applied
sciences
Article
Occurrence of Fluoroquinolones and Sulfonamides
Resistance Genes in Wastewater and Sludge at
Different Stages of Wastewater Treatment:
A Preliminary Case Study
Damian Rolbiecki 1 , Monika Harnisz 1, *, Ewa Korzeniewska 1 , Łukasz Jałowiecki 2 and
Grażyna Płaza 2
1
2
*
Department of Engineering of Water Protection and Environmental Microbiology, Faculty of Geoengineering,
University of Warmia and Mazury in Olsztyn, Prawocheńskiego St. 1, 10-719 Olsztyn, Poland;
damian.rolbiecki@uwm.edu.pl (D.R.); ewa.korzeniewska@uwm.edu.pl (E.K.)
Department of Environmental Microbiology, Institute for Ecology of Industrial Areas, Kossutha St. 6,
40-844 Katowice, Poland; l.jalowiecki@ietu.pl (Ł.J.); g.plaza@ietu.pl (G.P.)
Correspondence: monika.harnisz@uwm.edu.pl or monikah@uwm.edu.pl
Received: 9 July 2020; Accepted: 20 August 2020; Published: 22 August 2020
Abstract: This study identified differences in the prevalence of antibiotic resistance genes (ARGs)
between wastewater treatment plants (WWTPs) processing different proportions of hospital and
municipal wastewater as well as various types of industrial wastewater. The influence of treated
effluents discharged from WWTPs on the receiving water bodies (rivers) was examined. Genomic DNA
was isolated from environmental samples (river water, wastewater and sewage sludge). The presence
of genes encoding resistance to sulfonamides (sul1, sul2) and fluoroquinolones (qepA, aac(6′ )-Ib-cr)
was determined by standard polymerase chain reaction (PCR). The effect of the sampling season
(summer – June, fall – November) was analyzed. Treated wastewater and sewage sludge were
significant reservoirs of antibiotic resistance and contained all of the examined ARGs. All wastewater
samples contained sul1 and aac(6′ )-lb-cr genes, while the qepA and sul2 genes occurred less frequently.
These observations suggest that the prevalence of ARGs is determined by the type of processed
wastewater. The Warmia and Mazury WWTP was characterized by higher levels of the sul2 gene,
which could be attributed to the fact that this WWTP processes agricultural sewage containing animal
waste. However, hospital wastewater appears to be the main source of the sul1 gene. The results
of this study indicate that WWTPs are significant sources of ARGs, contributing to the spread of
antibiotic resistance in rivers receiving processed wastewater.
Keywords: antibiotic resistance; wastewater; WWTP; ARGs; sulfonamides; fluoroquinolones
1. Introduction
The overuse and misuse of antibiotics in human and veterinary medicine, animal farming
and agriculture contributes to antibiotic pollution and the spread of antibiotic resistance in the
environment [1,2]. The wide use of antimicrobial drugs creates selection pressure, which speeds up
microbial evolution and promotes the development of antibiotic resistance mechanisms. The presence
of close associations between antimicrobial medicines and resistance has been widely documented
around the world [3]. Antibiotics, antibiotic-resistant bacteria (ARB) and antibiotic resistance genes
(ARGs) are ubiquitous in surface water [4–6], ground water [7–9] and soil [10–12]. The ongoing spread
of these micropollutants in the natural environment contributes to the development of antibiotic
Appl. Sci. 2020, 10, 5816; doi:10.3390/app10175816
www.mdpi.com/journal/applsci
Appl. Sci. 2020, 10, 5816
2 of 13
resistance mechanisms in environmental bacteria. Antibiotic resistance genes play a fundamental role
in this process.
The sources and transmission mechanisms of ARGs have to be investigated in detail to prevent
the spread of antibiotic resistance in the environment. Raw municipal and hospital wastewater, treated
effluents and sewage sludge are significant reservoirs of ARGs, and they play a significant role in
the transfer of antibiotic resistance [1,13,14]. For this reason, the release of ARGs from wastewater
treatment plants (WWTPs) and their fate in the environment have attracted considerable research
interest in recent years [15–19].
The removal of solids, organics and nutrients is the key process in wastewater treatment.
Wastewater treatment plants are not equipped to remove microbiological contaminants, including ARB
and ARGs. The activated sludge process is a biological method that is frequently used in wastewater
treatment. The conditions inside activated sludge tanks, including high oxygen concentration,
high temperature and high densities of bacterial cells, can promote horizontal gene transfer (HGT)
between closely related as well as unrelated microorganisms [20]. As a result, treated effluents can
contain more copies of a given resistance gene per unit volume than raw wastewater [21,22].
Treated wastewater is evacuated to water bodies, which leads to the release of large gene pools,
including ARGs, into the natural environment [18,23]. Receptacles of treated effluents accumulate
mobile genetic elements (MGEs) such as plasmids, transposons, insertion sequences and integrons [15,24],
which are effective carriers of ARGs. Mobile genetic elements play a key role in the spread of genetic
information between even the most phylogenetically distant species of bacteria. Genetic resistance can be
further transferred between bacteria, including pathogenic microorganisms, posing a significant threat to
human health and life.
Organic solid waste such as sewage sludge is also a considerable source of ARGs, which contribute
to the spread of antibiotic resistance in the environment. Sewage sludge treatment leads to the
recovery of municipal biosolids. Biosolids are abundant in nutrients, and they are often used as
agricultural fertilizers [25]. In Poland, the storage of sewage sludge with a high caloric content
was banned in 2016 [26], which increased the supply of sewage sludge for fertilization purposes.
The management of sewage sludge delivers unquestioned benefits, but the application of treated sludge
in agriculture may also have negative consequences. Research has shown that ARGs levels in treated
sewage are very high [27,28] and often significantly exceed ARGs concentrations in wastewater [29,30].
Sewage sludge is usually stabilized before it is used as fertilizer, but according to many authors, biosolids
processed with the use of various stabilization methods are still highly abundant in ARGs [30,31].
Elevated concentrations of ARGs in soil samples [28,30,32] and accelerated transmission of ARGs from
soil to plants [32] were also reported in farmland fertilized with sewage sludge.
Microorganisms have developed various mechanisms of resistance to antibiotics, depending on
the type of antimicrobial drugs and their effects on bacterial cells. In Europe, clinical bacterial isolates
are becoming increasingly resistant to fluoroquinolones, which are an important class of antibiotics [33].
Resistance to fluoroquinolones is encoded by aac(6′ )-Ib-cr and qepA genes [34], which are usually
localized in plasmid DNA. The qepA gene encodes efflux pumps of the major facilitator superfamily
(MFS), which are responsible for the transport of antibiotics to extracellular space. The aac(6′ )-Ib-cr gene
encodes an enzyme that suppresses the activity of two fluoroquinolone antimicrobials (ciprofloxacin
and norfloxacin) through their acetylation [35].
