Diving Tourism

Questo manuale è il frutto di grande conoscenza ed esperienza ed è stato progettato per addestrare all'immersione tecnica i subacquei sportivi che siano già esperti ed abili e che posseggono come prerequisito minimo di addestramento il brevetto IANTD Advanced EANx Diver o un livello equivalente. Il suo scopo è quello di fornire le migliori informazioni e addestramento a coloro che desiderano diventare IANTD Technical Diver pienamente certificati o a coloro che desiderano avere informazioni limitate relative al conseguimento dei brevetti di IANTD Advanced Deep Air Diver o Normoxic Trimix Diver. Questo manuale svilupperà all'allievo le tre categorie didattiche necessarie del percorso evolutivo per diventare un IANTD Technical Diver:
 conoscenze teoriche
 addestramento psico-fisico
 corretto utilizzo dell’equipaggiamento
Attraverso lo sviluppo equilibrato di queste categorie il subacqueo potrà acquisire il brevetto di IANTD Advanced Deep Air Diver ed una volta stabilito questo prerequisito procedere verso la piena qualifica di IANTD Technical Diver. Inoltre le informazioni contenute nel manuale per accedere alla qualifica di IANTD Normoxic Trimix Diver rappresentano principalmente l’acquisizione del subacqueo della padronanza nell'utilizzo delle miscele trimix normossiche (max 20% O2 e 30% He). La configurazione adottata e le miscele decompressive saranno in funzione del brevetto già posseduto dal subacqueo per accedere al corso, cioè Advanced EANx Diver o Technical Diver.
ISBN 978-88-8250-223-2

Исследование посвящено изучению восприятия российскими дайверами мест погружений, природных и социальных условий подводных погружений, взаимосвязи предпочтений в отношении дайвинга и уровня опыта подводного пловца. Работа базируется на результатах социологического опроса, проведенного на базе социальных сетей.

//

The study is devoted to the study of Russian divers' perception of diving sites, natural and social conditions of diving, the relationship between diving preferences and the level of diving experience. The work is based on the results of a sociological survey conducted on the basis of social networks.

DIVING TOURISM VS UNDERWATER ANTIQUITIES - Law 3409/2005: The parliamentary procedure for its revision (Law 4688/2020), the critique and the codified text

The history of the development of the protection of marine archeological heritage up to Law 3409/2005 "Recreational diving and other provisions" is described in the text UNDERWATER ANTIQITIES, UNDERWATER ARCHAEOLOGICAL SITES AND "UNDERWATER MUSEUMS" [2015], which I have posted on academia.edu. It is interesting how N.3409 / 2005 was dealt with during its discussion and voting in the Hellenic Parliament, when the issue of protection of underwater archaeological heritage against diving tourism was raised , as well as by the international press [see my DIVING TOURISM VS UNDERWATER ANTIQUITIES - Law 3409/2005: The parliamentary process and the foreign press, in: academia.edu].The story was repeated with L.4688 / 2020 (Government Gazette 101 / A / 24-05-2020), which amended provisions of L.3409 / 2005 [APPENDIX III], despite the opposition of the Association of Greek Archaeologists [APPENDIX I] and of the opposition`parties during the debate and resolution (by a majority) [APPENDIX II] of Law 4688/2020.

