Majdi et al., Biol Plant, 2014.pdf

DOI: 10.1007/s10535-014-0398-5 BIOLOGIA PLANTARUM 58 (2): 379-384, 2014 BRIEF COMMUNICATION Spatial and developmental expression of key genes of terpene biosynthesis in Tanacetum parthenium M. MAJDI1,4*, G. KARIMZADEH2, and M.A. MALBOOBI3 Department of Agricultural Biotechnology, University of Kurdistan, Sanandaj, 6617715175, Iran1 Plant Breeding and Biotechnology Department, Faculty of Agriculture, Tarbiat Modares University, Tehran, 1411713111, Iran2 National Institute of Genetic Engineering and Biotechnology (NIGEB), Tehran, 1497716316, Iran3 Research Center for Medicinal Plant Breeding and Development, Faculty of Agriculture, University of Kurdistan, Sanandaj, 6617715175, Iran4 Abstract Feverfew (Tanacetum parthenium) is a medicinal plant belonging to the Asteraceae family. To improve understanding terpene metabolism in feverfew, the relative gene expression of four key genes coding 3-hydroxy-3-methylglutarylcoenzyme A reductase (HMGR) and germacrene A synthase (GAS) from the mevalonic acid pathway (MVA), as well as 1-deoxy-D-xylulose-5-phosphate reductoisomerase (DXR) and hydroxy-2-methyl-2-(E)-butenyl-4-diphosphate reductase (HDR) from the methyl erythritol phosphate pathway (MEP), were examined. Target organs and tissues included young leaves (not fully expanded), mature leaves (fully expanded), flowers, stems, roots, and glandular trichomes. HMGR, DXR, and HDR were isolated and sequenced for the first time in feverfew. Real-time quantitative PCR analysis revealed differential expression of these genes in feverfew tissues and developmental stages. Additional key words: feverfew, mevalonic acid pathway, methylerythritol phosphate pathway, real time PCR.  Feverfew (Tanacetum parthenium) belongs to the Asteraceae family. It contains diverse terpenes including pharmaceutically active compounds, such as parthenolide or costunolide (Palevitch et al. 1997, Liu et al. 2011, Majdi et al. 2013). The highest amount of parthenolide is in glandular trichomes, flowers, leaves and stems, whereas roots do not contain parthenolide (Majdi et al. 2011). In plants, the methylerythritol phosphate (MEP) pathway in plastids and the mevalonic acid (MVA) pathway in cytosol are responsible for terpene biosynthesis (Rohmer et al. 1993, Zeng et al. 2011). Both pathways produce the universal terpene precursors, isopentenyl diphosphate (IDP) and its allylic isomer, dimethylallyl diphosphate (DMADP). The cytosolic  MVA pathway begins by the condensation of three acetyl-CoA to 3-hydroxy-3-methylglutaryl-CoA (HMGCoA) (Chappell 1995). The plastidic MEP pathway starts by the condensation of pyruvate and glyceraldehyde-3phosphate to yield 1-deoxy-D-xylulose-5-phosphate (DXP) (Rohmer et al. 1993). Generally, cytosolic IDP/DMAPP serve as precursors for farnesyl diphosphate (FDP, C15) which is converted into sesquiterpenes (C15), triterpenes (C30), and homoterpenes (C11, C30), whereas plastidic IDP/DMAPP serve as precursors for geranyl diphosphate (GDP, C10) and geranylgeranyl diphosphate (GGDP, C20), which yield monoterpenes (C10, from GDP), and diterpenes (C20), tetraterpenes (C40), and prenyl chains (C45) from GGDP (Dudareva et al. 2005). Submitted 16 July 2013, last revision 20 October 2013, accepted 22 October 2013. Abbreviations: DMADP - dimethylallyl diphosphate; DXP - 1-deoxy-D-xylulose-5-phosphate; DXR - 1-deoxy-D-xylulose5-phosphate reductoisomerase; FDP - farnesyl diphosphate; GAS - germacrene A synthase; HDR - hydroxy-2-methyl-2-(E)-butenyl4-diphosphate reductase; HMGR - 3-hydroxy-3-methylglutaryl-coenzyme A reductase; IDP - isopentenyl diphosphate; MEP - methylerythritol phosphate; MVA - mevalonic acid; ORF - open reading frame; RACE - rapid amplification of cDNA ends; RGE - relative gene expression. Acknowledgements: This work was financially supported by the University of Kurdistan and the Iran National