IRANIAN JOURNAL OF BOTANY 25 (1), 2019
DOI: 10.22092/ijb.2019.124520.1227
NOTES ON THE GENUS DICTYOTA (DICTYOTACEAE, PHAEOPHYCEAE) IN
THE PERSIAN GULF, IRAN
M. Sadeghi, B. A. Fakheri, J. Sohrabipour, A. Emamjomeh & D. Samsampour
Received 2018. 12. 25; accepted for publication 2019. 04. 17
Sadeghi, M., Fakheri, B.A., Sohrabipour, J., Emamjomeh, A. & Samsampour, D. 2019. 06. 30: Notes on the genus
Dictyota (Dictyotaceae, phaeophyceae) in the Persian Gulf, Iran.- Iran. J. Bot. 25 (1): 61-71. Tehran.
In this research, the taxonomic status of the genus Dictyota in southern coastlines of Iran was studied. Taxonomy of
the genus at species levels is complicated and difficult due to the high morphological plasticity in response to
environmental conditions and overlapping of diagnostic characters. In this study, we combined morphological
information with cytoplasmic barcoding data from DNA rbcL and psbA. We identified Dictyota acutiloba as new
record and also confirmed the presence of Dictyota ciliolata in the Persian Gulf and Gulf of Oman. Our studies showed
D. ciliolata species has high inter-specific morphological diversity.
Mahnaz Sadeghi, Department of Plant Breeding and Biotechnology, Faculty of Agriculture, University of Zabol, Iran,
Barat Ali Fakheri (correspondences <ba_fakheri@yahoo.com>) Department of Plant Breeding and Biotechnology,
Faculty of Agriculture, University of Zabol, Zabol, Iran. -Jelveh Sohrabipour, Agricultural and Research and
Education Center of Hormozgan, Bandar Abbas, Agricultural Research, Education and extension Organization, Iran.
-Abbasali Emamjomeh, Department of Plant Breeding and Biotechnology, Faculty of Agriculture, University of Zabol,
Iran. -Davood Samsampour, Department of Horticultural Sciences, Faculty of Agriculture, University of Hormozgan,
Iran.
Key words: Brown algae; Dictyota; DNA barcoding; new record; psbA; rbcL
جلبکهای قهوهای) در سواحل ایرانی خلیج فارس، Dictyotaceae (خانوادهDictyota نکاتی در مورد جنس
دانشگاه زابل، دانشجوی دکتری بیوتکنولوژی کشاورزی:مهناز صادقی
دانشگاه زابل، استاد گروه اصالح نباتات و بیوتکنولوژی:براتعلی فاخری
آموزش و ترویج کشاورزی، سازمان تحقیقات، عضوهیئت علمي مرکز تحقیقات کشاورزی ومنابع طبیعي استان هرمزگان:جلوه سهرابی پور
دانشگاه زابل، استادیار گروه اصالح نباتات و بیوتکنولوژی:عباسعلی امام جمعه
دانشگاه هرمزگان، استادیار گروه باغباني:داوود صمصامپور
طبقهبندی این جنس در سطح گونه بهدلیل. درسواحل جنوبي ایران مورد بررسي قرار گرفتDictyota در این مطالعه وضعیت تاکسونومیک جنس
اطالعات، برای روشن شدن.تنوع باالی مورفولوژیک در پاسخ به شرایط محیطي و همچنین همپوشاني ویژگيهای تشخیصي پیچیده و دشوار است
به عنوان یکDictyota acutiloba در این مطالعه گونه. تلفیق کردیمpsbA وrbcL مورفولوژیک را با دادههای تواليهای ژنهای سیتوپالسمي
همچنین بررسيهای ما نشان. را براساس مطالعات درخلیج فارس تأیید نمودیمDictyota ciliolata رکورد جدید از منطقه شناسایي کرده و حضور
. دارای تنوع مورفولوژیک درون گونهای باالیي ميباشدD. ciliolata داد که گونه
INTRODUCTION
The genus Dictyota J. V. Lamouroux is a
considerable proportion of tropical marine flora
(Tronholm & al. 2010a) and grow in intertidal and
shallow subtidal habitats on rocky beaches worldwide
(Herren & al. 2006; Sotka and Hay 2009). Totally 97
specific and infraspecific taxa were registered for the
gens in algaebase website (Guiry & Guiry 2018). The
62 Notes on the genus Dictyota in the Persian Gulf, Iran
general definition of Dictyotales is often based on
morphology and anatomical characters (AltamiranoCerecedo & al. 2007; Wang & al. 2013). Vegetative
characters in the Dictyotales member are very diverse
(Tronholm & al. 2008; Steen & al. 2017). Accordingly,
the classifications of Dictyota has been reviewed
several times (De Clerck & al. 2006; Tronholm & al.