Το παρόν πόνημα αποτελεί μια διεπιστημονική μελέτη των Ενάλιων Επισκέψιμων Αρχαιολογικών Χώρων (ΕΕΑΧ) και των λοιπών οργανωμένων καταδυτικών τοποθεσιών στην Ελλάδα, συμπεριλαμβανομένων των καταδυτικών πάρκων (ΚΠ) και των σύγχρονων ναυαγίων. Γίνεται μια σύντομη επισκόπηση του σημερινού τους καθεστώτος, εστιάζοντας στην σημαντική συνεισφορά του καταδυτικού τουρισμού στη βιώσιμη ανάπτυξη και βιώσιμη προστασία του φυσικού και πολιτισμικού περιβάλλοντος • στατιστική αξιολόγηση των αποτελεσμάτων του Ελληνικού νόμου 3409/2005 για τις καταδύσεις αναψυχής, και, τέλος, ανάδειξη των θεσμών των ΚΠ και ΕΕΑΧ, ως νέων εργαλείων για την ανάπτυξη του καταδυτικού τουρισμού. Επισημαίνονται τα προβλήματα που οι παραπάνω θεσμοί αντιμετωπίζουν, ιδίως όσον αφορά το ζήτημα της απαγόρευσης γειτνίασης ΚΠ με ΕΕΑΧ εγγύτερα των 3ν.μ., μία άχρηστη και αδικαιολόγητη ρύθμιση, καταστροφική για αμφότερους τους θεσμούς, την υποχρεωτική συνοδεία των τουριστών από δημόσιους υπαλλήλους, μια ακατανόητη και κυρίως ανέφικτη απαίτηση, που έχει καταστήσει ανενεργούς τους ΕΕΑΧ και τις κηρύξεις τους κενές περιεχομένου, ενώ προτείνονται συγκεκριμένες, εφικτές και άμεσα υλοποιήσιμες λύσεις. Προτείνονται θεμελιώδεις θεσμικές λύσεις, όπως η αξιοποίηση του υπάρχοντος ειδικευμένου και ελεγχόμενου ανθρώπινου δυναμικού του καταδυτικού κλάδου, ο μετασχηματισμός του υπάρχοντος Μητρώου Παρόχων Καταδυτικών Υπηρεσιών του Ν.3409/2005 σε Καταδυτικό Επιμελητήριο, η θέσπιση της συνοδευόμενης κατάδυσης ως μέτρου προστασίας και η ανάθεση της συνοδείας στους Οργανωμένους Καταδυτικούς Χώρους (ΚΠ, ΕΕΑΧ και Σύγχρονα Ναυάγια) στους Παρόχους Καταδυτικών Υπηρεσιών με υποχρέωση ηλεκτρονικής ενημέρωσης των Αρχών για την διαρκή παρακολούθηση της εκάστοτε δραστηριότητας με ευθύνη των Παρόχων, και τέλος εκτίθενται τα πλεονεκτήματα της πρότασης και της δι’ αυτής ταυτόχρονης λύσης πολλών προβλημάτων.

Nella formazione di un subacqueo questo corso è il più importante dopo quello iniziale e determina il definitivo passaggio da una attività ricreativa e non impegnativa ad una piùcosciente e ragionata. Per questo bisogna essere consapevoli che l’attività che sta per essere intrapresa è entusiasmante, ma comporta dei rischi e che, per essere goduta appieno, deve essere svolta con disciplina e pieno senso di responsabilità. Ignoranza, leggerezza, scarso addestramento e presunzione possono determinare incidenti a se stessi o ad altri, talvolta anche mortali. La consapevolezza, la determinazione e il senso di responsabilità invece permetteranno di affrontare con successo il corso e quelli successivi che miglioreranno le vostre capacità d’immersione mettendovi in grado di esplorare in sicurezza profondità maggiori e per
tempi di permanenza più lunghi, oppure esplorare relitti, grotte ed altri ambienti fino ad ora preclusi. La padronanza di queste tecniche e conoscenze inoltre potranno aprire la porta, a coloro di voi che lo desidereranno, della vera e propria subacquea tecnica e delle
immersioni con trimix. Probabilmente l’aria è il gas che la maggioranza dei subacquei ancora utilizza, ma chi affronta questo corso deve avere come prerequisito il brevetto IANTD EANx Diver od uno equivalente che gli dia le basi sicure per uno sviluppo ulteriore delle conoscenze dell’immersione con gas respiratori diversi dall'aria. Gli obbiettivi d’addestramento saranno soddisfatti quando sarete in grado di padroneggiare completamente la conoscenza e l’utilizzo di miscele nitrox idonee per ottimizzare il tempo di fondo dell’immersione e la
decompressione, anche per periodi prolungati ed oltre i limiti della curva di non decompressione. Il primo passo verso queste capacità future ed entusiasmanti è lo studio di questo manuale che è il più completo e migliore testo sulla materia. Esso è la sorgente originale e basilare che deve essere padroneggiata da chi vuole intraprende questo tipo di attività d’immersione. E’ stato sviluppato specificatamente per formare le conoscenze, l’addestramento e la maturità dello studente. Esse comprendono la conoscenza teorica dei principi fisici e fisiologici, gli esercizi psicomotori, il giusto allenamento, la forma fisica, l’esperienza, la maturità caratteriale e la conoscenza dell’attrezzatura. Tutti argomenti
indispensabili, la cui padronanza è fondamentale per affrontare nel modo giusto le immersioni profonde ad aria e/o miscele di nitrox (EANx) fino al limite dei 42 m con decompressione.
Questo manuale tratta ed insegna tutti questi argomenti ed è il frutto di grandi conoscenze che solo venti anni fa, agli inizi degli anni ’90, non erano a disposizione di una utenza generalizzata, ciò che vi è scritto è frutto di grande studio, esperienza e sacrifici, è la base di conoscenza futura e un rifermento sempre affidabile.