Sulfonamides are one of the oldest groups of antibiotics used in medicine. In recent years, the use
of sulfonamides in human medicine has declined due to growing levels of bacterial resistance [36],
but these antimicrobials are still widely applied in veterinary medicine [37]. Sulfonamides inhibit
folate synthesis by suppressing the production of dihydropteroate synthase (DHPS) (EC 2.5.1.15),
an enzyme involved in the synthesis of folic acid. Bacteria have developed mechanisms of resistance
against sulfonamides through mutation of the chromosomal DHPS gene (folP) or the acquisition of
an alternative DHPS gene (sul). Dihydropteroate synthase encoded by a sul gene has a low affinity
for sulfonamides, and is not inhibited by this class of antibiotics. Three genes encoding resistance
Appl. Sci. 2020, 10, 5816
3 of 13
to sulfonamides (sul1, sul2, sul3) with estimated 50% sequence similarity have been identified to
date [37,38]. It is believed that general resistance to sulfonamides is encoded mostly by sul1 and sul2.
The acquisition of sulfonamide resistance through sul genes is the most prevalent mechanism in the
environment [19,39].
This study aimed to determine the prevalence of genes encoding resistance to sulfonamides (sul1,
sul2) and fluoroquinolones (qepA, aac(6′ )-Ib-cr) in various stages of wastewater treatment in two WWTPs.
The examined plants are situated in the regions of Warmia and Mazury (northern Poland) and Silesia
(southern Poland), which differ considerably in industrial development level. The treatment plants use
similar methods of wastewater treatment based on activated sludge. Differences in the prevalence of
ARGs between the studied WWTPs processing different proportions of the hospital and municipal
wastewater as well as various types of industrial wastewater were investigated. The study analyzed
whether the inflow of various sources of industrial wastewater (brewery wastewater, animal industry
wastewater) affects the differentiation in the occurrence of ARGs in WWTPs. Samples were collected at
the subsequent stages of wastewater treatment to capture the ARGs reduction, and the influence of
treated effluents evacuated from WWTPs on the receiving water bodies was examined by analyzing
samples of river water collected upstream and downstream from wastewater discharge points.
Sewage sludge was also analyzed. The impact of the season on the ARGs prevalence was evaluated by
analyzing samples collected in summer (June) and fall (November).
2. Materials and Methods
2.1. Study Area and Sampling Sites
In this study, the presence of genes encoding resistance to fluoroquinolones and sulfonamides was
analyzed in two WWTPs with similar treatment systems and processing capacities. Two wastewater
treatment plants (WWTPs) in Poland were analyzed in the study. The WWTPs are located in different
Polish regions: Warmia and Mazury (WM-WWTP) and Silesia (S-WWTP). Treated effluents are
evacuated to the Łyna River and the Gostynia River, respectively. Samples of river water collected
upstream and downstream from effluent discharge points were examined to determine the influence
of wastewater processing technology on rivers receiving treated wastewater. The analyzed WWTPs
are characterized by similar treatment technologies, but they differ in the type of inflowing wastewater.
Both WWTPs have a similar daily average processing capacity and employ a mechanical-biological
treatment system based on the activated sludge. S-WWTP has an average influent flow rate of
32,000 m3 /day, and it receives municipal sewage from the city of Tychy, hospital wastewater and
industrial sewage. Industrial wastewater (25% of the receiving wastewater) is supplied mainly by a
brewery where sewage is pre-cleaned in the methane fermentation process. The brewery is the largest
and the most important industrial facility in the S-WWMT area. S-WWTP deploys mechanical-biological
treatment methods and operates sequencing C-TECH reactors, activated sludge chambers (a system
of chambers of various oxygen conditions: anaerobic, anoxic and aerobic), a secondary settling
tank and an anoxic chamber. S-WWTP uses supplementary chemical phosphorus removal [40].
WM-WW TP operates a mechanical-biological treatment system with an elevated removal of nutrients
(MB-ERN) with the following sections of the wastewater treatment process: a pre-denitrification
chamber, a phosphorus removal tank, nitrification/denitrification chambers and secondary settling
tanks. It processes municipal sewage from the city of Olsztyn, industrial wastewater and sewage from
three hospitals. Industrial wastewater (20% of the receiving wastewater) is supplied by animal industry
wastewater. According to the information obtained from the administration of the WM-WWTP,
the plant has an average processing capacity of 35,000 m3 /day. The prevalence of bacterial infections,
the amount of antimicrobial drugs and the number of hospitalized patients differ across seasons.
These parameters can influence the results noted in each sampling season. Therefore, samples were
collected in the summer (June) and fall (November) of 2018. Samples of river water, wastewater and
Appl. Sci. 2020, 10, 5816
4 of 13
sludge from various stages of treatment were analyzed (n = 36). The types of samples collected in each
WWTP are presented in Table 1.
Table 1. Types of collected samples.
Region of Silesia
(S-WWTP)* (n = 18)
Region of Warmia and Mazury
(WM-WWTP)** (n = 18)
Type of Sample
Symbol
Type of Sample
Untreated wastewater
S1
Untreated wastewater
Wastewater from the outlet
Wastewater from the outlet
S2
of the primary clarifier
of the primary clarifier
Wastewater from the outlet
Wastewater in the biological
S3
Liquid samples from WWTPs
of the secondary clarifier
chamber
Wastewater from the outlet
Wastewater from the outlet
S4
of the C-TECH reactor
of the multipurpose reactor
Treated wastewater
S5
Treated wastewater
Sludge from the outlet of the
Sludge from the outlet of the
S6
mechanical concentrator
open fermentation pool
Solid samples from WWTPs
Sludge from the outlet of the
S7
Treated sludge
gravity concentrator
River water upstream the
River water upstream the
S8
effluent discharge point
effluent discharge point
River water
River water downstream the
River water downstream the
S9
effluent discharge point
effluent discharge point
* Silesian wastewater treatment plant; ** Warmia and Mazury wastewater treatment plant.
Symbol
W1
W2
W3
W4
W5
W6
W7
W8
W9
Three grab samples of around 160 mL of wastewater or river water were individually collected
and combined into composite samples in sterile 500 mL bottles. Sludge samples were collected into
sterile urine containers. The samples were transported to the laboratory on the day of collection and
stored in 4 ◦ C for further analysis.
2.2. DNA Extraction
Samples of wastewater and river water were filtered with the use of vacuum pumps and passed
through 0.2 µm pore size polycarbonate membrane filters. The volume of the filtered samples ranged
from 10 mL to 400 mL, depending on the site and season of collection. Sludge samples of 0.25 g each
were used directly for DNA isolation.
The DNeasy Power Water Kit (Qiagen, Hilden, Germany) was used to isolate genomic DNA
from sewage and water samples, and the DNeasy Power Soil Kit (Qiagen, Hilden, Germany) was
used to isolate genomic DNA from sewage sludge samples according to the manufacturer’s protocol.
The quality and quantity of the obtained genetic material was checked with the Multiskan Sky
Microplate Spectrophotometer (Thermo Scientific, Waltham, MA, USA).