2013). The morphological plasticity and inability to
distinguish valuable characters, especially in the great
Dictyota genus, have led to a long and difficult
taxonomic challenges (Silberfeld & al. 2014). The
same species of the genus are grouped in separate
categories based on apparent differences, or vice versa,
different species categories in one group according to
the apparent similarity (Tronholm & al. 2010b). Some
morphological features such as the presence of the
dentate margin, teeth shape, and the intervals at the
interdichotomies, widely used to determine the
Dictyota members in species level boundaries while
these characters may lead to wrong classifications
(Gauna & al. 2013). Hwang & al., 2005 reported a
change in the thalli length of the Dictyota on the coast
of Korea as a result of environmental conditions
changes in each location (Hwang & al. 2005). The
reported thalli length is variable due to environmental
factors, especially temperature (Pirian & al. 2016).
Recent studies have shown that morphological data
without approving by DNA sequence data analyses is
not enough to evaluate species diversity and determine
the boundaries of species (Amini & al. 2013). The
emergence of molecular markers has provided a new
insight into the classification and DNA-sequence based
taxonomy to solve many taxonomic challenging issues
(Leliaert & al. 2014). Phylogenetic analysis based on
nuclear, chloroplasts and mitochondrial DNA
sequences, provided detailed views on the diversity of
brown algae species (Lee & al. 2011). To date, seven
species of the genus Dictyota, have previously been
reported from southern coastlines of Iran (The Persian
Gulf and Gulf of Oman), which are classically
identified based on morphology (Silva& al. 1996;
IRAN. J. BOT. 25 (1), 2019
Sohrabipour & Rabii 1999; Sohrabipour & al. 2004;
Kokabi & Yousefzadi 2015). The focus of this study
was to evaluate the taxonomy of Dictyota in this region,
based on combination of morphological studies and
phylogenetic analyses of DNA, using the rbcL and
psbA sequences data.
MATERIALS AND METHODS
Specimen collection
Specimens of the genus Dictyota were collected
from Hormozgan province (Hormoz and Qeshm
islands, Bandar-Jask and Bandar-Lenge), Bushehr
Province (Bandar-Dayyer) in northern parts of Persian
Gulf (Iran) in February, March and April 2017 (table
1). The collected algae were cleaned and transferred to
the laboratory for further processing and herbarium
samples were prepared and deposited at the Herbarium
of the Research institute of Forests & Rangelands
(TARI) and the herbarium of Agricultural and Natural
Resource Research and Education Centre of
Hormozgan Province, Bandarabbas, Iran.
Molecular studies
Total genomic DNA was extracted using the
modified CTAB method (Doyle & Doyle 1990). The
DNA samples were stored at -20°C and used as
templates for PCR amplification. Partial regions of
rbcL (~ 790bp) and psbA(~ 1000 bp) were amplified
using the primers (table 1) designed by PRIMER3
software (Untergasser & al. 2012). The 20ml reactions
contained 10 ml 2x pcr master mix, 1 ml of each primer
and 1 ml of template DNA (100 ng) and the final
volume was adjusted up to 20 ml with distilled water.
The cycle was for 5 min initial denaturation at 94°C,
followed by 35 cycles of 94°C for 45s, annealing at
53°C for 45s for the rbcL region and 51°C for 45s for
the psbA, extension at 72°C for 1min, and a final
extension at 72°C for 5 min. The PCR products were
then purified and sequenced on an automated HiSeq
2000/250 sequencer (Illumina Inc., San Diego, USA)
by Macrogen (Seoul, Korea).
Table 1. Primer sequences used in this study.
