DOI: 10.1007/s10535-014-0398-5
BIOLOGIA PLANTARUM 58 (2): 379-384, 2014
BRIEF COMMUNICATION
Spatial and developmental expression of key genes
of terpene biosynthesis in Tanacetum parthenium
M. MAJDI1,4*, G. KARIMZADEH2, and M.A. MALBOOBI3
Department of Agricultural Biotechnology, University of Kurdistan, Sanandaj, 6617715175, Iran1
Plant Breeding and Biotechnology Department, Faculty of Agriculture, Tarbiat Modares University,
Tehran, 1411713111, Iran2
National Institute of Genetic Engineering and Biotechnology (NIGEB), Tehran, 1497716316, Iran3
Research Center for Medicinal Plant Breeding and Development, Faculty of Agriculture, University of Kurdistan,
Sanandaj, 6617715175, Iran4
Abstract
Feverfew (Tanacetum parthenium) is a medicinal plant belonging to the Asteraceae family. To improve understanding
terpene metabolism in feverfew, the relative gene expression of four key genes coding 3-hydroxy-3-methylglutarylcoenzyme A reductase (HMGR) and germacrene A synthase (GAS) from the mevalonic acid pathway (MVA), as well as
1-deoxy-D-xylulose-5-phosphate reductoisomerase (DXR) and hydroxy-2-methyl-2-(E)-butenyl-4-diphosphate
reductase (HDR) from the methyl erythritol phosphate pathway (MEP), were examined. Target organs and tissues
included young leaves (not fully expanded), mature leaves (fully expanded), flowers, stems, roots, and glandular
trichomes. HMGR, DXR, and HDR were isolated and sequenced for the first time in feverfew. Real-time quantitative
PCR analysis revealed differential expression of these genes in feverfew tissues and developmental stages.
Additional key words: feverfew, mevalonic acid pathway, methylerythritol phosphate pathway, real time PCR.
Feverfew (Tanacetum parthenium) belongs to the
Asteraceae family. It contains diverse terpenes including
pharmaceutically active compounds, such as parthenolide
or costunolide (Palevitch et al. 1997, Liu et al. 2011,
Majdi et al. 2013). The highest amount of parthenolide is
in glandular trichomes, flowers, leaves and stems,
whereas roots do not contain parthenolide (Majdi et al.
2011). In plants, the methylerythritol phosphate (MEP)
pathway in plastids and the mevalonic acid (MVA)
pathway in cytosol are responsible for terpene
biosynthesis (Rohmer et al. 1993, Zeng et al. 2011). Both
pathways produce the universal terpene precursors,
isopentenyl diphosphate (IDP) and its allylic isomer,
dimethylallyl diphosphate (DMADP). The cytosolic
MVA pathway begins by the condensation of three
acetyl-CoA to 3-hydroxy-3-methylglutaryl-CoA (HMGCoA) (Chappell 1995). The plastidic MEP pathway starts
by the condensation of pyruvate and glyceraldehyde-3phosphate to yield 1-deoxy-D-xylulose-5-phosphate
(DXP) (Rohmer et al. 1993). Generally, cytosolic
IDP/DMAPP serve as precursors for farnesyl diphosphate
(FDP, C15) which is converted into sesquiterpenes (C15),
triterpenes (C30), and homoterpenes (C11, C30), whereas
plastidic IDP/DMAPP serve as precursors for geranyl
diphosphate (GDP, C10) and geranylgeranyl diphosphate
(GGDP, C20), which yield monoterpenes (C10, from
GDP), and diterpenes (C20), tetraterpenes (C40), and
prenyl chains (C45) from GGDP (Dudareva et al. 2005).
Submitted 16 July 2013, last revision 20 October 2013, accepted 22 October 2013.
Abbreviations: DMADP - dimethylallyl diphosphate; DXP - 1-deoxy-D-xylulose-5-phosphate; DXR - 1-deoxy-D-xylulose5-phosphate reductoisomerase; FDP - farnesyl diphosphate; GAS - germacrene A synthase; HDR - hydroxy-2-methyl-2-(E)-butenyl4-diphosphate reductase; HMGR - 3-hydroxy-3-methylglutaryl-coenzyme A reductase; IDP - isopentenyl diphosphate;
MEP - methylerythritol phosphate; MVA - mevalonic acid; ORF - open reading frame; RACE - rapid amplification of cDNA ends;
RGE - relative gene expression.
