IRANIAN JOURNAL OF BOTANY 25 (1), 2019 DOI: 10.22092/ijb.2019.124520.1227 NOTES ON THE GENUS DICTYOTA (DICTYOTACEAE, PHAEOPHYCEAE) IN THE PERSIAN GULF, IRAN M. Sadeghi, B. A. Fakheri, J. Sohrabipour, A. Emamjomeh & D. Samsampour Received 2018. 12. 25; accepted for publication 2019. 04. 17 Sadeghi, M., Fakheri, B.A., Sohrabipour, J., Emamjomeh, A. & Samsampour, D. 2019. 06. 30: Notes on the genus Dictyota (Dictyotaceae, phaeophyceae) in the Persian Gulf, Iran.- Iran. J. Bot. 25 (1): 61-71. Tehran. In this research, the taxonomic status of the genus Dictyota in southern coastlines of Iran was studied. Taxonomy of the genus at species levels is complicated and difficult due to the high morphological plasticity in response to environmental conditions and overlapping of diagnostic characters. In this study, we combined morphological information with cytoplasmic barcoding data from DNA rbcL and psbA. We identified Dictyota acutiloba as new record and also confirmed the presence of Dictyota ciliolata in the Persian Gulf and Gulf of Oman. Our studies showed D. ciliolata species has high inter-specific morphological diversity. Mahnaz Sadeghi, Department of Plant Breeding and Biotechnology, Faculty of Agriculture, University of Zabol, Iran, Barat Ali Fakheri (correspondences <ba_fakheri@yahoo.com>) Department of Plant Breeding and Biotechnology, Faculty of Agriculture, University of Zabol, Zabol, Iran. -Jelveh Sohrabipour, Agricultural and Research and Education Center of Hormozgan, Bandar Abbas, Agricultural Research, Education and extension Organization, Iran. -Abbasali Emamjomeh, Department of Plant Breeding and Biotechnology, Faculty of Agriculture, University of Zabol, Iran. -Davood Samsampour, Department of Horticultural Sciences, Faculty of Agriculture, University of Hormozgan, Iran. Key words: Brown algae; Dictyota; DNA barcoding; new record; psbA; rbcL ‫ جلبکهای قهوهای) در سواحل ایرانی خلیج فارس‬، Dictyotaceae ‫ (خانواده‬Dictyota ‫نکاتی در مورد جنس‬ ‫ دانشگاه زابل‬،‫ دانشجوی دکتری بیوتکنولوژی کشاورزی‬:‫مهناز صادقی‬ ‫ دانشگاه زابل‬،‫ استاد گروه اصالح نباتات و بیوتکنولوژی‬:‫براتعلی فاخری‬ ‫ آموزش و ترویج کشاورزی‬،‫ سازمان تحقیقات‬،‫ عضوهیئت علمي مرکز تحقیقات کشاورزی ومنابع طبیعي استان هرمزگان‬:‫جلوه سهرابی پور‬ ‫ دانشگاه زابل‬،‫ استادیار گروه اصالح نباتات و بیوتکنولوژی‬:‫عباسعلی امام جمعه‬ ‫ دانشگاه هرمزگان‬،‫ استادیار گروه باغباني‬:‫داوود صمصامپور‬ ‫ طبقهبندی این جنس در سطح گونه بهدلیل‬.‫ درسواحل جنوبي ایران مورد بررسي قرار گرفت‬Dictyota ‫در این مطالعه وضعیت تاکسونومیک جنس‬ ‫ اطالعات‬،‫ برای روشن شدن‬.‫تنوع باالی مورفولوژیک در پاسخ به شرایط محیطي و همچنین همپوشاني ویژگيهای تشخیصي پیچیده و دشوار است‬ ‫ به عنوان یک‬Dictyota acutiloba ‫ در این مطالعه گونه‬.‫ تلفیق کردیم‬psbA ‫ و‬rbcL ‫مورفولوژیک را با دادههای تواليهای ژنهای سیتوپالسمي‬ ‫ همچنین بررسيهای ما نشان‬.‫ را براساس مطالعات درخلیج فارس تأیید نمودیم‬Dictyota ciliolata ‫رکورد جدید از منطقه شناسایي کرده و حضور‬ .‫ دارای تنوع مورفولوژیک درون گونهای باالیي ميباشد‬D. ciliolata ‫داد که گونه‬ INTRODUCTION The genus Dictyota J. V. Lamouroux is a considerable proportion of tropical marine flora (Tronholm & al. 2010a) and grow in intertidal and shallow subtidal habitats on rocky beaches worldwide (Herren & al. 2006; Sotka and Hay 2009). Totally 97 specific and infraspecific taxa were registered for the gens in algaebase website (Guiry & Guiry 2018). The 62 Notes on the genus Dictyota in the Persian Gulf, Iran general definition of Dictyotales is often based on morphology and anatomical characters (AltamiranoCerecedo & al. 2007; Wang & al. 2013). Vegetative characters in the Dictyotales member are very diverse (Tronholm & al. 2008; Steen & al. 2017). Accordingly, the classifications of Dictyota has been reviewed several times (De Clerck & al. 2006; Tronholm & al. 2013). The morphological