Gene
Sequence (5’ > 3’)
(rbcL)
Fwd
TATTCCGAATCACACCTCAGC
Rev
TTTGGCGAGCATATGTTGAA
(psbA)
Fwd
ATGACTGCTACTTTAGAAAGACG
Rev
TCATGCATWACTTCCATACCTA
Phylogenetic analyses
The raw DNA sequences were edited using
ChromasPro ver.2.1.3. (Technelysium Pty Ltd,
Queensland, Australia) and blasted against the
this study
this study
Olivier De Clerck&al (2010)
Olivier De Clerck&al(2010)
sequences of rbcL and psbA genes of the genus
Dictyota. The sequences were aligned using ClustalX
n.2.0.8 (Larkin & al. 2007) and manually adjusted
using BioEdit v.7.0.9.0 (Hall 1999). The best-fit
IRAN. J. BOT. 25 (1), 2019
M. Sadeghi & al.
models were selected using the corrected Akaike
information criterion for the maximum likelihood (ML)
(Akaike 1973) in KAKUSAN version 3(Tanabe 2007).
The sequences were analyzed for ML with 1000
bootstrap replicates using TREEFINDER version
October 2008. The accession numbers and collection
data of the specimens investigated in this study and the
acquired accession numbers from GenBank are shown
in table 2.
RESULTS
Molecular analyses
The rbcL phylogenetic tree showed that the
sequences of specimens including JA2, QE6, LE2 and
HO3 from southern coastlines of Iran grouped with D.
ciliolata with high bootstrap support for ML analaysis
(fig.1) and sequences of specimens including LE1, LE3
and DA1 from southern coastlines of Iran grouped with
D. acutiloba with high bootstrap support for ML
analysis (fig.1).
Morphological study of Dictyota ciliolata
The specimens identified as D. ciliolata using the
molecular analyses (figs.1 and 2) were collected from
the intertidal zones of Bandar-Lenge, Bandar-Jask,
Qeshm and Hormuz Islands (table 2), revealed
considerable variations in their morphology (fig. 3: A,
63
D & G). Thalli were flattened, erect or prostrate and
ribbon-like. Some of the specimens had smooth
margins [HO3 (fig.3 G)] whereas others were dentate
[QE6 (fig.3 A), LE2 (fig.3 D) and JA2]. The colors
varied from light green to medium brown. Thalli were
(3.5) 5-8 (13) cm in length and (1) 2-4 (6) mm width
with marginal proliferations. The phaeophycean hairs
were present in some specimens. All specimens had
dichotomous branching with different branching angles
of (20) 40-60 (70) degrees, showing smooth or twisted
growth patterns. We mainly observed regular
branching patterns (fig.3 A & G) rather than irregular
ones (fig.3.D). The main axis of all thalli had almost
uniform width but varied in length [short and wide:
HO3 (fig.3 G) vs. slender QE6 (fig.3 A), LE2]. Interdichotomies sizes ranged from (1) 1.5-2.5 (3) cm in
length and (1) 2-4 (6) mm in width. Apices were acute
(LE2 and JA2) or truncate (QE6 and HO3). At apical
segments, the dichotomous intervals are (1) 2-6 (12)
mm in length and (1) 1-2 (4) mm in width. Cross
sections with 50-290 µm thickness included two layers
of cortex and one layer of medullary cells. Both
monolayer cortex contained small and regular cells
(fig.3 C, F & I), which were 15-25 µm long and 10-15
µm wide. Medulla was also monolayer and contained
large cells of 50-350 µm long and 25-275 µm wide. The
detailed morphological data are presented in table 3.
Table 2. Specification of morphotypes of Dictyota with the collection details and GenBank accession numbers for
rbcL and psbA sequences.