Acknowledgements: This work was financially supported by the University of Kurdistan and the Iran National Science Foundation.
We gratefully thank Claudia Vickers (the Australian Institute for Bioengineering and Nanotechnology, University of Queensland,
Australia) for reading the manuscript and useful comments. Jafar Abdollahzadeh (the Department of Plant Protection, Faculty of
Agriculture, University of Kurdistan, Iran) is acknowledged for phylogenetic analysis.
* Corresponding author: fax: (+98) 8716620553, e-mail address; m.majdi@uok.ac.ir
379
M. MAJDI et al.
In the MVA pathway, HMGR (3-hydroxy-3-methylglutaryl-coenzyme A reductase) is the primary rate limiting enzyme. It catalyses the conversion of HMG-CoA to
MVA (Goldstein and Brown 1990). The first committed
step in the biosynthesis of sesquiterpenes is catalyzed by
sesquiterpene synthases which convert linear FDP to
various circular sesquiterpenes (Chappell 1995, Irmisch
et al. 2012).The first committed step in parthenolide
biosynthesis is catalysed by germacreneA synthase
(GAS) (Majdi et al. 2011).
The first committed step in the MEP pathway is
catalyzed by 1-deoxy-D-xylulose-5-phosphate reductoisomerase (DXR) which irreversibly converts DXP to
2-C-methyl-D-erythritol-4-phosphate (MEP) (Takahashi
et al. 1998).The conversion of 1-hydroxy-2-methyl-2-(E)butenyl-4-diphosphate (HMBDP) into IDP and DMADP
is mediated by 4-hydroxy-3-methylbut-2-enyl-diphosphate reductase (HDR) which is the last step of the MEP
pathway (Cordoba et al. 2009, Huang et al. 2009). A ratelimiting role for HDR has been reported in the
biosynthesis of MEP-derived terpenes (Hsieh and
Goodman 2005).
Two genes encoding the key enzymes of parthenolide
synthesis by the MVA pathway (HMGR and GAS), and
two genes encoding the key enzymes of the MEP
pathway (DXR and HDR) were chosen for our study
focused on examining terpenoid production in feverfew.
TpGAS has been isolated and characterized from feverfew
recently (Majdi et al. 2011), whereas HMGR, DXR, and
HDR genes have not yet been isolated from feverfew.
The objective of the present study was to isolate the latter
three genes and to examine the expression patterns of all
four genes in feverfew tissues, as well as to study their
developmental regulation in immature and mature leaves.
To this aim, a homology-based PCR cloning strategy was
employed for gene isolation followed by quantitative
real-time qPCR analysis to survey their expression
patterns.
Feverfew (Tanacetum parthenium L. Schulz-Bip.)
(2n=2x=18) seeds were obtained from the Zardband
Company, Tehran, Iran. Plants were grown in a growth
chamber with a 16-h photoperiod, a photosynthetic
photon flux density of 320 µmol m-2 s-1 and day/night
temperatures of 24/18 °C. A total RNA extraction and
cDNA synthesis was carried out as described by Majdi
et al. (2011). Sequence alignments of published cDNAs
from the NCBI database (http://www.ncbi.nlm.nih.gov/)
were used to design primers for gene isolation and
specific primer pairs were designed based on the
conserved regions of cDNAs (Table 1). The amplified
fragments were cloned into a pGEM-T Easy vector
(Promega, Madison, USA) and sequenced. 5'-RACE and
3'-RACE were performed using the SMART-RACE cDNA
amplification kit (Clontech, USA). A qPCR was carried
out for gene expression analysis with the iCycler iQ5
system (BioRad, Hercules, USA) using the iQ™ SYBR®
Green Supermix master mix (BioRad) in three biological
and two technical replicates. GAPDH was used as a
housekeeping gene for normalization. The ∆Ct was
calculated according to Livak and Schmittgen (2001). A
two step program was used as follows: annealing at 95 °C
for 3 min; 40 cycles at 95 °C for 10 s, and a final
extension at 55 °C for 30 s. The primer pairs were
designed for qPCR analysis using the Beacon designer
software (BioRad, Table 1). Sequences were compared by
BLAST search in GenBank (http://www.ncbi.nih.gov).
Phylogenetic tree analysis of deduced proteins was
performed with PAUP 4.0b10 (Swofford 2003) using the
maximum parsimony (MP) method with validation by
bootstrapping. Analysis of variance for relative gene
expression (RGE) in different tissues was carried out
based on a completely randomized design with
3 replications. Mean comparisons were conducted with
the Duncan’s test using the SPSS v. 18 software (SPSS,
Chicago, USA).