plasticity and inability to distinguish valuable characters, especially in the great Dictyota genus, have led to a long and difficult taxonomic challenges (Silberfeld & al. 2014). The same species of the genus are grouped in separate categories based on apparent differences, or vice versa, different species categories in one group according to the apparent similarity (Tronholm & al. 2010b). Some morphological features such as the presence of the dentate margin, teeth shape, and the intervals at the interdichotomies, widely used to determine the Dictyota members in species level boundaries while these characters may lead to wrong classifications (Gauna & al. 2013). Hwang & al., 2005 reported a change in the thalli length of the Dictyota on the coast of Korea as a result of environmental conditions changes in each location (Hwang & al. 2005). The reported thalli length is variable due to environmental factors, especially temperature (Pirian & al. 2016). Recent studies have shown that morphological data without approving by DNA sequence data analyses is not enough to evaluate species diversity and determine the boundaries of species (Amini & al. 2013). The emergence of molecular markers has provided a new insight into the classification and DNA-sequence based taxonomy to solve many taxonomic challenging issues (Leliaert & al. 2014). Phylogenetic analysis based on nuclear, chloroplasts and mitochondrial DNA sequences, provided detailed views on the diversity of brown algae species (Lee & al. 2011). To date, seven species of the genus Dictyota, have previously been reported from southern coastlines of Iran (The Persian Gulf and Gulf of Oman), which are classically identified based on morphology (Silva& al. 1996; IRAN. J. BOT. 25 (1), 2019 Sohrabipour & Rabii 1999; Sohrabipour & al. 2004; Kokabi & Yousefzadi 2015). The focus of this study was to evaluate the taxonomy of Dictyota in this region, based on combination of morphological studies and phylogenetic analyses of DNA, using the rbcL and psbA sequences data. MATERIALS AND METHODS Specimen collection Specimens of the genus Dictyota were collected from Hormozgan province (Hormoz and Qeshm islands, Bandar-Jask and Bandar-Lenge), Bushehr Province (Bandar-Dayyer) in northern parts of Persian Gulf (Iran) in February, March and April 2017 (table 1). The collected algae were cleaned and transferred to the laboratory for further processing and herbarium samples were prepared and deposited at the Herbarium of the Research institute of Forests & Rangelands (TARI) and the herbarium of Agricultural and Natural Resource Research and Education Centre of Hormozgan Province, Bandarabbas, Iran. Molecular studies Total genomic DNA was extracted using the modified CTAB method (Doyle & Doyle 1990). The DNA samples were stored at -20°C and used as templates for PCR amplification. Partial regions of rbcL (~ 790bp) and psbA(~ 1000 bp) were amplified using the primers (table 1) designed by PRIMER3 software (Untergasser & al. 2012). The 20ml reactions contained 10 ml 2x pcr master mix, 1 ml of each primer and 1 ml of template DNA (100 ng) and the final volume was adjusted up to 20 ml with distilled water. The cycle was for 5 min initial denaturation at 94°C, followed by 35 cycles of 94°C for 45s, annealing at 53°C for 45s for the rbcL region and 51°C for 45s for the psbA, extension at 72°C for 1min, and a final extension at 72°C for 5 min. The PCR products were then purified and sequenced on an automated HiSeq 2000/250 sequencer (Illumina Inc., San Diego, USA) by Macrogen (Seoul, Korea). Table 1. Primer sequences used in this study. Gene Sequence (5’ > 3’) (rbcL) Fwd TATTCCGAATCACACCTCAGC Rev TTTGGCGAGCATATGTTGAA (psbA) Fwd ATGACTGCTACTTTAGAAAGACG Rev TCATGCATWACTTCCATACCTA Phylogenetic analyses The raw