Science Foundation. We gratefully thank Claudia Vickers (the Australian Institute for Bioengineering and Nanotechnology, University of Queensland, Australia) for reading the manuscript and useful comments. Jafar Abdollahzadeh (the Department of Plant Protection, Faculty of Agriculture, University of Kurdistan, Iran) is acknowledged for phylogenetic analysis. * Corresponding author: fax: (+98) 8716620553, e-mail address; m.majdi@uok.ac.ir 379 M. MAJDI et al. In the MVA pathway, HMGR (3-hydroxy-3-methylglutaryl-coenzyme A reductase) is the primary rate limiting enzyme. It catalyses the conversion of HMG-CoA to MVA (Goldstein and Brown 1990). The first committed step in the biosynthesis of sesquiterpenes is catalyzed by sesquiterpene synthases which convert linear FDP to various circular sesquiterpenes (Chappell 1995, Irmisch et al. 2012).The first committed step in parthenolide biosynthesis is catalysed by germacreneA synthase (GAS) (Majdi et al. 2011). The first committed step in the MEP pathway is catalyzed by 1-deoxy-D-xylulose-5-phosphate reductoisomerase (DXR) which irreversibly converts DXP to 2-C-methyl-D-erythritol-4-phosphate (MEP) (Takahashi et al. 1998).The conversion of 1-hydroxy-2-methyl-2-(E)butenyl-4-diphosphate (HMBDP) into IDP and DMADP is mediated by 4-hydroxy-3-methylbut-2-enyl-diphosphate reductase (HDR) which is the last step of the MEP pathway (Cordoba et al. 2009, Huang et al. 2009). A ratelimiting role for HDR has been reported in the biosynthesis of MEP-derived terpenes (Hsieh and Goodman 2005). Two genes encoding the key enzymes of parthenolide synthesis by the MVA pathway (HMGR and GAS), and two genes encoding the key enzymes of the MEP pathway (DXR and HDR) were chosen for our study focused on examining terpenoid production in feverfew. TpGAS has been isolated and characterized from feverfew recently (Majdi et al. 2011), whereas HMGR, DXR, and HDR genes have not yet been isolated from feverfew. The objective of the present study was to isolate the latter three genes and to examine the expression patterns of all four genes in feverfew tissues, as well as to study their developmental regulation in immature and mature leaves. To this aim, a homology-based PCR cloning strategy was employed for gene isolation followed by quantitative real-time qPCR analysis to survey their expression patterns. Feverfew (Tanacetum parthenium L. Schulz-Bip.) (2n=2x=18) seeds were obtained from the Zardband Company, Tehran, Iran. Plants were grown in a growth chamber with a 16-h photoperiod, a photosynthetic photon flux density of 320 µmol m-2 s-1 and day/night temperatures of 24/18 °C. A total RNA extraction and cDNA synthesis was carried out as described by Majdi et al. (2011). Sequence alignments of published cDNAs from the NCBI database (http://www.ncbi.nlm.nih.gov/) were used to design primers for gene isolation and specific primer pairs were designed based on the conserved regions of cDNAs (Table 1). The amplified fragments were cloned into a pGEM-T Easy vector (Promega, Madison, USA) and sequenced. 5'-RACE and 3'-RACE were performed using the SMART-RACE cDNA amplification kit (Clontech, USA). A qPCR was carried out for gene expression analysis with the iCycler iQ5 system (BioRad, Hercules, USA) using the iQ™ SYBR® Green Supermix master mix (BioRad) in three biological and two technical replicates. GAPDH was used as a housekeeping gene for normalization. The ∆Ct was calculated according to Livak and Schmittgen (2001). A two step program was used as follows: annealing at 95 °C for 3 min; 40 cycles at 95 °C for 10 s, and a final extension at 55 °C for 30 s. The primer pairs were designed for qPCR analysis using the Beacon designer software (BioRad, Table 1). Sequences were compared by BLAST search in GenBank (http://www.ncbi.nih.gov). Phylogenetic tree analysis of deduced proteins was performed with PAUP 4.0b10 (Swofford 