2.3. Identification of Aantibiotic Resistance Genes by Polymerase Chain Reaction (PCR)
The presence of genes encoding resistance to sulfonamide (sul1, sul2) and quinolone (qepA,
aac (6′ )-Ib-cr) was confirmed by PCR. The applied primers and reaction profiles are presented in Table 2.
The PCR reactions were performed in a volume of 15 µL containing 10 µM of the respective primer
pairs, 1 µL of genomic DNA of each sample and the NZYTaq II 2xGreen Master Mix.
PCR products were separated electrophoretically by transferring 5 µL of every amplified DNA
fragment to 1.5% agarose gel stained with ethidium bromide (0.5 µg/mL) (Sigma, St. Louis, MO, USA).
Electrophoresis was conducted for 1 h at 100 V in 0.5× TBE buffer.
Appl. Sci. 2020, 10, 5816
5 of 13
Table 2. Polymerase chain reaction (PCR) primers and parameters.
Primer Sequence
(5′ -3′ )
Target Gene
Amplicon Size
(bp)
PCR Annealing
Temp (◦ C)
163
55.9
References
CGCACCGGAAACATCGCTGCAC
sul1
TGAAGTTCCGCCGCAAGGCTCG
[41]
TCCGGTGGAGGCCGGTATCTGG
sul2
qepA
aac(6′ )-Ib-cr
CGGGAATGCCATCTGCCTTGAG
191
60.8
570
58
[42]
482
55
[43]
CCAGCTCGGCAACTTGATAC
ATGCTCGCCTTCCAGAAAA
TTGCGATGCTCTATGAGTGGCTA
CTCGAATGCCTGGCGTGTTT
2.4. Cluster Analysis
An analysis of hierarchical clustering was performed to illustrate the relationship of the sampling
sites and the collection season based on the occurrence of studied ARGs. The Dice similarity coefficient
(Sørensen–Dice index) was used to measure the relationship between two sets of data. The unweighted
pair group method with arithmetic mean (UPGMA) was used as a clustering method. A hierarchical
tree (dendrogram) of the analyzed samples was generated for each research object (Supplementary
materials). The clustering analysis was performed using the Molecular Evolutionary Genetics Analysis
(MEGA7, Pennsylvania State University, State College, PA, USA, 2016) software [44].
3. Results and Discussion
The results of the cluster analysis did not show a similarity between the results for samples collected
in the same season. The samples collected in different seasons from the same sampling sites were often
grouped in one cluster on the dendrogram. It can be concluded that the sampling season probably had
no effect on the presence of ARGs in the analyzed samples (Figure S1). However, the prevalence of
ARGs differed across the types of genes and the stages of wastewater treatment. Raw sewage was a
significant source of ARGs and contained all of the analyzed genes (Table 3).
Influent wastewater is an important reservoir of ARGs. Wastewater treatment plants offer
supportive conditions for the spread of ARGs by horizontal gene transfer (HGT) [45–47]. The low
effectiveness of treatment processes can contribute to the transmission of ARGs from treated effluents
to surface water [2,19,48]. Antibiotic resistance genes are localized on MGEs, which can be exchanged
by both closely related and phylogenetically distant bacterial species. As a result, antibiotic resistance
can be spread between bacteria of anthropogenic origin and bacterial communities in the natural
environment [6,42]. ARGs in the environment stays in two forms: intracellular ARGs (iARGs) and
extracellular ARGs (eARGs). The forms of ARGs that occur in the environment determine the character
of its further transmission. iARGs support the spreading of antibiotic resistance via conjugation and
transduction, while eARGs can be uptaken and integrated by the competent non-resistant bacteria
via natural transformation. Of the mentioned HGT mechanisms, conjugation is deemed to have the
biggest impact on the dissemination of ARGs, while transformation and transduction are considered
less important [49].
Sulfonamides were the first safe and effective antimicrobial drugs in clinical practice that targeted
selected bacteria [50]. The medical use of sulfonamides is decreasing in Europe. The compound
annual growth rate (CAGR) of the sulfonamide market in Europe reached negative values between
2009 and 2018 [36]. In 2017, sulfonamides were the least used class of antibiotics for systemic use in
Polish and European hospitals [51]. Sulfonamide resistance in Gram-negative bacteria can probably
be attributed to sul1 and sul2 genes, which are carried by plasmids. Research has demonstrated
that sulfonamide resistance genes are the most ubiquitous ARGs in the environment [19,39]. In the
Appl. Sci. 2020, 10, 5816
6 of 13
present study, the sul1 gene was identified in all wastewater and sewage sludge samples collected
in both WWTPs. This gene was also present in samples of river water collected upstream from
the effluent discharge point. The above findings indicate that the sul1 gene is widely spread in the
environment. The analyzed gene was not eliminated in successive stages of treatment, which may
increase the concentration of this gene in the water and bottom sediments of effluent-receiving rivers.
Surface waters are highly contaminated with the sul1 gene [15,16,18,52]. The sul1 gene has been also
identified in samples of municipal wastewater [53], activated sludge [47] and wastewater containing
animal waste [54]. Hospital sewage appears to be the major source of the sul1 gene in the environment.
According to Lye et al. [2], the prevalence of sul1 is considerably higher in hospital wastewater than
in other types of sewage. Similar results were reported by Wang et al. [14], who analyzed hospital
sewage in China. In other studies, hospital wastewater was characterized by the highest concentration
of the sul1 gene relative to other ARGs [13,55]. The ubiquitous character of sul1 could result from
a close relationship between sul1 and class 1 integrons that are widespread in the environment [56].
According to Poey et al. [57], sul1 occurs in the variable region (gene cassette) of class 1 integrons.
In the current study, hospital sewage accounted for 2–6% of the wastewater processed by the WWTPs.
WM-WWTP treats wastewater from three hospitals, and S-WWTP treats wastewater from one hospital.
Hospital sewage could be a major source of sul1 in the analyzed WWTPs, which could explain the high
prevalence of this gene in all samples.
Table 3. Presence of amplicons for genes encoding resistance to sulfonamides and fluoroquinolones in
the analyzed samples. Colors correspond to sampling sites as in Table 1. + and − denote amplicons for
each gene that were and were not detected via endpoint PCR, respectively.
WM-WWTP **
S-WWTP *
Symbol
S1
S2
S3
S4
S5
S6
S7
S8
S9
W1
W2
W3
W4
W5
W6
W7
W8
W9
sul1
sul2
qepA
aac(6′ )-Ib-cr
Summer Fall
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
Summer Fall
+
+
+
+
+
−
+
−
+
−
−
+
+
+
−
+
−
+
+
+
+
+
+
+
+
+
+
−
+
+
+
+
−
−
+
−
Summer Fall
+
+
−
+
−
+
−
−
−
+
−
−
+
+
−
−
−
−
+
+
+
+
−
+
+
−
+
+
−
−
+
−
−
−
−
+
Summer Fall
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
* Silesian wastewater treatment plant; ** Warmia and Mazury wastewater treatment plant.
