ha-1) with the difference between them being 43.1%. Crushing costs on various forest habitat types differed from one another by 59.2% (with the lowest value of 1,162.23 PLN ha-1 observed in fresh coniferous forest (Bśw) and the highest value of 1,960.21 PLN ha-1 in ash-alder forest stands (OlJ)). The differences between the costs of one operation hour were 54.5% in the case of analysis of costs on different harvest types (from 110.64 PLN h-1 on bark beetle gaps in 2012 to 203.17 PLN h-1 on shelterwood harvesting sites in 2012) as well as 49.1% in the case of analysis of costs on different forest habitat types (from 122.32 PLN h-1 in fresh broadleaved forest (Lśw) to 248.92 PLN h-1 in ash-alder forest (OlJ)). 4. Discussion Research results indicate that logging residue in the Pomorze Forest District amounts to 11.14% from the total volume of harvested timber, whilst their value varies from 6.85% to 17.15% depending on the forest habitat type and type of harvest. That value is about 4% lower than in research of Jabłoński and Różański (2009), which was implemented in a different part of country and included measuring of a possible share of residue volume by direct weighing of tree parts. Logging residue volumes estimated within this study are close to the results of a similar study conducted in all six forest districts of the Augustowska Forest, which includes Augustów, Głęboki Bród, Płaska, Pomorze, Suwałki and Szczebra Forest Districts. There the logging residue comprised about 11.96% of the total timber harvested (Gałęzia 2013). It sho- Figure 1. Volume of biomass and its share in an overall quantity of logged timber, referring to forest habitat types: Bśw – fresh coniferous forest, BMśw – fresh mixed coniferous forest, LMśw – fresh mixed broadleaved forest, Lśw – fresh broadleaved forest, LMw – moist mixed broadleaved forest T. Gałęzia / Leśne Prace Badawcze, 2016, Vol. 77 (1): 50–55 53 Figure 2. Average costs of crushing of logging residues referring to shelterwood type; Rzu – clear-cuts, Rzl – complex shelterwoods, Luki – bark beetle gaps. Figure 3. Average costs of crushing of logging residues referring to forest habitat type; key: Bśw – fresh coniferous forest, BMśw – fresh mixed coniferous forest, Lśw – fresh broadleaved forest, LMb – boggy mixed broadleaved forest LMśw – fresh mixed broadleaved forest, Olj – ash-alder forest uld be noted that information on the share of small-diameter wood within total timber volume presented in current study was obtained in a different manner from the research of Jabłoński and Różański (2009). It presents real volumes of bio- mass collected from a given logging site in relation to the total timber volume. The structure of variable costs (including the share of fuel costs being around 61%) is similar to results received by 54 T. Gałęzia / Leśne Prace Badawcze, 2016, Vol. 77 (1): 50–55 Różański and Jabłoński (2005). The level of amortisation is, however, signiicantly higher than the above study. The average cost of logging residue chipping was 1449.19 PLN ha-1, which is almost three times higher than the costs presented by Różański and Jabłoński (2002). Such a big difference probably results from a signiicant growth in fuel prices during the past years and also a high price of mulcher, which translates into high amortisation costs. The average price of diesel fuel in 2002 was around 2.40 PLN dm−3 gross, and in 2012, it reached the level of about 3.99 PLN dm−3 gross (GUS 2014). The average diesel fuel price during the second quarter of 2014 reached the level of 5.27 PLN dm−3 gross (www.autocentrum.pl). It would be important to note that in 2012, the costs on logging sites were higher than those in 2013. It could be explained by logging residue stocking, which was implemented during that year. The goal of such measure was to simplify chipping or crushing of logging residue, whilst costs acquired during that operation were included into the starting price of energy material. That caused high prices of energy chips obtained in the year 2012. During the consecutive years, stocking was excluded from the process. The drastic decrease in energy biomass prices in 2014 results, amongst others, from the large supply of the material during that year as well as signiicant decrease in value of ‘green certiicates’. However, the decrease in costs of residue crushing in 2014 was primarily caused by the lack of operations on shelterwood harvesting sites and the absence of bark beetle gaps, which in previous years generated signiicantly higher costs than residue utilisation on clear-cuts. Another important factor was replacement (as part of investment) of the chipper rotor shaft together with the set of blades, which signiicantly improved work eficiency and reduced maintenance costs. Eficiency of a mulcher during its work on clear-cuts IB was 0.16 ha mth-1, which is similar to that estimated in the research of Różański and Jabłoński on economic eficiency of logging residue crushing (2005). When converting that value per working hour, it would come to about 0.10 ha PMH-1 (productive machine hour), which is almost two times lower than theoretical eficiency of the Meri Crusher MJS-2,0 DT (Różański, Jabłoński 2008) and more than two times lower than that of Meri Crusher MJS-2,5 DT (Różański, Jabłoński 2006). It would, however, be necessary to consider necessity of every day trips to logging sites, which substantially affects work eficiency. Crushers with similar width (MJ 2.3 ST and DT) in actual conditions obtained eficiency, which was 0.025 ha PMH-1 higher (Różański, Jabłoński 2002). Crushing of logging residue is far less economically proitable for a forest district than selling the residue in the form of energy material (Figure 4) even when prices of energy chips are signiicantly lower than those in previous years. It should, however, be remembered that small branches and needle-cover contain signiicant amounts of nutrients valuable for ecosystems. Whilst traditional timber harvesting of stems does not lead to soil depletion because of low amount of nutrients, the inclusion of logging residue collection into harvesting process increases loss of nitrogen at about 40%, phosphorus at 55%, potassium at 76%, calcium at 31% and magnesium at 22% (Gornowicz 2004). Residual material, which is the most valuable for the forest nutrient cycle, includes branches with more than 4 cm in diameter as well as needle-cover, whilst removal of logging site branches that have been cut during delimbing intensiies leaching of nutrients (Gornowicz 2004). It would be important to note that modern mulchers allow mixing of crushed particles with soil to the depth of about 20 cm, which partially compensates the loss of nutrients because of timber harvesting and also accelerates cycling of other materials (Chlebowski 2007). Current research has not analysed the effect of biomass loss collected for energy purposes on forest habitats; however, according to other studies, it could be observed that total removal of biomass from the logging site could be associated with the improvement of forest sanitary condition (Kolk 2005). Crushing of logging residue along with its mixing with soil from one side allows inclusion of biomass into nutrient recycling (Robert 2005) and from another it increases damages caused by weevils (Korczyński 2004). Whilst estimating the loss of nutrients and microelements contained in the material reserved for energy purposes, it should be remembered that the fall-off of needles and small branches occurs during the whole period of forest stand life and during that time those tree parts are not being harvested. It should be added that technical structure of chippers allows separating logging residue from dirt such as soil, needles and small elastic twigs, because of which those elements remain on the surface of a logging site. Figure 4. Average annual costs of crushing (Kr) and incomes from the sale of energy chips (Pz). 5. Conclusions Based on the research results, forest districts should be advised to implement chipping of logging residue and to sell T. Gałęzia / Leśne Prace Badawcze, 2016, Vol. 77 (1): 50–55 energy chips. From the economic point of view, the removal of logging residue without the use of equipment belonging to the forest district would be proitable even in cases when there would be no proits from residue sale. Improvement of forest health state could be seen as an additional argument towards the beneit of energy chips sales. At the same time, harvesting of small-diameter energy material could lead to depletion of forest habitats, which requires a special caution when making decisions on biomass harvesting for energy purposes from poor habitat types. Conlict of interest The author declares a lack of potential conflicts. Acknowledgements and source of funding The research was funded from personal means. References Chlebowski K. 2007. The analysis of the effectiveness of grinding of chip residue by Meri Crusher MJ 2.3 DT. Acta Scientiarum Polonorum, Silvarum Colendarum Ratio et Industria Lignaria 6(3): 17–23. Gałęzia T. 2013. Analiza efektywności wybranych metod pozyskiwania biomasy leśnej na cele energetyczne w Puszczy Augustowskiej. Rozprawa doktorska, Szkoła Główna Gospodarstwa Wiejskiego, Warszawa. Gornowicz R. 2004. Technologie utylizacji pozostałości zrębowych na terenach nizinnych. Postępy Techniki w Leśnictwie 87: 31–37. Kolk A. 2005. Ocena wybranych sposobów utylizacji pozostałości zrębowych pod względem ochrony lasu. Postępy Techniki w Leśnictwie 92: 25–28. Korczyński I. 2004. Ocena sposobów utylizacji drewna gorszej jakości z punktu widzenia ochrony lasu. Postępy Techniki w Leśnictwie 87: 38–43. Maksymiak M. 2008. Badania porównawcze rozdrabniaczy leśnych. Technika Rolnicza, Ogrodnicza, Leśna 2: 22–24. Pierovich J.M., Smith R.C. 1973. Choosing forest residues management alternatives. USDA Forest Service General Technical Report, PNW-7. Portland, USA. Translated by: Olga Zyrina 55 Robert W. 2005. Technologie utylizacji pozostałości zrębowych w Nadleśnictwie Dąbrowa, Postępy Techniki w Leśnictwie 92: 29–32. Różański H., Jabłoński K. 2002. Badania eksploatacyjne wybranych kruszarek do rozdrabniania pozostałości zrębowych, w: Użytkowanie lasu w wielofunkcyjnym, zrównoważonym leśnictwie. Wydawnictwo SGGW, Warszawa. Różański H., Jabłoński K. 2005. Efektywność ekonomiczna rozdrabniania pozostałości zrębowych przy użyciu ciągnika Valtra T-190 i rozdrabniarki MJS-2,5 DT, w: Procesy produkcyjne w leśnictwie – technika, technologia, organizacja. Ogólnopolska Konferencja Naukowa, 21 czerwca 2005, Wydawnictwo SGGW, Warszawa. Różański H., Kujawski M., Jabłoński K. 2006. Mechanics of the milling of logging residues with a Meri Crusher MJS-2.5 DT machine. Acta Scientiarum Polonorum, Silvarum Colendarum Ratio et Industria Lignaria 5(2): 95–102. Różański H., Jabłoński K. 2008. Eficiency and technical parameters of the crushing of logging residues with a Meri Crusher MJS-2.0 DT machine. Acta Scientiarum Polonorum, Silvarum Colendarum Ratio et Industria Lignaria 7(1): 53–58. Różański H., Jabłoński K. 2009. Economic effectiveness of logging residue bundling and chipping. Acta Scientiarum Polonorum, Silvarum Colendarum Ratio et Industria Lignaria 8(2): 47–51. Sadowski J., Moskalik T., Zastocki D., Wrona T. 2012. Wybrane gospodarcze i przyrodnicze aspekty zagospodarowania pozostałości zrębowych. Studia i Materiały CEPL w Rogowie 32(3): 246–253. WojtkowiakR.,NowińskiM.,TomczakR.2003a.Spalaniepozostałości pozrębowych, a emisja lotnych produktów. Sylwan 147(8): 55–60. Wojtkowiak R., Nowiński M., Tomczak R. 2003b. Spalanie pozostałości pozrębowych a nagrzewanie się gleby. Sylwan 147(6): 22–27. Sources of information Dyrektywa Parlamentu Europejskiego i Rady 2009/28/WE z dnia 23 kwietnia 2009 r. w sprawie promowania stosowania energii ze źródeł odnawialnych zmieniająca i w następstwie uchylająca dyrektywy 2001/77/WE oraz 2003/30/WE. GUS 2014. Efektywność wykorzystania energii w latach 2002– 2012. Informacje i opracowania statystyczne. Główny Urząd Statystyczny, Warszawa. Ustawa z dnia 28 września 1991 r. o lasach, tekst jednolity Dz. U. z 2011 nr 12 poz.59 z późn. zm. http://www.autocentrum.pl/paliwa/ceny-paliw/podlaskie/on/2014/ DOI: 10.1515/frp-2015-0007 Available online: www.lesne-prace-badawcze.pl Leśne Prace Badawcze / Forest Research Papers Marzec / March 2016, Vol. 77 (1): 56–67 e-ISSN 2082-8926 ORIGINAL RESEARCH ARTICLE The change in weight and surface temperature of a pine cone (Pinus sylvestris L.) as a result of microwave irradiation Monika Aniszewska Warsaw University of Life Sciences – SGGW, Faculty of Production Engineering, Department of Agricultural and Forest Machinery, ul. Nowoursynowska 164, 02–787 Warszawa. Poland Tel. +48 22 5934520, e-mail: monika_aniszewska@sggw.pl Abstract. In this article, the author investigates the change of weight and temperature of pine cones in a microwave oven over the following range of microwave irradiation power (PMF): 800, 620, 440, 260 and 130 W. Cones were divided into groups according to their weight and the author examined the influence of PMF on their water content and drying rate. The process is described with the help of mathematical equations and curves. The cones were irradiated in the microwave until all cones of the given group began to open the irst scales. Small cones required longer exposure times to PMF than medium and large cones in order to cause scale opening. The most eficient of the ive settings was a irradiation power of 620 W with an exposure time to microwaves for no longer than 20 seconds. In the second part of the study, the author analyses the changes of temperature on the cone surface using a thermal imaging camera. The values of surface temperature depended on irradiation power and the duration