Immunology 2004 112 471–480
doi:10.1046/j.1365-2567.2004.01905.x
Induction of nitric oxide release from the human alveolar epithelial cell line A549:
an in vitro correlate of innate immune response to Mycobacterium tuberculosis
SUGATA ROY,* SADHNA SHARMA,* MONIKA SHARMA,* RAMESH AGGARWAL & MRIDULA BOSE*
*Department of Microbiology, V. P. Chest Institute, University of Delhi, Delhi, India and Department of Microbiology,
National Institute of Communicable Diseases, Shamnath Marg, Delhi, India
SUMMARY
In view of the presence of a large number of epithelial cells in the alveoli of the lung and their
ability to produce various cytokines and chemokines, the possible role of alveolar epithelial cells
in the innate immune response to tuberculosis was examined. The human alveolar epithelial cell
line A549 was used as a model. The ability of A549 cells to induce nitric oxide (NO) in response
to Mycobacterium tuberculosis infection was taken as an in vitro correlate of innate immunity.
M. tuberculosis infection induced A549 cells to produce significant levels of NO and to express
inducible nitric oxide synthase mRNA at 48 hr of infection. However, the amount of NO
released at this point was not mycobactericidal. Cytokine stimulation (interferon-c, tumour
necrosis factor-a, interleukin-1b, alone or in combination) of the infected A549 cells induced a
higher concentration of NO. The study of colony-forming units (CFU) as a measure of the
mycobactericidal capacity of A549 cells revealed a reduction in CFU of M. tuberculosis by
39Æ29%
% (from 10Æ62 ± 0Æ48 – 6Æ392 ± 0Æ54) following cytokine stimulation of the infected
cells. Interestingly c-irradiated M. tuberculosis H37Rv could also induce higher than basal level
of NO. Therefore we examined mycobacterial antigenic components for their possible role in
NO production. We observed that A549 cells produced significantly higher amounts of NO at
48 hr when treated with mycobacterial whole cell lysates, cell wall or cell membrane preparations. The release of NO and the resultant mycobactericidal activity could be further enhanced
by simultaneously conditioning the M. tuberculosis infected A549 cells with cytokine and mycobacterial components. These results suggest that alveolar epithelial cells respond to their
microenvironment, which is constituted of various cytokines and macrophage-processed antigens
and may contribute to the innate immune response to tuberculosis.
Keywords epithelial cells, A549, NO, Mycobacterium tuberculosis, innate immune response
INTRODUCTION
Tuberculosis is acquired through inhalation of droplets
containing live Mycobacterium tuberculosis, and the lung is
the major site of disease activity. Although most studies of
the interactions between M. tuberculosis and lung cells have
focused on alveolar macrophages1–4 it is possible that the
Received 1 January 2004; revised 10 March 2004; accepted
22 April 2004.
Correspondence: Dr M. Bose, Department of Microbiology,
Vallabh Bhai Patel Chest Institute, University of Delhi, Delhi110007, India. E-mail: mridulabose@hotmail.com
2004 Blackwell Publishing Ltd
471
interactions between M. tuberculosis and alveolar epithelial
cells play an important role in the immune response during
pulmonary tuberculosis. Until recently the alveolar epithelial cells were considered as ‘bystanders’ only.5 Subsequently several reports have appeared in the literature on
the innate immune response against M. tuberculosis infection mediated by cells like neutrophils and dendritic cells.6–8
However, not much is known about the part played by the
alveolar epithelial cells during tuberculosis infection.
Type II alveolar epithelial cells are ideally situated to
play a role in local regulation of inflammatory response
within the alveolar space.9,10 These cells produce inflammatory mediators such as interleukin-8 (IL-8),11,12 prostaglandins,9 nitric oxide (NO)13,14 and complement
472
S. Roy et al.
proteins15,16 capable of modulating local immune response.
An in vitro experimental model using the alveolar epithelial
cell line A549 has demonstrated that H37Rv, a virulent
strain of M. tuberculosis can replicate within the A549 cell
line at a low multiplicity of infection (1–10 per organism)
and grow more rapidly in A549 cells than the avirulent
H37Ra strain.17–22 These studies, however, did not focus on
the ability of M. tuberculosis to induce NO production as a
mediator of innate immune response.
NO is a short-lived, readily diffusible molecule of great
biological importance. It plays a key role in signal transduction, neurotransmission, and host-defense mechanism.
NO is produced by nitric oxide synthase (NOS), a hemeprotein that catalyses the oxidation of l-arginine to NO and
citrulline.23,24 The inducible NOS (iNOS or NOS2) has
been identified as a protective locus against tuberculosis
using a transgenic mouse model NOS2– ⁄ –, and NO is shown
to be mycobactericidal in a murine system.25 Although
there are conflicting reports as to whether human monocytes ⁄macrophages are able to kill M. tuberculosis in an
iNOS-dependent manner, in earlier communications from
our laboratory26,27 we have reported that proinflammatory
cytokine stimulation of monocytes ⁄ex vivo matured
macrophages from active tuberculosis patients leads to NO
production that brings down the colony-forming units
(CFU) of M. tuberculosis in these cells. The present study
was designed to see whether infection of alveolar cells with
M. tuberculosis results in induction of NO. The possible
bactericidal activity of the induced NO on the CFU counts
of M. tuberculosis in the A549 cells was also studied. In
order to demonstrate that the NO release was an active
process, mRNA expression for the iNOS gene was correlated for each set of experiments. IL-8 estimation and
mRNA expression for IL-8 was undertaken as a measure of
activation of the A549 cell line. To understand whether
interaction with live mycobacteria is mandatory, c-irradiated H37Rv and several mycobacterial subcellular components were incorporated in the test systems. We
demonstrate that the alveolar epithelial cells upon infection
with M. tuberculosis or stimulation with mycobacterial
components induce release of NO. Additional cytokine
stimulation brings about reduction in CFU that correlates
significantly with the concentration of released NO.
MATERIALS AND METHODS
Alveolar epithelial cell line
The human pulmonary type II alveolar epithelial cell line
A549 was purchased from National Center for Cell Science,
Pune, India and was maintained in Dulbecco’s modified
Eagle’s medium (DMEM) supplemented with 10% fetal
calf serum (FCS), 2 mm glutamine, and 10 lg ⁄ml ampicillin, an antibiotic with no significant antimycobacterial
activity at this concentration, in a humidified 5% CO2
atmosphere. Epithelial cells were seeded in six-well tissue
culture plates (106 cells per well) 48 hr before use. Immediately before experiment, medium was replaced with
serum-free DMEM supplemented with 2 mm glutamine
and 10 lg ⁄ml ampicillin.