The 3' and 5' rapid amplification of cDNA ends
(RACE) led to the full length isolation of TpHMGR
(Gene Bank Accession No. JN005887.1), TpDXR (Gene
Bank Accession No. AER00470), and TpHDR (Gene
Bank Accession No. JN005889). A BLAST search in
GenBank revealed that TpHMGR, TpDXR, and TpHDR
had the highest similarity with their orthologues from
Artemisia annua, another closely related plant species
from the Asteraceae, with 91 % (HMGR), 98 % (DXR),
and 93 % (HDR) similarity (data not shown).
Phylogenetic analysis of each deduced protein with
corresponding proteins from other plant species using
PAUP 4.0b10 showed that TpHMGR, TpDXR, and
TpHDR also shared the highest similarity with their
A. annua homologues (Fig. 1A-C). Deduced proteins
including HMGR, DXR, and HDR from T. parthenium
and A. annua were in the same cluster and had the
Table 1. Primer pairs used to clone HMGR, DXR, and IDS in T. parthenium, and nucleotide sequences of the primers used in qPCR.
Cloning
qPCR
380
Gene
Forward 5’- 3’
Reverse 5’- 3’
HMGR
DXR
HDR
GAPDH
HMGR
GAS
DXR
HDR
AATGAACATGGTGTCAAAGGG
GCCACACTTTTCAACAAGGG
TCGATACAACATGCCCATGGG
GTTGACTTGACTGTGAGACTTGAG
CTTCCATAGAGGTTGGCACAGTTG
TGCTATCTCGGGTACTTTCAAGG
CTAATGTCACACTTCTTGCGGAAC
CTGAGTGGCGTCACAGATGG
CACCAGCCAACACCGAACC
ACGAGCAACCTCAACAACAC
GTCGCTCCTGAGTGGCGTCAC
CCTTGAGGTTGCCTTCGGATTC
GAGCGTTTGAGCCTGGTGATTC
TTCTCCTCTTATTCTCAACTGTGC
TGTAATCGGAACCAGCCAAAGC
GAAGGGAGAAACAGAGGAGATAGG
KEY GENES IN TERPENE BIOSYNTHESIS
Fig 1. Phylogenic tree analysis of TpHMGR (A),
TpDXR (B), and TpHDR (C) with orthologues
from other plant species using PAUP 4.0b10 for
maximum parsimony and bootstrap analysis.
The numbers on the branches represent bootstrap
support for 1 000 replicates. Bar = 10 changes.
381
M. MAJDI et al.
Table 2. The relative gene expression (RGE) of TpHMGR, TpGAS, TpDXR, and TpHDR in different tissues of Tanacetum
parthenium. Real time qPCR was based on the Ct values. The Ct value for each sample was normalized using the housekeeping gene
GAPDH. Means SE, n = 3. Different letters in each row marked significant (P < 0.05) differences among tissues according to the
Duncan’s test. nd - not detected.
Gene
Young leaves
Old leaves
Flowers
Stems
Roots
Trichomes
HMGR
GAS
DXR
HDR
0.33 0.026b
0.46 0.025c
0.10 0.009b
0.49 0.039c
0.18 0.012c
0.01 0.001d
0.08 0.006b
2.70 0.513a
0.61 0.046a
1.67 0.094b
0.40 0.023a
1.12 0.086c
0.20 0.021c
nd
nd
0.13 0.032d
0.07 0.006d
nd
0.02 0.001c
0.06 0.006e
0.64 0.017a
16.33 1.299a
0.60 0.049a
1.55 0.032b
shortest evolutionary distance from each other. A similar
trend was observed for TpGAS, the previously isolated
gene (Majdi et al. 2011). In addition, the multiple
sequence alignment of TpHMGR, TpDXR, and TpHDR
with some homologues from other plant species using
ClustalW (http://www2.ebi.ac.uk/clustalw) showed a
relatively high conservation among plant species (data
not shown) which most likely underlies their key roles in
biology. The highest sequence similarity between
T. parthenium and A. annua for all the isolated genes
suggests that publicly available sequence databases, e.g.,
glandular trichome ESTs from A. annua (Wang et al.
2009) might be a useful tool for isolating orthologues
from T. parthenium.
ANOVA analysis shows that the expression of
TpHMGR, TpGAS, TpDXR, and TpHDR in feverfew
significantly differed among tissues (P < 0.05; Table 2).