2003) using the maximum parsimony (MP) method with validation by bootstrapping. Analysis of variance for relative gene expression (RGE) in different tissues was carried out based on a completely randomized design with 3 replications. Mean comparisons were conducted with the Duncan’s test using the SPSS v. 18 software (SPSS, Chicago, USA). The 3' and 5' rapid amplification of cDNA ends (RACE) led to the full length isolation of TpHMGR (Gene Bank Accession No. JN005887.1), TpDXR (Gene Bank Accession No. AER00470), and TpHDR (Gene Bank Accession No. JN005889). A BLAST search in GenBank revealed that TpHMGR, TpDXR, and TpHDR had the highest similarity with their orthologues from Artemisia annua, another closely related plant species from the Asteraceae, with 91 % (HMGR), 98 % (DXR), and 93 % (HDR) similarity (data not shown). Phylogenetic analysis of each deduced protein with corresponding proteins from other plant species using PAUP 4.0b10 showed that TpHMGR, TpDXR, and TpHDR also shared the highest similarity with their A. annua homologues (Fig. 1A-C). Deduced proteins including HMGR, DXR, and HDR from T. parthenium and A. annua were in the same cluster and had the Table 1. Primer pairs used to clone HMGR, DXR, and IDS in T. parthenium, and nucleotide sequences of the primers used in qPCR. Cloning qPCR 380 Gene Forward 5’- 3’ Reverse 5’- 3’ HMGR DXR HDR GAPDH HMGR GAS DXR HDR AATGAACATGGTGTCAAAGGG GCCACACTTTTCAACAAGGG TCGATACAACATGCCCATGGG GTTGACTTGACTGTGAGACTTGAG CTTCCATAGAGGTTGGCACAGTTG TGCTATCTCGGGTACTTTCAAGG CTAATGTCACACTTCTTGCGGAAC CTGAGTGGCGTCACAGATGG CACCAGCCAACACCGAACC ACGAGCAACCTCAACAACAC GTCGCTCCTGAGTGGCGTCAC CCTTGAGGTTGCCTTCGGATTC GAGCGTTTGAGCCTGGTGATTC TTCTCCTCTTATTCTCAACTGTGC TGTAATCGGAACCAGCCAAAGC GAAGGGAGAAACAGAGGAGATAGG KEY GENES IN TERPENE BIOSYNTHESIS Fig 1. Phylogenic tree analysis of TpHMGR (A), TpDXR (B), and TpHDR (C) with orthologues from other plant species using PAUP 4.0b10 for maximum parsimony and bootstrap analysis. The numbers on the branches represent bootstrap support for 1 000 replicates. Bar = 10 changes. 381 M. MAJDI et al. Table 2. The relative gene expression (RGE) of TpHMGR, TpGAS, TpDXR, and TpHDR in different tissues of Tanacetum parthenium. Real time qPCR was based on the Ct values. The Ct value for each sample was normalized using the housekeeping gene GAPDH. Means  SE, n = 3. Different letters in each row marked significant (P < 0.05) differences among tissues according to the Duncan’s test. nd - not detected. Gene Young leaves Old leaves Flowers Stems Roots Trichomes HMGR GAS DXR HDR 0.33  0.026b 0.46  0.025c 0.10  0.009b 0.49  0.039c 0.18  0.012c 0.01  0.001d 0.08  0.006b 2.70  0.513a 0.61  0.046a 1.67  0.094b 0.40  0.023a 1.12  0.086c 0.20  0.021c nd nd 0.13  0.032d 0.07  0.006d nd 0.02  0.001c 0.06  0.006e 0.64  0.017a 16.33  1.299a 0.60  0.049a 1.55  0.032b shortest evolutionary distance from each other. A similar trend was observed for TpGAS, the previously isolated gene (Majdi et al. 2011). In addition, the multiple sequence alignment of TpHMGR, TpDXR, and TpHDR with some homologues from other plant species using ClustalW (http://www2.ebi.ac.uk/clustalw) showed a relatively high conservation among plant species (data not shown) which most likely underlies their key roles in biology. The highest sequence similarity between T. parthenium and A. annua for all the isolated genes suggests that publicly available sequence databases, e.g., glandular trichome ESTs from A. annua (Wang et al. 2009) might be a useful tool for isolating orthologues from T. parthenium. ANOVA analysis shows that the expression of TpHMGR, TpGAS, TpDXR, and TpHDR in feverfew significantly differed among tissues (P < 0.05; Table 2). The highest expression of TpHMGR was detected in flowers and glandular trichomes, followed by young leaves, old leaves, stems, and roots. Nevertheless, the RGE values for TpHMGR