Mycobacteria
M. tuberculosis H37Rv (American Type Culture Collection,
Rockville, MD) was maintained in Lowenstein Jensen
medium slants. Mycobacteria were subcultured 15 days
prior to use in 8 ml Middlebrook 7H9 (DIFCO, Becton
Dickinson India Ltd, Haryana, India) supplemented with
albumin dextrose catalase. Prior to experiments the culture
tubes were vortexed, allowed to stand for one minute. The
upper 6 ml was withdrawn and centrifuged at 220 g for
10 min. The pellet was resuspended in DMEM supplemented with 10% FCS and passed through an 8-lm filter to
prepare a single cell suspension. The dispersed bacterial
concentration was measured by taking absorbance at
600 nm using MacFarland’s nephelometric standards.27
The bacterial concentration was adjusted to a density of 108
bacteria ⁄ml, aliquoted and kept as a single lot at 4. For
infection, the H37Rv suspension from this lot was taken
out and added in the six-well plates at 1 : 10 ratio (A549
cell: H37Rv).
Infection of A549 cells by M. tuberculosis H37Rv
and cytokine stimulation
Lung alveolar epithelial cells were infected with M. tuberculosis H37Rv and stimulated with three prime cytokines
(interferon-c (IFN-c), tumour necrosis factor-a (TNF-a)
and IL-1b), that are thought to be present in the internal
milieu of the infected lung. A549 cells grown in six-well
tissue culture wells were charged with warmed DMEM
supplemented with 2% FCS prior to infection and cytokine
exposure. Initially the monolayers were treated with
350 lmol of NG-monomethyl-arginine to suppress any
constitutive NOS activity for 2 hr (data not shown).28 In
these experiments (in triplicate) confluent monolayers of
A549 were infected with M. tuberculosis H37Rv at a ratio of
1 : 10 (cells : M. tuberculosis) in DMEM supplemented
with 10% FCS for 6 hr followed by 2 hr treatment with
amikacin (20 lg ⁄ml), an aminoglycoside antimicrobial
agent, to inhibit the growth of extracellular mycobacteria.
The monolayer was washed three times with DMEM to
remove extra cellular mycobacteria. The final wash medium
was plated on the Lowenstein Jensen (LJ) slant to confirm
the absence of extracellular mycobacteria in the medium.17
Following washing, infected monolayers were either kept
as such or stimulated with the cytokines TNF-a, IFN-c and
IL-1b individually or in combination of two or three and
incubated at 37 in a 5% CO2 atmosphere. TNF-a, IFN-c
and IL-1b were added at a concentration of 10 ng ⁄ml,
250 units ⁄ml and 50 units ⁄ml, respectively.29,30 In another
set, as a control experiment, uninfected monolayers were
exposed to the cytokines TNF-a, IFN-c and IL-1b as described above. A NO assay was performed at 24 and 48 hr,
respectively. All experiments were done in triplicate. The
kinetics of NO secretion showed an optimal production at
48 hr after cytokine stimulation. Therefore, this time period
was considered for all further observations (data not shown).
In parallel experiments subsequent addition of l-arginine,
which is a substrate for the enzyme iNOS, resulted in further
increase in the production of NO (data not shown). A549
cells were also grown on cover slips and infected with
2004 Blackwell Publishing Ltd, Immunology, 112, 471–480
Role of nitric oxide in innate immune response to tuberculosis
M. tuberculosis in the same ratio (MOI 1 : 10). Monolayers
were then washed as described above and the cover slips were
air dried and methanol fixed and stained using a modified
cold kinyoun stain. The percentage of cells infected with
M. tuberculosis was determined by counting the number of
epithelial cells associated with mycobacteria. Counts were
performed in high power field, one slide for each time point
and experiments were performed in triplicate. We also
undertook an invasion assay following a previously published protocol12,17,21,22 to demonstrate that M. tuberculosis
was able to invade A549 cells. Briefly, amikacin was added to
the culture medium to kill extracellular organisms, followed
by washing and lysing A549 cell monolayers to release the
mycobacteria. The lysates were cultured on LJ slants after
appropriate dilutions. CFU of mycobacteria was determined
after 3–4 weeks of incubation at 37.
An XTT assay31 [sodium 3¢-(1-phenylamino carbonyl)3-4-tetrazolium-bis (4-methoxy-6-nitro) benzene sulphonic
acid hydrate] (Sigma, St Louis, MO) was performed at each
time point to measure the cell growth and viability of
infected A549 cell line. A CFU assay was performed at
48 hr. Isolation of messenger RNA and reverse transcription–polymerase chain reaction (RT–PCR) was also performed at 48 hr.
Stimulation of A549 with c-irradiated H37Rv
or components of H37Rv
In a parallel set of experiments the A549 cell lines were
treated either with killed mycobacteria (c-irradiated H37Rv)
or different subcellular components of H37Rv. c-Irradiated
M. tuberculosis, whole cell lysate (WCL), cell wall, cell
membrane, cytosol and lipoarabinomannan (LAM) were all
derived from M. tuberculosis H37Rv and were kindly provided by Dr J. T. Belisle, Colorado State University, Fort
Collins, CO [http://www.cvmbs.colostate.edu/microbiology/tb]. The aim of the experiment was to determine whether M. tuberculosis bacterial components of the cell surface
and other subcellular components released after infection
could also induce NO release. Confluent monolayers of
A549 were stimulated with c-irradiated H37Rv at a ratio of
1 : 10 (cells : c-irradiated H37Rv) or were stimulated with
different components of H37Rv at the following concentrations: WCL (10 lg ⁄ml), cell wall (5 lg ⁄ml), cell membrane (5 lg ⁄ml), cytosol (5 lg ⁄ml) and LAM (5 lg ⁄ml).32
These concentrations of mycobacterial components were
found to be optimum for NO production (data not shown).
An NO was performed at 24 and 48 hr. All experiments
were repeated at least three times. An assay was performed
at each time point. Isolation of messenger RNA and RT–
CR was also performed at 48 hr.
Infection of A549 cells followed by stimulation
with cytokines and mycobacterial components
To determine the response of infected A549 cells to the
mycobacterial components and to the cytokine present in
the milieu of infected lung, the cells were infected with
H37Rv followed by simultaneous stimulation with cytokines and different components of H37Rv as were used in
the earlier experiments. NO assay was performed at 24 and
2004 Blackwell Publishing Ltd, Immunology, 112, 471–480
473
48 hr. XTT assay was performed to measure the cell growth
and viability in each well. A CFU assay was performed at
48 hr. Isolation of messenger RNA and RT–PCR was also
performed at 48 hr.