The sul2 gene occurred less frequently than the sul1 gene. The sul2 gene was not identified in river
water upstream from the effluent discharge point (excluding site S8 in fall). This gene was present in all
samples of raw wastewater, but it was eliminated in successive stages of treatment. These observations
could also suggest that sul2 was less abundant in raw sewage that sul1. The presence of the sul2 gene in
river water was noted only in WM-WWTP in summer. Koczura et al. [52] reported significantly smaller
concentrations of sul2 than sul1 in surface waters. In a study by Ziembińska-Buczyńska et al. [47],
sul2 was less prevalent than sul1 in bacterial isolates from activated sludge. According to Pei et al. [41],
sul2 is an important indicator of the environmental impacts of agriculture, which could explain why
sul2 concentrations are higher in areas with a predominance of agriculture, in particular livestock
Appl. Sci. 2020, 10, 5816
7 of 13
production and aquaculture. Lye et al. [2] found the highest abundance of sul2 in zoo wastewater.
The livestock population in Warmia and Mazury is several times higher than in Silesia [58], which could
imply that Warmia and Mazury is characterized by a higher contamination of animal waste and higher
concentrations of sul2 in the environment, in particular in wastewater evacuated from animal farms.
Olsztyn, the capital city of Warmia and Mazury, where MW-WWTP is situated, is the seat of Poland’s
largest poultry company, which specializes in turkey rearing and the production and processing
of turkey meat. Wastewater from turkey farms and production plants is evacuated to MW-WWTP,
which could explain the higher abundance of sul2 in raw sewage reaching MW-WWTP than S-WWTP.
The sul2 gene was not identified in only one stage of wastewater treatment in MW-WWTP, whereas in
S-WWTP, sul2 was not detected in four sampling sites.
According to the literature, seasonal variations in the virulence of pathogenic microorganisms and
the immune status of infected individuals are responsible for the seasonality of infectious diseases [59].
Seasonal variations are also noted in antibiotic use, and the consumption of antimicrobials is significantly
higher in fall than in summer [60]. Despite the above, it appears that the prevalence of sulfonamide
resistance genes in samples of river water, wastewater and sludge was not noticeably affected by season
in the present study; however, this is only a preliminary case study and to determine more precise
correlations the research must be expanded with quantitative analyses of ARGs. Similar observations
were made by Koczura et al. [52], who did not report significant seasonal differences in sul1 copy
numbers in river water and sewage sludge, but noted that the sul2 gene was more prevalent in
spring samples.
Fluoroquinolones are broad-spectrum antibiotics and one of the most frequently prescribed
antimicrobials. Extensive clinical use of fluoroquinolones has contributed to high resistance of
pathogenic microorganisms to this group of antibiotics. In Europe, the number of hospital strains of
Escherchia coli and Klebsiella pneumoniae resistant to fluoroquinolones increased in 2015 –2018. In 2018,
the highest percentage of Pseudomonas aeruginosa isolates (19.7%) were resistant to fluoroquinolones [33].
The genes conditioning bacterial resistance to fluoroquinolones include aac(6′ )-Ib-cr, which encodes
aminoglycoside acetyltransferase, and qepA, which encodes active efflux pumps [34]. In this study,
both genes were detected in samples of raw wastewater.
The aac(6′ )-lb-cr gene was identified in all analyzed samples, and it was not eliminated during
wastewater treatment. It was also detected in samples of river water collected upstream from effluent
discharge points, which suggests that this gene also originates from other sources. The qepA gene was
less frequently isolated, and it was not found in river water sampled upstream from effluent discharge
points. In S-WWTP, the qepA gene was completely eliminated from treated wastewater in summer,
and it was not transmitted to the river with the evacuated effluents. This gene was present only in
sewage sludge where the concentration of biological material was highest relative to the remaining
samples. The qepA gene was less effectively removed in WM-WWTP. In both seasons, qepA was not
detected in river water sampled upstream from the effluent discharge point, but it was identified in the
samples collected downstream from the effluent discharge point.
According to the literature, aac(6′ )-lb-cr and qepA genes are commonly found in the wastewater.
Korzeniewska and Harnisz [21] detected both genes in influents and effluents from 13 wastewater
treatment plants with different type of the wastewater treatment technologies modifications.
Yan et al. [61] found aac(6′ )-lb-cr and qepA in treated wastewater from three Chinese hospitals,
in municipal wastewater and in river water. In each sampling site, the aac(6′ )-lb-cr gene had higher
copy numbers than the qepA gene. Wen et al. [48] analyzed samples of unpolluted river water and
samples of river water collected in the vicinity of hospitals. The qepA gene was not detected in any of
the samples, whereas the aac(6′ )-lb-cr gene was ubiquitous in all samples.
The lower prevalence of qepA could be attributed to the fact that resistance to fluoroquinolones
encoded by this gene evolved relatively late. The qepA gene was first identified in 2007 by research teams
from Belgium and Japan [62,63]. The first mechanism of plasmid encoded resistance to fluoroquinolones
was discovered in 1998 [64].
Appl. Sci. 2020, 10, 5816
8 of 13
It should be noted that all studied genes (excluding qepA at site W7 in fall) were present in treated
sewage sludge intended for further use. More than 500,000 tons of sewage sludge are produced each
year in Poland, of which around 20% are used as agricultural fertilizers on account of their high organic
matter content [65]. The application of sewage sludge as agricultural fertilizer contributes to the spread
of antibiotic resistance in the environment [28]. Chen et al. [28] found that sewage sludge fertilization
can transfer up to 108 of ARGs and MGEs to soil. The resulting increase in bacterial diversity in
the soil environment was significantly correlated with the prevalence of ARGs. Sewage sludge is
particularly abundant in tetracycline and sulfonamide resistance genes [27]. According to Lee et al. [27],
sulfonamide resistance genes (sul1 and sul2) were the most frequently occurring ARGs (45.6%) in
the examined sewage sludge. The number of sul1 copies in sewage sludge significantly exceeded
(26–87 times) the number of sul2 copies. Lee et al. [27] also observed that the prevalence of sulfonamide
resistance genes was six-fold (%) higher in sewage sludge than in raw wastewater, which suggests that
these genes are highly accumulated in sewage sludge. Quinolone resistance genes were identified
significantly less frequently, and they were not present in sewage sludge. The accumulation of ARGs
and MGEs in soil could imply that the application of sewage sludge could accelerate gene transmission
to the soil environment via HGT.
The presence of antibiotics acting as active mutagens can also significantly contribute to the
evolution of drug resistance mechanisms. Sublethal concentrations of antibiotics, which are frequently
noted in wastewater, can lead to mutations that promote the emergence of drug resistance [66,67].
The samples of raw sewage, treated wastewater and river water that were examined in the current
study were additionally analyzed by Giebułtowicz et al. [68] for the presence of 26 antimicrobials.