of irradiation. Keywords: seed extraction, microwave oven, water quantity, drying rate 1. Introduction In order to obtain seeds from coniferous species, including Scots pine, Norway spruce, Common larch and Silver ir, seeds have to be extracted. This is a labour-intensive and time-consuming process. The methods to improve this process are investigated. Many attempts have been undertaken to shorten the time of process of extraction. The temperature of drying was increased (Antosiewicz 1979), the pressure was decreased (Bogdanow 1966), the size of the cones was reduced mechanically by cutting off the base of the cone, the cones were segregated into groups of different sizes (small, medium, large), soaking of the cones in water was used during the gradual process of drying (Aniszewska 2012a, 2013). Despite many research efforts, the time of extraction wasn’t signiicantly shortened. One of the reasons was the high sensitivity of seeds to external factors. Incorrectly selected parameters of extraction can cause damage to the seeds. A signiicant improvement occurred in the ield of seed science in Poland in recent years. Due to many investments, new ob- jects were built and old objects of technical infrastructure were modernised, including kilns, stores, seed testing and seed control stations in which new technologies were introduced. The new objects have a large area and they are intended for processing large mass of reproductive material. In order to reduce the cost of extraction in such objects, the cones should be delivered regularly and in large number, which can be dificult to achieve in a non-seed year. In such years, the cost of extraction is usually high and can exceed even 15.00 PLN / kg of cones (without depreciation costs of the facilities) (Aniszewska, Zychowicz 2008). In the 1960s, there was an idea of equipping each forest inspectorate in small seed huller, which was supposed to allow fast obtaining of seeds collected by cones’ owners. As a result, only a small number of hullers were produced, because of the fact that they didn’t meet the quality criteria. The weak element of the device was the control system of extraction process. It resulted from the lack of knowledge in this ield and technical capabilities of the drying industry. Presently, thanks to the development of this section, the construction of devices of this kind is no longer a problem. An attempt to draw guidelines for Submitted: 27.04.2015, reviewed: 18.08.2016, accepted after revision: 21.10.2015. © 2016 M. Aniszewska M. Aniszewska / Leśne Prace Badawcze, 2016, Vol. 77 (1): 56–67 the construction of new, small extraction devices used for maximisation of the number of obtained seeds seems to be right. An improved process of extraction could be used in devices in which extracted could be small portions of cones. In order to decrease the initial humidity of the cones, and as a result to reduce the time of scales leaning from the axis, the use of electromagnetic rays (microwaves) in the irst phase of one- or two-stage cones extraction was proposed. The irst stage of the process will allow for a fast loss of the water from closed cones, which will lead to loss of the mass and the beginning of opening of the scales. The beginning of scales opening is considered to be the moment in which individual scales separate from each other with no visible leaning from their axis. This irst move will have an influence to give better and more intensive leaning of the scales and exposure of seeds in the next phase of irst stage of extraction, that is, cabinet kiln or cone extraction chamber. However, in order to use electromagnetic irradiation universally, the recognition of the way in which microwaves influence the cones and seeds inside them is necessary. The time of irradiation exposure and its maximum power should be determined. The aim of this article is the description of the mass of the cones, which were subjected to the microwave irradiation, using mathematical formula: changes in water content and the speed of drying rate of the cones until the moment of opening of the irst scales and characteristics of the degree of heating up of the external surface of the material with the use of different power of electromagnetic rays. In following article, the subject of seed quality was not examined. Only the change in mass, humidity and temperature of cones under the influence of irradiation were recorded. An assessment of the quality of obtained seeds in cones after use of microwave irradiation will be presented in another publication. Microwaves are electromagnetic waves of frequency from 0.3 to 300 GHz and length of waves from 0.001 to 1 m. In microwave ovens, microwaves of frequency 2.45 GHz and length of waves around 120 mm are used. The described waves are reflected by metal and let through glass, paper and majority of plastics. During irradiation, the energy is transferred to the material as a result of which the temperature raises in the material. The increase of the temperature is a result of influence of microwaves on water molecules. Molecules are set in motion and they hit each other with great force. The molecules start to vibrate, taking over the energy of absorbed microwaves. The inal effect of microwave activity is connected with humidity of the material. The more water is in the material, the more intensive is the microwave irradiation (PMF). Over the years, there were attempts to use the reaction of electromagnetic ield on living organisms. Electromagnetic waves can be used for improving the vitality of seeds, by killing the pathogens on the surface of the seed coat (Adair 2003), elimination of the hardness of seed coat, in order for 57 them to germinate faster (Nelson 1985; Thuery, 1992; Warchalewski et al. 2007; Pietruszewski, Kania 2011; Cieśla et al. 2015), speeding of fruit drying process (e.g. kiwi) (Maskan 2001), vegetables (e.g. potatoes) (Khraisheh et al. 2004; Jakubowski 2008), rice (Pinkrová et al. 2003), destruction of parasitic fungi, pests in wood (Krajeński A, 1990a,b, 2001). Microwaves were used for soil disinfestations, instead of herbicides (Thuery 1992) or inhibition of seed germination on sow areas (Velázquez-Martí et al. 2006). A device for emission of microwave irradiation to soil was constructed. It is presently used in forest nurseries (Słowiński 2013) and in greenhouses. Ballad and others (1976) also stated adverse impact of microwaves on seeds. Dried seeds had lower laboratory capacity of germination than those that were dried in traditional method of convection. According to Ballad and others (1976), the degree of reduction of germination capacity depended on the level of water content in the seeds. The authors stated that when the level of water was high, the damage of seeds appeared. Opinions on the influence of the electromagnetic waves are divided and they depend on many factors (e.g. frequency or length of the waves, humidity, construction and structure of the material, etc.). On the basis of available literature, it cannot be stated explicitly whether short-term impact of irradiation on living organisms, including cones, is positive or negative. 2. Material and methods For the research, Scots pine cones from economic seed stands (ESS) were used. Cones were collected in January 2015 and kept in kiln in Ruciane Nida on the area of Maskulińskie Forest Inspectorate (Regional Directorate of State Forest in Olsztyn). Closed cones were transferred to the laboratory of Department of Agricultural and Forest Machinery, where they were divided into ive even parts. Each part consisted of 45 pieces of cones (including 15 small, 15 medium and 15 large cones). Small cones weighed up to 6.0 g, medium between 6.01 and 9.0 g and large over 9.01 g. Single cones of different weights were, in sequence, subjected to PMF in laboratory’s microwave oven SHARP R-200. Five ranges of power were used: 130, 250, 440, 620 and 800 W. The power of microwave oven was changed with the use of knob of the adjuster in the housing of the oven. Cones were subjected to electromagnetic rays until beginning of leaning of the scales in each cone was observed. Before starting the research in microwave oven, the cones were weighed and their external parameters were measured (length and thickness). Mass measurement was made with the use of moisture balance WPS 210S, with an accuracy of 0.001 g. The measurement of grandiosity parameters was made with the use of slide caliper with an accuracy of 0.01 mm. 58 M. Aniszewska / Leśne Prace Badawcze, 2016, Vol. 77 (1): 56–67 During research, the change in mass of a single cone was registered, with accuracy to 0.001 g, initially every 5 s, and later every 10 or 20 s depending upon the used power. On the basis of measurement of the mass of single cones, the change in mass during the time of exposure to irradiation was calculated. After inishing the research, the cones were dried in temperature 105 ± 1°C for 24 h in order to determine the dry mass. It allowed to describe changes in water content and to establish the drying rate during microwave irradiation exposure. The change in mass was the difference between two following measured masses, whereas water content was calculated as a difference of cone mass measured after deined time of microwave irradiation and its dry mass. Acquaintance of water mass in the cones and cone’s try mass allowed to calculate the absolute humidity in % according to the formula: (1) where mp – is the initial mass of the cone and ms – the mass of a dry cone. For description of changes in water content in cones, exponential equation corresponding to the second period of drying solids (Pabis 1982) was used: u = (u0 – uk) · e(−b · τ) + uk (2) where: u0 – is the initial water content in the cone, uk – the inal water content in the cone, e – the base of the natural logarithm, τ – the time, b – the coeficient of cone susceptibility to change in water content. Initial water content can be regulated by subjecting cones to preliminary drying. The inal value of water content depends however on drying factor. Coeficient b was set for each cone on the base of actual course of changes in water content (Aniszewska 2012b). It is a parameter that characterises the cone’s susceptibility to change in water content in the deined conditions. Drying rate was calculated as a derivative of time and current water content (u) according to the formula: (3) A stage of microwave irradiation of cones was described with the use of exponential equation of water content and drying rate. During this process, temperature and air humidity was registered with the use of Hygro–Palm gauge. During research, pictures of single cones were taken with the use of thermal imaging camera VIGOcam V50. With the use of this camera, every 5, 10 or 20 s, the change of cone’s surface external temperature until the moment of scale leaning from the axis was registered. During picture-taking, closed cones were lying on the edge of the plate of microwave oven. Pictures were used for analysis of temperature change in following stages of microwave irradiation in dependence on the power of microwave oven. Therma program was used for image processing. The accuracy of temperature registration was 0.1°C. Program Statistica 10 was used for statistical analysis of the results and also tests for small count of samples (Bruchwald 1997). 3. Results and discussion 3.1. Characteristics of the examined cones For the research, 225 cones (75 small, 75 medium and 75 large cones) were collected. In the set, the smallest cone had an initial mass of 3.586 g, and the biggest-18.041 g. The average length of the cones was 45.38 mm (31.00 to 65.00 mm), and thickness 22.00 mm (16.40 to 30.2 mm). According to other researchers (Sokołowski 1931; Staszkiewicz 1968; Białobok 1993), the cones of Scots pine from Europe have a length between 19 and 70 mm, and thickness between 12 and 35 mm. Therefore, the examined cones can be found in the range given for both grandiosity parameters. The analysis showed a signiicant dependence between cone’s length (h) and its thickness (d) (R = 0.9162). The increase of cone’s thickness by 1 mm causes the increase of its length by around 2.15 mm. According to Staszkiewicz (1968), this increment is smaller and amounts to 1.70 mm. The relationship between cone’s initial mass (mp), length (h) and thickness (d) was obtained. They are described by formulas (4) and (5). h = 2.1935 mp + 27.365 (4) d = 0.9475 mp + 14.214 (5) The increase in cone’s initial mass by 1 g is correlated with the increase of cone’s length by around 2.2 mm (R = 0.9363), and its thickness by almost 1 mm (R = 0.9469). 