Cell viability assay (XTT assay)
To check for the cell proliferation and viability, overall
activity of mitochondrial dehydrogenase in each set of
experiments was measured according to the method of
Roehm et al.31 A549 cells were grown in a 96-well tissue
culture plate in four different concentrations (102, 103, 104,
105 and 106), followed by cytokine stimulation or infection
or antigen stimulation, according to the experimental
design described above. 25 ll of XTT in DMEM was added
to each well and incubated at 37 for 24 hr. Overall activity
of mitochondrial dehydrogenase in each well was measured
spectrophotometrically at 490 nm using 650 nm as the
reference wavelength.
NO assay
Concentration of nitrite produced by A549 cells as a
measure of the production of NO was determined by the
method of Ding et al.33 Briefly, 100 ll supernatant was
removed from each culture well at 24 and 48 hr, centrifuged
at 400 g for 10 min to make it cell free, incubated with
100 ll of Griess reagent (1% sulphanilamide, 0Æ1%
napthylethylenediamine dihydrochloride, 2Æ5% phosphoric
acid) at room temperature for 10 min Absorbance was read
at 540 nm in a Beckman DU-64 spectrophotometer.
The concentration of nitrite (NO2) was determined by
using sodium nitrite as standard. Nitrite release was
reported as lm ⁄1 · 106 cells per well. Cell-free medium was
used as blank for the assay.
Messenger RNA isolation and RT–PCR
Messenger RNA was isolated from either M. tuberculosis
infected or uninfected epithelial cells cultured in a six-well
plate that were treated with cytokines or mycobacterial
components at 37 for 48 hr. The cells were scraped using a
cell scraper and collected after centrifugation at 400 g for
15 min.34 Messenger RNA (mRNA) was isolated using
mRNA capture kit (Roche Biochemicals). Briefly the cells
were lysed using lysis buffer, biotinylated oligo (dt)20 was
added directly to the tubes and incubated for 5 min at 37.
Fifty microlitres of the mix was transferred to streptavidincoated PCR tubes and incubated for 5 min at 37. The mix
was then removed and tubes washed with the washing
buffer. The captured mRNA was used directly for RT–PCR
using specific primers and a Techne thermocycler. For each
sample, one aliquot without RT, was used as negative
control for PCR amplification. The housekeeping b-actin
gene was used as an internal control. Reverse transcription
was carried out at 42 for 60 min according to the manufacturer’s protocol.
Primer sequences were as follows: iNOS: TGGAATTC
ACTCAGCTGTGC (sense), GATGTTGTAGCGCTGG
ACG (antisense);35 IL-8: ATGACTTCCAAGCTGGCC
GTG (sense), TTATGAATTCTCAGCCCTTCTTCAAA
AACTTCTC (antisense);36 b-actin: CCAAGGCCAA
474
S. Roy et al.
CCGCGAGAAGATGAC (sense), AGGGTACATGGTG
GTGCCGCCAGAC (antisense); (one step RT–PCR kit;
Roche Biochemicals, Mumbai, India).
Cycling conditions were as follows: initial denaturation
at 94 for 2 min, 35 cycles each of denaturation at 94 for
30 s, annealing for 1 min, extension at 68 for 1 min with
final extension at 68 for 7 min. The annealing temperature
for iNOS was 54 and for IL-8 and b-actin it was 65 and
66, respectively.35,36 The RT–PCR products were run and
visualized on 1Æ5% agarose gel with ethidium bromide
along with the 100 base pair marker (MBI fermentas;
Genetix Biotech Asia Pvt Ltd, New Delhi, India).
CFU assay
To determine the effect of nitric oxide produced by the
infected A549 cell, A CFU assay was performed for each set
of experiments. Infected A549 cells were harvested at 48 hr
according to the experimental design described above, and
lysed with 0Æ5 ml of 1% Triton-X-100 for 15 min followed by
repeated passage through a 21-gauge needle to release
intracellular mycobacteria.4,27 Serial 10-fold dilutions of the
lysate were prepared in DMEM as 10)1, 10)2,10)3,10)4 and
then plated on LJ medium slants. Colonies were counted
after 3 weeks of incubation at 37 with 5% CO2 and CFU
were calculated taking the dilutions into consideration. The
number of initially ingested mycobacteria was calculated by
lysing the infected A549 cells 6 hr after amikacin treatment
and inoculating onto LJ slants, after suitable dilutions. On an
average three to five mycobacteria were taken up by each cell
and 40% of the A549 cells were infected (data not shown).
IL-8 assay
Pulmonary epithelial cells release IL-8 in response to
M. tuberculosis infection.11,12,36 As an indicator of active
response of A549 cells to M. tuberculosis infection in our
experimental protocol, the cytokine IL-8 was assayed in cell
culture supernatants at 48 hr. A solid phase sandwich
enzyme-linked immunosorbent assay method using matched antibody pairs was applied, according to the manufacturer’s instructions (Diaclone Research, Sancon,
France). Briefly, the culture supernatants were added to the
IL-8-cytokine specific monoclonal antibody-coated wells
along with biotinylated IL-8-specific monoclonal antibody.
After incubation and washing, the enzyme (strepavidin
peroxidase) was added. After incubation and washing to
remove unbound enzyme, a substrate solution was added to
induce a coloured reaction product. The intensity of the
coloured reaction is a direct measure of the concentration
of cytokine IL-8 present in the culture supernatant.
Statistical analysis
Each experiment was repeated thrice and results are
expressed as mean with standard error of mean (mean ±
SEM), Student’s t-test and t-paired tests were used to assess
significance using Graph Pad PrismTM software.