The highest expression of TpHMGR was detected in
flowers and glandular trichomes, followed by young
leaves, old leaves, stems, and roots. Nevertheless, the
RGE values for TpHMGR in all examined tissues were
relatively low (0.07 - 0.64). No significant difference was
observed for RGE of TpHMGR in flowers and glandular
trichomes. A low constitutive expression of HMGR has
been also reported in snapdragon tissues (Dudareva et al.
2005). Arabidopsis contains two differentially expressed
HMGR genes, HMGR1 and HMGR2. HMGR1 is
expressed in all tissues with the highest expression in
roots and flowers, whereas the expression of HMGR2 is
limited to roots and flowers (Enjuto et al. 1994). The
TpHMGR transcription was lower in old leaves compared
to young leaves (Table 2). The higher expression of
TpHMGR in glandular trichomes and young leaves is
consistent with the high activity of parthenolide
biosynthesis in these tissues relative to the activity in
stems, roots, and old leaves. Consistent with our results, a
correlation between the HMGR expression and
production of artemisinin (an endoperoxide sesquiterpene
lactone) has been reported in A. annua tissues (Ram et al.
2010, Olofsson et al. 2011). The highest expression of
TpGAS was detected in glandular trichomes, followed by
young leaves, flowers, and old leaves; it was not
expressed in stems and roots (Table 2). The transcription
of TpGAS was extremely high in glandular trichomes
(RGE = 16) compared with other tissues (RGE less than
1.67). The TpGAS expression patterns show its spatial
382
and developmental regulation (Table 2). The presence
and absence of the TpGAS expression is also well
coordinated with the presence and absence of
parthenolide production in the tissues examined. By far,
the highest expression was observed in glandular
trichomes, known to be the active site of parthenolide
biosynthesis, whereas no expression was detected in roots
which do not contain parthenolide (Majdi et al. 2011). An
apparent decrease in the expression of TpGAS in old
leaves compared with young leaves might be related to
density of glandular trichomes. In line with this idea, in
A. annua, young leaves show a higher trichome density
and produce a higher amount of artemisinin than do old
leaves (Arsenault et al. 2010). It has been shown that
glandular trichome densities in young leaves is much
higher than in fully expanded leaves because the original
number of trichomes spreads out in over the larger
surface area during leaf expansion, e.g., in A. annua
(Olofsson et al. 2011). Changes in the expression of
TpGAS during feverfew flowering has been reported
previously. This indicates that developmental regulation
of TpGAS exists both in leaves and flowers (Majdi et al.
2011). In agreement with our results, the expression
analysis of two sesquiterpene synthases in A. annua,
including amorpha-4,11-diene synthase (AaADS) the
first committed step of artemisinin biosynthesis and
germacrene A synthase (AaGAS) shows a similar pattern
with the TpGAS expression in young and old leaves
(Olofsson et al. 2011). Both of these terpenoids are
produced in glandular trichomes. The highest expression
of TpDXR was detected in glandular trichomes, followed
by flowers, young leaves, old leaves, and roots, whereas
no TpDXR expression was detected in stems (Table 2). In
A. annua and A. thaliana, DXR expressions show a
similar pattern: it is higher in flowers than in stems or
roots (Carretero-Paulet et al. 2001, Olofsson et al. 2011).
The developmental regulation of DXR has been reported
in Arabidopsis (Carretero-Paulet et al. 2006), but in the
current study, the constitutive gene expression was
detected for TpDXR in young and old leaves (Table 2). In
tomato, a constitutive expression of DXR has been
reported in ripening fruit (Rodríguez-Concepcion et al.
2001). Also in snapdragon flowers, a DXR gene
expression does not show a diurnal pattern despite that
the biosynthesis and emission of MEP-derived isoprenoid
volatiles do show a diurnal pattern (Dudareva et al.
KEY GENES IN TERPENE BIOSYNTHESIS
2005). TpHDR was expressed in all tissues. The high
expression was found in old leaves, followed by
glandular trichomes, flowers, young leaves, stems, and
roots (Table 2). The TpHMGR and TpGAS expressions
were 1.8 and 38 fold higher in young leaves than in old
leaves, respectively, conversely to the TpHDR gene
expression which was 5.5 fold higher in old leaves than
in young leaves (Table 2). In Arabidopsis and Oncidium,
a HDR expression is also detected in all tissues (Huang
et al. 2009), and transcription is lowest in roots and
highest in flowers (Hsieh and Goodman 2005, Huang et
al. 2009). An interesting observation in our study was the
dramatic up-regulation of TpHDR in old leaves compared
with young leaves. In A. annua, an expression of HDR is
higher in old leaves than other tissues (Olofsson et al.