Very high concentrations of sulfamethoxazole (SXT) and ciprofloxacin (CIP) were noted in raw
wastewater reaching both WWTPs, and they were nearly three times higher in WM-WWTP than in
S-WWTP. It should also be noted that CIP levels in raw wastewater exceeded the minimum inhibitory
concentrations (MIC) recommended by EUCAST for most microorganisms [69]. To regulate the risk
issuing from the concentrations of antibiotics in the environment, Bengtson-Palme and Larsson [70]
estimated Predicted No-Effect Concentrations (PENCs) of antimicrobials for resistance selection.
Based on these [70] calculations, average CIP concentrations in influents, effluents and downstream
rivers were found to exceed the PENCs values for influents, effluents and downstream rivers in both
WWTPs, which is particularly worrying. Based on the calculated values of the risk quotient (RQ),
Giebułtowicz et al. [68] concluded that high concentrations of the analyzed antibiotics contribute to the
development of selective resistance. The results of the qualitative analyses presented in this study
cannot reveal a correlation between antibiotic concentrations and the prevalence of the examined
ARGs. Further research involving quantitative analysis is needed to investigate the above problem.
The study determined whether the tested ARGs are present/absent in the DNA isolated from
analyzed samples. However, it remains unknown if and what part of the current ARGs is intercellularly
carried (iARGs) by live and metabolically active bacterial cells. Therefore, to reach beyond the
qualitative and quantitative analyzes of ARGs and to reach a more extensive knowledge of ARGs
dynamics, it is necessary to identify which of the detected ARGs are expressed. The combination
of metagenomic and metatranscriptomic analyses will allow the identification of ARGs that are not
only present but also actively transcribed. There is little work on antibiotic resistance gene expression
in WWTP [71–73]. The researchers report that about 65.8% identified ARGs shows transcriptional
activity [73], and that there is a significant overexpression of ARGs occurring in an environment that
is heavily affected by antibiotic use [71]. We believe that this issue should be the direction of further
research in the WWTPs.
4. Conclusions
Wastewater treated at WWTPs is a significant point source of ARGs. The existing wastewater
treatment methods do not effectively eliminate ARGs whose concentrations in treated effluents are
not routinely monitored. This imperfect process promotes the release of ARGs into the environment.
Appl. Sci. 2020, 10, 5816
9 of 13
This study demonstrated that genes encoding resistance to sulfonamides and fluoroquinolones are
widespread in the environment and that WWTPs contribute to their transmission. The prevalence
of ARGs in raw wastewater and in various stages of wastewater treatment differed in the examined
WWTPs. These variations could be attributed to differences in the type and sources of processed
wastewater. WM-WWTP processes wastewater from livestock farms, which could explain the higher
prevalence of the sul2 gene in the analyzed samples. Hospital wastewater appears to be the main
source of sul1 in both WWTPs. Sewage sludge was found to be a significant reservoir of ARGs.
Sewage sludge should be stabilized before it is used as fertilizer, and its application in agriculture
should be monitored. The growing prevalence and spread of ARB and ARGs pose a significant public
health concern around the world. A sound knowledge of the sources and transmission mechanisms of
antibiotic resistance in various environments is required to develop effective strategies for managing
these risks and evaluating their impact on human health. The study is a preliminary study and a base
for further in-depth metagenomic and metatranscriptomic analyses.
Supplementary Materials: The following are available online at http://www.mdpi.com/2076-3417/10/17/5816/s1,
Figure S1: Similarity of samples, based on the occurrence of antibiotic-resistance genes (ARGs).
Author Contributions: Conceptualization, M.H., E.K. and G.P.; methodology, M.H. and E.K., software, D.R.;
validation, M.H. and D.R.; formal analysis, D.R.; resources, M.H., Ł.J. and G.P.; data curation, D.R.; writing—original
draft preparation, D.R.; writing—review and editing, M.H., E.K. and G.P.; visualization, D.R.; supervision, M.H.;
funding acquisition, M.H. and G.P. All authors have read and agreed to the published version of the manuscript.
Funding: This research was funded by grants from the National Science Center (Poland) No. 2017/26/M/NZ9/00071
and 2017/27/B/NZ9/00267.
Conflicts of Interest: The authors declare no conflict of interest.
References
1.
2.
3.
4.
5.
6.
7.
8.
9.
10.
11.
Guo, J.; Li, J.; Chen, H.; Bond, P.L.; Yuan, Z. Metagenomic analysis reveals wastewater treatment plants as
hotspots of antibiotic resistance genes and mobile genetic elements. Water Res. 2017, 123, 468–478. [CrossRef]
Lye, Y.L.; Bong, C.W.; Lee, C.W.; Zhang, R.J.; Zhang, G.; Suzuki, S.; Chai, L.C. Anthropogenic impacts on
sulfonamide residues and sulfonamide resistant bacteria and genes in Larut and Sangga Besar River, Perak.
Sci. Total Environ. 2019, 688, 1335–1347. [CrossRef]
WHO. WHO Report on Surveillance of Antibiotic Consumption: 2016–2018 Early Implementation; Licence: CC
BY-NC-SA 3.0 IGO; World Health Organization: Geneva, Switzerland, 2018.
Danner, M.C.; Robertson, A.; Behrends, V.; Reiss, J. Antibiotic pollution in surface fresh waters: Occurrence
and effects. Sci. Total Environ. 2019, 664, 793–804. [CrossRef]
Koniuszewska, I.; Korzeniewska, E.; Harnisz, M.; Kiedrzyńska, E.; Kiedrzyński, M.; Czatzkowska, M.;
Jarosiewicz, P.; Zalewski, M. The occurrence of antibiotic-resistance genes in the Pilica River, Poland.
Ecohydrol. Hydrobiol. 2020, 20, 1–11. [CrossRef]
Xiong, W.; Sun, Y.; Ding, X.; Zhang, Y.; Zeng, Z. Antibiotic resistance genes occurrence and bacterial
community composition in the Liuxi River. Front. Environ. Sci. 2014, 2, 1–6. [CrossRef]
Andrade, L.; Kelly, M.; Hynds, P.; Weatherill, J.; Majury, A.; O’Dwyer, J. Groundwater resources as a global
reservoir for antimicrobial-resistant bacteria. Water Res. 2020, 170, 115360. [CrossRef]
Burke, V.; Richter, D.; Greskowiak, J.; Mehrtens, A.; Schulz, L.; Massmann, G.; Victoria, B.; Doreen, R.;
Janek, G.; Anne, M.; et al. Occurrence of Antibiotics in Surface and Groundwater of a Drinking Water
Catchment Area in Germany. Water Environ. Res. 2016, 88, 652–659. [CrossRef]
Szekeres, E.; Chiriac, C.M.; Baricz, A.; Szőke-Nagy, T.; Lung, I.; Soran, M.-L.; Rudi, K.; Dragoş, N.; Coman, C.