RESULTS
NO production by A549 cell line following cytokine
stimulation
The A549 cell line, which is functionally similar to the human lung alveolar epithelial cells, was used as a model to
study the innate immune response to tuberculosis. Induction
of NO release was studied as an in vitro correlate. Because
alveolar macrophages along with CD4 T cells release IFN-c,
TNF-a and IL-1b in the internal milieu of the infected
lung1,2,37 the A549 cells were stimulated with cytokines
IFN-c, TNF-a and IL-1b individually or in combination. Significant concentrations of NO were released after
stimulation with IFN-c alone (35Æ26 ± 5Æ1 lm ⁄l, P <
0Æ0001), which was comparable to that produced by the
mixture of all the three cytokines (38Æ76 ± 5Æ2 lm ⁄l,
P < 0Æ0001) at 24 hr (Table 1). The kinetics of secretion
showed an optimal production at 48 hr after cytokine stimulation, therefore this time point was considered for all
further observations. Enhanced production of NO after
addition of arginine confirmed that the iNOS pathway of
NO production is functional in A549 cells, as arginine is the
substrate for iNOS enzyme.23,24,33 Any constitutive activity
of cNOS was inhibited by addition of NG-monomethylarginine at the beginning of the experiments.28 IFN-c was
found to be significant inducer of iNOS alone or in combination with other cytokines (P < 0Æ001) (Table 1). To
Table 1. Production of nitrite by human alveolar epithelial cells A549 (lmol ⁄ 1 · 106 cells)
A549 cells
A549 cells infected with M. tuberculosis
Treatment
24 hr
48 hr
24 hr
48 hr
No cytokine
IFN-c
TNF-a
IL-1b
IFN-c + TNF-a
Cytokine mix
12Æ44 ± 3Æ3
35Æ26 ± 5Æ07*
15Æ56 ± 6Æ1
9Æ750 ± 1Æ8
29Æ43 ± 4Æ5*
38Æ76 ± 5Æ2*
13Æ30 ± 3Æ4
40Æ24 ± 6Æ68*
19Æ46 ± 2Æ9
21Æ08 ± 5Æ9
50Æ30 ± 4Æ1*
55Æ05 ± 7Æ8*
20Æ44 ± 5Æ5
41Æ16 ± 5Æ1*
23Æ75 ± 4Æ7*
18Æ51 ± 2Æ6
37Æ86 ± 4Æ9
48Æ86 ± 4Æ9*
29Æ53 ± 5Æ7*
61Æ27 ± 4Æ9*
31Æ56 ± 3Æ6*
38Æ03 ± 6Æ0*
55Æ46 ± 6Æ2*
56Æ75 ± 7Æ7*
*P < 0Æ0001 when paired t-tests were performed between A549 cells alone and cells infected with M. tuberculosis; A549 cells alone and cells stimulated with
cytokines; A549 cells alone and cells infected with M. tuberculosis followed by cytokine stimulation.
Infected cells were simultaneously stimulated with various cytokines individually or as a mixture. ‘Cytokine mix’ has all three cytokines. IFN-c, TNF-a and
IL-1b were added at a concentration of 250 unit ⁄ ml, 10 ng ⁄ ml and 50 units ⁄ ml, respectively. All the experiments were performed in triplicate and results
presented as mean ± SEM.
2004 Blackwell Publishing Ltd, Immunology, 112, 471–480
475
Role of nitric oxide in innate immune response to tuberculosis
1
(a)
2
3
4
5
6
7
genase activity continued to increase in all experimental
wells, as determined by XTT assay (data not shown).
8
322 bp iNOS
cDNA
687 bp β-actin
cDNA
(b)
Figure 1. RT–PCR result for iNOS gene (322 bp product) mRNA
expression at 48 hr. (a) Lane 1: 100 bp marker. Lane 2: A549 cells
treated with IFN-c. Lane 3: A549 cells infected M. tuberculosis
H37Rv and treated with IFN-c. Lane 4: A549 cells treated with
cytokine mixture. Lane 5: A549 cells treated with TNF-a. Lane 6:
A549 cells infected with M. tuberculosis H37Rv and treated with
TNF-a. Lane 7: A549 cells infected with M. tuberculosis H37Rv
and treated with cytokine mixture. Lane 8: Untreated A549 cells.
(b) b-actin gene mRNA (control, 687 bp product) demonstrating
equal loading in all the corresponding lanes as in (a).
specifically examine whether the NO production is due to up
regulation of iNOS mRNA expression in the alveolar epithelial cell line A549, iNOS specific cDNA synthesis following RT–PCR was performed (Fig. 1). When mRNA was
isolated from these cells at 48 hr and RT–PCR performed
for iNOS gene a good amount of RT–PCR product of 322
base pairs was obtained, which was in accordance with the
published literature.37 b-actin was used as an internal control. The cell viability was not affected by any of the cytokine used as checked by XTT assay (data not shown).
Antigenic components of H37Rv are good inducers of NO
To determine whether induction of NO by M. tuberculosis
could be due to bacterial components released after infection of cells or is caused by a constitutively expressed
bacterial component, we substituted killed (c-irradiated)
H37Rv for live bacteria. A549 cell line (106 cells ⁄ml) when
stimulated with c-irradiated H37Rv (1 · 107 cells ⁄ml) did
not produce significant levels of NO at 24 and 48 hr. But
when incubated further until 72 hr, the production rose to a
significant level (24Æ87 ± 4Æ8 lm ⁄l, P < 0Æ0001). Though
the concentration of NO was much less than that produced
by live M. tuberculosis-infected A549 cells, the observation
that killed M. tuberculosis is capable of causing induction of
iNOS indicates that one or more constitutive components
of the bacteria are competent to initiate a pathway that
results in NO induction. In a subsequent experiment
(Fig. 2) we observed that the WCL of M. tuberculosis
induced up-regulation of NO indicating that some bacterial
components too were able to exert their effects even when
not presented in the form of whole particulate bacteria.
We therefore surveyed several subcellular fractions of
M. tuberculosis H37Rv. Among the various components of
M. tuberculosis, WCL stimulated higher production of NO
(57Æ11 ± 6Æ2 lm ⁄l; P < 0Æ001) followed by cell wall
(51Æ46 ± 5Æ0 lm ⁄l; P < 0Æ001) and cell membrane fraction
(41Æ89 ± 5Æ5 lm ⁄l;P < 0Æ001) even at 24 hr of incubation
when compared with basal value (12Æ44 ± 3Æ3 lm ⁄l). In
M. tuberculosis stimulated NO production by A549 cell line
2004 Blackwell Publishing Ltd, Immunology, 112, 471–480
100
Concentration of nitrite
(µM/l)
The percentage of A549 cells infected with M. tuberculosis
H37Rv assessed by microscopy of kinyoun-stained cell
preparations showed that 40% of A549 cells were infected after 6 hr. This observation is consistent with studies
that demonstrated by invasion assay that 42 ± 5% of
A549 cells were invaded by M. tuberculosis after 4 hr
incubation.17,21,22,35
Production of NO by M. tuberculosis-infected A549 cells
indicated the active participation of alveolar epithelium in
the innate immune response to tuberculosis. The kinetics of
secretion showed an optimal production at 48 hr postinfection. Therefore this time point was considered for all
further observations. When A549 cells were infected with
M. tuberculosis the level of NO produced were negligible
initially but rose significantly at 48 hr (29Æ53 ± 5Æ7 lm ⁄l,
P < 0Æ0001) and continued to increase up to 100 hr
(66Æ09 ± 4Æ8 lm ⁄l) (data not shown). When these infected
cells were subsequently stimulated with cytokines the
amount of NO produced was much higher than that produced by uninfected cells stimulated with cytokines. Again
IFN-c was the most potent cytokine to induce this effect
(Table 1). An up-regulation of iNOS mRNA was observed
at 48 hr when RT–PCR was performed on these samples
(Fig. 1). The viability of the cells was not affected by
M. tuberculosis infection as the overall mitrochondrial dehydro-
75
24 hr
48 hr
f
f
f
50
f
f
25
0
Medium only WCL
CW
MEM
CYT
LAM
Time (hr)
Figure 2. M. tuberculosis H37Rv cell components induce NO
production by A549 cells. A549 cells were stimulated with different mycobacterial components. Cell culture supernatant
was harvested at 24 and 48 hr following stimulation. Results were
the mean ± SEM of three independent experiments (n ¼ 3).