code
Locality
Dictyota ciliolata
QE6 shibderaz, Qeshm island
HO3 Hormuz island
LE2 Bandar-lenge
JA2
Bahal, Bandar-jask
Dictyota acutiloba
LE1 Bandar-e Lenge
LE3 Bandar-e Lenge
DA1 Bandar-e Dayyer
Latitude and longitude
Collection
date
GenBank
Acc. no. (rbcL)
GenBank
Acc. no. (psbA)
26°41'48.7"N 55°57'21.8"E
27°02'37.4"N 56°29'45.1"E
26°32'31.6"N 54°52'30.1"E
25°40'54.6"N 57°51'23.7"E
Feb.2017
Feb.2017
Mar.2017
Apr.2017
MF325794
MF325795
MF325796
MF538751
MK101392
MK101393
MK101394
MK101395
26°32'31.6"N 54°52'30.1"E
26°32'31.6"N 54°52'30.1"E
27°50'16.4"N 51°53'22.3"E
Feb.2017
Mar.2017
Apr.2017
MG602965
MG602966
MG602967
MK101389
MK101390
MK101391
Morphological study of Dictyota acutiloba
The specimens identified as D. acutiloba using the
molecular analyses (figs.1 and 2) were collected from
the intertidal zones of Bandar-Lenge and BandarDayyer (table 2), (fig. 4: A & B). Thalli were flattened,
ribbon-like and erect or prostrate. Thallus with smooth
margins, colors varied from olive green to medium
brown, no iridescence and banding. Thalli were (6) 812 (20) cm in length and (0.5) 0.7 (1) mm in width and
show marginal proliferations, phaeophycean hairs
absent, dichotomous branching with different
branching angles of (30) 40-55 (75) degrees, showing
smooth to sinuate growth patterns. Branching patterns
was mainly regular (fig.4 A). The main axis of thalli
was almost uniform in width. Inter-dichotomies sizes
ranged (1.5) 1.5-3 (4.5) cm in length and (0.5) 0.7-1 (1)
mm in width. Apices were acute or wrench. At apical
segments, the dichotomous intervals are (2) 3-4 (5) mm
in length and (0.5) 0.6-0.8 (0.9) mm in width. Dark
spots present in such a way that dark vertical lines
appear on the surface of the thalli (A2 & B2). Cross
sections with 90-250 µm thickness included two layers
of cortex and monolayer of medullary cells in the
middle. The cortex contained small regular cells (fig.4
F & G), with 20-40 µm long and 15-25 µm wide.
Medulla was also monolayer and contained large cells
of 50-185 µm long and 25-175 µm wide. The detailed
morphological data are presented in table 3.
64 Notes on the genus Dictyota in the Persian Gulf, Iran
IRAN. J. BOT. 25 (1), 2019
Fig. 1. Maximum likelihood (ML) tree for rbcL sequences of Dictyota ciliolata and Dictyota acutiloba from the
southern coastlines of Iran and other regions. ML bootstrap values over 50% are shown at the nodes. Branch lengths
are drawn proportional to the amount of the sequence changes.
IRAN. J. BOT. 25 (1), 2019
M. Sadeghi & al.
65
Fig. 2. Maximum likelihood (ML) tree for psbA sequences of Dictyota ciliolata and Dictyota acutiloba from the
southern coastlines of Iran and other regions. ML bootstrap values over 50% are shown at the nodes. Branch lengths
are drawn proportional to the amount of the sequence changes.
66 Notes on the genus Dictyota in the Persian Gulf, Iran
IRAN. J. BOT. 25 (1), 2019
Fig. 3. Morphological types of Dictyota ciliolata from Persian Gulf and Gulf of Oman. A, D, G: habits of morphotypes
(QE6, LE2 and HO3 respectively); Scale bars = 2 cm. B, E, H: detail of dichotomous branching; Scale bars = 1 mm.
C, F, I: cross section of the middle portion of branches. Scale bars = 100 μm.
IRAN. J. BOT. 25 (1), 2019
M. Sadeghi & al.
67
Fig. 4. Morphological types of Dictyota acutiloba from Persian Gulf. A, B: habits of sporophytes respectively LE1,
DA1; Scale bar= 1 cm. C, D, E: detail of dichotomous branching; Scale bar respectively = 1mm; 1mm; 0.3 mm F, G:
cross sections of the middle portion of a branch. Scale bars = 100μm.
DISCUSSION
In this study on Dictyota species belonging to the
Dictyotaceae, we combine DNA barcoding data from
two cytoplasmic genes, rbcL and psbA sequences, with
morphological characteristics to reveal the clear
taxonomic status of Dictyota genus in southern
coastlines of Iran (Persian Gulf and Gulf of Oman).
The classification of Dictyotales is mainly based on
the comparison of vegetative growth and reproduction
Hwang & al. 2009). The species are components of
warm and tropical marine flora. Nevertheless, many
species are not easily defined through morphological
characteristics, because of their diversity and the
presence or absence of characteristics show significant
changes (De Clerck & Coppejans 1999), including
marginal dentation, the number of medulla layers also
shows a significant difference between Dictyotales and
can be varied in many species depending on the growth
conditions (De Clerck and Coppejans 1999; Tronholm
& al. 2013). Most tropical representatives of Dictyota
have a similar reproductive and anatomical structure of
the thallus, generally vary according to habit of thallus,
size of interdichotomies, cortical and medullary cells
size (De Clerck & al. 2001). Due to morphological
plasticity, some of the recorded species from the
previous studies of Dictyota may have been mistake.