DNA sequences were edited using ChromasPro ver.2.1.3. (Technelysium Pty Ltd, Queensland, Australia) and blasted against the this study this study Olivier De Clerck&al (2010) Olivier De Clerck&al(2010) sequences of rbcL and psbA genes of the genus Dictyota. The sequences were aligned using ClustalX n.2.0.8 (Larkin & al. 2007) and manually adjusted using BioEdit v.7.0.9.0 (Hall 1999). The best-fit IRAN. J. BOT. 25 (1), 2019 M. Sadeghi & al. models were selected using the corrected Akaike information criterion for the maximum likelihood (ML) (Akaike 1973) in KAKUSAN version 3(Tanabe 2007). The sequences were analyzed for ML with 1000 bootstrap replicates using TREEFINDER version October 2008. The accession numbers and collection data of the specimens investigated in this study and the acquired accession numbers from GenBank are shown in table 2. RESULTS Molecular analyses The rbcL phylogenetic tree showed that the sequences of specimens including JA2, QE6, LE2 and HO3 from southern coastlines of Iran grouped with D. ciliolata with high bootstrap support for ML analaysis (fig.1) and sequences of specimens including LE1, LE3 and DA1 from southern coastlines of Iran grouped with D. acutiloba with high bootstrap support for ML analysis (fig.1). Morphological study of Dictyota ciliolata The specimens identified as D. ciliolata using the molecular analyses (figs.1 and 2) were collected from the intertidal zones of Bandar-Lenge, Bandar-Jask, Qeshm and Hormuz Islands (table 2), revealed considerable variations in their morphology (fig. 3: A, 63 D & G). Thalli were flattened, erect or prostrate and ribbon-like. Some of the specimens had smooth margins [HO3 (fig.3 G)] whereas others were dentate [QE6 (fig.3 A), LE2 (fig.3 D) and JA2]. The colors varied from light green to medium brown. Thalli were (3.5) 5-8 (13) cm in length and (1) 2-4 (6) mm width with marginal proliferations. The phaeophycean hairs were present in some specimens. All specimens had dichotomous branching with different branching angles of (20) 40-60 (70) degrees, showing smooth or twisted growth patterns. We mainly observed regular branching patterns (fig.3 A & G) rather than irregular ones (fig.3.D). The main axis of all thalli had almost uniform width but varied in length [short and wide: HO3 (fig.3 G) vs. slender QE6 (fig.3 A), LE2]. Interdichotomies sizes ranged from (1) 1.5-2.5 (3) cm in length and (1) 2-4 (6) mm in width. Apices were acute (LE2 and JA2) or truncate (QE6 and HO3). At apical segments, the dichotomous intervals are (1) 2-6 (12) mm in length and (1) 1-2 (4) mm in width. Cross sections with 50-290 µm thickness included two layers of cortex and one layer of medullary cells. Both monolayer cortex contained small and regular cells (fig.3 C, F & I), which were 15-25 µm long and 10-15 µm wide. Medulla was also monolayer and contained large cells of 50-350 µm long and 25-275 µm wide. The detailed morphological data are presented in table 3. Table 2. Specification of morphotypes of Dictyota with the collection details and GenBank accession numbers for rbcL and psbA sequences. code Locality Dictyota ciliolata QE6 shibderaz, Qeshm island HO3 Hormuz island LE2 Bandar-lenge JA2 Bahal, Bandar-jask Dictyota acutiloba LE1 Bandar-e Lenge LE3 Bandar-e Lenge DA1 Bandar-e Dayyer Latitude and longitude Collection date GenBank Acc. no. (rbcL) GenBank Acc. no. (psbA) 26°41'48.7"N 55°57'21.8"E 27°02'37.4"N 56°29'45.1"E 26°32'31.6"N 54°52'30.1"E 25°40'54.6"N 57°51'23.7"E Feb.2017 Feb.2017 Mar.2017 Apr.2017 MF325794 MF325795 MF325796 MF538751 MK101392 MK101393 MK101394 MK101395 26°32'31.6"N 54°52'30.1"E 26°32'31.6"N 54°52'30.1"E 27°50'16.4"N 51°53'22.3"E Feb.2017 Mar.2017 Apr.2017 MG602965 MG602966 MG602967 MK101389 MK101390 MK101391 Morphological study of Dictyota acutiloba The