Location via proxy:   [ UP ]  
[Report a bug]   [Manage cookies]                
Scribd Logo
Upload

Welcome to Scribd!

  • 520 views

    SOLVE A CRIME Activity

    Uploaded by

    eula faith miracle andam
    1. A fire-breathing mutant called WHO set fire to a school science laboratory. Three suspects were identified based on their characteristics and alibis. 2. DNA evidence in the form of genetic codes was recovered from the crime scene. 3. Additional information provided the amino acid sequences that correspond to traits like nose hair length, skin color, and lip shape. 4. A crime scene investigator application asks applicants to analyze the DNA evidence to identify the primary suspect.

    Copyright:

    © All Rights Reserved
    Download as DOC, PDF, TXT or read online from Scribd

    SOLVE A CRIME Activity

    Uploaded by

    eula faith miracle andam
    520 views2 pages
    1. A fire-breathing mutant called WHO set fire to a school science laboratory. Three suspects were identified based on their characteristics and alibis. 2. DNA evidence in the form of genetic codes was recovered from the crime scene. 3. Additional information provided the amino acid sequences that correspond to traits like nose hair length, skin color, and lip shape. 4. A crime scene investigator application asks applicants to analyze the DNA evidence to identify the primary suspect.

    Original Title

    SOLVE A CRIME activity.doc

    Copyright

    © © All Rights Reserved

    Available Formats

    DOC, PDF, TXT or read online from Scribd

    Did you find this document useful?

    Is this content inappropriate?

    1. A fire-breathing mutant called WHO set fire to a school science laboratory. Three suspects were identified based on their characteristics and alibis. 2. DNA evidence in the form of genetic codes was recovered from the crime scene. 3. Additional information provided the amino acid sequences that correspond to traits like nose hair length, skin color, and lip shape. 4. A crime scene investigator application asks applicants to analyze the DNA evidence to identify the primary suspect.

    Copyright:

    © All Rights Reserved
    Download as DOC, PDF, TXT or read online from Scribd
    Download as doc, pdf, or txt
    520 views2 pages

    SOLVE A CRIME Activity

    Uploaded by

    eula faith miracle andam
    1. A fire-breathing mutant called WHO set fire to a school science laboratory. Three suspects were identified based on their characteristics and alibis. 2. DNA evidence in the form of genetic codes was recovered from the crime scene. 3. Additional information provided the amino acid sequences that correspond to traits like nose hair length, skin color, and lip shape. 4. A crime scene investigator application asks applicants to analyze the DNA evidence to identify the primary suspect.

    Copyright:

    © All Rights Reserved
    Download as DOC, PDF, TXT or read online from Scribd
    Download as doc, pdf, or txt
    of 2

    SOLVE A CRIME: IN SEARCH OF MUTANT WHO

    A. The crime and the suspects


    A fire-breathing mutant called WHO razed the science laboratory to the ground. The
    school was in chaos. Parents and teachers demanded to know who the culprit is. The
    school officials are in a tight spot. They have to find WHO, and they have to it fast. They
    have three suspects, namely:
    1. Bigote Ugly who flunked the Biology class three times. He has long nose hairs, dark
    skin and full lips.
    2. Wiz Whitey whose investigatory project is about the potential applications of nuclear
    fusion in generating energy. She has short nose hairs, albino white skin and full lips.
    3. Dirty-Hare-Ry who was given a week’s suspension by the Disciplinary Committee for
    repeated tardiness. He has short nose hairs, dark skin and harelip (cleft upper lip).
    B. The crime scene
    A fresh DNA sample was obtained from the crime scene, believed to have been left by the
    mutant arsonist. We will call this THE CODE.
    THE CODE 1: TACAAATTTATCTACCATCGTCGTATCTACAAATTTCGTATC
    THE CODE 2: TACGAATTTATCTACCATCGTCGTATCTACAAACTTCGTATC
    THE CODE 3: TACAAATTTATCTACCATCGTCATATCTACAAACTTCGTATC

    C. Additional information
    Amino acids that make up the proteins for the three hereditary characters:
    1. Nose hairs
     Short: (phe-lys)
     Long: (leu-lys)
    2. Skin color
     Dark skin: (val-ala-ala)
     Albino white skin: (val-ala-val)
    3. Lips
     Full lips: (phe-gln-ala)
     Harelips with cleft palate (phe-lys-ala)

    Note: The amino acid sequences in the proteins for particular characters in NOT REAL, this was
    only conceptualized and designed for the purpose of illustrating the relationship among
    DNA, protein and expression of hereditary characters.

    D. Fill in the blacks the missing codon


    DNA mRNA tRNA Amino Acid
    1. TAC AUG UAC Methionine/ Start
    2. AAA ____ ____ Phenylalanine (Phe)
    3. TTT ____ ____ Lysine (Lys)
    4. CTT GAA ____ Glutamine (Glu)
    5. ATC ____ AUC Stop
    6. CGT ____ ____ Alanine (Ala)
    7. GAA CUU ____ Leucine (Leu)
    8. CAT ____ CAU Valine (Val)

    E. WANTED: Crime scene investigator

    Application Form
    1. Copy the DNA, called THE CODE. Use a slash to separate the nucleotide letters in group
    of 3.
    _________________________________________________________________
    2. Write the mRNA produced by transcription. Don’t forget complementary base pairing.
    _________________________________________________________________
    3. Write the tRNA using the mRNA as blueprint. Don’t forget complementary base pairing.
    _________________________________________________________________
    4. Write the amino acid sequence of the protein equivalent.
    _________________________________________________________________
    5. Write the phenotype expressed, based on the sequence of amino acids in the proteins
    synthesized.
    _________________________________________________________________
    6. Provide the cartographic sketch of your PRIMARY SUSPECT based on the description
    generated from your DNA analysis.

    WANTED

    MUTANT WHO

    a.k.a

    7. Submit(Name
    your analysis,
    of primary we will let you know Cartographic
    andsuspect) if you got the sketch of suspect
    job. Good luck!

    You might also like