3.2. Change of mass, water content and drying rate The values of mass change of all cones from group: small, medium and large in each of ive parts were averaged. The average change of mass of cones subjected to microwave irradiation of each power was showed on graphs (Fig. 1 a-e). For three groups of cones, varying in mass, trend lines were set and they were described with linear equations (6). Values of the coeficients a and c for those equations were given in Table 1. m(τ) = aτ + c (6) M. Aniszewska / Leśne Prace Badawcze, 2016, Vol. 77 (1): 56–67 59 a b c d e Figure 1. Weight change of small, medium and large cones under the influence of radiation-microwave with different power: a – 800 W, b – 620 W, c – 440 W, d – 260 W, e – 130 W M. Aniszewska / Leśne Prace Badawcze, 2016, Vol. 77 (1): 56–67 60 Table 1. The coeficients of linear equations (a – way, c – constant) describing the change in the weight of the cone under the influence of microwave radiation Power [W] 800 620 260 130 Size cones Coeficient a Coeficient c Coeficient R large 0.1598 0.0051 0.9286 medium 0.0743 0.0039 0.9857 small 0.0193 0.0037 0.9613 large 0.0622 -0.0029 0.9294 medium 0.0258 0.0030 0.9260 small 0.0117 0.0017 0.9381 large 0.0187 -0.0062 0.9073 medium 0.0097 -0.0042 0.8769 small 0.0031 0.0007 0.8069 large 0.0054 -0.0053 0.9018 medium 0.0022 -0.0013 0.8395 small 0.001 0.00002 0.7235 Coeficients for equations for cones subjected to microwave irradiation of 440 W power were not given in Table 1, due to insuficient statistically value of correlation coeficient for trend line, described by equation of the irst degree. In equation (6), coeficient c is a constant and determines the point in which regression line meets the y-axis. For ive equations, this coeficient has a negative value, and for the rest of them it has a positive value. Parameter a is a directional coeficient describing the gradient of the regression line inclination towards x-axis. The higher the value, the bigger the angle between x-axis and the regression line. The biggest inclination angle was observed in case of big cones and the power on the level of 800 W. The time the cones spent in a microwave oven at the power of 800 W was for 1.5 min (0.225 s), at the power 660 W for 1.8 min (0.030 h), at 440 W for 4.8 min (0.080 h), 260 W for 7.2 min (0.120 h) and at 130 W for 18 min (0.300 h). The curves of drying, showed on Figure 2, indicate that irradiation intensity has a large influence on time of drying. Increasing of power from 130 to 800 W results in the reduction of drying time on average by 16.5 min (0.275 h). The loss in mass is connected with the power of microwave oven. In time, it is also connected with the influence of electromagnetic rays on cones. At a power of 800 W, the greatest loss in mass was observed in case of large cones. During 1.5 min, the loss was over 1 g, which constitutes 8% of mass loss. On the other hand, at 130 W of power, a similar loss in mass was achieved after 18 minutes. In Table 2, the values of mass loss, in grams and percentages, under the influence of microwave irradiation are given. Average loss in mass expressed as a percentage for all large cones amounted to 8.4%, for medium cones, it was 6.9% and for small cones, it was 5.9%. On the other hand, humidity after the microwave irradiation amounted, respectively, to 16.2%, 17.7% and 18.3%. In Table 2, values of mean humidity corresponding to the beginning of scale opening is given. They were calculated for three sizes of cones and for four power values of microwave irradiation (800, 440, 260 and 130 W). In Table 2, there is no data for 620 W power. Examining of cones from the moment when scales started opening showed that regardless of the used power, initial humidity for scale opening was in the range from 18.3 to 24%. It was noticed that the higher initial humidity of the cones was the higher was humidity of the irst moment the scale opened. The difference between the initial value and value of the beginning of the scale opening for all examined big cones was smaller than for the small ones. It results from the fact that small cones require evaporating more water in order to open its scales than big cones. A detailed comparative analysis of values of the dependence of the beginning of scale opening on used power showed that cones subjected to microwave irradiation at 800 W power had the highest humidity at scale opening of 22.5%, and at 130 W the lowest, at around 20%. The difference between those values amounted on average, for large cones, to 1.7%, for medium cones to 2.7%, and for small cones to 3.3% wherein the difference in initial humidity between them amounted, respectively, to 2.3%, 0.2% and 1.1%. The change in water content in time for ive powers of microwave irradiation during cones drying is showed in Figure M. Aniszewska / Leśne Prace Badawcze, 2016, Vol. 77 (1): 56–67 61 Table 2. The mean values of weight loss and humidity for ive radiation output and three sizes of cones Size cones Weight loss [g] Weight loss weight dry [%] Initial humidity [%] Initial humidity open [%] Humidity after the end of radiation [%] large 1.020 8.33 25.66 22.40 17.33 medium 0.491 5.78 23.80 22.60 18.02 0.155 4.72 25.41 22.30 20.69 Power [W] Time [h] 800 0.025 small 620 440 260 130 0.030 0.080 0.120 0.300 large 0.541 5.35 24.45 n/a 19.10 medium 0.275 4.41 24.05 n/a 19.64 small 0.129 3.26 21.91 n/a 18.65 large 0.836 10.42 25.50 21.90 15.08 medium 0.624 11.01 26.89 21.60 15.88 small 0.411 10.14 24.75 20.50 14.61 large 0.872 9.45 24.21 21.00 14.76 medium 0.433 7.07 24.32 21.70 17.25 small 0.182 5.46 24.89 20.90 19.43 large 0.790 8.46 23.42 20.70 14.96 medium 0.348 6.04 23.64 19.90 17.60 small 0.188 5.95 24.28 19.00 18.33 2(a–c). The water content decreased depending upon the microwave power. The fastest the water content decreased at the highest microwave power and the slowest decrease was seen at the lowest power. Cones drying in microwave oven runs much faster in comparison to drying in the convection dryer. It is connected with the temperature of drying. Electromagnetic waves, which influencing the material (cones), cause material’s heating to over 100°C, while during traditional peeling to 60°C (Aniszewska, 2013). The loss of water from cones from initial humidity to observed beginning of scales opening amounts on an average to over 3%. The time of exposure to electromagnetic rays for individual powers is variable and is up to 0.3 h, the shortest for 800 W power and the longest for 130 W power (Table 2). With convection drying in laboratory conditions (Aniszewska 2004, 2012a), the beginning of scale opening occurs after 3–4 h, whereas cones’ humidity decreased at the time on average by 4–5%. At the same time, when comparing value of water loss from cones subjected to electromagnetic waves and their influence on convection drying in production conditions, it turns out that the beginning of cones opening in production conditions occurred after 16 h (peeling time depends on cones’ humidity and parameters of drying air). Rukini (1997) performed a comparison of drying process in a traditional way (in convection dryer) and using microwave irradiation on the cones of Mon- terey pine (Pinus radiata D. Don). Rukini (1997) stated that it is best to peel cones in the kiln dryer at a temperature up to 60°C and in microwave oven for 30 s. In case of the second method of peeling, in order to obtain seeds of good quality, the cones should be soaked in warm water before placing them in the microwave oven. In Table 3, the parameters of the model of water content change (2) and the drying rate (3) used for large, medium and small cones and ive microwave powers are presented. For the highest power, coeficient b amounted aver 30, and for the lowest over 4.5 (Table 3). The graphs depicting the cones drying rate and its dependence on microwave irradiation time are shown in Figure 4. It was observed that the drying rate and its changes are the bigger, the larger the cones are and the bigger irradiation power is. It can be noticed that drying rate changes in a way similar to linear dependence. 3.3. The change in cone’s surface temperature The change in temperature of single cone’s surface during microwave irradiation was described on the base of pictures registered by thermal imaging camera. In Table 4 the time of irradiation and minimum and maximum temperature for each power of irradiation is presented. 62 M. Aniszewska / Leśne Prace Badawcze, 2016, Vol. 77 (1): 56–67 a b c Figure 2. Change of water content in the cones: a – large, b – c medium – small under the influence of microwave radiation power: 800, 620, 440, 260 and 130 Air temperature inside the microwave oven during following attempts amounted to around 24°C, whereas the temperature of the room was around 22°C and air humidity was 50%. Initially, the temperature of external layers of scales of a closed cone was read from pictures taken by thermal imaging camera and amounted to around 16°C. On the basis of the pictures, it was stated that the temperature of the inside of the cone, in the middle of its length, amounted on an average to 7°C (the cones were kept in the cooler before the examination). As a result of electromagnetic waves influence, the temperature on the surface of the cones increased intensively to 100°C. A single cone reached the temperature close to 100°C after only 5 s of irradiation at 800 W, whereas after 20 s at 620 W, after 25 s at 440 W and 260 W, and after 150 s at 130 W. In following stages, the temperature rose to 120°C. The only exceptions were cones subjected to irradiation at a power of 130 W. In this case, maximum temperature of cone’s surface in the examined time was 100°C. This maximum temperature of the external surface was registered in the half of the cone’s length (Table 4). The time taken (in seconds) to reach 100% area of the cone at the temperature of 100°C is shown in Fig. 5. The area kept increasing with temperature. In Figure 6, the values of maximum temperature reached after PMF irradiation (in seconds) on the surface of single cones depends upon the used power. It can be noticed that at the level from 130 to 620 W, the temperature raised and dropped, in turns, before it reached 100°C. It M. Aniszewska / Leśne Prace Badawcze, 2016, Vol. 77 (1): 56–67 63 a b Figure 3. The changes in cones of small, medium and large size under the influence of microwave radiation with a power of 260 W, in terms of: a – water content, b – drying rate Table 3. The model parameters changes in water content and the drying rate when subjected to microwave irradiation of large size, medium and small cones Power [W] Size cones Initial water [kg H2O/kg DM] uo Final water [kg H2O/kg DM] uk Coeficient b large 0.2565 0.1723 37.464 800 medium 0.2380 0.1796 37.222 small 0.2540 0.2059 43.846 large 0.2445 0.1899 25.920 30.006 620 440 260 130 medium 0.2404 0.1950 small 0.2191 0.1856 29.113 large 0.2547 0.1495 14.736 medium 0.2675 0.1565 14.026 small 0.2487 0.1463 4.055 large 0.2421 0.1466 8.0121 medium 0.2432 0.1705 7.722 small 0.2488 0.1933 11.202 large 0.2341 0.1485 3.785 medium 0.2364 0.1749 5.768 small 0.2428 0.1822 5.784 64 M. Aniszewska / Leśne Prace Badawcze, 2016, Vol. 77 (1): 56–67 a b c Figure 4. The drying rate of cones: a – small, b – medium, c – large under the influence of microwave power of 800, 620, 440, 260 and 130 W depending on the time and the water content was caused by magnetron activity that transmitted electromagnetic waves, which depends upon power set in the microwave oven. The magnetron in the microwave is characterised by the fact that there is no possibility of controlling the quantity of microwaves transmitted by electrodes. So that is it possible to control the heating timeif voltage input to the magnetron is controlled. At the lowest power consumption, the lamp operates at full power, however, for a ive-time period, and then a pause of several dozen seconds appears. As power increases, the heating time extends and the pause time shortens. It is showed in Picture 5. M. Aniszewska / Leśne Prace Badawcze, 2016, Vol. 77 (1): 56–67 65 Table 4. Mean values of the minimum and maximum temperatures of cones during heating at a power of 800, 620, 440, 260 and 130 W Power [W] 800 620 440 260 130 Number Time [s] The surface temperature of cones [°C] minimum maximum 1 0 6.4 16.0 2 5 52.0 94.0 3 5 69.0 109.0 4 5 79.0 119.0 1 0 7.0 16.7 2 5 42.0 64.1 3 5 40.0 54.5 4 10 60.0 95.0 5 10 76.0 120.0 1 0 9.0 14.0 2 5 45.0 74.2 3 5 42.0 66.3 4 5 50.0 68.6 5 10 71.0 97.1 6 5 75.0 113.4 7 5 68.0 99.8 1 0 18.0 12.7 2 5 19.5 13.4 3 5 19.0 14.2 4 5 20.3 14.7 5 10 70.0 105.8 6 10 55.5 84.9 7 10 48.4 76.6 8 10 76.0 120.0 1 0 23.8 15.6 2 5 23.3 17.2 3 5 22.7 18.1 4 5 22.3 18.8 5 5 25.3 19.9 6 10 51.0 80.5 7 10 45.0 73.2 8 10 44.0 69.3 9 10 52.0 86.7 10 10 47.9 75.6 11 10 51.0 79.3 12 20 45.3 70.6 13 20 60.7 89.1 66 M. Aniszewska / Leśne Prace Badawcze, 2016, Vol. 77 (1): 56–67 Figure 5. Example of picture cones heated by electromagnetic radiation 620 a – before, b – after 20 s Figure 6. Changes of the maximum surface temperature of cones under the influence of microwave radiation 4. Summary and conclusions The conducted research showed, that the increase in microwave irradiation allows for shortening of the time of water evaporation from the cones and their heating, which results in the acceleration of the moment when irst scales open. At 800 W power, it was 1.5 min, at 130 W it was 18 min, whereas the loss in mass in both cases amounted around 3–4% (at the beginning of scale opening). The use of proposed initial stage of microwave irradiation in traditional process of drying can signiicantly shorten the peeling time. The advantage of this modernised peeling method is the short time in which the effect of irst scale opening can be achieved. But in order to use this method, adequate power of microwave oven and the time of cones’ exposure to irradiation should be selected, so that it does not influence negatively on seed quality. 1. The best option among examined ones is the irradiation power at 620 W and time of influence of microwave oven no longer than 20–30 seconds, which is conirmed by Rukoni’s (1997) research. 