2011), a similar pattern to what we observed in
T. parthenium. Consistent with this, an up-regulation of
HDR during tomato ripening has been reported (Lois
et al. 2000).
In conclusion, TpHMGR, TpDXR, and TpHDR were
expressed in all tissues, whereas TpGAS was not
expressed in stems and roots. TpHMGR and TpGAS,
which both belong to the MVA pathway, were downregulated in old leaves compared to young leaves,
whereas TpHDR belonging to the MEP pathway was upregulated in old leaves. TpDXR did not show
developmental changes in transcription in feverfew
leaves. Except for TpHDR, which was highly expressed
in old leaves, other genes were highly expressed in
glandular trichomes and flowers (the active tissues of
parthenolide biosynthesis). Phylogenetic and sequence
similarity analyses of the isolated genes from feverfew
with homologues from other plant species show that the
shortest evolutionary distance exists between them and
their homologues from A. annua. Beside this, a similar
trend was observed for expression patterns of isolated
genes in different tissues of T. parthenium and A. annua
indicating that the function of the pathways is conserved
between the two species. These results suggest that
molecular information from A. annua can be used to help
pave the way towards terpene biosynthesis elucidation in
T. parthenium.
References
Arsenault, P.R., Vail. D., Wobbe, K.K., Erickson, K., Weathers,
P.J.: Reproductive development modulates gene expression
and metabolite levels with possible feedback inhibition of
artemisinin in Artemisia annua. - Plant Physiol. 154: 958968, 2010.
Carretero-Paulet, L., Ahumada, I., Cunillera, N., RodríguezConcepción, M., Ferrer, A., Boronat, A., Campos, N.:
Expression and molecular analysis of the Arabidopsis DXR
gene encoding 1-deoxy-D-xylulose-5-phosphate reductoisomerase, the first committed enzyme of the 2-C-methylD-erythritol 4-phosphate pathway. - Plant Physiol. 129:
1581-1591, 2001.
Carretero-Paulet, L., Cairó, A., Botella-Pavía, P., Besumbes, O.,
Campos, N., Boronat, A., Rodríguez-Concepción, M.:
Enhanced flux through the methylerythritol 4-phosphate
pathway
in
Arabidopsis
plants
overexpressing
deoxyxylulose 5-phosphate reductoisomerase. - Plant mol.
Biol. 62: 683-695, 2006.
Chappell, J.: Biochemistry and molecular biology of the
isoprenoid biosynthetic pathway in plants. - Annu. Rev.
Plant Physiol. Plant mol. Biol. 46: 521-547, 1995.
Cordoba, E., Salmi, M., León, P.: Unraveling the regulatory
mechanisms that modulate the MEP pathway in higher
plants. - J. exp. Bot. 60: 2933-2943, 2009.
Dudareva, N., Andersson, S., Orlova, I., Gatto, N., Reichelt, M.,
Rhodes, D., Boland, W., Gershenzon, J.: The nonmevalonate pathway supports both monoterpene and sesquiterpene formation in snapdragon flowers. - Proc. nat. Acad.
Sci. USA 102: 933-938, 2005.
Enjuto, M., Balcells, L., Campos, N., Caellest, C., Arro, M.,
Boronat, A.: Arabidopsis thaliana contains two
differentially expressed 3-hydroxy-3-methylglutaryl-CoA
reductase genes, which encode microsomal forms of the
enzyme. - Proc. nat. Acad. Sci. USA 91: 927-931, 1994.
Goldstein, J.L., Brown, M.S.: Regulation of the mevalonate
pathway. - Nature 343: 425-430, 1990.
Hsieh, M.H., Goodman, H.M.: The Arabidopsis IspH homolog
is involved in the plastid nonmevalonate pathway of
isoprenoid biosynthesis. - Plant Physiol. 138: 641-653,
2005.
Huang, J.Z., Cheng, T.C., Wen, P.J., Hsieh, M.H., Chen, F.C.:
Molecular characterization of the Oncidium orchid HDR
gene encoding 1-hydroxy-2-methyl-2-(E)-butenyl 4-diphosphate reductase, the last step of the methylerythritol
phosphate pathway. - Plant Cell Rep. 28: 1475-1486, 2009.