specimens identified as D. acutiloba using the molecular analyses (figs.1 and 2) were collected from the intertidal zones of Bandar-Lenge and BandarDayyer (table 2), (fig. 4: A & B). Thalli were flattened, ribbon-like and erect or prostrate. Thallus with smooth margins, colors varied from olive green to medium brown, no iridescence and banding. Thalli were (6) 812 (20) cm in length and (0.5) 0.7 (1) mm in width and show marginal proliferations, phaeophycean hairs absent, dichotomous branching with different branching angles of (30) 40-55 (75) degrees, showing smooth to sinuate growth patterns. Branching patterns was mainly regular (fig.4 A). The main axis of thalli was almost uniform in width. Inter-dichotomies sizes ranged (1.5) 1.5-3 (4.5) cm in length and (0.5) 0.7-1 (1) mm in width. Apices were acute or wrench. At apical segments, the dichotomous intervals are (2) 3-4 (5) mm in length and (0.5) 0.6-0.8 (0.9) mm in width. Dark spots present in such a way that dark vertical lines appear on the surface of the thalli (A2 & B2). Cross sections with 90-250 µm thickness included two layers of cortex and monolayer of medullary cells in the middle. The cortex contained small regular cells (fig.4 F & G), with 20-40 µm long and 15-25 µm wide. Medulla was also monolayer and contained large cells of 50-185 µm long and 25-175 µm wide. The detailed morphological data are presented in table 3. 64 Notes on the genus Dictyota in the Persian Gulf, Iran IRAN. J. BOT. 25 (1), 2019 Fig. 1. Maximum likelihood (ML) tree for rbcL sequences of Dictyota ciliolata and Dictyota acutiloba from the southern coastlines of Iran and other regions. ML bootstrap values over 50% are shown at the nodes. Branch lengths are drawn proportional to the amount of the sequence changes. IRAN. J. BOT. 25 (1), 2019 M. Sadeghi & al. 65 Fig. 2. Maximum likelihood (ML) tree for psbA sequences of Dictyota ciliolata and Dictyota acutiloba from the southern coastlines of Iran and other regions. ML bootstrap values over 50% are shown at the nodes. Branch lengths are drawn proportional to the amount of the sequence changes. 66 Notes on the genus Dictyota in the Persian Gulf, Iran IRAN. J. BOT. 25 (1), 2019 Fig. 3. Morphological types of Dictyota ciliolata from Persian Gulf and Gulf of Oman. A, D, G: habits of morphotypes (QE6, LE2 and HO3 respectively); Scale bars = 2 cm. B, E, H: detail of dichotomous branching; Scale bars = 1 mm. C, F, I: cross section of the middle portion of branches. Scale bars = 100 μm. IRAN. J. BOT. 25 (1), 2019 M. Sadeghi & al. 67 Fig. 4. Morphological types of Dictyota acutiloba from Persian Gulf. A, B: habits of sporophytes respectively LE1, DA1; Scale bar= 1 cm. C, D, E: detail of dichotomous branching; Scale bar respectively = 1mm; 1mm; 0.3 mm F, G: cross sections of the middle portion of a branch. Scale bars = 100μm. DISCUSSION In this study on Dictyota species belonging to the Dictyotaceae, we combine DNA barcoding data from two cytoplasmic genes, rbcL and psbA sequences, with morphological characteristics to reveal the clear taxonomic status of Dictyota genus in southern coastlines of Iran (Persian Gulf and Gulf of Oman). The classification of Dictyotales is mainly based on the comparison of vegetative growth and reproduction Hwang & al. 2009). The species are components of warm and tropical marine flora. Nevertheless, many species are not easily defined through morphological characteristics, because of their diversity and the presence or absence of characteristics show significant changes (De Clerck & Coppejans 1999), including marginal dentation, the number of medulla layers also shows a significant difference between Dictyotales and can be varied in many species depending on the growth conditions (De Clerck and Coppejans 1999; Tronholm & al. 2013). Most tropical representatives of Dictyota have a similar reproductive and anatomical structure of the thallus, generally vary according to habit of thallus, size of interdichotomies, cortical and medullary cells size (De Clerck & al. 2001). Due to morphological plasticity, some of the recorded species from the previous studies of Dictyota may have been mistake. For example, the species Dictyota crenulata was misidentified as Dictyota ciliolata, based on the presence of marginal teeth (Tronholm & al. 2012). 