*P < 0Æ001 when paired t-test were performed between A549 cells
alone and cells stimulated with mycobacterial components at
24 hr. /P < 0Æ001 when paired t-tests were performed between
A549 cell alone and cells stimulated with mycobacterial components at 48 hr. WCL, whole cell lysate of H37Rv; CW, cell wall of
H37Rv; MEM, membrane fraction of H37Rv; CYT, cytosol fraction of H37Rv; LAM, lipoarabinomannan of H37Rv.
476
S. Roy et al.
1
2
3
4
5
6
7
125
322 bp iNOS
cDNA
687 bp β-actin
cDNA
(b)
Figure 3. RT–PCR result for iNOS gene (322 bp product) mRNA
expression at 48 hr. (a) Lane 1: 100 bp marker. Lane 2: A549 cells
stimulated with whole cell lysate of H37Rv. Lane 3: A549 cells
stimulated with cytosol of H37Rv. Lane 4: A549 cells stimulated
with LAM of H37Rv. Lane 5: A549 cells stimulated with cell wall
fraction of H37Rv. Lane 6: A549 cells stimulated with membrane
fraction of H37Rv. Lane 7: A549 cells only. (b) b-actin gene
mRNA (control, 687 bp product) demonstrating equal loading in
all the corresponding lanes as in (a).
contrast, the cytosolic preparation did not produce significant amounts of NO at that timepoint (Fig. 2). The NO
release was sustained till 48 hr of incubation by mycobacterial components. Because LAM is a major component of
M. tuberculosis cell wall, we examined the ability of purified
LAM to induce NO production. The cells stimulated with
LAM produced insignificant amount of NO at 24 hr. At
48 hr, however, production rose to significant level (Fig. 2)
when compared to basal level production, but not significant as compared to NO concentration at 48 hr after
infection with live H37Rv (Table 1). Synthesis of iNOS was
observed in cells stimulated with WCL, cell wall and cell
membrane fractions of M. tuberculosis H37Rv as shown by
synthesis of iNOS cDNA by RT–PCR (Fig. 3). The cell
viability was not affected by any of the mycobacterial
component used, as determined by XTT assay (data not
shown).
Booster effect of mycobacterial components and
cytokine mixture on NO production by infected cells
To determine whether the mycobacterial antigens processed
and presented by alveolar macrophages in the lung has any
role to play in the mycobacteria–alveolar epithelial cell
interaction, infected A549 cells were stimulated with cytokine mixture and with various mycobacterial components.
When the infected cells were stimulated with mycobacterial
components alone the production of NO lasted only 48 hr
but when infected cells were stimulated with cytokinemixture along with mycobacterial antigens the induction of
NO continued until 100 hr (Fig. 4). When the level of NO
released from these cells were compared with NO released
by cells infected and cytokine mixture treated, the enhanced
production was statistically significant in case of WCL and
cell wall (P < 0Æ05). This increased production was
observed after 48 hr of incubation and beyond. The viability of the infected cells was not affected by simultaneous
stimulation with cytokine mixture together with various
antigenic components of M. tuberculosis as determined by
XTT assay (data not shown).
ϕ
100
Concentration of nitrite
(µM/l)
(a)
ϕ
24 hr
48 hr
72 hr
100 hr
75
50
25
0
Medium H37Rv WCL
CW
MEM
Time (hr)
CYT
LAM
Figure 4. M. tuberculosis components induced NO production from
A549 cells infected with M. tuberculosis followed by stimulation
with a cytokine mix along with different mycobacterial components. For estimation of NO, cell culture supernatants were harvested at 24, 48, 72 and 100 hr following stimulation. Results were
the mean ± SEM of three independent experiments (n ¼ 3). When
paired t-tests were performed between A549 cells alone and infected A549 cells stimulated with the cytokine mixture and mycobacterial components, the P-value was <0Æ001 in the case of all
components. Paired t-tests were also performed between infected
A549 cells stimulated with cytokine mixture only and infected A549
cells simultaneously treated with the cytokine mixture and different
antigenic components. The P-value (u) was < 0Æ05 in experiments
using WCL and CW only. WCL, whole cell lysate of H37Rv; CW,
cell wall of H37Rv; MEM, membrane fraction of H37Rv; CYT,
cytosol fraction of H37Rv; LAM, lipoarabinomannan of H37Rv.
(Infection with H37Rv and cytokine stimulation was common in all
experiments shown here as a bar diagram.)
Intracellular mycobactericidal activity of A549 cells
In order to relate the nitrite production by A549 cells with
intracellular mycobacterial killing, the percentage viable
count of intracellular M. tuberculosis was determined. The
amount of NO produced from the A549 cells infected with
M. tuberculosis was not sufficient to kill the mycobacteria.
It was only after cytokine stimulation leading to enhanced
production of NO that these cells could bring down the
CFU. The reduction was 34Æ87% when only IFN-c was
used, 36Æ37% when IFN-c + TNF-a were used, and 39Æ29%
when all the cytokines are used to stimulate infected A549
cells. Lowered mycobacterial colony counts correlated with
the log phase of NO release at 48 hr (Table 2).