Irmisch, S., Krause, S.T., Kunert, G., Gershenzon, J.,
Degenhardt, J., Köllner, T.G.: The organ-specific
expression of terpene synthase genes contributes to the
terpene hydrocarbon composition of chamomile essential
oils. - BMC Plant Biol. 12: 84, 2012.
Liu, Q., Majdi, M., Cankar, K., Goedbloed, M., Charnikhova,
T., Verstappen, F., De Vos, R., Beekwilder, J., Van der
Krol, S., Bouwmeester, H.: Reconstitution of the
costunolide biosynthetic pathway in yeast and Nicotiana
benthamiana. - PLoS ONE 8:1-12, 2011.
Livak, K.J., Schmittgen, T.D.: Analysis of relative gene
expression data using real-time quantitative PCR and the
2(T)(-∆∆C) method. - Methods 25: 402-408, 2001.
Lois, L.M., Rodríguez-Concepción, M., Gallego, F., Campos,
N., Boronat, A.: Carotenoid biosynthesis during tomato fruit
development: regulatory role of 1-deoxy-D-xylulose
5-phosphate synthase. - Plant J. 22: 503-513, 2000.
Majdi, M., Charnikhova, T., Bouwmeester, H.: Genetical,
developmental and spatial factors influencing parthenolide
and its precursor costunolide in feverfew (Tanacetum
parthenium L. Schulz Bip.). - Ind. Crops Prod. 47: 270-276,
2013.
Majdi, M., Liu, Q., Karimzadeh, G., Malboobi, M.A.,
Beekwilder, J., Cankar, K., De Vos, R., Todorovic, S.,
Simonovic, A., Bouwmeester, H.: Biosynthesis and
localization of parthenolide in glandular trichomes of
feverfew (Tanacetum parthenium L. Schulz Bip.). Phytochemistry 72: 1739-1750, 2011.
Olofsson, L., Engstrom, A., Lundgren, A., Brodelius, P.E.:
Relative expression of genes of terpene metabolism in
383
M. MAJDI et al.
different tissues of Artemisia annua L. - BMC Plant Biol.
11: 45, 2011.
Palevitch, D., Earon, G., Carasso, R.: Feverfew (Tanacetum
parthenium) as a prophylactic treatment for migraine: a
double-blind placebo-controlled study. - Phytother. Res. 11:
508-511, 1997.
Ram, M., Khan, M.A., Jha, P., Khan, S., Kiran, U., Ahmad,
M.M., Javed, S., Abdin, M.Z.: HMG-CoA reductase limits
artemisinin biosynthesis and accumulation in Artemisia
annua L. plants. - Acta Physiol. Plant. 32: 859-866, 2010.
Rodríguez-Concepción, M., Ahumada, I., Diez-Juez, E., SauretGueto, S., Lois, L.M., Gallego, F., Carretero-Paulet, L.,
Campos, N., Boronat, A.: 1-deoxy-D-xylulose 5-phosphate
reductoisomerase and plastid isoprenoid biosynthesis during
tomato fruit ripening. - Plant J. 27: 213-222, 2001.
Rohmer, M., Knani, M., Simonin, P., Sutter, B., Sahm, H.:
Isoprenoid biosynthesis in bacteria: a novel pathway for the
early steps leading to isopentenyldiphosphate. - Biochem. J.
384
295: 517-524, 1993.
Takahashi, S., Kuzuyama, T., Watanabe, H., Seto, H.: A 1deoxy-D-xylulose 5-phosphate reductoisomerase catalyzing
the formation of 2-C-methyl-D-erythritol 4-phosphate in an
alternative nonmevalonate pathway for terpenoid
biosynthesis. - Proc. nat. Acad. Sci. USA 95: 9879-9884,
1998.
Swofford, D.L.: PAUP: Phylogenetic Analysis Using
Parsimony (and Other Methods). Version 4.0b 10. - Sinauer
Associates, Sunderland 2003.
Wang, W., Wang, Y., Zhang, Q., Qi, Y., Guo, D.: Global
characterization of Artemisia annua glandular trichome
transcriptome using 454 pyrosequencing. - BMC Genomics
10: 465, 2009.
Zeng, Q.P., Zeng, X.M., Yang, R.Y., Yang, X.Q.: Singlet
oxygen as a signaling transducer for modulating artemisinin
biosynthetic genes in Artemisia annua. - Biol. Plant. 55:
669-674, 2011.