2. For description of water content change in cones and drying rate under influence of irradiation, an exponential equation corresponding to second period of drying solids can be used. 3. It was stated that small cones need more time for water evaporation and the beginning of scale opening than medium and large ones. Therefore in order to use this method, cones should be segregated irst. 4. The use of thermal imaging camera in the research allows for an assessment of the degree of heating of the cone’s surface. At the power of 800 W, the heating of a single cone to 100°C appears after 5–10 s, and at 130 W after 120 s. 5. Research over evaluation of change in the temperature of the inside of the cone under influence of microwave irradiation should be conducted. Also attempts of PMF on a larger number of cones should be conducted in order to check how the temperature is distributed on the surface and inside of the cone after seconds of irradiation of the process. Conlict of interest The authors declare lack of potential conflicts. Gratitude and source of funding The research has been funded from own resources of Faculty of Production Engineering of Warsaw University of Life Sciences – SGGW. M. Aniszewska / Leśne Prace Badawcze, 2016, Vol. 77 (1): 56–67 References Adair R.K. 2003. Biophysical limits on a thermal effects of RF and microwave irradiation. Bioellectromagnetics 24, 39–48. DOI: 10.1002/Bem.10061. Aniszewska M. 2004. Analiza procesu cieplnego wyłuszczania nasion z szyszek sosny zwyczajnej (Pinus sylvestris L.), praca doktorska. Wydział Leśny SGGW, Warszawa. Aniszewska M. 2012a. Dynamika procesu pozyskania nasion w jedno- i dwuetapowych procesach łuszczenia szyszek sosny zwyczajnej (Pinus sylvestris L.). Rozprawy naukowe i monograie. Wydawnictwo SGGW, Warszawa. Aniszewska M. 2012b. Porównanie procesu wyłuszczenia nasion sosny zwyczajnej (Pinus sylvestris L.) z szyszek całych i pozbawionych trzpienia. Leśne Prace Badawcze 73(1): 65–72. DOI:10.2478/v10111-012-0007-3. Aniszewska M. 2013. Zmiany wilgotności i temperatury szyszek sosny zwyczajnej (Pinus sylvestris L.) łuszczonych dwuetapowo. Leśne Prace Badawcze 74(3): 205–214. DOI: 10.2478/ frp-2013-0020. Aniszewska M., Zychowicz W. 2008. Koszty łuszczenia szyszek w nowoczesnych wyłuszczarniach gospodarczych. Monograia, Tendencje i problemy techniki leśnej w warunkach leśnictwa wielofunkcyjnego, Poznań, 177–182. Antosiewicz Z. 1979. Wpływ temperatury i wilgotności powietrza na jakość nasion sosny i świerka w czasie łuszczenia szyszek. Las Polski 6: 11–12. Ballad L/A.T., Nelson S.O., Bruchwald S.O., Sterson L.E. 1976. Effects of radiofrequency electric ield on permeability to water some legume seed. Seed Science and Technology 4: 257–274. Białobok S., Baratyński A., Bugała W. 1993. Biologia sosny zwyczajnej. Poznań – Kórnik, Polska Akademia Nauk, Instytut Dendrologii, 624 s. Bogdanow B. P. 1966. O suszkie szyszek w wakuomie. Lesnoje chozjajstwo 3, 57–60. Bruchwald A. 1997. Statystyka matematyczna dla leśników. Wydawnictwo SGGW, Warszawa. Cieśla A., Kraszewski W., Skowron M., Syrek P. 2015. Wpływ działania pola magnetycznego na kiełkowanie nasion. Przegląd Elektrotechniczny 91(1): 125–128. DOI 10.15199/48.2015.01.25. Jakubowski T. 2008. Wpływ napromieniowania mikrofalowego na dynamikę wzrostu kiełków bulwy ziemniaka. Inżynieria Rolnicza 5(103): 7–13. Khraisheh M.A.M., Mcminn W.A.M., Magee T.R.A. 2004. Quality and structural changes in starchy food during microwave and convective drying. Food Research International 37(5): 497– 503. DOI: 10.1016/jfoodres.2003.11.010. Krajewski A. 1990a. Możliwość zastosowania mikrofal do dezynsekcji iglastego drewna budowlanego. Wydawnictwo PKZ, Warszawa. 67 Krajewski A. 1990b. Zwalczanie owadów – szkodników technicznych drewna za pomocą mikrofal. Ochrona Zabytków 168(1): 27–34. Krajewski A. 2001. Fizyczne metody dezynsekcji drewna dóbr kultury. Rozprawy naukowe i monograie. Wydawnictwo SGGW. Warszawa. Maskan M. 2001. Drying, shrinkage and rehydration characteristics of kiwi fruits during hot air and microwave drying. Journal of Food Engineering 48(2): 177–182. Nelson S.O. 1985. RF and microwave energy for potentional agricultural applications. Journal Mirowave Power 28: 65–70. Pabis S. 1982. Teoria konwekcyjnego suszenia produktów rolniczych. Warszawa, PWRiL, 228 s. Pietruszewski S., Kania K. 2011. Wpływ promieniowania mikrofalowego na kinetykę kiełkowania nasion łubinu białego i grochu konsumpcyjnego. Acta Agrophysica 18(1): 121–129. Pinkrová J., Hubáčková B., Kadlec P., Prihoda J., Bubník Z. 2003. Changes of Starch durning microwave treatment of rice. Czech Journal of Food Sciences 21(5): 176–184. Rukuni D. 1997. Seed Extraction Methods and Quality Effects in Pinus radiata D. Don. Master thesis of Applied Science in Seed Technology at Massey University, Palmer North, New Zealand, 1–88. Słowiński K. 2013. Wpływ promieniowania mikrofalowego wyemitowanego do nieodkażonego podłoża szkółkarskiego na przeżywalność i wybrane cechy jakościowe sadzonek sosny zwyczajnej (Pinus sylvestris L.). Zeszyty naukowe Uniwersytetu Rolniczego im. Hugona Kołłątaja w Krakowie 517, Rozprawy 394. Sokołowski S. 1931. Prace biometryczne nad rasami sosny zwyczajnej (Pinus sylvestris) na ziemiach Polski. Prace RolniczoLeśne PAU 5, 1–106. Statistica 10. 2011. Start Soft. www.statsoft.com [18.09.2015]. Staszkiewicz J. 1968. Badania nad sosną zwyczajną z Europy południowo-wschodniej i Kaukazu oraz jej stosunkiem do sosny z innych obszarów Europy, oparte na zmienności morfologicznej szyszek – Inwestigations on Pinus silvestris L. from south-eastern Europe and from Caucasus and its relation the pine from other territories of Europe. Fragmenta Floristica et Geobotanica Polonica 14(3): 259–315. Thuery J. 1992. Microwaves: Industrial, Scientiic and Medical Applications. Artech Houses Publishers, Norwood. 692. Velázquez-Martí B., Gracia-López C., Marzal-Domenech A. 2006. Germination inhibition of undesirable seed in the soil using microwave irradiation. Biosystems Engineering 93(4): 365–373. DOI:10.1016/j.biosystemseng.2006.01.005. Warchalewski J.R., Dolińska R., Błaszczak W. 2007. Analiza mikroskopowa ziarna pszenicy dwu pokoleń wyhodowanych z nasion ogrzanych mikrofalami. Acta Agrophysica 10(3): 727–737. Leśne Prace Badawcze / Forest Research Papers Marzec / March 2016, Vol. 77 (1): 68–75 DOI: 10.1515/frp-2016-0008 Available online: www.lesne-prace-badawcze.pl ORIGINAL RESEARCH ARTICLE e-ISSN 2082-8926 Preliminary studies on the molecular identification of sex in Taxus baccata L. Marcin Zarek Agricultural University of Cracow, Faculty of Forestry, Institute of Forest Ecosystem Protection, Department of Forest Pathology, Mycology and Tree Physiology, Al. 29 Listopada 46, 31–425 Kraków, Poland Tel. 660388658, e-mail: rlzarek@cyf-kr.edu.pl Abstract. The scientiic objective of this research was to screen random ampliied polymorphic DNA (RAPD) and intersimple sequence repeat (ISSR) primers in order to ind the molecular markers enabling the distinction between male and female individuals of the European yew. This is an initial step toward understanding the mechanisms of sex determination in this species. The study was conducted on European yew originating from two sites in Poland: the Zadni Gaj nature reserve near Cieszyn and the yew collection from the Botanical Garden of the Jagiellonian University in Krakow. In the present study, 716 random primers (696 RAPD primers: OPA-OPAI_1-16 and 20 ISSR primers marked as UBC) were tested to identify the sex in European yew by means of a modiied bulked segregant analysis (BSA) method. The work was conducted in three stages, gradually limiting the number of primers through the elimination of primers that either did not exhibit any differences between the examined groups or did not provide ampliication products. Among the tested primers, no ideal markers that would be present in all individuals of one sex but absent in the individuals of the other sex were found. However, some markers were found (A07_954, H13_729, J08_660, L12_390, U01_457, V14_527, AE03_941, AE03_1014) to occur with greater frequency in one sex. Using these, we further examined 13 band combinations (proiles) that were observed to occur only in male individuals and another 13 combinations that were observed only in female individuals, which could be used in the practical identiication of sex. This is the irst report to ascertain the sex of Taxus baccata trees, and it may help to determine the sex at an early stage of development. Keywords: molecular markers, RAPD, ISSR, BSA, yew 1. Introduction The European yew (Taxus baccata L.) is a shrub or small tree belonging to the gymnosperm plants, usually growing up to 20–28 m. It is a dioecious, slow-growing species, widely spread in Europe, but highly fragmented. When it grows in good light conditions, it reaches its maturity at the age of about 30–35 years; however, under heavy shadows, it does not mature until the age of 70 or even 120 years. It is a shadow-resistant species, but it can also grow in full insolation. Over recent centuries, a decrease in European yew population size has been observed across the whole of Europe, which is related amongst others to human forest management (Thomas, Polwart 2003; Hiliker et al. 2004). The Taxus genus contains both dioecious and monoecious species. Monoecy is common in Taxus canadensis (Allison 1991), whilst dioecy dominates in Taxus brevifolia; however, about 10–15% of monoecious trees are also observed in the Received: 12.10.2015 r., reviewed: 25.11.2015 r., accepted: 22.12.2015. © 2016 M. Zarek latter (DiFazio et al. 1996; Hogg et al. 1996). T. baccata is a typical dioecious species in which monoecy is an extremely rare phenomenon (Iszkuło, Jasińska 2004). In some plants, labile in sex expression (an individuals or their parts can change sex during ontogeny) could be observed, what may be a result of problems with sex control in a complex environment or it may be an adaptive ability. Sex determination in dioecious plants may be of a genetic or an environmental character. In the case of genetic determination, it may be controlled by a single locus on an autosome, many loci on autosomes or genes on heteromorphic chromosomes (Irish, Nelson 1989). The application of molecular techniques over recent decades has enabled the recognition and description of numerous floral meristem identity genes that contribute to the plant development processes (Weigel, Meyerowltzt 1994; Ainsworth 2000; Theissen 2001; Ming et al. 2011; Gschwend et al. 2012). However, it is still not fully clear what the direct effect of these genes is on sex determination in many plant species. M. Zarek / Leśne Prace Badawcze, 2016, Vol. 77 (1): 68–75 One of the dioecious species for which the mechanism of sex determination is still unknown is the European yew. There is also no method enabling male and female individuals to be distinguished at an early stage of development. The possibility of distinguishing individuals appears only at the moment of sexual maturity, when they start to create generative reproduction organs, a process that occurs quite late in the case of yew. For several reasons, the possibility of yew sex recognition at a juvenile age is a highly signiicant issue. Yew is used as a medicinal plant of high signiicance in cancer treatment, and some studies (Iszkuło et al. 2013) have indicated a higher concentration of active substances in female individuals. Also, in the case of decorative greenery, female individuals are more appreciated because of their decorative arils. In natural populations, the rate of mature male to female individuals is about 1:1; however, these results relate to mature tree stands, because currently studies may only be conducted after the appearance of generative organs on the trees. Owing to the impossibility of distinguishing male individuals from female ones in younger age classes, no studies have been conducted so far into the ratio of male to female individuals in populations before they reach maturity. Knowledge of the sex of young individuals is also signiicant for species protection. The yew restitution programme assumes the reintroduction of the species into the forests, but it is important to introduce a suitable number of male and female individuals so that the populations have the chance to function properly. Sex proportion imbalance decreases the effective population size and, in a long time scale, increases the number of homozygous individuals and all negative effects of inbreeding. In some extreme cases, it may even lead to the extinction of the whole introduced population. Bulked segregant analysis (BSA) is a rapid procedure for identifying markers in speciic regions of the genome and is irst described by Michelmore et al. (1991). The method involves comparing two pooled DNA samples of individuals from a segregating population that originates from a single cross. Within each pool, or bulk, the individuals are identical for the trait or gene of interest but are arbitrary for all other genes. Two pools with a different trait of interest are analysed to identify markers that distinguish them. Markers that are polymorphic between the pools are genetically linked to the locus determining the trait used to construct the pools (Peters et al. 2003). This technique has been successfully used to identify random ampliied polymorphic DNA (RAPD) markers linked to disease-resistance genes and sex-linked genes in several plants such as Pistacia vera L. (Hormaza et al. 1994), Asparagus oficinalis L.) (Jiang, Sink 1997), Salix viminalis L. (Alstrom-Rapaport et al. 1998; Gunter 2003), Actinidia chinensis Planch. (Harvey et al. 1997; Gill et al. 1998), Silene latifolia Poir. (Zhang et al. 1998), Cannabis sativa L. (Mandolino et al. 1999), Piper longum L. (Banerjee et al. 1999), Myristica fragrans Houtt. (Shibu et al. 2000), Eucommia ulmoides Oliv. (Xu et al. 2004), Encephalartos natalensis R.A.Dyer & I.Verd. (Prakash, Staden 2006), Carica papaya L. (Urasaki et al. 2002; Chaves-Bedoya, Nuñez 2006) and Simmondsia chinensis (Link) Schneid. (Agrawal et al. 2007). Despite some disadvantages, RAPD markers are still very often used in such kinds of research because of the relatively low cost, the possibility 69 of testing a high number of primers and searching both DNA coding and non-coding regions. Other effective type of molecular markers is intersimple sequence repeat (ISSR) that has been successfully used, for example, in Humulus lupulus L. (Danilova, Karlov 2006), Humulus japonicus Siebold & Zucc. (Aleksandrov et al. 2011), Simmondsia chinensis (Link) Schneider (Sharma et al. 2008), Phoenix dactylifera L. (Younis et al. 2008), Carica papaya L. (Gangopadhyay et al. 2007) and Calamus tenuis Roxb. (Sarmah, Sarma 2011) for the identiication of sex polymorphism. The aim of this study was to ind molecular marker that could distinguish male and female in early stage of development and test whether RAPD or ISSR markers provide information about sex of an individual. To date, there is no information about sex determination mechanisms in T. baccata. This is the irst step in the understanding of this process. 