For example, the species Dictyota crenulata was
misidentified as Dictyota ciliolata, based on the
presence of marginal teeth (Tronholm & al. 2012).
68 Notes on the genus Dictyota in the Persian Gulf, Iran
IRAN. J. BOT. 25 (1), 2019
Table 3. Morphological characters of Dictyota ciliolata and Dictyota acutiloba.
Ml/Cl: ratio of the length of medulla cells to the cortical cells.
Characters
Thallus length cm
Texture
Habit
Margins
Color and Iridescence
Branching
Branching angle
Phaeophycean hairs
Axes width
Inter dichotomies
Length (mm)
Average width (mm)
L/W
Apical segment
Apical shape
Interdichotomous Length (mm)
Width (mm)
L/W
Cortical cells
Cortex length (μm)
Cortex width (μm)
Medullary cells
Layers
length (μm)
Width (μm)
Ml/Cl (μm)
Cross section thickness (μm)
D. ciliolata
Iran
3.5-13
Crisp or supple
Flattened, erect or prostrate, Ribbonlike
Smooth or dentation
Light green to medium brown
Isotomous
dichotomous,
often
regular
(20) 40-60 (70)
Mostly present
Almost uniform width
D. acutiloba
Iran
(6) 8-12 (20)
Supple
Erect or prostrate
(10) 15-25 (30)
(1) 2-4 (6)
(1.5) 2.5-3.75(5)
(10) 15-20 (45)
(0.5) 0.7-1 (1)
(10) 15-28 (45)
Acute to truncate
Acute or wrench
(1) 2-6 (12)
(1) 1-2 (4)
(1) 2- 3 (6)
(2) 2-4 (5)
(0.4) 0.5-0.8 (0.9)
(2.5) 3.7-8 (12.5)
15-25
10-15
(20) 25-35 (40)
(10) 15-20 (25)
Monolayer
50-350
25-275
(1.5) 3.4 -7 (17.5)
(50) 70-150 (290)
Monolayer
(55) 90-130 (185)
(50) 60-120 (175)
(2.8) 4-4.6 (6.6)
(75) 150-190 (250)
Dictyota crenulata is very similar to Dictyota
ciliolata, but different in the shape and frequency of
marginal teeth (Tronholm & al. 2012).Also species that
was reported at the first as Dictyota bartayresiana, in
south of the Carol Sea, later shifted to a new taxa as
Canistrocarpus cervicornis (Tronholm & al. 2013).The
inability to distinguish morphologically diagnostic
constants of traits that separate the different species,
make specifying the boundary of the species highly
variable and ambiguous (Tronholm & al. 2010a).
Studies on European species have shown that
morphological data without the use of DNA barcoding
data is not sufficient to estimate the species diversity
and boundaries (Amini & al. 2013). The DNA analysis
showed is a very effective tool for investigating algal
taxonomic relationships (Silberfeld & al. 2014).
To carry out the molecular analysis on the of the
Smooth
Olive green to medium brown
Dichotomous, regular, smooth to
Sinuate growth patterns
(30) 40-55 (75)
Absent
Almost uniform width
collected specimens from the southern coastlines of
Iran we chose two cytoplasmic genes, i.e. chloroplast
rbcL and psbA, because the cytoplasmic genes seem to
provide clearer information in evolution (Bittner & al.
2008). Our phylogentic analyses revealed 0-1.6 %
intraspecific divergence in rbcL sequences for D.
ciliolata and showed a divergence of 2.5-3 % from the
closest sister clade including D. naevosa and 7-9.6%
divergence from the out group, Canistrocarpus
cervicornis. In contrast, the intraspecific distances of
psbA sequences was 0-0.6% and the nearest sister
species, D. rigida, showed a divergence of 3.4-3.7%
and divergence from the out group, Dilophus okamurae
was 7.8-9.1%. On the other hand, in D. acutiloba the
intraspecific divergence based on rbcL sequences was
found to be 0-1.5 % and the closest species, D.
bartayresiana, showed 5.7-6.8 % divergence from D.
IRAN. J. BOT. 25 (1), 2019
acutiloba and 9.1-10.3% from the out group,
Canistrocarpus cervicornis. However, the intraspecific
distance of psbA sequences was found to be 0-0.1% and
the closest species, D. bartayresiana, showed 4.8-4.9%
and 7.67.8-25% divergence from the out group,
Dilophus okamurae. Accordingly, we confirm the
presence of Dictyota ciliolata and introduce a new
record from Dictyota acutiloba in the southern
coastlines of Iran.