68 Notes on the genus Dictyota in the Persian Gulf, Iran IRAN. J. BOT. 25 (1), 2019 Table 3. Morphological characters of Dictyota ciliolata and Dictyota acutiloba. Ml/Cl: ratio of the length of medulla cells to the cortical cells. Characters Thallus length cm Texture Habit Margins Color and Iridescence Branching Branching angle Phaeophycean hairs Axes width Inter dichotomies Length (mm) Average width (mm) L/W Apical segment Apical shape Interdichotomous Length (mm) Width (mm) L/W Cortical cells Cortex length (μm) Cortex width (μm) Medullary cells Layers length (μm) Width (μm) Ml/Cl (μm) Cross section thickness (μm) D. ciliolata Iran 3.5-13 Crisp or supple Flattened, erect or prostrate, Ribbonlike Smooth or dentation Light green to medium brown Isotomous dichotomous, often regular (20) 40-60 (70) Mostly present Almost uniform width D. acutiloba Iran (6) 8-12 (20) Supple Erect or prostrate (10) 15-25 (30) (1) 2-4 (6) (1.5) 2.5-3.75(5) (10) 15-20 (45) (0.5) 0.7-1 (1) (10) 15-28 (45) Acute to truncate Acute or wrench (1) 2-6 (12) (1) 1-2 (4) (1) 2- 3 (6) (2) 2-4 (5) (0.4) 0.5-0.8 (0.9) (2.5) 3.7-8 (12.5) 15-25 10-15 (20) 25-35 (40) (10) 15-20 (25) Monolayer 50-350 25-275 (1.5) 3.4 -7 (17.5) (50) 70-150 (290) Monolayer (55) 90-130 (185) (50) 60-120 (175) (2.8) 4-4.6 (6.6) (75) 150-190 (250) Dictyota crenulata is very similar to Dictyota ciliolata, but different in the shape and frequency of marginal teeth (Tronholm & al. 2012).Also species that was reported at the first as Dictyota bartayresiana, in south of the Carol Sea, later shifted to a new taxa as Canistrocarpus cervicornis (Tronholm & al. 2013).The inability to distinguish morphologically diagnostic constants of traits that separate the different species, make specifying the boundary of the species highly variable and ambiguous (Tronholm & al. 2010a). Studies on European species have shown that morphological data without the use of DNA barcoding data is not sufficient to estimate the species diversity and boundaries (Amini & al. 2013). The DNA analysis showed is a very effective tool for investigating algal taxonomic relationships (Silberfeld & al. 2014). To carry out the molecular analysis on the of the Smooth Olive green to medium brown Dichotomous, regular, smooth to Sinuate growth patterns (30) 40-55 (75) Absent Almost uniform width collected specimens from the southern coastlines of Iran we chose two cytoplasmic genes, i.e. chloroplast rbcL and psbA, because the cytoplasmic genes seem to provide clearer information in evolution (Bittner & al. 2008). Our phylogentic analyses revealed 0-1.6 % intraspecific divergence in rbcL sequences for D. ciliolata and showed a divergence of 2.5-3 % from the closest sister clade including D. naevosa and 7-9.6% divergence from the out group, Canistrocarpus cervicornis. In contrast, the intraspecific distances of psbA sequences was 0-0.6% and the nearest sister species, D. rigida, showed a divergence of 3.4-3.7% and divergence from the out group, Dilophus okamurae was 7.8-9.1%. On the other hand, in D. acutiloba the intraspecific divergence based on rbcL sequences was found to be 0-1.5 % and the closest species, D. bartayresiana, showed 5.7-6.8 % divergence from D. IRAN. J. BOT. 25 (1), 2019 acutiloba and 9.1-10.3% from the out