Investigating antibiotics, antibiotic resistance genes, and microbial contaminants in groundwater in relation
to the proximity of urban areas. Environ. Pollut. 2018, 236, 734–744. [CrossRef] [PubMed]
Pérez-Valera, E.; Kyselková, M.; Ahmed, E.; Sladecek, F.X.J.; Goberna, M.; Elhottová, D. Native soil
microorganisms hinder the soil enrichment with antibiotic resistance genes following manure applications.
Sci. Rep. 2019, 9, 6760. [CrossRef] [PubMed]
Forsberg, K.J.; Patel, S.; Gibson, M.K.; Lauber, C.L.; Knight, R.; Fierer, N.; Dantas, G. Bacterial phylogeny
structures soil resistomes across habitats. Nature 2014, 509, 612–616. [CrossRef] [PubMed]
Appl. Sci. 2020, 10, 5816
12.
13.
14.
15.
16.
17.
18.
19.
20.
21.
22.
23.
24.
25.
26.
27.
28.
29.
30.
31.
10 of 13
Cycoń, M.; Mrozik, A.; Piotrowska-Seget, Z. Antibiotics in the Soil Environment—Degradation and Their
Impact on Microbial Activity and Diversity. Front. Microbiol. 2019, 10, 338. [CrossRef]
Lorenzo, P.; Adriana, A.; Jéssica, S.; Carles, B.; Marinella, F.; Marta, L.; Luis, B.J.; Pierre, S. Antibiotic resistance
in urban and hospital wastewaters and their impact on a receiving freshwater ecosystem. Chemosphere 2018,
206, 70–82. [CrossRef] [PubMed]
Wang, Q.; Wang, P.; Yang, Q. Occurrence and diversity of antibiotic resistance in untreated hospital wastewater.
Sci. Total Environ. 2018, 621, 990–999. [CrossRef] [PubMed]
Cacace, D.; Fatta-Kassinos, D.; Manaia, C.M.; Cytryn, E.; Kreuzinger, N.; Rizzo, L.; Karaolia, P.; Schwartz, T.;
Alexander, J.; Merlin, C.; et al. Antibiotic resistance genes in treated wastewater and in the receiving water
bodies: A pan-European survey of urban settings. Water Res. 2019, 162, 320–330. [CrossRef] [PubMed]
Huang, Z.; Zhao, W.; Xu, T.; Zheng, B.; Yin, D. Occurrence and distribution of antibiotic resistance genes
in the water and sediments of Qingcaosha Reservoir, Shanghai, China. Environ. Sci. Eur. 2019, 31, 1–9.
[CrossRef]
Osińska, A.; Korzeniewska, E.; Harnisz, M.; Felis, E.; Bajkacz, S.; Jachimowicz, P.; Niest˛epski, S.; Konopka, I.
Small-scale wastewater treatment plants as a source of the dissemination of antibiotic resistance genes in the
aquatic environment. J. Hazard. Mater. 2020, 381, 121221. [CrossRef]
Sabri, N.A.; Schmitt, H.; Van Der Zaan, B.; Gerritsen, H.W.; Zuidema, T.; Rijnaarts, H.H.M.; Langenhoff, A.A.M.
Prevalence of antibiotics and antibiotic resistance genes in a wastewater effluent-receiving river in the
Netherlands. J. Environ. Chem. Eng. 2020, 8, 102245. [CrossRef]
Stange, C.; Yin, D.; Xu, T.; Guo, X.; Schäfer, C.; Tiehm, A. Distribution of clinically relevant antibiotic resistance
genes in Lake Tai, China. Sci. Total Environ. 2019, 655, 337–346. [CrossRef]
Rizzo, L.; Manaia, C.M.; Merlin, C.; Schwartz, T.; Dagot, C.; Ploy, M.C.; Michael, I.; Fatta-Kassinos, D.
Urban wastewater treatment plants as hotspots for antibiotic resistant bacteria and genes spread into the
environment: A review. Sci. Total Environ. 2013, 447, 345–360. [CrossRef]
Korzeniewska, E.; Harnisz, M. Relationship between modification of activated sludge wastewater treatment
and changes in antibiotic resistance of bacteria. Sci. Total Environ. 2018, 639, 304–315. [CrossRef]
Pazda, M.; Kumirska, J.; Stepnowski, P.; Mulkiewicz, E. Antibiotic resistance genes identified in wastewater
treatment plant systems—A review. Sci. Total Environ. 2019, 697, 134023. [CrossRef] [PubMed]
Jäger, T.; Hembach, N.; Elpers, C.; Wieland, A.; Alexander, J.; Hiller, C.; Krauter, G.; Schwartz, T. Reduction
of Antibiotic Resistant Bacteria During Conventional and Advanced Wastewater Treatment, and the
Disseminated Loads Released to the Environment. Front. Microbiol. 2018, 9, 2599. [CrossRef] [PubMed]
Marano, R.B.M.; Cytryn, E. The Mobile Resistome in Wastewater Treatment Facilities and Downstream
Environments. In Antimicrobial Resistance in Wastewater Treatment Processes; Keen, P.L., Fugère, R., Eds.;
John Wiley & Sons, Inc. (Wiley): Hoboken, NJ, USA, 2017; pp. 129–155.
Kaplan, E.; Ofek, M.; Jurkevitch, E.; Cytryn, E. Characterization of fluoroquinolone resistance and qnr
diversity in Enterobacteriaceae from municipal biosolids. Front. Microbiol. 2013, 4, 144. [CrossRef] [PubMed]
Minister of Economy. Internet System of Legal Acts. Available online: http://isap.sejm.gov.pl/isap.nsf/DocDetails.
xsp?id=WDU20150001277 (accessed on 21 August 2020). (In Polish)
Lee, J.; Shin, S.G.; Jang, H.M.; Kim, Y.B.; Lee, J.; Kim, Y.M. Characterization of antibiotic resistance genes
in representative organic solid wastes: Food waste-recycling wastewater, manure, and sewage sludge.
Sci. Total Environ. 2017, 579, 1692–1698. [CrossRef]
Chen, Q.-L.; An, X.; Li, H.; Su, J.; Ma, Y.; Zhu, Y.-G. Long-term field application of sewage sludge increases
the abundance of antibiotic resistance genes in soil. Environ. Int. 2016, 92, 1–10. [CrossRef]
Gao, P.; Munir, M.; Xagoraraki, I. Correlation of tetracycline and sulfonamide antibiotics with corresponding
resistance genes and resistant bacteria in a conventional municipal wastewater treatment plant. Sci. Total Environ.
2012, 421, 173–183. [CrossRef]
Munir, M.; Xagoraraki, I. Levels of Antibiotic Resistance Genes in Manure, Biosolids, and Fertilized Soil.