IL-8 production by infected A549 cell line
As a measure of activation of the A549 cells we undertook
IL-8 estimation in the culture supernatant of A549 cells
at various experimental timepoints as described earlier.11,12,36 We checked for mRNA expression for the IL-8
gene in the same experimental sets. The basal value for
production of IL-8 by the A549 cells was below the detection level. Stimulation of IL-8 production and IL-8 mRNA
expression (Fig. 5) following M. tuberculosis infection,
2004 Blackwell Publishing Ltd, Immunology, 112, 471–480
477
Role of nitric oxide in innate immune response to tuberculosis
Table 2. Correlation of nitric oxide production and mycobactericidal activity of A549 cells, infected with M. tuberculosis H37Rv
and stimulated with various cytokines
A549 + H37Rv +
(IFN-c + TNF-a)
A549 + H37Rv +
(IFN-c + TNF-a +
IL-1b)
A549 + H37Rv
24 hr
48 hr
Nitric oxide
(lmol ⁄ l)
CFU ⁄ ml ⁄ well
(·104)
% Reduction
in CFU
Nitric oxide
(lmol ⁄ l)
CFU ⁄ ml ⁄ well
(·104)
% Reduction
in CFU
Nitric oxide
(lmol ⁄ l)
CFU ⁄ ml ⁄ well
(·104)
% Reduction
in CFU
Nitric oxide
(lmol ⁄ l)
CFU ⁄ ml ⁄ well
(·104)
41Æ16 ± 5Æ1
61Æ27 ± 4Æ9
9Æ285 ± 0Æ29
6Æ858 ± 0Æ37
12Æ07%
34Æ87%
37Æ86 ± 4Æ9
55Æ46 ± 6Æ2
9Æ083 ± 0Æ64
6Æ7 ± 0Æ54
13Æ74%
36Æ37%
48Æ86 ± 4Æ9
56Æ75 ± 7Æ7
9Æ283 ± 0Æ61
6Æ392 ± 0Æ54
11Æ84%
39Æ29%
20Æ02 ± 5Æ5
29Æ53 ± 5Æ7
10Æ26 ± 0Æ2
10Æ62 ± 0Æ48
Percent reduction was calculated from CFU ⁄ ml at 6 hr after amikacin
treatment and washing in each set of experiments. CFU ⁄ ml at 6 hr was
10Æ53 ± 0Æ71 which was the basal value. Basal value of nitrite at 6 hr was
5Æ68 ± 3Æ1 lm ⁄ l. IFN-c, TNF-a and IL-1b were added at a concentration of
250 units ⁄ ml, 10 ng ⁄ ml and 50 units ⁄ ml, respectively.
indicates activation of the A549 cells. Cells infected with
M. tuberculosis produced 190Æ5 pg ⁄ml of IL-8 at 48 hr. The
level was further increased after cytokine stimulation of the
cells. The cytokine mixture stimulation further enhanced
IL-8 production by the A549 cells (480Æ9 pg ⁄ml at 48 hr).
The level of IL-8 was also increased after stimulation of
A549 cells with WCL (159Æ8 pg ⁄ml), cell wall (84Æ51 pg ⁄ml),
membrane (69Æ25 pg ⁄ml), LAM (48Æ65 pg ⁄ml) and cytosol
(45Æ35 pg ⁄ml) fraction of M. tuberculosis H37Rv at 48 h
(Fig. 6).
1
(a)
2
3
4
5
6
7
8
9
300 bp IL-8
cDNA
687 bp β-actin
cDNA
(b)
Figure 5. RT–PCR result for IL-8 gene (300 bp product) mRNA
expression at 48 hr. (a) Lane 1: 100 bp pair marker. Lane 2:
Cytokine mixture stimulated A549 cells. Lane 3: IFN-c stimulated
A549 cells. Lane 4: IFN-c + TNF-a stimulated A549 cells. Lane 5:
TNF-a stimulated A549 cells. Lane 6: A549 cells infected with
H37Rv. Lane 7: A549 cells infected with H37Rv and stimulated
with IFN-c. Lane 8: A549 cells infected with H37Rv and stimulated
with cytokine mixture. Lane 9: A549 cells only. (b) b-actin gene
mRNA (control, 687 bp product) demonstrating equal loading in
all the corresponding lanes as in (a).
2004 Blackwell Publishing Ltd, Immunology, 112, 471–480
400
Concentration of IL-8
(pg m/l)
A549 + H37Rv +
IFN-c
Treatment
500
300
200
100
0
1
2
3
4
5
6
7
8
9
10
Time (hr)
Figure 6. Concentration of IL-8 produced by A549 cells stimulated
with cytokines, infected with live M. tuberculosis (H37Rv) and
different mycobacterial components. Cell culture supernatant was
harvested at 48 hr following stimulation. Results are mean ± SEM
of three independent experiments (n ¼ 3). Paired t-tests were performed between A549 cells alone and A549 cells after various
treatment. The P-value (w) was < 0Æ001. Lane 1: A549 cells only.
A549 treated with IFN-c (lane 2), TNF-a (lane 3), cytokine mixture
(lane 4), Live H37Rv (lane 5), mycobacterial WCL (lane 6),
mycobacterial cell wall component (lane 7), mycobacterial membrane preparation (lane 8), mycobacterial cytosol (lane 9), LAM
(lane 10).
DISCUSSION
Once inhaled into the alveoli of the lung, M. tuberculosis
associates itself with macrophages in the alveolar spaces
that play a significant role in the survival and multiplication
of tubercle bacilli in the body of the infected host.1–4,23,24
Most of these earlier studies were primarily limited to the
role of alveolar macrophages in immunopathogenesis of
tuberculosis. Recently, however, a number of studies have
described that M. tuberculosis can invade and replicate
within type II alveolar epithelial cells.17,18,20 Whether
M. tuberculosis enters epithelial cells either to replicate or to
avoid the mechanism of host defence is not clear. Earlier it
was thought that a mode of infection via non-professional
phagocytic cells like epithelial cells might enable the bacteria to escape potentially hostile environment of macrophages and would create a niche for the bacteria to replicate
and establish the infection.5 However, an increasing body
of evidence suggests that the epithelial cells may play an
important role in initiation of the acute inflammatory
response to microbial pathogens by producing chemokines
like IL-8 and MCP-1.11,12,21 In this study, we demonstrate
that alveolar epithelial cells play an active role in the innate
immunity to M. tuberculosis by elaboration of NO in
response to infection with mycobacteria as also to the
presence of mycobacterial components in the milieu.
Earlier reports have also demonstrated NO production
by A549 cells in response to proinflammatory cytokines.13,14,28–30 For our experiments we selected three of the
proinflammatory cytokines that are released when
M. tuberculosis infects the alveolar macrophages and are
thought to be present in the internal milieu of the infected
478
S. Roy et al.
lung.1–3,26 Alveolar macrophages and monocytes recruited
early in the course of pulmonary infection with M. tuberculosis have previously been shown to be the major cellular
source of immune regulatory and proinflammatory mediators including NO in the lung.4,23,24,27 Our data presented
here suggest that not only monocytes ⁄macrophages but
also pulmonary epithelial cells could also have a major role
to play in the pathogenesis ⁄host defence against pulmonary
tuberculosis. Here, we observed that direct infection of
A549 cells with M. tuberculosis causes low-level NO release.
Further, cytokine stimulation of these infected A549 cells
caused substantial induction of NO production. A recent
study reported that M. tuberculosis was able to directly
stimulate low-level secretion of both IL-8 and monocyte
chemoattractant protein-1 in pulmonary epithelial cells
over a period of 1–6 days.11,12,36 When we investigated IL-8
secretion from pulmonary epithelial cell line A549 directly
infected with M. tuberculosis, we also found release of this
cytokine up to 48 hr. Therefore direct exposure of alveolar
epithelium to virulent mycobacteria does appear to activate
the epithelium to secrete chemokines as well as NO.