group, Canistrocarpus cervicornis. However, the intraspecific distance of psbA sequences was found to be 0-0.1% and the closest species, D. bartayresiana, showed 4.8-4.9% and 7.67.8-25% divergence from the out group, Dilophus okamurae. Accordingly, we confirm the presence of Dictyota ciliolata and introduce a new record from Dictyota acutiloba in the southern coastlines of Iran. In a revision of the Dictyota genus, using the phylogenetic analysis of rbcL and 26SrRNA, Pachydictyon, Glossophorella, Glossophora and Dilophus, instead of five distinct genuse, were considered in the large genus Dictyota Lamouroux, which included the species with monolayer cortex and monolayer/multilayer medulla(De Clerck & al. 2006). Also, some species were separated from this taxon and two new genera of Canistrocarpus De Paula & De clerck and Rugulopteryx De clerck & Coppejans were formed. The species previously known as Dictyota cervicornis was changed to Canistrocarpus cervicornis(Hwang & al. 2009). Also, phylogenic studies showed that the species previously reported as D. ciliolata from the Mediterranean Sea which was introduced as new species named D. cyanoloma(Tronholm & al. 2010b). Molecular data showed that some of the specimens collected in this study belong to Dictyota ciliolate, thalli of the species is completely erect, 8-15 cm long, texture somewhat crisp, color in situ brown, generally retain their color in dry specimens. The margins are normally dentate, but specimens with a reduced number of teeth or specimens without any dentation have also been observed. Interdichotomies width is mainly same size in whole thalli. Apices generally rounded, sometimes truncate, apical cell protruding (De Clerck 2003). The common characteristics of D. ciliolata collected in this study are a medium sized to large specimens, up to 15 cm long, dichotomously branched, wide of thalli in various morphotypes is narrow to slightly wide, main axis of thalli of a specimen has almost uniform width. The margins in almost morphotypes are dentate and sometime are smooth. Branching isotomous dichotomous and sometimes anisotomous dichotomous. branching angles of 20-70°. With marginal proliferations and without surface proliferations. The apices are rounded, acute or truncate. Cortex and medulla is monolayered. According to barcoding data, other some collected specimens from the current studied area are Dictyota acutiloba, originally described from the Hawaiian Archipelago, is generally accepted that is a Pacific species (De Clerk & al. 2006; Lozano-Orozco & al. 2015). D. acutiloba thalli is erect, 4.5-16.5 cm long, M. Sadeghi & al. 69 medium brown in color, growth form often twisted, difficult to separate and spread out of branches when is out of water, mostly with dichotomous branching, margins smooth. Single medullary cell layer and single cortical layer. Apices extending to acute tips (Kraft 2009). Thalli of D. acutiloba is up to 20 cm in length, medium brown color, sinusoidal form, smooth margins, blades become narrow from the base to the tip, apices acute to round, distance between Inter dichotomies of thalli often unequal, base and middle part of the thalli are equal and longer, with no surface proliferations (fig 4 &table 3). Variable environmental conditions affect the occurrence of brown algae. Population of Dictyota mostly appear in the cold season. In fact, visible part of the specimens of the species disappear completely in summer (Tronholm & al. 2008). Similarly, the maximum abundance of D. acutiloba and D. ciliolata from the Persian Gulf was observed in the intertidal to shallow subtidal zones on hard and rocky substrate from January to march while nothing during the summer. In this study, we investigated morphological characterizations combined with the molecular