J. Environ. Qual. 2011, 40, 248–255. [CrossRef]
Ma, Y.; Wilson, C.A.; Novak, J.T.; Riffat, R.; Aynur, S.; Murthy, S.; Pruden, A. Effect of Various Sludge
Digestion Conditions on Sulfonamide, Macrolide, and Tetracycline Resistance Genes and Class I Integrons.
Environ. Sci. Technol. 2011, 45, 7855–7861. [CrossRef]
Appl. Sci. 2020, 10, 5816
32.
33.
34.
35.
36.
37.
38.
39.
40.
41.
42.
43.
44.
45.
46.
47.
48.
49.
50.
51.
11 of 13
Yang, L.; Liu, W.; Zhu, D.; Hou, J.; Ma, T.; Wu, L.; Zhu, Y.; Christie, P. Application of biosolids drives the
diversity of antibiotic resistance genes in soil and lettuce at harvest. Soil Biol. Biochem. 2018, 122, 131–140.
[CrossRef]
European Centre for Disease Prevention and Control (ECDC). Surveillance of Antimicrobial Resistance in Europe
2018; Annual report of the European Antimicrobial Resistance Surveillance Network (EARS-Net); ECDC:
Stockholm, Sweden, 2018.
Ruiz, J.; Pons, M.J.; Gomes, C. Transferable mechanisms of quinolone resistance. Int. J. Antimicrob. Agents
2012, 40, 196–203. [CrossRef]
Wong, M.H.; Chan, E.W.; Liu, L.Z.; Chen, S. PMQR genes oqxAB and aac(6′ )Ib-cr accelerate the development
of fluoroquinolone resistance in Salmonella typhimurium. Front. Microbiol. 2014, 5, 521. [CrossRef] [PubMed]
European Centre for Disease Prevention and Control (ECDC). Antimicrobial Consumption—Annual
Epidemiological Report for 2018; ECDC: Stockholm, Sweden, 2019.
Jiang, H.; Cheng, H.; Liang, Y.; Yu, S.; Yu, T.; Fang, J.; Zhu, C. Diverse Mobile Genetic Elements and Conjugal
Transferability of Sulfonamide Resistance Genes (sul1, sul2, and sul3) in Escherichia coli Isolates From
Penaeus vannamei and Pork From Large Markets in Zhejiang, China. Front. Microbiol. 2019, 10, 1787.
[CrossRef]
Hsu, J.T.; Chen, C.Y.; Young, C.W.; Chao, W.L.; Li, M.H.; Liu, Y.H.; Lin, C.M.; Ying, C. Prevalence of
sulfonamide-resistant bacteria, resistance genes and integron-associated horizontal gene transfer in natural
water bodies and soils adjacent to a swine feedlot in northern Taiwan. J. Hazard. Mater. 2014, 277, 34–43.
[CrossRef] [PubMed]
Yan, M.; Xu, C.; Huang, Y.; Nie, H.; Wang, J. Tetracyclines, sulfonamides and quinolones and their
corresponding resistance genes in the Three Gorges Reservoir, China. Sci. Total Environ. 2018, 840–848.
[CrossRef] [PubMed]
Romańczuk, P.; Pieczykolan, M. Porównanie eksploatowanych ciagów
˛
technologicznych ściekowych na
oczyszczalni ścieków Tychy–Urbanowice. Gaz Woda Tech. Sanit. 2006, 7-8, 49–53.
Pei, R.; Kim, S.C.; Carlson, K.H.; Pruden, A. Effect of River Landscape on the sediment concentrations of
antibiotics and corresponding antibiotic resistance genes (ARG). Water Res. 2006, 40, 2427–2435. [CrossRef]
Li, J.; Wang, T.; Shao, B.; Shen, J.; Wang, S.; Wu, Y. Plasmid-Mediated Quinolone Resistance Genes and
Antibiotic Residues in Wastewater and Soil Adjacent to Swine Feedlots: Potential Transfer to Agricultural
Lands. Environ. Heal. Perspect. 2012, 120, 1144–1149. [CrossRef]
Park, C.H.; Robicsek, A.; Jacoby, G.A.; Sahm, D.; Hooper, D.C. Prevalence in the United States of aac(6′ )-Ib-cr
Encoding a Ciprofloxacin-Modifying Enzyme. Antimicrob. Agents Chemother. 2006, 50, 3953–3955. [CrossRef]
Kumar, S.; Stecher, G.; Tamura, K. MEGA7: Molecular Evolutionary Genetics Analysis version 7.0 for bigger
datasets. Mol. Boil. Evol. 2016, 33, 1870–1874. [CrossRef]
Kurasam, J.; Sihag, P.; Mandal, P.K.; Sarkar, S. Presence of fluoroquinolone resistance with persistent
occurrence of gyrA gene mutations in a municipal wastewater treatment plant in India. Chemosphere 2018,
211, 817–825. [CrossRef]
Osińska, A.; Harnisz, M.; Korzeniewska, E. Prevalence of plasmid-mediated multidrug resistance determinants
in fluoroquinolone-resistant bacteria isolated from sewage and surface water. Environ. Sci. Pollut. Res. 2016, 23,
10818–10831. [CrossRef]
Ziembińska-Buczyńska, A.; Felis, E.; Folkert, J.; Meresta, A.; Stawicka, D.; Gnida, A.; Surmacz-Górska, J.
Detection of antibiotic resistance genes in wastewater treatment plant—Molecular and classical approach.
Arch. Environ. Prot. 2015, 41, 23–32. [CrossRef]
Wen, Y.; Pu, X.; Zheng, W.; Hu, G. High Prevalence of Plasmid-Mediated Quinolone Resistance and IncQ
Plasmids Carrying qnrS2 Gene in Bacteria from Rivers near Hospitals and Aquaculture in China. PLoS ONE
2016, 11, e0159418. [CrossRef] [PubMed]
Dong, P.; Wang, H.; Fang, T.; Wang, Y.; Ye, Q. Assessment of extracellular antibiotic resistance genes (eARGs)
in typical environmental samples and the transforming ability of eARG. Environ. Int. 2019, 125, 90–96.
[CrossRef] [PubMed]
Tačić, A.; Nikolić, V.; Nikolić, L.; Savić, I. Antimicrobial sulfonamide drugs. Adv. Technol. 2017, 6, 58–71.
[CrossRef]
Gouvras, G. The European Centre for Disease Prevention and Control. Eurosurveillance 2004, 9, 2. [CrossRef]
Appl. Sci. 2020, 10, 5816
52.
53.
54.
55.
56.
57.
58.
59.
60.
61.
62.
63.
64.
65.
66.
67.
68.
69.
70.
12 of 13
Koczura, R.; Mokracka, J.; Taraszewska, A.; Łopacinska, N. Abundance of Class 1 Integron-Integrase and
Sulfonamide Resistance Genes in River Water and Sediment is Affected by Anthropogenic Pressure and
Environmental Factors. Microb. Ecol. 2016, 72, 909–916. [CrossRef]
Mohameda, H.S.A.; Uswege, M.; Robinson, H.M. Correlation between antibiotic concentrations genes
contaminations at Mafisa wastewater treatment plant in Morogoro Municipality, Tanzania. Glob. Environ.