2. Material and methods 2.2. Plant material Plant material was collected for the study within two sites of European yew: the Zadni Gaj reserve near Ustroń and the collection of the UJ Botanical Garden in Krakow. In Zadni Gaj, needles were collected from 12 male and 12 female fully developed, mature trees after sexual phenotypic identiication, whilst in the Botanical Garden material was collected and determined from 8 male and 8 female individuals. The individual samples were stored at −80°C before use. 2.2. DNA isolation Total genomic DNA was isolated using the modiied cetyltrimethylammonium bromide (CTAB) method from about 200 mg of frozen needle tissue from male and female individuals separately (Khanuja et al. 1999). DNA concentrations were detected with a Synergy™ 2 Multi-Detection Microplate Reader (BioTek Instruments, Winooski, VT) and diluted in double-distilled sterile water to a inal concentration of 80 ng/µl. For further analysis, DNA samples were stored at a temperature of −20oC. 2.3. Bulked segregant analysis (BSA) The BSA was designed in two variants: a main (Figure 1) and an alternative pathway (Figure 2). Variant choice depended on on-going results obtained from particular stages. Analysis was conducted in three stages. Stage I (common for both variants) involved preparation of three mixed samples from DNA of 12 male individuals and three mixed samples from DNA of 12 female individuals (four different individuals per sample), all derived from the Zadni Gaj reserve. Each individual was represented by the same amount of DNA. At this stage, 716 of the 10-nucleotide primers selected from the Operon set (http://www.operon.com/products/downloads/ OperonsRAPD10merSequences.xls) (Operon Technologies, Alameda, CA, USA) (set OP: A-Z, AA- AI 1-16) were tested on six mixed DNA samples (three male pools and three female M. Zarek / Leśne Prace Badawcze, 2016, Vol. 77 (1): 68–75 70 pools), as were 20 ISSR primers marked as UBC (University of British Columbia kit) of the following sequences (Table 1). Primers that generated bands occurring in all mixed samples of one sex and were absent in opposite sex samples (main pathway) or demonstrated differences in the frequency of occurrence between the sexes (alternative pathway) were transferred to stage II. At stage II, the selected primers were veriied not in the mixed samples but individually on 12 male and 12 female individuals sourced from the Zadni Gaj reserve. Primers with bands characteristic entirely for male or female groups (main pathway) or differing in terms of the frequency of occurrence between the examined groups (alternative pathway) were transferred to stage III. Stage III involved veriication of selected primers on 15 male and 15 female individuals of T. baccata belonging to two populations (Zadni Gaj and UJ Botanical Garden). The expected inal result of the main pathway was obtaining an ‘ideal’ marker or markers enabling the classiication of a given individual to a speciied sex in a quick and unequivocal manner, irrespective of its origin. In the case of the alternative pathway, the expected inal effect was obtaining proiles of markers differing in terms of the frequency of occurrence in male and female individuals, unequivocally identifying examined individuals within a given sex, using the lowest number of primers possible. 2.4. DNA ampliication RAPD and ISSR analysis were used to screen a total of 716 primers of arbitrary sequences obtained from Sigma-Aldrich (Sigma-Aldrich Co. LLC., St. Louis, MO, USA). The ampliication was conducted in sterile 0.2-ml Eppendorf test tubes in 10 µl of a reaction mixture containing PCR 10X DreamTaq Green Buffer, 2 mM MgCl2, 200 µM each of deoxynucleotides (dNTPs), 0.5 µM of primer, 0.25 U of DreamTaq™ DNA polymerase (Fermentas, Burlington, Canada), 80 ng of genomic DNA and two tracking dyes. Ampliication was conducted in a Biometra T3 thermocycler (Göttingen, Germany) following the thermal proile: one cycle consisting of 6 min at 95oC, 45 s at 35oC and 2.5 min at 72oC followed by 36 cycles of 1 min at 95oC, 45 s at 35oC and 2.5 min at 72oC. The inal elongation was conducted for 8 min at 72oC. The ampliication products were separated electrophoretically in a 1.5% agarose gel (Prona, Madrid, Spain) with a 100-bp internal size standard (GeneRuler DNA Ladder Plus, Fermentas) and stained with Midori Green DNA Stain (Nippon Genetics Europe GmbH, Duren, Germany). The results were analysed using Bio-1D++ computer software (Vilber Lourmat, Torcy, France). 3. Results Seven hundred and sixteen primers were tested as a part of the study. Each of them allowed 0–15 bands of lengths ranging from 200 to 3000 bp to be obtained. It was observed just at stage I that none of the examined primers gave bands that would be both present in all three examined bulk mixtures from a given group and completely absent in the bulks from the opposite sex (Figure 1). Owing to the results obtained at this stage, the decision was taken to continue the study using variant II, that is, alternative pathway. The results obtained at stage I enabled the division of the primers into four groups: primers providing some differences between male and female groups (polymorphic), primers providing no differences between the examined groups (monomorphic), primers providing no ampliication products (empty), and those providing a smeared image, preventing the distinction of particular bands and a readout of their length (Figure 2). The most abundant group (74.44%) was represented by monomorphic primers, 8.38% of the primers gave no ampliication products and 1.26% provided a smeared image. The above primers were rejected. Hundred and fourteen primers (15.92%) that appeared to be polymorphic between the examined groups were qualiied for stage II. The number of individuals from a given group in which a previously observed marker occurred was veriied in stage II on one population example (Zadni Gaj). At that stage, two markers seemed to be the most promising: primer Table 1. Sequences of the ISSR primers from UBC group used in the research Primer Sequence Primer Sequence UBC881 GGGTGGGGTGGGGTG UBC891 HVHTGTGTGTGTGTGTG UBC882 VBVATATATATATATAT UBC892 TAGATCTGATATCTGAATTCCC UBC883 BVBTATATATATATATA UBC895 AGAGTTGGTAGCTCTTGATC UBC884 HBHAGAGAGAGAGAGAG UBC899 CATGGTGTTGGTCATTGTTCCA UBC885 BHBGAGAGAGAGAGAGA UBC900 ACTTCCCCACAGGTTAACACA UBC886 VDVCTCTCTCTCTCTCT UBC880 GGAGAGGAGAGGAGA UBC887 DVDTCTCTCTCTCTCTC UBC879 CTTCACTTCACTTCA UBC888 BDBCACACACACACACA UBC878 GGATGGATGGATGGAT UBC889 DBDACACACACACACAC UBC877 TGCATGCATGCATGCA UBC890 VHVGTGTGTGTGTGTGT UBC876 GATAGATAGACAGACA M. Zarek / Leśne Prace Badawcze, 2016, Vol. 77 (1): 68–75 71 Figure 1. The diagram of stages I, II and III of main pathway used in the research. M1 – ideal male sex-linked marker, M2 – ideal female sex-linked marker C07 generated a 540-bp band, which was present in the DNA of 8 out of 12 male trees (66.7%) and in only 1 female tree (8.3%). Similarly, K14_780bp marker (5′-CCCGCTACAC-3′) was ampliied in 7 out of 12 male trees (58.3%) and 2 female trees (16.7%). These primers when used together enabled us to distinguish 92% of male trees from females in the Zadni Gaj population. Twenty-four primers in total qualiied for stage III, and these were the primers which in stage II were present both in male and female individuals, but with varying frequencies. Eight of them were rejected because of the absence of result repeatability. Nineteen markers in total (Table 2) were obtained using another 16 primers, and some of them distinctly differed in terms of the frequency of occurrence in male and female individuals irrespective of their origin. Unfortunately, both marker C07_540 and marker K14_780 appeared to be useless, because in the case of the population from the UJ Botanical Garden in Krakow, they were present in the same percentage ratios in male and female individuals. Finally, 7 primers were selected out of the 16 tested, and they constituted the lowest number allowing unequivocal distinction of male individuals from female ones. In the result, 8 markers (an example of the marker H13_729 is shown in the Figure 3) were obtained using these primers (Table 2), and their combinations formed 13 proiles of bands observed entirely in male individuals and 13 bands present in female individuals (Table 3). 4. Discussion The ideal sex-related marker should be clear, repeatable and present in all individuals of a given sex irrespective of their origin and concurrently should be absent in opposite sex individuals. In order to assure identiication faultlessness, it is useful to have at least two markers, one for each sex. This is related to the fact that the absence of a given band may be connected to errors in DNA ampliication and not necessarily to marker absence. Our study demonstrated that despite the relatively large number of primers tested (716), we did not manage to ind a single marker unequivocally identifying sex 72 M. Zarek / Leśne Prace Badawcze, 2016, Vol. 77 (1): 68–75 Figure 2. The diagram of stages I, II and III of alternative pathway used in the research. M3, M4 – markers differing in terms of the frequency of occurrence in male and female individuals. using the BSA method, which led to the need for the application of an alternative pathway. An occurrence of different sexes is a phenomenon that aims a continuous creation of new genes combinations and thus genetic variability increase. This is also usually related to the occurrence of physiological or morphological differences between male and female individuals and often also in their economic value. The occurrence of gonochory amongst animals is common and quite well recognised. In most cases, it is related to the occurrence of heteromorphic sex chromosomes. Dioecy in the plant world is observed considerably more rarely, mechanisms of its determination have been poorly recognised so far and they may be controlled by single gene or sex chromosomes. Ming et al. (2011) described six stages of sex chromosome evolution, starting from single mutations in genes determining the sex through homomorphic chromosomes impossible to be distinguished at a cytological level, and heteromorphic chromosomes, up to a complete reduction of one of the chromosomes. In the case of gymnosperm plants, which also include the European yew, sex chromosomes are only recognised in six species belonging to three families, and all of these are heteromorphic chromosomes. It is easy to ind sex-linked markers in plants with heteromorphic sex chromosomes using the RAPD method. In Cannabis sativa, only 15 primers were needed to ind two markers linked to the male sex according to Sakamoto et al. (1995) and 20 primers to ind one marker according to Mandolino et al. (1999). In Silene latifolia, 60 tested primers were needed to detect four markers (Mulcahy et al. 1992), and according to Zhang et al. (1998), 340 primers were needed to ind 44 male-speciic markers. It may be concluded based on the above information that yew has no heteromorphic sex chromosomes, which is also conirmed in cytological observations. Analyses of yew karyotype were conducted quite a long time ago (Sax, Sax 1933), and they did not demonstrate any differences between the sexes. Also, current studies (Tomasino et al. 2012) have so far not provided any information concerning cytological differences. M. Zarek / Leśne Prace Badawcze, 2016, Vol. 77 (1): 68–75 73 Table 2. The sequences of markers obtained in stage III of experiment and their frequency of occurrence in male and female individuals of Taxus baccata Marker Primer sequence Frequency of occurrence in male [%] Frequency of occurrence in female [%] A07_954* GAAACGGGTG 46.6 80 A07_1411 GAAACGGGTG 26.6 46.6 B01_730 GTTTCGCTCC 46.6 40 B03_590 CATCCCCCTG 26.6 6.6 C07_540 GTCCCGACGA 66.6 66.6 H13_729* GACGCCACAC 26.6 40 I07_642 CAGCGACAAG 13.3 26.6 J08_660* CATACCGTGG 13.3 53.3 K14_780 CCCGCTACAC 53.3 53.3 L12_390* GGGCGGTACT 73.3 33.3 L12_790 GGGCGGTACT 66.6 53.3 U01_457* ACGGACGTCA 53.3 13.3 V14_527* AGATCCCGCC 66.6 93.3 AC02_560 GTCGTCGTCT 46.6 46.6 AE03_941* CATAGAGCGG 33.3 66.6 AE03_1014* CATAGAGCGG 20 46.6 AE04_493 CCAGCACTTC 33.3 26.6 AE15_467 TGCCTGGACC 13.3 13.3 AF08_877 CTCTGCCTGA 20 20 * Markers selected for construction of sex-speciic band proiles Table 3. Combinations of 8 markers (profiles of bands) observed entirely in male or female individuals male female Marker 1 A07_954 H13_729 2 3 4 5 6 7 * * * 10 11 12 13 * * * L12_390 * U01_457 V14_527 AE03_1014 9 * J08_660 AE03_941 8 * * * * * * * * * * * * * 1 * * 2 3 4 5 6 7 * * * * * * * * * * * * * * * * * * * * * * * * * * * * The probability of inding sex-linked markers in dioecious plants depends on the genome size. The larger the genome is, the more random primers should be screened to ind a sex-speciic marker (Jiang et al. 2003). The haploid genome size of Carica papaya is 0.74 × 109 bp (Bennett, Smith 1991) and only 40 primers were used to obtain two male-speciic markers (Ba- * * 8 * * 9 10 11 12 13 * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * nerjee et al. 1999). In Actinidia chinensis, the genome size is 4.36 × 109 bp (Bennett et al. 2000) and 500 RAPD primes were needed to isolate two sex-speciied markers (Gill et al. 1998). Finally, for Ginkgo biloba, which has a large genome of about 9.9 × 109 bp (Murray 1998), 1200 primers were used to ind one sex-linked male marker (Jiang et al. 2003). 