analysis of the Dictyota algae species in the Persian Gulf and Gulf of Oman, Iran. We reported new record of D. acutiloba and confirmed the presence of D. ciliolata. Future studies may lead to identification of new taxa and increasing the total number of speies in the area. REFERENCE Akaike, H. 1973: Maximum likelihood identification of Gaussian autoregressive moving average models. Biometrika 60: 255-265. Altamirano-Cerecedo, M. D. C. & RiosmenaRodríguez, R. 2007: Vegetative and reproductive variability of Dictyota crenulata (Phaeophyta: Dictyotales) along the central and southwestern Gulf of California, Mexico. -Pacific Science, 61 (4): 575-586. Amini, F., Riahi, H. & Zolgharnain, H. 2013: Ribulose1, 5-Bisphosphate Carboxylase/Oxygenase Gene Sequencing in Taxonomic Delineation of Padina Species in theNorthern Coast of the Persian Gulf, (IRAN). -Journal of the Persian Gulf 4 (13): 47–57. Bittner, L., Payri, C. E., Couloux, A., Cruaud, C., de Reviers, B. & Rousseau, F. 2008: Molecular Phylogeny of the Dictyotales and Their Position within the Phaeophyceae, Based on Nuclear, Plastid and Mitochondrial DNA Sequence Data. Molecular Phylogenetics and Evolution 49 (1): 211–226. De Clerck, O. & Coppejans, E. 1999: Two new species of Dictyota (Dictyotales, Phaeophyta) from the Indo-Malayan region. -Phycologia 38: 184-194. 70 Notes on the genus Dictyota in the Persian Gulf, Iran De Clerck, O., De Vos, P., Gillis, M. & Coppejans, E. 2001: Molecular systematics in the genus Dictyota (Dictyotales, Phaeophyta): a first attempt based on restriction patterns of the internal transcribed spacer 1 of the rDNA (ARDRA-ITS1). -Systematics and Geography of Plants 71: 25-35. De Clerck, O. 2003: The genus Dictyota (Dictyotales, Phaeophyta) in the Indian Ocean. -National Botanic Garden of Belgium, pages 1-205. De Clerck, O., Leliaert, F., Verbruggen, H., Lane, C. E., De Paula, J. C., Payo, D. A. & Coppejans, E. 2006: A revised classification of the Dictyoteae (Dictyotales, Phaeophyceae) based on rbcl and 26s ribosomal DNA sequence analyses. -1. Journal of Phycology 42: 1271-1288. Doyle, J. J. & Doyle, J. L. 1990: Isolation of plant DNA from fresh tissue. -Focus12: 13-15. Guiry, M. D. & Guiry, G. M. 2018: AlgaeBase. Worldwide electronic publication, National University of Ireland, Galway. http: //www. algaebase. org; searched on 30 November 2018. Gauna, M. C., Cáceres, E. J. & Parodi, E. R. 2013: Temporal variations of vegetative features, sex ratios and reproductive phenology in a Dictyota dichotoma (Dictyotales, Phaeophyceae) population of Argentina. -Helgoland marine research 67: 721. Hall, T. A. 1999: BioEdit: A user-friendly biological sequence alignment editor and analysis program for Windows 95/98/NT. -Nucleic Acids Symposium Series41: 95–98. Herren, L. W., Walters, L. J. & Beach, K. S. 2006: Fragment generation, survival, and attachment of Dictyota spp. at Conch Reef in the Florida Keys, USA. -Coral Reefs 25: 287-295. Hwang, I. K., Kim, H. S. & Lee, W. J. 2005: Polymorphism in the brown alga Dictyota dichotoma (Dictyotales, Phaeophyceae) from Korea. -Marine Biology 147: 999-1015. Hwang, I, Lee, W., Kim, H. & De Clerck, O. 2009: Taxonomic Reappraisal of Dilophus Okamurae (Dictyotales, Phaeophyta) from The Western Pacific Ocean. -Phycologia 48 (1): 1–12. Kokabi, M. & Yousefzadi, M. 2015: Checklist of the marine macroalgae of Iran. -Botanica Marina 58: 307-320. Kraft, G. T. 2009. Algae of Australia: Marine Benthic Algae of the Lord Howe Islands and the Southern Great Reef. 2. Brown Algae. -ABRS Canberra, CSIRO Publ., Melbourne, 364 pp. Larkin, M. A., Blackshields, G., Brown, N. P., Chenna, R., McGettigan, P. A., McWilliam, H., Valentin, F., Wallace, I. M., Wilm, A., Lopez, R. & Thompson, J. D. 2007: Clustal W and Clustal X version 2. 