In a revision of the Dictyota genus, using the
phylogenetic analysis of rbcL and 26SrRNA,
Pachydictyon, Glossophorella, Glossophora and
Dilophus, instead of five distinct genuse, were
considered in the large genus Dictyota Lamouroux,
which included the species with monolayer cortex and
monolayer/multilayer medulla(De Clerck & al. 2006).
Also, some species were separated from this taxon and
two new genera of Canistrocarpus De Paula & De
clerck and Rugulopteryx De clerck & Coppejans were
formed. The species previously known as Dictyota
cervicornis was changed to Canistrocarpus
cervicornis(Hwang & al. 2009). Also, phylogenic
studies showed that the species previously reported as
D. ciliolata from the Mediterranean Sea which was
introduced
as
new
species
named
D.
cyanoloma(Tronholm & al. 2010b).
Molecular data showed that some of the specimens
collected in this study belong to Dictyota ciliolate,
thalli of the species is completely erect, 8-15 cm long,
texture somewhat crisp, color in situ brown, generally
retain their color in dry specimens. The margins are
normally dentate, but specimens with a reduced number
of teeth or specimens without any dentation have also
been observed. Interdichotomies width is mainly same
size in whole thalli. Apices generally rounded,
sometimes truncate, apical cell protruding (De Clerck
2003). The common characteristics of D. ciliolata
collected in this study are a medium sized to large
specimens, up to 15 cm long, dichotomously branched,
wide of thalli in various morphotypes is narrow to
slightly wide, main axis of thalli of a specimen has
almost uniform width. The margins in almost
morphotypes are dentate and sometime are smooth.
Branching isotomous dichotomous and sometimes
anisotomous dichotomous. branching angles of 20-70°.
With marginal proliferations and without surface
proliferations. The apices are rounded, acute or
truncate. Cortex and medulla is monolayered.
According to barcoding data, other some collected
specimens from the current studied area are Dictyota
acutiloba, originally described from the Hawaiian
Archipelago, is generally accepted that is a Pacific
species (De Clerk & al. 2006; Lozano-Orozco & al.
2015). D. acutiloba thalli is erect, 4.5-16.5 cm long,
M. Sadeghi & al.
69
medium brown in color, growth form often twisted,
difficult to separate and spread out of branches when is
out of water, mostly with dichotomous branching,
margins smooth. Single medullary cell layer and single
cortical layer. Apices extending to acute tips (Kraft
2009). Thalli of D. acutiloba is up to 20 cm in length,
medium brown color, sinusoidal form, smooth margins,
blades become narrow from the base to the tip, apices
acute to round, distance between Inter dichotomies of
thalli often unequal, base and middle part of the thalli
are equal and longer, with no surface proliferations (fig
4 &table 3). Variable environmental conditions affect
the occurrence of brown algae. Population of Dictyota
mostly appear in the cold season. In fact, visible part of
the specimens of the species disappear completely in
summer (Tronholm & al. 2008). Similarly, the
maximum abundance of D. acutiloba and D. ciliolata
from the Persian Gulf was observed in the intertidal to
shallow subtidal zones on hard and rocky substrate
from January to march while nothing during the
summer.
In this study, we investigated morphological
characterizations combined with the molecular analysis
of the Dictyota algae species in the Persian Gulf and
Gulf of Oman, Iran. We reported new record of D.
acutiloba and confirmed the presence of D. ciliolata.
Future studies may lead to identification of new taxa
and increasing the total number of speies in the area.
REFERENCE
Akaike, H. 1973: Maximum likelihood identification of
Gaussian autoregressive moving average models. Biometrika 60: 255-265.
Altamirano-Cerecedo, M. D. C. & RiosmenaRodríguez, R. 2007: Vegetative and reproductive
variability of Dictyota crenulata (Phaeophyta:
Dictyotales) along the central and southwestern
Gulf of California, Mexico. -Pacific Science, 61 (4):
575-586.
Amini, F., Riahi, H. & Zolgharnain, H. 2013: Ribulose1, 5-Bisphosphate Carboxylase/Oxygenase Gene
Sequencing in Taxonomic Delineation of Padina
Species in theNorthern Coast of the Persian Gulf,
(IRAN). -Journal of the Persian Gulf 4 (13): 47–57.