in all examined tissues were relatively low (0.07 - 0.64). No significant difference was observed for RGE of TpHMGR in flowers and glandular trichomes. A low constitutive expression of HMGR has been also reported in snapdragon tissues (Dudareva et al. 2005). Arabidopsis contains two differentially expressed HMGR genes, HMGR1 and HMGR2. HMGR1 is expressed in all tissues with the highest expression in roots and flowers, whereas the expression of HMGR2 is limited to roots and flowers (Enjuto et al. 1994). The TpHMGR transcription was lower in old leaves compared to young leaves (Table 2). The higher expression of TpHMGR in glandular trichomes and young leaves is consistent with the high activity of parthenolide biosynthesis in these tissues relative to the activity in stems, roots, and old leaves. Consistent with our results, a correlation between the HMGR expression and production of artemisinin (an endoperoxide sesquiterpene lactone) has been reported in A. annua tissues (Ram et al. 2010, Olofsson et al. 2011). The highest expression of TpGAS was detected in glandular trichomes, followed by young leaves, flowers, and old leaves; it was not expressed in stems and roots (Table 2). The transcription of TpGAS was extremely high in glandular trichomes (RGE = 16) compared with other tissues (RGE less than 1.67). The TpGAS expression patterns show its spatial 382 and developmental regulation (Table 2). The presence and absence of the TpGAS expression is also well coordinated with the presence and absence of parthenolide production in the tissues examined. By far, the highest expression was observed in glandular trichomes, known to be the active site of parthenolide biosynthesis, whereas no expression was detected in roots which do not contain parthenolide (Majdi et al. 2011). An apparent decrease in the expression of TpGAS in old leaves compared with young leaves might be related to density of glandular trichomes. In line with this idea, in A. annua, young leaves show a higher trichome density and produce a higher amount of artemisinin than do old leaves (Arsenault et al. 2010). It has been shown that glandular trichome densities in young leaves is much higher than in fully expanded leaves because the original number of trichomes spreads out in over the larger surface area during leaf expansion, e.g., in A. annua (Olofsson et al. 2011). Changes in the expression of TpGAS during feverfew flowering has been reported previously. This indicates that developmental regulation of TpGAS exists both in leaves and flowers (Majdi et al. 2011). In agreement with our results, the expression analysis of two sesquiterpene synthases in A. annua, including amorpha-4,11-diene synthase (AaADS)  the first committed step of artemisinin biosynthesis  and germacrene A synthase (AaGAS) shows a similar pattern with the TpGAS expression in young and old leaves (Olofsson et al. 2011). Both of these terpenoids are produced in glandular trichomes. The highest expression of TpDXR was detected in glandular trichomes, followed by flowers, young leaves, old leaves, and roots, whereas no TpDXR expression was detected in stems (Table 2). In A. annua and A. thaliana, DXR expressions show a similar pattern: it is higher in flowers than in stems or roots (Carretero-Paulet et al. 2001, Olofsson et al. 2011). The developmental regulation of DXR has been reported in Arabidopsis (Carretero-Paulet et al. 2006), but in the current study, the constitutive gene expression was detected for TpDXR in young and old leaves (Table 2). In tomato, a constitutive expression of DXR has been reported in ripening fruit (Rodríguez-Concepcion et al. 2001). Also in snapdragon flowers, a DXR gene expression does not show a diurnal pattern despite that the biosynthesis and emission of MEP-derived isoprenoid volatiles do show a diurnal pattern (Dudareva et al. KEY GENES IN TERPENE BIOSYNTHESIS 