0. Bioinformatics, 23: 2947-2948. IRAN. J. BOT. 25 (1), 2019 Lee, S. R., Oak, J. H., Keum, Y. S., Lee, J. & Chung, I. K. 2011: Utility of rbcS gene as a novel target DNA region for brown algal molecular systematics. Phycological Research 59: 34-41. Leliaert, F., Verbruggen, H., Vanormelingen, P., Steen, F., López-Bautista, J. M., Zuccarello, G. C. & De Clerck, O. 2014: DNA-based species delimitation in algae. -European Journal of Phycology 49: 179196. Lozano-Orozco, J. G., Sentíes, A., De Clerck, O., Dreckmann, K. M. & Díaz-Larrea, J. 2015: Two new species of the genus Dictyota (Phaeophyceae: Dictyotales) from the Mexican Caribbean. American Journal of Plant Sciences 6: 2492. Pirian, K., Piri, K., Sohrabipour, J., Tamadoni Jahromi, S. & Blomster, J. 2016: Molecular and Morphological Characterisation of Ulva Chaugulii, U. Paschima and U. Ohnoi (Ulvophyceae) from the Persian Gulf, Iran. -Botanica Marina 59: 147–58. Silberfeld, T, Rousseau, F. & Reviers, B. 2014: An Updated Classification of Brown Algae (Ochrophyta, Phaeophyceae). -Cryptogamie, Algologie 35 (2): 117–56. Silva, P. C., Basson, P. W. & Moe, R. L. 1996: Catalogue of the benthic marine algae of the Indian Ocean. University of California Publications in Botany 79. 1259 pp. -University of California Press, Berkeley. Sohrabipour, J. & Rabii, R. 1999: A list of marine algae of seashores of Persian Gulf and Oman Sea in the Hormozgan Province. -Iranian Journal of Botany 8: 131-162. Sohrabipour, J., Rabei, R., Nezhadsatari, T. & Asadi, M. 2004: The marine algae of the southern coast of Iran, Persian Gulf, Lengeh area, Iran. J. Bot. 10 (2): 84-93. Sotka, E. E. & Hay, M. E. 2009: Effects of herbivores, nutrient enrichment, and their interactions on macroalgal proliferation and coral growth. -Coral Reefs 28: 555-568. Steen, F., Aragay, J., Zuljevic, A., Verbruggen, H., Mancuso, F. P., Bunker, F., Vitales, D., Gómez Garreta, A. & De Clerck, O. 2017: Tracing the introduction history of the brown seaweed Dictyota cyanoloma (Phaeophyceae, Dictyotales) in Europe. -European Journal of Phycology 52: 31-42. Tanabe, A. S. 2007: Kakusan: A computer program to automate the selection of a nucleotide substitution model and the conturation of a mixed model on multilocus data. -Molecular Ecology Notes7: 962– 964. Tronholm, A., Sanson, M., Afonso-Carrillo, J. & De Clerck, O. 2008: Distinctive morphological features, life-cycle phases and seasonal variations in IRAN. J. BOT. 25 (1), 2019 subtropical populations of Dictyota dichotoma (Dictyotales, Phaeophyceae). -Botanica Marina51: 132-144. Tronholm, A., Sanson, M., Afonso-Carrillo, J., Verbruggen, H. & De Clerck, O. 2010a: Niche partitioning and the coexistence of two cryptic Dictyota (Dictyotales, Phaeophyceae) species from the Canary Islands, Journal of Phycology 46: 10751087. Tronholm, A., Steen, F., Tyberghein, L., Leliaert, F., Verbruggen, H., Antonia Ribera Siguan, M. & De Clerck, O. 2010b: Species delimitation, taxonomy, and biogeography of Dictyota in Europe (Dictyotales, Phaeophyceae), Journal of phycology 46: 1301-1321. Tronholm, A., Leliaert, F., Sansón, M., Afonso- M. Sadeghi & al. 71 Carrillo, J., Tyberghein, L., Verbruggen, H. & De Clerck, O. 2012: Contrasting geographical distributions as a result of thermal tolerance and long-distance dispersal in two allegedly widespread tropical brown algae. Plos One 7: 30813-30822. Tronholm, A., Sanson, M., Afonso-Carrillo, J., Leliaert, F., Ferandez-Garcia, C. & De Clerck, O. 2013: Taxonomy of the Dictyota ciliolate-crenulata complex (Dictyotales, Phaeophyceae). Journal of Phycology 52: 171-181. Wang, W. L., Lin, C. S., Lee, W. J. & Liu, S. L. 2013: Morphological and molecular characteristics of Homoeostrichus formosana sp. nov. (Dictyotaceae, Phaeophyceae) from Taiwan. -Botanical studies, 54 (1), p. 13.