Il turismo archeologico subacqueo in Italia: opportunità e rischi
1. Una straordinaria opportunità
2. Elitismo gentrificato e slow diving
3. Una pratica virtuale ed educativa
4. Mondo blu e mondo grigio: l’alterità del turismo subacqueo
5. Una cura per un sistema cancerizzato? Il caso di Siracusa
6. La chimera del turismo sostenibile: le Cinque Terre e Capri
7. I percorsi subacquei di Ustica: turismo e archeologia
8. Autenticità e spazi marini: Ustica e Corfu
9. Turisti, archeologi o pirati? Spot e archeologia subacquea
10. Atlantide e il turismo subacqueo pseudo-archeologico
11. Ustica: il museo delle anfore tra voyeurismo e necrofilia
12. Dal mito alla realtà: i percorsi fantasma di Ustica
13. Il sontuoso mondo di Baia e la nascita del turismo
14. Il parco sommerso di Baia e il Ninfeo di Punta Epitaffio
15. La vendetta del Ciclope: un percorso difficile

Le informazioni contenute in questo manuale introducono all'utilizzo delle miscele trimix, limitatamente a quelle normossiche. Il termine normossico, come già è stato introdotto dai corsi precedenti, indica quelle miscele con la frazione/percentuale dell’ossigeno identica a quella naturale dell’atmosfera, perciò con 0,20/0,21 O2, cioè 20/21% di ossigeno nella miscela respirata. Per vari motivi di sicurezza la frazione dell’elio (He) è limitata ad un massimo di 0,30, cioè 30% del totale della miscela. Perciò con tale definizione ci riferiamo a miscele trimix con un minimo del 20% O2, un massimo del 30% di He, il rimanente sarà N2. Ovviamente sono consentite miscele iperossiche di trimix, cioè con percentuale dell’ossigeno superiore a 20%, mantenendo quella dell’elio comunque non superiore al 30%, con queste si può ottimizzare la saturazione del gas inerte, quella dell’ossigeno e la narcosi per quote fino a circa 50 metri. In questo manuale sono inclusi cenni di fisica, informazioni sulla analisi delle miscele e sul loro uso in sicurezza, nonché informazioni sulla configurazione dell’equipaggiamento e su esercizi pratici da eseguire per potere padroneggiare tale tipologia d’immersioni. Il corso Normoxic Trimix Diver è comunque fondamentalmente un corso estremamente pratico, finalizzato al corretto addestramento che possa rendere sicuro e competente il subacqueo che risulti idoneo a svolgere immersioni con miscele trimix nei limiti dei quali egli è stato brevettato. Le informazioni teoriche sono perciò di cultura generale e di introduzione ad un più accurato sviluppo che potrà avvenire nei corsi di IANTD Technical Diver e di IANTD Trimix Diver.

ABSTRAK: Pariwisata merupakan salah satu sektor perekonomian yang selalu mengalami peningkatan tercepat di dunia termasuk di Indonesia. Namun tidak dipungkiri juga industri pariwisata memberi dampak besar pada kerusakan lingkungan, perubahan iklim dan kemerosotan nilai budaya masyarakat lokal. Tulisan ini bertujuan memberikan rekomendasi model pengelolaan wisata selam di kapal MV. Boelongan Nederland berdasarkan prinsip pariwisata berkelanjutan yaitu kegiatan wisata yang memberi manfaat secara ekonomis namun tetap memperhatikan kelestarian lingkungan Teluk Mandeh, bangkai kapal dan sosial budaya masyarakat Nagari Mandeh. Beberapa rencana strategisnya adalah penetapan regulasi, kelembagaan dan pemberdayaan masyarakat, zonasi wilayah lalu pengembangan wisata dengan sifat multiple destination.