74 M. Zarek / Leśne Prace Badawcze, 2016, Vol. 77 (1): 68–75 T. baccata is a coniferous tree and has a relatively large genome size as compared to most other plant species, including many angiosperm tree species. The size of Taxus genome is a little larger than that of Ginkgo and has 10.9 × 109 bp (Ahuja, Neale 2005). The size of the yew genome seems to be another factor impeding the search for a sex marker/markers. Thus, further testing of subsequent series of primers seems to be necessary. Another problem in the studies on T. baccata is that some individuals had both male and female ‘flowers’. Co-sexual individuals could be found with many male structures and with only single female ones or sometimes with equal numbers of male and female structures dispersed in the crown of the whole tree (Iszkuło, Jasińska 2004). This may be caused both by some instability of the sex determination process and also by individuals of various sexes fused in one trunk with an age as a result of growing close together. Individuals with only one branch of a different sex have been observed in the nature, and also individuals on which one annual increment on the same branch demonstrated the features of a different sex (Zarek, unpublished). Therefore, it is extremely important in such kinds of analysis to qualify the examined individual unequivocally to a given sex, which may multiple veriications during ield observations. Sex instability observed in Taxus could be an argument for environmental basis for sex determination in this species. Some of dioecious plants have exclusively genotypic sex determination (GSD); but in other cases, environmental sex determination (ESD) is also observed. In ESD, sex development is controlled by environmental factors such as temperature, pH and hormones. Often a mixture of GSD and ESD leads to a mismatch between genotypic and phenotypic sex. According to Stehlik et al (2008), one of the most direct ways for changing sex ratios in progeny is sex determination induced by environment. Plant species that are generally very plastic in gender expression show environmentally influenced sex-allocation plasticity or sex inconstancy during flowering. But it is still unclear how environmental influences interact with genetic sex determination mechanisms. According to Gschwend et al. (2012), species with autosomal determination mechanisms may in some circumstances create the mutations causing a return to the androgynous stadium, whilst species that form chromosomes of both sexes stay dioecious as long as these chromosomes exist. In turn, according to Ming et al. (2011), all dioecious species may potentially create sex chromosomes and also transform again from dioecy to various forms of monoecy (such as monoecy, gynodioecy or androdioecy), especially at early stages of the evolution of sex chromosomes. It may be supposed, based on our study and literature data, that sex determination in the European yew is of a multi-gene character and may be related to the occurrence of homomorphic sex chromosomes. Finding a practical marker identifying the sex, especially before the period of individual maturity, is for now still an unresolved issue. The marker proiles proposed by us may be useful at this stage of research; however, they require veriication of their frequency of occurrence in a larger number of populations. To the best of our knowledge, this was the irst attempt to ind sex-speciic markers for the identiication of sex in Taxus. Further studies should be continued to increase the number of RAPD and ISSR primers screened in an effort to ind a marker flanking the putative sex-determination locus as well as try to use more sophisticated methods such as next-generation sequencing (NGS) that provide very high genome coverage. The next step should be to generate an SCAR marker (sequence characterised ampliied regions) because polymorphic RAPD and ISSR markers transformed to SCAR markers can be more advantageous in commercial breeding programmes if a quick assay can be developed to detect the presence or absence of the product. In addition, sequence-speciic markers could potentially be used to screen more T. baccata populations and other Taxus species. Conlict of interest None declared. Acknowledgements and source of funding This Research was inanced by the Ministry of Science and Higher Education of the Republic of Poland. The author gratefully wish to thank the Director of the UJ Botanical Garden in Krakow for providing yew collection. References Agrawal V., Sharma K., Gupta S., Kumar R., Prasad M. 2007. Identiication of sex in Simmondsia chinensis (Jojoba) using RAPD markers. Plant Biotechnology Reports 1(4): 207–210. DOI:10.1007/s11816-007-0031-6. Ahuja M., Neale D. 2005. Evolution of genome size in conifers. Silvae Genetica 54(3): 126–137. Ainsworth C. 2000. Boys and Girls Come Out to Play: The Molecular Biology of Dioecious Plants. Annals of Botany 86(2): 211–221. DOI:10.1006/anbo.2000.1201. Aleksandrov O. S., Divashuk M. G., Karlov G. I. 2011. Development of a sex-speciic molecular marker for Japanese hop Humulus Japonicus Siebold & Zucc. Russian Journal of Genetics 47(8): 1016–1020. DOI:10.1134/S1022795411080023. Allison T. 1991. Variation in sex expression in Canada yew (Taxus canadensis). American Journal of Botany 78(4): 569–578. Alstrom-Rapaport C., Lascoux M., Wang Y. C., Roberts G., Tuskan G. A. 1998. Identiication of a RAPD marker linked to sex determination in the basket willow (Salix viminalis L.). Journal of Heredity 89: 44–49. Banerjee N. S., Manoj P., Das M. R. 1999. Male sex associated RAPD markers in Piper longum L. Current Science 77: 693–695. Bennett M. D., Bhandol P., Leitch I. J. 2000. Nuclear DNA amounts in angiosperms and their modern uses—807 new estimates. Annals of Botany 86(4): 859–909. DOI:10.1006/anbo.2000.1253. Bennett M. D., Smith J. B. 1991. Nuclear DNA Amounts in Angiosperms. Philosophical Transactions of the Royal Society B: Biological Sciences 334(1271): 309–345. DOI:10.1098/ rstb.1991.0120. Chaves-Bedoya G., Nuñez V. 2006. A SCAR marker for the sex types determination in Colombian genotypes of Carica papaya. Euphytica 153(1-2): 215–220. DOI:10.1007/s10681-006-9256-7 Danilova T. V., Karlov G. I. 2006. Application of inter simple sequence repeat (ISSR) polymorphism for detection of sex-speciic molecular markers in hop (Humulus lupulus L.). Euphytica 151(1): 15–21. DOI:10.1007/s10681-005-9020-4. M. Zarek / Leśne Prace Badawcze, 2016, Vol. 77 (1): 68–75 DiFazio S. P., Wilson M. V., Vance N. C. 1996. Variation in sex expression of Taxus brevifolia in western Oregon. Canadian Journal of Botany 74(12): 1943–1946. DOI:10.1139/b96-232. Gangopadhyay G., Roy S., Ghose K., Poddar R., Bandyopadhyay T., Basu D., Mukherjee1 K. K. 2007. Sex detection of Carica papaya and Cycas circinalis in pre-flowering stage by ISSR and RAPD. Current Science 92(4): 524–526. Gill G. P., Harvey C. F., Gardner R. C., Fraser L. G. 1998. Development of sex-linked PCR markers for gender identiication in Actinidia. TAG Theoretical and Applied Genetics 97(3): 439–445. DOI:10.1007/s001220050914. Gschwend A. R., Weingartner L. a, Moore R. C., Ming R. 2012. The sex-speciic region of sex chromosomes in animals and plants. Chromosome Research: 20(1): 57–69. DOI:10.1007/ s10577-011-9255-y. Gunter L. E. 2003. The Development of Two Flanking SCAR Markers Linked to a Sex Determination Locus in Salix viminalis L. Journal of Heredity 94(2): 185–189. DOI:10.1093/jhered/ esg023. Harvey C. F., Gill G. P., Fraser L. G., McNeilage M. A. 1997. Sex determination in Actinidia . 1. Sex-linked markers and progeny sex ratio in diploid A. chinensis. Sexual Plant Reproduction 10(3): 149–154. DOI:10.1007/s004970050082. Hiliker K., Holderegger R., Rotach P., Gugerli F. 2004. Dynamics of genetic variation in Taxus baccata: local versus regional perspectives. Canadian Journal of Botany 82: 219–227. DOI:10.1139/B03-136. Hogg K. E., Mitchell A. K., Clayton M. R. 1996. Conirmation of cosexuality in Paciic yew ( Taxus Brevifolia Nutt.). Western North American Naturalist 56(4): 377–378. Hormaza J., Dollo L., Polito V. 1994. Identiication of a RAPD marker linked to sex determination in Pistacia vera using bulked segregant analysis. Theoretical and applied Genetics 89: 9–13. Irish E. E., Nelson T. 1989. Sex Determination in Monoecious and Dioecious Plants. The Plant Cell 1(8): 737–744. DOI:10.1105/ tpc.1.8.737. Iszkuło G., Jasińska A. 2004. Variation in sex expression in Polish and Ukrainian populations of Taxus baccata L. Dendrobiology 52: 29–32. Iszkuło G., Kosiński P., Hajnos M. 2013. Sex influences the taxanes content in Taxus baccata. Acta Physiologiae Plantarum 35(1): 147–152. DOI:10.1007/s11738-012-1057-0. Jiang C., Sink K. C. 1997. RAPD and SCAR markers linked to the sex expression locus M in asparagus. Euphytica 94: 329-333. Jiang L., You R. L., Li M. X., Shi C. 2003. Identiication of a Sex-Associated RAPD Marker in Ginkgo biloba. Acta Botanica Sinica 45(6): 742–747. Khanuja S., Shasany A., Darokar M., Kumar S. 1999. Rapid isolation of DNA from dry and fresh samples of plants producing large amounts of secondary metabolites and essential oils. Plant Molecular Biology Reporter 17: 1–7. Mandolino G., Carboni A., Forapani S., Faeti V., Ranalli P. 1999. Identiication of DNA markers linked to the male sex in dioecious hemp (Cannabis sativa L.). Theoretical and Applied Genetics 98(1): 86–92. DOI:10.1007/s001220051043. Michelmore R. W., Paran I., Kesseli R. V. 1991. Identiication of markers linked to disease-resistance genes by bulked segregant analysis: a rapid method to detect markers in speciic genomic regions by using segregating populations. Proceedings of the National Academy of Sciences of the United States of America 88(21): 9828–9832. 75 Ming R., Bendahmane A., Renner S. S. 2011. Sex chromosomes in land plants. Annual review of plant biology 62: 485–514. DOI:10.1146/annurev-arplant-042110-103914. Mulcahy D., Weeden N., Kesseli R., Carroll S. 1992. DNA probes for the Y-chromosome of Silene latifolia, a dioecious angiosperm. Sexual plant reproduction 5: 86–88. Murray B. 1998. Nuclear DNA amounts in gymnosperms. Annals of Botany, 82(Supplement A): 3–15.enix dactylifera L.) Using RAPD and ISSR Techniques. Research Journal of Agriculture and Biological Sciences 4(4): 278–284. Peters J. L., Cnudde F., Gerats T. 2003. Forward genetics and mapbased cloning approaches. Trends in Plant Science 8(10): 484– 91. DOI:10.1016/j.tplants.2003.09.002. Prakash S., Staden J. 2006. Sex identiication in Encephalartos natalensis (Dyer and Verdoorn) using RAPD markers. Euphytica 152(2): 197–200. DOI:10.1007/s10681-006-9198-0. Sakamoto K., Shimomura K., Komeda Y., Kamada H., Satoh S. 1995. A Male-Associated DNA Sequence in a Dioecious Plant, Cannabis sativa L. Plant Cell Physiology 36(8): 1549–1554. Sarmah P., Sarma R. N. 2011. Identiication of a DNA marker linked to sex determination in Calamus tenuis Roxb., an economically important rattan species in northeast India. Molecular Breeding 27(1): 115–118. DOI:10.1007/s11032-010-9510-5. Sax H. J., Sax K. 1933. Chromosome number and morphology in the conifers. Journal of the Arnold Arboretum 14: 356–375. Sharma K., Agrawal V., Gupta S., Kumar R., Prasad M. 2008. ISSR marker-assisted selection of male and female plants in a promising dioecious crop: jojoba (Simmondsia chinensis). Plant Biotechnology Reports 2(4): 239–243. DOI:10.1007/s11816-008-0070-7. Shibu M. P., Ravishankar K. V., Anand L., Ganeshaiah K. N., Shaanker R. U. 2000. Identiication of sex-speciic DNA markers in the dioecious tree, nutmeg (Myristica fragrans Houtt.). Plant Genetic Resources Newsletter (121): 59–61. Stehlik I., Friedman J., Barrett S. C. H. 2008. Environmental influence on primary sex ratio in a dioecious plant. Proceedings of the National Academy of Sciences of the United States of America 105(31): 10847–52. DOI:10.1073/pnas.0801964105. Theissen G. 2001. Development of floral organ identity: stories from the MADS house. Current Opinion in Plant Biology 4(1): 75–85. Thomas P., Polwart A. 2003. Taxus baccata L. Journal of Ecology 91: 489–524. Tomasino M. P., Gennaro A., Simeone M. C., Schirone B., Ceoloni C. 2012. Conventional and molecular cytogenetic analysis of Taxus baccata karyotype. In: Conventional and molecular cytogenetic analysis of Taxus baccata karyotype, 77 p. Urasaki N., Tokumoto M., Tarora K., Ban Y., Kayano T., Tanaka H., Oku H., Chinen I., Terauchi R. 2002. A male and hermaphrodite speciic RAPD marker for papaya (Carica papaya L.). Theoretical and Applied Genetics 104: 281–285. Weigel D., Meyerowltzt E. M. 1994. The ABCs of Floral Homeotic Genes Review. Cell 78: 203–209. Xu W., Wang B., Cui K. 2004. RAPD and SCAR markers linked to sex determination in Eucommia ulmoides Oliv. Euphytica 136: 233–238. Younis R. A. A., Ismail O. M., Soliman S. 2008. Identiication of Sex-speciic DNA Markers for Date Palm (Phoenix dactylifera L.) Using RAPD and ISSR Techniques. Research Journal of Agriculture and Biological Sciences 4(4): 278–284. Zhang Y., Stilio V., Rehman F., Avery A., Mulcahy D., Kesseli R. 1998. Y chromosome speciic markers and the evolution of dioecy in the genus Silene. Genome 41: 141–147. DOI: 10.1515/frp-2015-0009 Available online: www.lesne-prace-badawcze.pl Leśne Prace Badawcze / Forest Research Papers Marzec / March 2016, Vol. 77 (1): 76–81 e-ISSN 2082-8926 REVIEW ARTICLE The use of phosphates in forestry Miłosz Tkaczyk1*, Katarzyna A. Kubiak1, Jacek Sawicki2, Justyna A. Nowakowska3, Tomasz Oszako1 1 Forest Research