Bittner, L., Payri, C. E., Couloux, A., Cruaud, C., de
Reviers, B. & Rousseau, F. 2008: Molecular
Phylogeny of the Dictyotales and Their Position
within the Phaeophyceae, Based on Nuclear, Plastid
and Mitochondrial DNA Sequence Data. Molecular Phylogenetics and Evolution 49 (1):
211–226.
De Clerck, O. & Coppejans, E. 1999: Two new species
of Dictyota (Dictyotales, Phaeophyta) from the
Indo-Malayan region. -Phycologia 38: 184-194.
70 Notes on the genus Dictyota in the Persian Gulf, Iran
De Clerck, O., De Vos, P., Gillis, M. & Coppejans, E.
2001: Molecular systematics in the genus Dictyota
(Dictyotales, Phaeophyta): a first attempt based on
restriction patterns of the internal transcribed spacer
1 of the rDNA (ARDRA-ITS1). -Systematics and
Geography of Plants 71: 25-35.
De Clerck, O. 2003: The genus Dictyota (Dictyotales,
Phaeophyta) in the Indian Ocean. -National Botanic
Garden of Belgium, pages 1-205.
De Clerck, O., Leliaert, F., Verbruggen, H., Lane, C.
E., De Paula, J. C., Payo, D. A. & Coppejans, E.
2006: A revised classification of the Dictyoteae
(Dictyotales, Phaeophyceae) based on rbcl and 26s
ribosomal DNA sequence analyses. -1. Journal of
Phycology 42: 1271-1288.
Doyle, J. J. & Doyle, J. L. 1990: Isolation of plant DNA
from fresh tissue. -Focus12: 13-15.
Guiry, M. D. & Guiry, G. M. 2018: AlgaeBase. Worldwide electronic publication, National University of
Ireland, Galway. http: //www. algaebase. org;
searched on 30 November 2018.
Gauna, M. C., Cáceres, E. J. & Parodi, E. R. 2013:
Temporal variations of vegetative features, sex
ratios and reproductive phenology in a Dictyota
dichotoma (Dictyotales, Phaeophyceae) population
of Argentina. -Helgoland marine research 67: 721.
Hall, T. A. 1999: BioEdit: A user-friendly biological
sequence alignment editor and analysis program for
Windows 95/98/NT. -Nucleic Acids Symposium
Series41: 95–98.
Herren, L. W., Walters, L. J. & Beach, K. S. 2006:
Fragment generation, survival, and attachment of
Dictyota spp. at Conch Reef in the Florida Keys,
USA. -Coral Reefs 25: 287-295.
Hwang, I. K., Kim, H. S. & Lee, W. J. 2005:
Polymorphism in the brown alga Dictyota
dichotoma (Dictyotales, Phaeophyceae) from
Korea. -Marine Biology 147: 999-1015.
Hwang, I, Lee, W., Kim, H. & De Clerck, O. 2009:
Taxonomic Reappraisal of Dilophus Okamurae
(Dictyotales, Phaeophyta) from The Western
Pacific Ocean. -Phycologia 48 (1): 1–12.
Kokabi, M. & Yousefzadi, M. 2015: Checklist of the
marine macroalgae of Iran. -Botanica Marina 58:
307-320.
Kraft, G. T. 2009. Algae of Australia: Marine Benthic
Algae of the Lord Howe Islands and the Southern
Great Reef. 2. Brown Algae. -ABRS Canberra,
CSIRO Publ., Melbourne, 364 pp.
Larkin, M. A., Blackshields, G., Brown, N. P., Chenna,
R., McGettigan, P. A., McWilliam, H., Valentin, F.,
Wallace, I. M., Wilm, A., Lopez, R. & Thompson,
J. D. 2007: Clustal W and Clustal X version 2. 0. Bioinformatics, 23: 2947-2948.
IRAN. J. BOT. 25 (1), 2019
Lee, S. R., Oak, J. H., Keum, Y. S., Lee, J. & Chung, I.
K. 2011: Utility of rbcS gene as a novel target DNA
region for brown algal molecular systematics. Phycological Research 59: 34-41.
Leliaert, F., Verbruggen, H., Vanormelingen, P., Steen,
F., López-Bautista, J. M., Zuccarello, G. C. & De
Clerck, O. 2014: DNA-based species delimitation
in algae. -European Journal of Phycology 49: 179196.