Tomando como punto de partida la historia maritima y la metodología científica de la arqueología subacuatica, entendiendo la necesidad de acercar la cultura y la historia a los ciudadanos y visitantes, como una forma de protección y conservación del patrimonio, presentará en la Primera Conferencia Internacional en Dajla, las lineas básicas para convertir el Patrimonio Natural y Cultural Sumergido de la zona, en un motor de la región, su puesta en valor y dinamización para su conservación y protección, de acuerdo con la Convención de la UNESCO de 2001.

Making a tour of the underwater archaeological parks in Europe, for example; Angra Bay, or Baia Azores and Naples in Italy, look like have become strategic instrument to put in value the underwater cultural heritage. Taking this continental reference work, to enhance upward submarine submerged natural heritage and cultural heritage (primarily shipwrecks).
You bet, in the Canary Islands because of the weather conditions and the geostrategic accessibility as European tourist destination (12 million visitors a year), for the abundance of land and maritime heritage; archaeological sites and museums. The autonomy Canaria stands out as ideal destination for promoting diving as a tourist resource of the Underwater Cultural Heritage. Therefore, the importance of proper use as protection, to enjoy the underwater cultural heritage.

In our collective imagination the sea and its depths express two contrasting forces: on the one hand, the fascination of a world to be discovered, which is perceived as a bearer of knowledge, constructor of social relations and source of riches; on the other, the fear of a dangerous, sterile state, bringer of death. This dichotomy has its roots in the symbolic system of ancient world, which regarded the sea as belonging to ritual initiatory practices based on the opposition between nature and culture. An analysis of myths and stories about underwater travels and initiatory dives allows us to trace a diachronic path from the heroes of ancient myths to the first forms of underwater archaeological tourism. From Alexander the Great to the voyages of Nautilus, from Theseus to the heroes of the modern cinema, a single thread connects the human imaginary to the world of the depths.

1. Recreational diving is a concern regarding its effects on benthic assemblages, especially on heavily dived coral reefs. However, spearfisher behaviour and the scale of damage they cause to corals remains unknown. 2. The behaviour of recreational spearfishers was observed to determine their rate of physical contacts with corals. The experience level and fishes captured by spearfishers were assessed to establish their relationship with the number of contacts with corals. 3. All spearfishers made contact with corals, at an average rate of 1.25 ± 0.1 SE touches per minute and caused physical damage at a rate 0.51 ± 0.04 per minute. Massive corals were most frequently touched and branching corals were most frequently damaged. Touches and damage occurred mainly through fin kicks, spearfisher bodies and spearguns. Contact rates varied according to spearfisher experience level and the fish they were targeting. Novice spearfishers showed no preference for specific targets while experienced spearfishers target mesopredator fishes. 4. Spearfishing caused the highest known rates of touches and damage to corals among all the activities involving recreational diving. The activity may add to local stressors on corals, especially at sites with high visitation rates. Understanding how the factors that affect spearfisher behaviour and their effects on corals may help managers to develop strategies to mitigate the incidence of damaging behaviour.

... 1–6. © Allerton Press, Inc., 2011 ... of amplification of a 734 bp fragment of the hLF gene using pair of primers GL F (5' TGTCTTC CTCGTCCTGCTGTTCC 3') and GL R (5' CAT ACTCGTCCCTTTCAGCCTCG 3'). Amplification was carried out in the Perkin Elmer thermocycler ( ...

Στην προοπτική αξιοποίησης του ενάλιου πολιτισμι-
κού πλούτου της χώρας, η πολιτεία διαμόρφωσε
θεσμικό πλαίσιο για την ανάπτυξη του καταδυτικού
τουρισμού. Ο νομοθέτης, επηρεασμένος από τον
επενδυτικό χαρακτήρα της τουριστικής ανάπτυξης,
κινήθηκε με ευρύτητα πνεύματος για την διαμόρφωση
της κατάδυσης αναψυχής απομακρυνόμενος από το
αυστηρό πλαίσιο της επαγγελματικής κατάδυσης.
Όμως, η αειφόρος τουριστική ανάπτυξη επιβάλλει την
ορθολογική διαχείριση του καταδυτικού τουρισμού.

... 1–6. © Allerton Press, Inc., 2011 ... of amplification of a 734 bp fragment of the hLF gene using pair of primers GL F (5' TGTCTTC CTCGTCCTGCTGTTCC 3') and GL R (5' CAT ACTCGTCCCTTTCAGCCTCG 3'). Amplification was carried out in the Perkin Elmer thermocycler ( ...