Institute, Forest Protection Department, Sękocin Stary, Braci Leśnej 3, 05–90 Raszyn, Poland; Kazgod Sp. z o.o., Wierzbowa 7, 05–870 Błonie. Poland; 3 Forest Research Institute, Laboratory of Molecular Biology, Sękocin Stary, Braci Leśnej 3, 05–090 Raszyn, Poland 2 *Tel. +48 22 7150610, fax +48 22 7150557, e-mail: M.Tkaczyk@ibles.waw.pl Abstract. Phosphite preparations are now an important alternative in plant protection against new, invasive pathogens of the genus Phytophthora and/or Pythium. It is crucial to intervene when alien, invasive oomycetes are carried to plantations or forest stands and attack ine roots via zoospores. The aim of this paper was to demonstrate the possibility of phosphite application to induce resistance to tree pathogens. Phosphate-based fertilizers have been used successfully in nurseries, where application is relatively easy by means of foliar sprays. The traditional fungicides, which are effective in combating fungi, however, fail to control oomycetes. Instead, they mask the disease, which, in turn, causes serious damage to seedlings after they have been planted in a suitable environment. Moreover, the number of effective fungicides available for forest plant protection has continued to decrease in the last decade. The effectiveness of the chemicals is reduced due to their frequent use and their similarity in terms of the active compound or the mechanism of action. Given the low diversity of active compounds, it is necessary to monitor the development of resistance of pathogens to fungicides by means of molecular biology (sequencing and quantitative PCR). Minimising the undesired side effects of chemicals on both, mycorrhizal fungi and pathogens can be achieved by strict adherence to rigorous security measures and, where possible, frequently changing the active compounds to alternatives such as phosphites. The signiicance of phosphate and phosphite uptake by trees is still a matter of debate, especially under ield conditions. Nevertheless, phosphites are environmentally friendly compounds, which constitute an alternative or complement to the traditional chemicals (in accordance with the Directive on Integrated Plant management). Keywords: Pathogens, plant protection, fertilizers 1. Introduction Until recently, it was believed that phosphites interact toxically only in direct contact with pathogens (e.g. genus Phytophthora), and should be therefore applied directly on the site of the infection, and in relatively high concentration (Fenn, Coffey, 1984; 1985). However, detailed studies have shown that there is no relationship between the concentration of phosphites and its effectiveness, and the use of high concentration was completely non-toxic to fungi (Smillie et al. 1989). Further studies revealed that the application of phosphites reduces sporulation of organisms belonging to the genus of Phytophthora. As a result of their action, plant cell walls are altered and the amount of suppressors masking the development of disease. The result of these studies was the creation of many fertilizers based on phosphite (Lovatt 1990). The research on the use of fertilizers in order to reduce the incidence of tree dieback was carried out in Germany in 2006–2009 by Jung (2008). In Poland in 2009, the Institute of Pomology and Floriculture was carrying out research on the use of the fertilizer named Actifos, which contains ammonium phosphonates in its composition, in plant protection (Orlikowski 2004, 2006; Korzeniowski, Orlikowski 2008; Muszyńska Orlikowski 2010). A similar work was also carried out at the Forest Research Institute (Tkaczyk et al. 2014). The purpose of this paper is to summarise the results of the research on phosphite in three aspects: as fertilizer, Submitted: 28.07.2015, reviewed: 19.08.2015, accepted after revision: 21.08.2015. © 2016 M. Tkaczyk et al. M. Tkaczyk et al. / Leśne Prace Badawcze, 2016, Vol. 77 (1): 76–81 77 fungicides and bio-stimulators (resistance), and indicate the possibility of their use in forestry (e.g. in the context of the EU directive on integrated plant). 2. Phosphites used as fertilizer Phosphates, as salts of phosphoric acid H3PO3 (orthophosphoric III), differ from phosphoric acid H3PO4 (orthophosphoric V) with one oxygen atom less (Fig. 1). This difference gives phosphites greater mobility in the soil and in plant tissues than phosphates and greater ability to penetrate the plants through leaves, stems and roots, and thus are more easily retrieved and transported through the xylem and phloem (Guest, Grant 1991). Thoughts about the use of phosphonates by plants as a phosphorus source are divided. Thao and Yamakawa (2010) cites studies of Maclntire et al (1950), which showed that phosphites are a source of phosphorus. Thao and others (2008) explored the usefulness of phosphite as a fertilizer in crops of spinach. They showed that in a situation where delivered to plants both forms of phosphorous and phosphite in suficient doses, the symptoms of lack of phosphorus were not observed. However, when the only source of phosphorus was replaced by phosphite, this led to a reduction of growth of spinach. A similar relationship was observed in crops of Brassica rapa var. perviridis (Thao et al. 2008; Thao Yamakawa, 2009, Thao Yamakawa, 2010). Other researchers conirmed that phosphite may be applied as a source of phosphorus in sweet potato tissue cultures (Hirosse et al. 2012). In studies of Moor et al (2009), the use of phosphites as fertilizers for strawberries did not affect the plant growth or increase their fruiting. Avila et al (2012b), on the example of corn, demonstrated that an application of phosphites as fertilizers reduces the possibility of phosphorus uptake in its pure form, regardless of the nutrition with phosphorus. Replacement of a quarter dose of phosphorus fertilization by phosphite led to a reduction in the production of plant biomass showing deiciency of phosphorus. This effect was not observed in the experimental variant, when the plants are properly nourished. Similar studies on the effect of foliar application of phosphite on corn growth was carried out by Schroetter et al (2006) who demonstrated that inadequate supply of plant in phosphorus led to their stunting, or even dying. This effect was much smaller when the plants were properly nourished with all necessary nutrients. In studies of Ratjen and Gerendás (2009) courgettes, which showed a deiciency of phosphorus, were severely damaged in the variant, which uses phosphite fertilization. Other studies on the effects of phosphite fertilization on the biomass yield of bean (Avila et al. 2012) showed that at the time when the phosphite is added in small amounts, no signiicant changes in the plant biomass was obseved, whereas increasing Figure 1. The Phosphite ionic compound (left) and the phosphate ionic compound (right), modiied by Guest, Grant (1991) the dose would cause its signiicant decrease. These tests were carried out on both plants having as well good as poor nutritional status of phosphorus. In a variant of phosphorus deiciency in plants the foliar fertilization was applied, which led to their damage (Avila et al. 2012). Generally, it is believed that the phosphites are very stable chemical and are not transformed to phosphorus that can be used by plants as a food source (Ouimette, Coffey, 1989). This is a single bond between carbon and phosphorus, which is resistant to hydrolysis and is not readily biodegradable (Othake et al., 1996; Kelderer et al. 2006). So far, no plant enzyme capable of oxidising phosphites to the phosphorus form was found, although isolated bacteria from the roots of avocado have the ability to oxidise phosphites in plant tissues (Brunings et al. 2012). Also, bacteria of similar characteristics were located in the soil (Stoven et al. 2007). They can include species such as Escherichia coli, Klebsiella aerogenes, Agrobacterium tumefaciens and bacteria of the genera Pseudomonas and Rhizobium. However, this process is dependent on a number of environmental factors: temperature, soil moisture and pH, but the period of phosphites oxidation can last from a few weeks to even years (McDonald et al., 2001a). 3. Phosphites used as a fungicide In the 1970s more attention was paid to phosphite as a potential means for protection of plants (Barchietto et al., 1989; Martin et al. 1998; McDonald et al., 2001b). Then, Rhône-Poulenc Agrochimie, a French company, introduced a new fungicide to protect the plant against downy mildew and diseases caused by organisms of Phytophthora genus (Fenn, Coffey 1987; Landschoot, Cook, 2005; Ann et al. 2009; Wojdyła et al. 2010; Wojdyła et al. 2011). The product comprised fosetyl-aluminum as an active substance. The action of preparations containing in its composition 78 M. Tkaczyk et al. / Leśne Prace Badawcze, 2016, Vol. 77 (1): 76–81 phosphonates against Oomycetes (genera of Phytophthora, Pythium, Peronospora, Bremia and Plasmopara) was reported by many authors (Pankhurst et al. 1998; Aberton et al., 1999; Dobrowolski et al. 2008; Amiri et al. 2009; Ann et al. 2009; Hardy, 2009; Wilkinson et al., 2001a). Ouimette and Coffey (1989) observed in vitro the influence of ive different compounds (having in their composition the phosphite) on 34 isolates belonging to nine different species of Phytophthora, and Wilkinson et al (2001b) under the same conditions studied the influence of potassium phosphite for 71 isolates of Phytophthora cinnamomi . Generally, the sensitivity of pathogens to phosphites was growing with increasing concentration of the preparation, although some isolates responded poorly to increasing doses. Reducing the development of Phytophthora plurivora and P. cinnamomi through the use of phosphites in vitro described Fenn and Coffey (1984). This mechanism was related with the growth reduction of pathogen cells and its sporulation (Grifith et al. 1990; Niere et al. 1990; Soulie et al., 1995; Davis, Grant 1996; Jackson et al. 2000; Matheron 2000; Wilkinson et al., 2001c). Coffey and Joseph (1985) noted the impact of phosphite preparations on the growth and development of P. plurivora and P. cinnamomi, including the signiicant inhibition of mycelial growth, reducing the formation of oospores (up to 97%) or two- to threefold reduction in the number of produced zoosporangia and halve the production of chlamydospores. This phenomenon is associated with the disturbance of pathogen metabolism by phosphite (Grifith et al., 1990; McDonald et al., 2001). Smillie et al (1989b), while testing the effect of phosphites against P. cinnamomi on lupine, P. nicotianae on tobacco and P. palmivora the papaya, also conirmed that a suitable concentration of the phosphite can protect plants against these pathogens. 4. Phosphites used as a stimulator (resistance and growth) Pscheidt and Ocamb (2013) observed that the concentrations of phosphite in plants that managed to protect themselves against infection were lower than these, which were considered to be needed to inhibit the growth of pathogens in vitro and therefore they hypothesised that there are plant defense systems interacting with the phosphites to reduce the growth of pathogens. The activation occurs at the time of contact with the pathogens. In addition, to direct influence on the growth and pathogens, the phosphites reduce the production of suppressors masking the presence of pathogens and thus accelerate the defense responses of plants (Yamada et al. 1989). The contact of plant tissues with pathogens in the presence of phosphites starts the plant defense reactions, for example phytoalexins synthesis in plant cells (Guest, Bompeix 1990). The response of resistant or susceptible plant to infection is similar. The only difference is in the rate of formation of phytoalexins. The resistance mechanisms of the species are hereditary, and after recovering are gradually disappearing. The amount of produced phytoalexins depends on the age of the plant, temperature, oxygen content in the air and quantity of the inoculum (Fig. 2). Further processes occurring in infected cells in the presence of phosphites are: ethylene biosynthesis, the increase of plant resistance to stress conditions, the increase in the activity of phenylalanine lyase and lignin biosynthesis (Guest, Bompeix 1990). The plant is able to isolate infected cells from the others (thanks to phytoalexins), which leads to reducing the spread of disease (Daniel, Guest 2006; Singh et al., 2003). 5. Possibilities of phosphate fertilizers application in forestry Initially, the test results using phosphites were not as good as with the use of phosphoric acid (Maclntire et al. 1950). Until the 1980s, the research on the use of phosphoric acid as a fertilizer in agriculture have been abandoned and focused on the clariication of its impact on improving the growth and health of plants. Because of the above-described characteristics, the phosphites are of great help in reducing the negative effects of soil-borne pathogens, attacking the ine roots of plants. In addition, in a current situation of a limited number of plant protection products approved for use in forestry, the use of phosphite is an important alternative solution in the context of integrated pest management (IPM). The Forest Research Institute on the order of the National Forests successfully completed a series of experiments in nurseries and within the scientiic project EU Life + performed experimental spray-diseased oak stands in the Krotoszyn Plateau (western Poland). Preliminary results are encouraging, and their summary will occur in 2017, after the analysis of the crowns and roots of trees surveyed. If the use of phosphites proves to be a successful method in the experiment, it will attract a particular interest of the foresters to protect valuable adult oak forests, attacked by alien, invasive, pathogenic oomycetes. Conlict of interest The authors declare no potential conflicts. Acknowledgements and source of funding The work was carried out within the framework of the research project Life 11 ENV / E / 459 project acronim-HESOFF “Evaluation of the health state of forests and an effect of phosphate treatments with the use of photovoltaic SLE M. Tkaczyk et al. / Leśne Prace Badawcze, 2016, Vol. 77 (1): 76–81 79 Figure 2. Reaction of a plant cell to Phytophthora spp., without phosphite (a) in the presence of phosphite (b) (Guest, Grant 1991): 1. Some molecules from the disease are recognised directly. 