Lozano-Orozco, J. G., Sentíes, A., De Clerck, O.,
Dreckmann, K. M. & Díaz-Larrea, J. 2015: Two
new species of the genus Dictyota (Phaeophyceae:
Dictyotales) from the Mexican Caribbean. American Journal of Plant Sciences 6: 2492.
Pirian, K., Piri, K., Sohrabipour, J., Tamadoni Jahromi,
S. & Blomster, J. 2016: Molecular and
Morphological Characterisation of Ulva Chaugulii,
U. Paschima and U. Ohnoi (Ulvophyceae) from the
Persian Gulf, Iran. -Botanica Marina 59: 147–58.
Silberfeld, T, Rousseau, F. & Reviers, B. 2014: An
Updated Classification of Brown Algae
(Ochrophyta,
Phaeophyceae).
-Cryptogamie,
Algologie 35 (2): 117–56.
Silva, P. C., Basson, P. W. & Moe, R. L. 1996:
Catalogue of the benthic marine algae of the Indian
Ocean. University of California Publications in
Botany 79. 1259 pp. -University of California Press,
Berkeley.
Sohrabipour, J. & Rabii, R. 1999: A list of marine algae
of seashores of Persian Gulf and Oman Sea in the
Hormozgan Province. -Iranian Journal of Botany 8:
131-162.
Sohrabipour, J., Rabei, R., Nezhadsatari, T. & Asadi,
M. 2004: The marine algae of the southern coast of
Iran, Persian Gulf, Lengeh area, Iran. J. Bot. 10 (2):
84-93.
Sotka, E. E. & Hay, M. E. 2009: Effects of herbivores,
nutrient enrichment, and their interactions on
macroalgal proliferation and coral growth. -Coral
Reefs 28: 555-568.
Steen, F., Aragay, J., Zuljevic, A., Verbruggen, H.,
Mancuso, F. P., Bunker, F., Vitales, D., Gómez
Garreta, A. & De Clerck, O. 2017: Tracing the
introduction history of the brown seaweed Dictyota
cyanoloma (Phaeophyceae, Dictyotales) in Europe.
-European Journal of Phycology 52: 31-42.
Tanabe, A. S. 2007: Kakusan: A computer program to
automate the selection of a nucleotide substitution
model and the conturation of a mixed model on
multilocus data. -Molecular Ecology Notes7: 962–
964.
Tronholm, A., Sanson, M., Afonso-Carrillo, J. & De
Clerck, O. 2008: Distinctive morphological
features, life-cycle phases and seasonal variations in
IRAN. J. BOT. 25 (1), 2019
subtropical populations of Dictyota dichotoma
(Dictyotales, Phaeophyceae). -Botanica Marina51:
132-144.
Tronholm, A., Sanson, M., Afonso-Carrillo, J.,
Verbruggen, H. & De Clerck, O. 2010a: Niche
partitioning and the coexistence of two cryptic
Dictyota (Dictyotales, Phaeophyceae) species from
the Canary Islands, Journal of Phycology 46: 10751087.
Tronholm, A., Steen, F., Tyberghein, L., Leliaert, F.,
Verbruggen, H., Antonia Ribera Siguan, M. & De
Clerck, O. 2010b: Species delimitation, taxonomy,
and biogeography of Dictyota in Europe
(Dictyotales,
Phaeophyceae),
Journal
of
phycology 46: 1301-1321.
Tronholm, A., Leliaert, F., Sansón, M., Afonso-
M. Sadeghi & al.
71
Carrillo, J., Tyberghein, L., Verbruggen, H. & De
Clerck, O. 2012: Contrasting geographical
distributions as a result of thermal tolerance and
long-distance dispersal in two allegedly widespread
tropical brown algae. Plos One 7: 30813-30822.
Tronholm, A., Sanson, M., Afonso-Carrillo, J.,
Leliaert, F., Ferandez-Garcia, C. & De Clerck, O.
2013: Taxonomy of the Dictyota ciliolate-crenulata
complex (Dictyotales, Phaeophyceae). Journal of
Phycology 52: 171-181.
Wang, W. L., Lin, C. S., Lee, W. J. & Liu, S. L. 2013:
Morphological and molecular characteristics of
Homoeostrichus formosana sp. nov. (Dictyotaceae,
Phaeophyceae) from Taiwan. -Botanical studies, 54
(1), p. 13.