2005). TpHDR was expressed in all tissues. The high expression was found in old leaves, followed by glandular trichomes, flowers, young leaves, stems, and roots (Table 2). The TpHMGR and TpGAS expressions were 1.8 and 38 fold higher in young leaves than in old leaves, respectively, conversely to the TpHDR gene expression which was 5.5 fold higher in old leaves than in young leaves (Table 2). In Arabidopsis and Oncidium, a HDR expression is also detected in all tissues (Huang et al. 2009), and transcription is lowest in roots and highest in flowers (Hsieh and Goodman 2005, Huang et al. 2009). An interesting observation in our study was the dramatic up-regulation of TpHDR in old leaves compared with young leaves. In A. annua, an expression of HDR is higher in old leaves than other tissues (Olofsson et al. 2011), a similar pattern to what we observed in T. parthenium. Consistent with this, an up-regulation of HDR during tomato ripening has been reported (Lois et al. 2000). In conclusion, TpHMGR, TpDXR, and TpHDR were expressed in all tissues, whereas TpGAS was not expressed in stems and roots. TpHMGR and TpGAS, which both belong to the MVA pathway, were downregulated in old leaves compared to young leaves, whereas TpHDR belonging to the MEP pathway was upregulated in old leaves. TpDXR did not show developmental changes in transcription in feverfew leaves. Except for TpHDR, which was highly expressed in old leaves, other genes were highly expressed in glandular trichomes and flowers (the active tissues of parthenolide biosynthesis). Phylogenetic and sequence similarity analyses of the isolated genes from feverfew with homologues from other plant species show that the shortest evolutionary distance exists between them and their homologues from A. annua. Beside this, a similar trend was observed for expression patterns of isolated genes in different tissues of T. parthenium and A. annua indicating that the function of the pathways is conserved between the two species. These results suggest that molecular information from A. annua can be used to help pave the way towards terpene biosynthesis elucidation in T. parthenium. References Arsenault, P.R., Vail. D., Wobbe, K.K., Erickson, K., Weathers, P.J.: Reproductive development modulates gene expression and metabolite levels with possible feedback inhibition of artemisinin in Artemisia annua. - Plant Physiol. 154: 958968, 2010. Carretero-Paulet, L., Ahumada, I., Cunillera, N., RodríguezConcepción, M., Ferrer, A., Boronat, A., Campos, N.: Expression and molecular analysis of the Arabidopsis DXR gene encoding 1-deoxy-D-xylulose-5-phosphate reductoisomerase, the first committed enzyme of the 2-C-methylD-erythritol 4-phosphate pathway. - Plant Physiol. 129: 1581-1591, 2001. Carretero-Paulet, L., Cairó, A., Botella-Pavía, P., Besumbes, O., Campos, N., Boronat, A., Rodríguez-Concepción, M.: Enhanced flux through the methylerythritol 4-phosphate pathway in Arabidopsis plants overexpressing deoxyxylulose 5-phosphate reductoisomerase. - Plant mol. Biol. 62: 683-695, 2006. Chappell, J.: Biochemistry and molecular biology of the isoprenoid biosynthetic pathway in plants. - Annu. Rev. Plant Physiol. Plant mol. Biol. 46: 521-547, 1995. Cordoba, E., Salmi, M., León, P.: Unraveling the regulatory mechanisms that modulate the MEP pathway in higher plants. - J. exp. Bot. 60: 2933-2943, 2009. Dudareva, N., Andersson, S., Orlova, I., Gatto, N., Reichelt, M., Rhodes, D., Boland, W., Gershenzon, J.: The nonmevalonate pathway supports both monoterpene and sesquiterpene formation in snapdragon flowers. - Proc. nat. Acad. Sci. USA 102: 933-938, 2005. Enjuto, M., Balcells, L., Campos, N., Caellest, C., Arro, M., Boronat, A.: Arabidopsis thaliana contains two differentially expressed 3-hydroxy-3-methylglutaryl-CoA reductase genes, which encode microsomal forms of the enzyme. - Proc. nat. Acad. Sci. USA 91: 927-931, 1994. Goldstein, J.L., Brown, M.S.: Regulation of the mevalonate pathway. - Nature 343: 425-430, 1990. Hsieh, M.H., Goodman, H.M.: The Arabidopsis IspH homolog is involved in the plastid nonmevalonate pathway of isoprenoid biosynthesis. - Plant Physiol. 