2. Phytophthora disease masks its recognition with suppressors. 3. Recognition fails at host-cell interface. 4. Only a weak signal goes to cell nucleus, this delays the plants defence response. 5. Pathogen is affected by phosphite. 6. Suppressors either under or not produced. 7. Recognition of disease by plant cell. 8. Phosphite encourages defensive molecules, such as phytoalexins and PR proteins, to attack the pathogen directly. 9. Defensive molecules send alarm signals to cells that have not yet been attacked. 10. Polysaccharides strengthen the cell wall adding additional protection. 11. Pathogen is limited or killed by plant response. 80 M. Tkaczyk et al. / Leśne Prace Badawcze, 2016, Vol. 77 (1): 76–81 UAVs inanced by The European Community According To LIFE + program and by the National Fund for Environmental Protection and Water Management in Poland. References Aberton M.J., Wilson B.A., Cahill D.M. 1999. The use of potassium phosphonate to control Phytophthora cinnamomi in native vegetation at Anlesea, Victoria. Australasian Plant Pathology 28: 225–234. DOI 10.1071/AP99037. Amiri A., Holb I.J., Schnabel G. 2009. A new selective medium for the recovery and enumeration of Monilinia fructicola, M. fructigena, and M. laxa from stone fruits. Phytopathology 99: 1199–1208. DOI 10.1094/PHYTO-99-10-1199. Ann P.J., Tsai J.N., Wong I.T., Hsieh T.F., Lin C.Y. 2009. A simple technique, concentration and application schedule from using neutralized phosphorous acid to control Phytophthora diseases. Plant Pathology Bulletin 18: 155–165. vila F.W., Faquin V., Da Silva Lobato A.K., Pereira Baliza D., Marques D.J., Dos Passos A.M.A., Alves Bastos D.E., Silva Guedes E.M. 2012a. Growth, phosphorus status, and nutritional aspect in common bean exposed to different soil phosphate levels and foliar applied phosphorus forms. Scientiic Research and Essays 7: 2195–2204. DOI 10.5897/SRE11.1329. Ávila F.W., Faquin V., Ramos S.J., Pinheiro G.L., Marques D.J., Da Silva Lobato A.K., Ce Oliveira Neto C.F., vila P.A. 2012b. Effects of phosphite and phosphate supply in a weathered tropical soil on biomass yield, phosphorus status and nutrient concentrations in common bean. Journal of Food, Agriculture & Environment 10: 312–317. Barchietto T., Saindrenan P., Bompeix G. 1989. Characterization of phosphonate uptake in two Phytophthora spp. and its inhibition by phosphate. Archives of Microbiology 151: 54–58. DOI 10.1007/BF00444669. Brunings A.M., Liu G., Simonne E.H., Zhang S., Li Y., Datnoff L.E. 2012. Are Phosphorous and Phosphoric Acid Equal Phosphorous Sources for Plant Growth? Florida Cooperative Extension Service HS 1010: 1–7. Coffey M.D., Joseph M.C. 1985. Effects of phosphorous acid and fosetyl-Al on the life cycle of Phytophthora cinnamomi and P. citricola. Phytopathology 75: 1042–1046. DOI 10.1094/ Phyto-75-1042. Daniel R., Guest D. 2006. Defence responses induced by potassium phosphonate in Phytophthora palmivora – challenged Arabidopsis thaliana. Physiological and Molecular Plant Pathology 67: 194–201. DOI 10.1016/j.pmpp.2006.01.003. Davis A.J., Grant B.R. 1996. The effect of phosphonate on the sporulation of Fusarium oxysporum f.sp. cubense. Australasian Plant Pathology 25: 31–35. DOI 10.1071/AP96007. Dobrowolski M.P., Shearer B.L., Colquhoun I.J., O’Brien P.A., Hardy G.E.StJ. 2008. Selection for decreased sensitivity to phosphite in Phytophthora cinnamomi with prolonged use of fungicide. Plant Pathology 57: 928–936. DOI 10.1111/j.1365-3059.2008.01883.x. Fenn M.E., Coffey M.D. 1984. Studies on the in vitro and in vivo antifungal activity of fosetyl – Al and phosphorous acid. Phytopathology 74: 606–611. DOI 10.1094/Phyto-74-606. Fenn M. E., Coffey M. D. 1985. Further evidence for the direct mode of action of fosetyl-Al and phosphorous acid. Phytopathology 75: 1064–1068. Fenn M., Coffey M.D. 1987. Phosphonate fungicides for control of diseases caused by Phytophthora. California Avocado Society, Yearbook 71: 606–611. Grifith J.M., Smille R.H., Gran B.R. 1990. Alterations in nucleotide and pyrophosphate levels in Phytophthora palmivora following exposure to the antifungal potassium phosphonate (phosphite). Journal of General Microbiology 136: 1285– 1291. DOI 10.1099/00221287-136-7-1285. Guest D.I., Bompeix G. 1990. The complex mode of action of phosphonates. Australasian Plant Pathology 19: 113–115. DOI 10.1071/APP9900113. Guest D., Grant B. 1991. The complex action of phosphonates as antifungal agents. Biological Reviews 66: 159–187. DOI 10.1111/j.1469-185X.1991.tb01139.x. Hardy G.E.St.J. 2009. Phosphite and its potential to control P. cinnamomi in natural plant communities and adjacent rehabilitated mine sites in Western Australia, “Phytophthora diseases of forest trees” IUFRO Working Party 7.02.09, Proceedings from the irst international meeting on phytophthoras in forest and wild land ecosystems: 82–86. Hirosse E.H., Creste J.E., Custódio C.C, Machado-Neto N.B. 2012. In vitro growth of sweet potato fed with potassium phosphite. Acta Scientiarum, Agronomy 34: 85–91. DOI 10.4025/ actasciagron.v34i1.10810. Jackson T.J., Burges T., Colquhoun I.J., Hardy G.E.StJ. 2000. Action of the fungicide phosphite on Eucaluptus marginata inoculated with Phytophthora cinnamomi. Plant Pathology 49: 147–154. DOI 10.1046/j.1365-3059.2000.00422.x. Jung T. 2008. Widespread Phytophthora infestations of nursery stock in Central Europe as major pathway of Phytophthora diseases of forests and semi-natural ecosystems. 3rd International Workshop Phytophthora/Pythium and related genera. 9th Congress of Plant Pathology, Turin, Italy, August 24-29.2008. Kelderer M., Matteazzi A., Casera C. 2006. Effects of the period of application of K-phosphite on residues on apple fruits, Ecofruit – 12th International Conference on Cultivation Technique and Phytopathological Problems in Organic Fruit-Growing: Proceedings to the Conference from 31st January to 2nd February 2006 at Weinsberg/Germany: 225–227. Korzeniowski M., Orlikowski L.B. 2008. Ochrona różanecznika przed fytoftorozą (Phytophthora spp.), środkami zawierającymi fosetyl glinowy, propamokarb i fenamidon. Zeszyty Problemowe Postępów Nauk Rolniczych 529: 35–39. Landschoot P., Cook J. 2005. Sorting out the phosphonate products. Golf Course Management 11: 73–77. Lovatt C.J. 1990. Factors affecting fruit set/early fruit drop in avocado. California Avocado Society Yearbooks 74: 193–199. Maclntire W.H., Winterberg S.H., Gardi L.J., Sterges A.J., Clements L.B. 1950. Fertilizer evaluation of certain phosphorus, phosphorous and phosphoric materials by means of pot cultures. Agronomy Journal 42: 543–549. Martin H., Grant B.R., Stehmann C. 1998. Inhibition of inorganic pyrophosphatase by phosphonate – a site of action in Phytophthora spp.? Pesticide Biochemistry and Physiology 61: 65–77. M. Tkaczyk et al. / Leśne Prace Badawcze, 2016, Vol. 77 (1): 76–81 Matheron M.E. 2000. Impact of azoxystrobin, dimethomorph, fluaziam, fosatyl-Al, and metalaxyl on growth, sporulation, and zoospore cyst germination of three Phytophthora spp. Plant Disease 84: 454–458. DOI 10.1094/PDIS.2000.84.4.454. McDonald A.E., Grant B.R., Plaxton W.C. 2001a. Phosphite (phosphorous acid): its relevance in the environment and agriculture, and influence on the plant phosphate starvation. Journal of Plant Nutrition 24: 1505–1519. DOI 10.1081/PLN-100106017. McDonald A.E., Nier J.O., Plaxton C. 2001b. Phosphite disturbs the acclimation of Saccharomyces cerevisiae to phosphate starvation. Canadian Journal of Microbiology 47: 969–978. Moor U., Põldma P., Tõnutare T., Karp K., Starast M., Vool E. 2009. Effect of phosphite fertilization on growth, ield and fruit composition of strawberries. Scientia Horticulturae 119: 264–269. DOI 10.1016/j.scienta.2008.08.005. Muszyńska D., Orlikowski L.B. 2010. Wykorzystanie propamokarbu z fosetylem glinowym w ochronie cyprysika i pelargonii przed Phytophthora cinnamomi i Pythium ultimum. Zeszyty Problemowe Postępów Nauk Rolniczych 554: 113–118. Niere J.O., Grifith J.M., Grant B.R. 1990. 31P NMR studies on the effect of phosphite on Phytophthora palmivora. Journal of General Microbiology 136: 147–156. DOI 10.1099/00221287-136-1-147. Orlikowski L.B. 2004. Chemical control of Rhododendron twig blight caused by Phytophthora ramorum. Journal of Plant Protction Research 44(1): 41–46. Orlikowski L.B. 2006. Ochrona roślin ozdobnych w szkółkach pojemnikowych przed fytoftorozą. Progress in Plant Protection / Postępy w Ochronie Roślin 46 (1): 358–365. Othake H., Wu H., Imazu K., Anbe Y., Kato J., Kuroda A. 1996. Bacterial phosphonate degradation, phosphate oxidation and polyphosphate accumulation. Resources. Conservation and Recycling 18: 125–134. DOI 10.1016/S0921-3449(96)01173-1. Ouimette D.G., Coffey M.D. 1989. Phosponate levels in avocado (Persea americana) seedlings and soil following treatment with fosetyl-Al or potassium phosphonate. Plant Disease 73: 212–215. DOI 10.1094/PD-73-0212. Pankhurst C.E., Hawke B.G., McDonald H.J. 1998. Role of root disease in the poor establishment of Medicago pastures after cereal cropping in South Australia. Plant Pathology 47: 749–758. Pscheidt J.W., Ocamb C.M. 2013. Fungicide theory of use and mode of action. Paciic Northwest Plant Disease Management Handbook. Ratjen A.M., Gerendás J. 2009. A critical assessment of the suitability of phosphite as a source of phosphorous. Journal of Plant Nutrition and Soil Science 172: 821–828. DOI 10.1002/jpln.200800287. Schroetter S., Kreuzig R., Angeles-Wedler D., Schnug E. 2006. Effect of phosphite on phosphorus supply and growth of corn (Zea mays). Landbauforschung Völkenrode 56: 87–99. Singh V.K., Wood S.M., Knowles V.L., Plaxton W.C. 2003. Phosphite accelerates programmed cell death in phosphate-starved oilseed rape (Brassica napus) suspension cell cultures. Planta 218: 233–239. DOI 10.1007/s00425-003-1088-2. Smillie F., Peers S. H., Elderield A. J., Bolton C., Flower R. J. 1989a. Differential regulation by glucocorticoids of intracellular lipocortin I, II and V in rat mixed peritoneal leukocytes. British Journal of Pharmacology 97, 425p. Translated by: Małgorzata Oszako 81 Smillie R., Grant B.R., Guest D. 1989b. The mode of action of phosphite: evidence for both direct and indirect modes of action on three Phytophthora spp. In Plants Phytopathology 79: 921–926. Souli M.C., Malfatti P., Demandre C., Bompeix G., Mon ger R. 1995. Phosphonate inhibition in the biosynthetic pathway of polyunsaturated long chain fatty acids of Phytophthora capsici. Plant Science 105: 53–61. Stöven K., Schroetter S., Panten K., Schnug E. 2007. Effect of phosphite on soil microbial enzyme activity and the feeding activity of soil mesofauna. Landbauforschung Völkenrode 2: 127–131. Thao H.T.B, Yamakawa T., Shibata K., Sarr P.S., Myint A.K. 2008. Growth responded of komatsuna (Brassica rapa var. peruviridis) to root and foliar application of phosphite. Plant Soil 308: 1–10. Thao H.T.B., Yamakawa T. 2009. Phosphite (phosphorous acid): fungicide, fertilizer or bio-stimulator? Soil Science and Plant Nutrition 55: 228–234. DOI 10.1111/j.1747-0765.2009.00365.x. Thao H.T.B, Yamakawa T. 2010. Phosphate absorption of intact komatsuna plants as influences by phosphate. Soil Science and Plant Nutrition 56: 228–234. DOI 10.1111/j.1747-0765.2009.00431.x. Tkaczyk M., Nowakowska J.A, Oszako T. 2014. Nawozy fosforynowe jako stymulatory wzrostu roślin w szkółkach leśnych. Sylwan 158(1): 3–9. Wilkinson C.J., Holmes J.M., Dell B., McComb J.A., Shearer B.L., Colquhoun I.J., Hardy G.E.StJ. 2001a. Effect of Phosphite on in planta zoospore production of Phytophthora cinnamomi. Plant Pathology 50: 587–593. DOI 10.1046/j.1365-3059.2001.00605.x. Wilkinson C.J., Holmes J.M., Tynan K.M., Colquhoun I.J., McComb J.A., Hardy G.E.StJ., Dell B. 2001b. Ability of phosphite applied in a glasshouse trial to control Phytophthora cinnamomi in ive plant species native to Western Australia. Australasian Plant Pathology 30: 343–351. DOI 10.1071/AP01055. Wilkinson C.J., Shearer B.L., Jackson T.J., Hardy G.F.StJ. 2001c. Variation in sensitivity of Western Australian isolates of Phytophthora cinnamomi to phosphite in vitro. Plant Pathology 50: 83–89. DOI 10.1046/j.1365-3059.2001.00539.x. Wojdyła A., Wieczorek W., Świętosławski J. 2010. Nawóz do ochrony róż przed mączniakiem prawdziwym. Progress in Plant Protection / Postępy w Ochronie Roślin 50(1): 402–405. Wojdyła A., Wieczorek W., Świętosławski J. 2011. Nawóz powodujący obniżenie występowania szarej pleśni w roślinach ozdobnych. Progress in Plant Protection / Postępy w Ochronie Roślin 51(3): 1212–1216. Yamada T., Hashimoto H., Shiraishi T., Oku H. 1989. Suppression of pisatin, phenylanine ammonia-lyaes mRNA, and chalcone synthase mRNA accumulation by a putative pathogenicity factor from the fungus Mycosphaerella pinodes. Molecular Plant-Microbe Interaction 2(5): 256–261. DOI 10.1094/MPMI-2-256. Authors’ contribution M.T. – The concept and submitting work to develop text of the article, manuscript preparation, preparation of drawings; K.K., J.A.N., T.O. – The concept and submitting work to develop text of the article; JS – Review of the literature, developing text of the article.