IFN-c was found to be the critical mediator of NO
production among the three proinflammatory cytokines
used. The cytokine mixture stimulation greatly enhanced
the production of NO from the A549 cells infected with
mycobacteria. This could mean that the elaboration of
these cytokines by the alveolar macrophages in response to
mycobacterial infection are able to stimulate alveolar epithelial cells to produce NO in the actual in vivo situation.
We demonstrated that de novo synthesis of NO was
occurring as the iNOS mRNA expression from A549 cells
was demonstrated by RT–PCR in these cells. Inducible
NOS expression is also reported to be increased in macrophages during inflammation, possibly indicating that the
iNOS may be readily induced in the context of priming
events such as during inflammation, which is further complemented by M. tuberculosis ingestion to provide a fully
activating signal for iNOS induction.4,27 Because iNOS is a
highly conserved single gene14,29,30,38 the same mechanism
applies for the A549 cells in all probability.
Investigations to study the mycobactericidal capacity of
the alveolar epithelial cells revealed some interesting observations. The A549 cells, when infected with M. tuberculosis
without cytokine stimulation, released NO was insufficient
to reduce the CFU of mycobacteria. It was necessary to
stimulate the alveolar epithelial cells by cytokines to bring
down the CFU (Table 2). Our results confirm earlier
reports4,27 that cytokine mixture leads to release of very high
concentration of NO. We further demonstrated that the
reduction in CFU occurred in the same wells. This observation suggested a clear relationship between the amount
of NO released and the control of growth of intracellular
mycobacteria within the alveolar epithelial cells.
Another interesting observation was the c-irradiated
M. tuberculosis induced production of NO by alveolar
epithelial cells, although this effect was produced only after
prolonged incubation for up to 72 hr. That the killed
mycobacteria could induce production of NO suggested
that some constitutive component of M. tuberculosis has
the potential to induce NO release. Mycobacterial cell
surface has unusual physicochemical properties attributable
to peptidoglycan, arabinogalactan and mycolic acids present in it.2,23,24 Various subcellular components of
M. tuberculosis, namely, WCL, cell wall, cell membrane,
cytosol preperation and LAM were used in our experimental protocols. The results demonstrated that WCL, cell
wall and cell membrane components induced significant
production of NO and iNOS mRNA expression whereas
cytosol and LAM could not. Our results suggested that
while live M. tuberculosis has the potential to directly infect
alveolar cells, NO production could be brought about by
either M. tuberculosis or its antigenic components in the
milieu of the alveolus. Although LAM, a highly immunogenic mycobacterial cell wall component, is associated with
NO production from rodent macrophages1,2 in our
experimental set up we could not find any significant
inducible effect of LAM on NO production or iNOS
mRNA expression from the human alveolar cell A549.
Such an observation may be because of the fact that LAM
has been reported to be responsible for scavenging mycobactericidal molecules like superoxide and NO from the
local environment. Exposure of macrophages to high concentration of purified M. tuberculosis LAM is shown to
result in defective responses to IFN-c, including transcriptional activation, intracellular microbicidal activity,
expression of major histocompatibility complex class II
molecules and cytotoxicity for tumour cells.32,39 Same
mechanism may be responsible for less production of NO
by LAM in our experimental setup because the iNOS gene
is reportedly IFN-c responsive.1,2
We may summarize that alveolar epithelial cells play an
active role in innate immunity by de novo production of NO
although the amount of NO produced by direct infection of
A549 cells is not sufficient for mycobacterial killing. However, our results indicate that cytokine stimulation of the
infected cells lead to definite mycobacterial killing and
reduction of mycobacterial load, at least in an in vitro
situation. These results along with our observation of
enhanced NO release induced by cell wall and cell membrane component opens a new area of investigation for
immunotherapeutic interventions in pulmonary tuberculosis. Further analysis of the precise components of
M. tuberculosis will be necessary to definitely identify the
molecule(s) responsible for initiating NO production. The
identified mycobacterial components may find clinical
application in future as subunit vaccine or immune
modulators to enhance the anti mycobacterial defence
mechanism especially in drug resistant mycobacterial
infection.
ACKNOWLEDGMENTS
The gift of c-irradiated H37Rv, whole cell lysate, cell wall, membrane, cytosol, LAM of M. tuberculosis H37Rv from J. T. Belisle
(Colorado State University) is gratefully acknowledged. We are
thankful to the Indian Council of Medical Research, India and the
Department of Science and Technology, Government of India for
providing financial support.
2004 Blackwell Publishing Ltd, Immunology, 112, 471–480
Role of nitric oxide in innate immune response to tuberculosis
REFERENCES
1 Ellner JJ. Review: The immune response in tuberculosisimplication for tuberculosis control. J Infect Dis 1997; 176:
1351–9.
2 Fenton MJ, Vermeulen MW. Immunopathology of tuberculosis: Roles of macrophages and monocytes. Infect Immun 1996;
64:683–90.
3 Fulton SA, Cross JV, Toossi ZT, Boom WH. Regulation of
interleukin-12 by interleukin 10, transforming growth factor-b,
tumour necrosis factor-a and interferon-c in human monocytes
infected with Mycobacterium tuberculosis H37Ra. J Infect Dis
1998; 178:1105–14.
4 Rich EA, Torres M, Sada E, Finegan CK, Hamilton BD,
Toossi Z. Mycobacterium tuberculosis stimulated production of
nitric oxide by human alveolar macrophages and relationship of
nitric oxide production to growth inhibition of MTB. Tubercle
Lung Dis 1997; 78:247–55.
5 Hernandez-Pando R, Jeyanathan M, Mengistu G, Rook GAW.
Persistence of DNA from Mycobacterium tuberculosis in
superficially normal lung tissue during latent infection. Lancet
2000; 356:2133–8.
6 Bennouna S, Bliss SK, Curiel TJ, Denkers EY. Cross-Talk in
the innate immune system. Neutrophils instruct recruitment
and activation of dendritic cells during microbial infection.
J Immunol 2003; 171:6052–8.
7 Fulton SA, Reba SM, Martin TD, Boom WH. Neutrophil
mediated mycobacteriocidal immunity in the lung during
Mycobacterium bovis BCG infection in C57BL ⁄ 6 mice. Infect
Immun 2002; 70:5322–7.
8 Kisich KO, Higgins M, Diamond G, Heifets L. Tumor necrosis
factor alpha stimulates killing of Mycobacterium tuberculosis by
human neutrophils. Infect Immun 2002; 70:4591–9.
9 Schneeberger EE. Alveolar type II cells. In: RJ Crystal, J B
West, eds. The Lung Scientific Foundations. Raven Press: New
York, 1991:736–58.