Health Saf. 2018, 2, 5.
Tao, C.-W.; Hsu, B.-M.; Ji, W.-T.; Hsu, T.-K.; Kao, P.-M.; Hsu, C.-P.; Shen, S.-M.; Shen, T.-Y.; Wan, T.-J.;
Huang, Y.-L. Evaluation of five antibiotic resistance genes in wastewater treatment systems of swine farms
by real-time PCR. Sci. Total Environ. 2014, 496, 116–121. [CrossRef]
Szekeres, E.; Baricz, A.; Chiriac, C.M.; Farkas, A.; Opriş, O.; Soran, M.-L.; Andrei, A.Ş.; Rudi, K.; Balcázar, J.L.;
Dragos, N.; et al. Abundance of antibiotics, antibiotic resistance genes and bacterial community composition
in wastewater effluents from different Romanian hospitals. Environ. Pollut. 2017, 225, 304–315. [CrossRef]
Gundogdu, A.; Long, Y.B.; Vollmerhausen, T.L.; Katouli, M. Antimicrobial resistance and distribution of sul
genes and integron-associated intI genes among uropathogenic Escherichia coli in Queensland, Australia.
J. Med. Microbiol. 2011, 60, 1633–1642. [CrossRef] [PubMed]
Poey, M.E.; Azpiroz, M.F.; Laviña, M. On sulfonamide resistance, sul genes, class 1 integrons and their
horizontal transfer in Escherichia coli. Microb. Pathog. 2019, 135, 103611. [CrossRef] [PubMed]
Statistics Poland; Agriculture Department. Farm Animals in 2017. 2018. Available online: https://stat.gov.pl/
files/gfx/portalinformacyjny/pl/defaultaktualnosci/5508/6/18/1/zwierzeta_gospodarskie_w_2017_roku.pdf
(accessed on 2 July 2020).
Fares, A. Factors Influencing the Seasonal Patterns of Infectious Diseases. Int. J. Prev. Med. 2013, 4, 128–132.
[PubMed]
Zachara, J.; Zachara, R.; Zachara, N.; Matuszczak, A.; Kłoda, K. The comparison of use of antibiotics due to
acute respiratory infections in the rural population of primary care in 2010 and 2017. J. Educ. Health Sport
2019, 9, 70–83.
Yan, L.; Liu, D.; Wang, X.-H.; Wang, Y.; Zhang, B.; Wang, M.; Xu, H. Bacterial plasmid-mediated quinolone
resistance genes in aquatic environments in China. Sci. Rep. 2017, 7, 40610. [CrossRef] [PubMed]
Périchon, B.; Courvalin, P.; Galimand, M. Transferable Resistance to Aminoglycosides by Methylation of
G1405 in 16S rRNA and to Hydrophilic Fluoroquinolones by QepA-Mediated Efflux in Escherichia coli.
Antimicrob. Agents Chemother. 2007, 51, 2464–2469. [CrossRef] [PubMed]
Yamane, K.; Wachino, J.-I.; Suzuki, S.; Kimura, K.; Shibata, N.; Kato, H.; Shibayama, K.; Konda, T.; Arakawa, Y.
New Plasmid-Mediated Fluoroquinolone Efflux Pump, QepA, Found in an Escherichia coli Clinical Isolate.
Antimicrob. Agents Chemother. 2007, 51, 3354–3360. [CrossRef]
Martínez-Martínez, L.; Pascual, A.; Jacoby, G.A. Quinolone resistance from a transferable plasmid. Lancet
1998, 351, 797–799. [CrossRef]
Eurostat. Sewage Sludge Production and Disposal from Urban Wastewater (in Dry Substance (d.s)). Dataset
[Tables], Product Code: Ten00030, Updated on 31 Jan 2020. Available online: http://ec.europa.eu/eurostat/
tgm/table.do?tab=table&plugin=1&language=en&pcode=ten00030 (accessed on 2 July 2020).
Nair, C.G.; Chao, C.; Ryall, B.; Williams, H.D. Sub-lethal concentrations of antibiotics increase mutation
frequency in the cystic fibrosis pathogen Pseudomonas aeruginosa. Lett. Appl. Microbiol. 2013, 56, 149–154.
[CrossRef]
Kohanski, M.A.; Depristo, M.A.; Collins, J.J. Sublethal Antibiotic Treatment Leads to Multidrug Resistance
via Radical-Induced Mutagenesis. Mol. Cell 2010, 37, 311–320. [CrossRef]
Giebułtowicz, J.; Nał˛ecz-Jawecki, G.; Harnisz, M.; Kucharski, D.; Korzeniewska, E.; Płaza, G. Environmental
Risk and Risk of Resistance Selection Due to Antimicrobials’ Occurrence in Two Polish Wastewater Treatment
Plants and Receiving Surface Water. Molecules 2020, 25, 1470. [CrossRef] [PubMed]
European Committee on Antimicrobial Susceptibility Testing Breakpoint Tables for Interpretation of MICs
and Zone Diameters Version 9.0, Valid from 1 January 2019. Available online: https://korld.nil.gov.pl/pdf/
EUCAST_breakpoints_tlumaczenie_wersja%209.0_strona.pdf (accessed on 2 July 2020). (in Polish)
Bengtsson-Palme, J.; Larsson, D.G.J. Concentrations of antibiotics predicted to select for resistant bacteria:
Proposed limits for environmental regulation. Environ. Int. 2016, 86, 140–149. [CrossRef]
Appl. Sci. 2020, 10, 5816
71.
72.
73.
13 of 13
Rowe, W.P.M.; Baker-Austin, C.; Verner-Jeffreys, D.W.; Ryan, J.J.; Micallef, C.; Maskell, D.J.; Pearce, G.P.
Overexpression of antibiotic resistance genes in hospital effluents over time. J. Antimicrob. Chemother. 2017,
72, 1617–1623. [CrossRef] [PubMed]
Ju, F.; Beck, K.; Yin, X.; Maccagnan, A.; McArdell, C.S.; Singer, H.P.; Johnson, D.R.; Zhang, T.;
Bürgmann, H. Wastewater treatment plant resistomes are shaped by bacterial composition, genetic exchange,
and upregulated expression in the effluent microbiomes. ISME J. 2019, 13, 346–360. [CrossRef] [PubMed]
Liu, Z.; Klümper, U.; Liu, Y.; Yang, Y.; Wei, Q.; Lin, J.-G.; Gu, J.-D.; Li, M. Metagenomic and metatranscriptomic
analyses reveal activity and hosts of antibiotic resistance genes in activated sludge. Environ. Int. 2019, 129,
208–220. [CrossRef] [PubMed]
© 2020 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access
article distributed under the terms and conditions of the Creative Commons Attribution
(CC BY) license (http://creativecommons.org/licenses/by/4.0/).