138: 641-653, 2005. Huang, J.Z., Cheng, T.C., Wen, P.J., Hsieh, M.H., Chen, F.C.: Molecular characterization of the Oncidium orchid HDR gene encoding 1-hydroxy-2-methyl-2-(E)-butenyl 4-diphosphate reductase, the last step of the methylerythritol phosphate pathway. - Plant Cell Rep. 28: 1475-1486, 2009. Irmisch, S., Krause, S.T., Kunert, G., Gershenzon, J., Degenhardt, J., Köllner, T.G.: The organ-specific expression of terpene synthase genes contributes to the terpene hydrocarbon composition of chamomile essential oils. - BMC Plant Biol. 12: 84, 2012. Liu, Q., Majdi, M., Cankar, K., Goedbloed, M., Charnikhova, T., Verstappen, F., De Vos, R., Beekwilder, J., Van der Krol, S., Bouwmeester, H.: Reconstitution of the costunolide biosynthetic pathway in yeast and Nicotiana benthamiana. - PLoS ONE 8:1-12, 2011. Livak, K.J., Schmittgen, T.D.: Analysis of relative gene expression data using real-time quantitative PCR and the 2(T)(-∆∆C) method. - Methods 25: 402-408, 2001. Lois, L.M., Rodríguez-Concepción, M., Gallego, F., Campos, N., Boronat, A.: Carotenoid biosynthesis during tomato fruit development: regulatory role of 1-deoxy-D-xylulose 5-phosphate synthase. - Plant J. 22: 503-513, 2000. Majdi, M., Charnikhova, T., Bouwmeester, H.: Genetical, developmental and spatial factors influencing parthenolide and its precursor costunolide in feverfew (Tanacetum parthenium L. Schulz Bip.). - Ind. Crops Prod. 47: 270-276, 2013. Majdi, M., Liu, Q., Karimzadeh, G., Malboobi, M.A., Beekwilder, J., Cankar, K., De Vos, R., Todorovic, S., Simonovic, A., Bouwmeester, H.: Biosynthesis and localization of parthenolide in glandular trichomes of feverfew (Tanacetum parthenium L. Schulz Bip.). Phytochemistry 72: 1739-1750, 2011. Olofsson, L., Engstrom, A., Lundgren, A., Brodelius, P.E.: Relative expression of genes of terpene metabolism in 383 M. MAJDI et al. different tissues of Artemisia annua L. - BMC Plant Biol. 11: 45, 2011. Palevitch, D., Earon, G., Carasso, R.: Feverfew (Tanacetum parthenium) as a prophylactic treatment for migraine: a double-blind placebo-controlled study. - Phytother. Res. 11: 508-511, 1997. Ram, M., Khan, M.A., Jha, P., Khan, S., Kiran, U., Ahmad, M.M., Javed, S., Abdin, M.Z.: HMG-CoA reductase limits artemisinin biosynthesis and accumulation in Artemisia annua L. plants. - Acta Physiol. Plant. 32: 859-866, 2010. Rodríguez-Concepción, M., Ahumada, I., Diez-Juez, E., SauretGueto, S., Lois, L.M., Gallego, F., Carretero-Paulet, L., Campos, N., Boronat, A.: 1-deoxy-D-xylulose 5-phosphate reductoisomerase and plastid isoprenoid biosynthesis during tomato fruit ripening. - Plant J. 27: 213-222, 2001. Rohmer, M., Knani, M., Simonin, P., Sutter, B., Sahm, H.: Isoprenoid biosynthesis in bacteria: a novel pathway for the early steps leading to isopentenyldiphosphate. - Biochem. J. 384 295: 517-524, 1993. Takahashi, S., Kuzuyama, T., Watanabe, H., Seto, H.: A 1deoxy-D-xylulose 5-phosphate reductoisomerase catalyzing the formation of 2-C-methyl-D-erythritol 4-phosphate in an alternative nonmevalonate pathway for terpenoid biosynthesis. - Proc. nat. Acad. Sci. USA 95: 9879-9884, 1998. Swofford, D.L.: PAUP: Phylogenetic Analysis Using Parsimony (and Other Methods). Version 4.0b 10. - Sinauer Associates, Sunderland 2003. Wang, W., Wang, Y., Zhang, Q., Qi, Y., Guo, D.: Global characterization of Artemisia annua glandular trichome transcriptome using 454 pyrosequencing. - BMC Genomics 10: 465, 2009. Zeng, Q.P., Zeng, X.M., Yang, R.Y., Yang, X.Q.: Singlet oxygen as a signaling transducer for modulating artemisinin biosynthetic genes in Artemisia annua. - Biol. Plant. 55: 669-674, 2011.