10 Simon RH, Paine R. 3rd. Participation of pulmonary alveolar
epithelial cells in lung inflammation. J Lab Clin Med 1995;
126:108–18.
11 Standiford TJ, Kunkel SL, Basha MA, Chensue SW, Lynch
JP, Toews GB, Westwick J, Strieter RM. Interleukin-8
gene expression by pulmonary epithelial cell line: a model
for cytokine networks in the lung. J Clin Invest 1990;
86:1945–53.
12 Wickremasinghe MI, Thomas LH, Friedland JS. Pulmonary
epithelial cells are a source of IL-8 in the response to Mycobacterium tuberculosis: essential role of IL-1 from infected
monocytes in a NF-jB dependent network. J Immunol 1999;
163:3936–47.
13 Asano K, Chee CBE, Gaston B, Lilly CM, Gerard C, Stamler
JS. Constitutive and inducible nitric oxide synthase gene
expression, regulation, and activity in human lung epithelial
cells. Proc Natl Acad Sci U S A 1994; 91:10089–93.
14 Robbins RA, Barnes PJ, Springall DR. Expression of inducible
nitric oxide in human lung epithelial cells. Biochem Biophys
Res Commun 1994; 203:209–18.
15 Ferguson JS, Schlesinger LS. Pulmonary surfactant in innate
immunity and pathogenesis of tuberculosis. Tubercle Lung Dis
2000; 80:173–84.
16 Gaynor CD, McCormack FX, Voelker DR, McGowan SE,
Schlesinger LS. Pulmonary surfactant protein A mediates
enhanced phagocytosis of Mycobacterium tuberculosis by a
direct interaction with human macrophages. J Immunol 1995;
155:5343–51.
2004 Blackwell Publishing Ltd, Immunology, 112, 471–480
479
17 Bermudez LE, Goodman J. Mycobacterium tuberculosis invades
and replicates within type II alveolar cells. Infect Immun 1996;
64:1400–6.
18 Castro-Garza J, King CH, Swords WE, Quinn FD. Demonstration of spread by Mycobacterium tuberculosis bacilli in A549
epithelial cell monolayers. FEMS Microbiol Lett 2002;
212:145–9.
19 Dobos KM, Spotts EA, Quinn FD, King CH. Necrosis of lung
epithelial cells during infection with Mycobacterium tuberculosis
is preceded by cell permeation. Infect Immun 2000; 68:6300–
10.
20 Garcia-Perez BE, Mondragon-Flores R, Luna-Herrera J.
Internalization of Mycobacterium tuberculosis by macropinocytosis in non phagocytic cells. Microb Pathog 2003; 35:49–55.
21 McDonough KA, Kress Y. Cytotoxicity for lung epithelial cell
is a virulence-associated phenotype of Mycobacterium tuberculosis. Infect Immun 1995; 63:4802–11.
22 Mehta PK, King CH, White EH, Murtagh JRJJ, Quinn FD.
Comparison of in vitro models for the study of Mycobacterium
tuberculosis invasion and intracellular replication. Infect
Immun 1996; 64:2673–9.
23 Celada A, Nathan C. Macrophage activation revisited. Immunol Today 1994; 15:100–2.
24 Nathan C, Hibbs J. Role of nitric oxide synthesis in macrophage antimicrobial activity. Curr Opin Immunol 1991; 3:65–
70.
25 MacMicking JD, North RJ, LaCourse R, Mudgett JS, Shah
SK, Nathan CF. Identification of nitric oxide synthase as a
protective locus against tuberculosis. Proc Natl Acad Sci USA
1997; 94:5243–8.
26 Bose M, Farnia P. Proinflammatory cytokines can significantly
induce human mononuclear phagocytes to produce nitric oxide
by a cell maturation dependent process. Immunol Lett 1995;
48:59–64.
27 Bose M, Farnia P, Sharma S, Chattopadhya D, Saha K.
Nitric oxide dependent killing of Mycobacterium tuberculosis
by human mononuclear phagocytes from patients with
active tuberculosis. Int J Immunopathol Pharmacol 1999;
12:69–79.
28 Kwon S, George SC. Synergistic cytokine-induced nitric oxide
production in human alveolar epithelial cells. Nitric Oxide Biol
Chem 1999; 3:348–57.
29 Chu SC, Marks-Konczalik J, Wu HP, Banks TC, Moss J.
Analysis of the cytokine stimulated human inducible nitric
oxide synthase (iNOS) gene: characterization of differences
between human and mouse iNOS promoters. Biochem Biophys
Res Commun 1998; 248:871–8.
30 Marks-Konczalik J, Chu SC, Moss J. Cytokine mediated
transcriptional induction of the human inducible nitric oxide
synthase gene requires both activator protein 1 and nuclear
factor jB-binding sites. J Biol Chem 1998; 273:22201–8.
31 Roehm NW, Rodgers GH, Hatfield SM, Glasebrook AL. An
improved colorimetric assay for cell proliferation and viability
utilizing the tetrazolium salt XTT. J Immunol Methods 1991;
142:257–65.
32 Ting LM, Kim AC, Cattamanchi A, Ernst JD. Mycobacterium
tuberculosis inhibits IFN-c transcriptional responses without
inhibiting activation of STAT1. J Immunol 1999; 163:3898–
906.
33 Ding AH, Nathan CF, Stuehr DJ. Release of reactive nitrogen
intermediates and reactive oxygen intermediates from mouse
peritoneal macrophages. Comparison of activating cytokines
and evidence for independent production. J Immunol 1988;
141:2407–12.
480
S. Roy et al.
34 Chomczynski P, Sacchi N. Single-step method of RNA isolation by acid guanidinium thiocyanate-phenol-choroform
extraction. Anal Biochem 1987; 162:156–9.
35 Nozaki Y, Hasegawa Y, Ichiyama S, Nakashima I, Shimokata
K. Mechanism of nitric oxide-dependent killing of Mycobacreium bovis BCG in human alveolar macrophages. Infect
Immun 1997; 65:3644–7.
36 Lin Y, Zhang M, Barnes PF. Chemokine production by a
human alveolar epithelial cell line in response to Mycobacterium
tuberculosis. Infect Immun 1998; 66:1121–6.
37 Flesch IE, Kaufmann SH. Role of cytokines in tuberculosis.
Immunobiology 1993; 189:316–39.
38 Spitsin SV, Koprowski H, Michaels FH. Characterization and
functional analysis of the human inducible nitric oxide synthase
gene promoter. Mol Med 1996; 2:226–35.
39 Sibley LD, Hunter SW, Brennan PJ, Krahenbuhl JL. Mycobacterial lipoarabinomannan inhibits c interferon-mediated
activation of macrophages. Infect Immun 1988; 56:1232–6.
2004 Blackwell Publishing Ltd, Immunology, 112, 471–480