Location via proxy:   [ UP ]  
[Report a bug]   [Manage cookies]                
0% found this document useful (0 votes)
367 views

Course Synthesis Matching Type (4 Items X 2 Points) Column A Column B

This document contains a course synthesis assignment with two parts: 1) A 4 item matching question that asks the student to match evolutionary changes to different animal groups based on a provided cladogram. 2) A short essay asking the student to analyze 5 DNA sequences, mark start/stop codons and identified alleles with colors, and report how many individuals have the identified allele. Scoring criteria for the essay including markings, identified allele, and number of individuals is provided. The document also provides the answers to the matching question and the 5 DNA sequences to be analyzed for the essay.

Uploaded by

Xenah Faelnar
Copyright
© © All Rights Reserved
Available Formats
Download as DOCX, PDF, TXT or read online on Scribd
0% found this document useful (0 votes)
367 views

Course Synthesis Matching Type (4 Items X 2 Points) Column A Column B

This document contains a course synthesis assignment with two parts: 1) A 4 item matching question that asks the student to match evolutionary changes to different animal groups based on a provided cladogram. 2) A short essay asking the student to analyze 5 DNA sequences, mark start/stop codons and identified alleles with colors, and report how many individuals have the identified allele. Scoring criteria for the essay including markings, identified allele, and number of individuals is provided. The document also provides the answers to the matching question and the 5 DNA sequences to be analyzed for the essay.

Uploaded by

Xenah Faelnar
Copyright
© © All Rights Reserved
Available Formats
Download as DOCX, PDF, TXT or read online on Scribd
You are on page 1/ 2

SH1918

Course Synthesis

Matching Type (4 items x 2 points)


Match the items in column A with column B based on the cladogram below.
COLUMN A COLUMN B
___1. Experienced the least number of A. Amphibians
evolutionary changes B. Snakes
C. Birds
___2. Experienced the highest number of
D. Non-avian birds
evolutionary changes
E. Crocodiles
___3. Closer to turtles than crocodiles F. Mammals
___4. Closer to amphibians than lizards

Short Essay (7 points)


Using MS Word or any word processing software, analyze the five (5) DNA sequences below. Refer to
the guide below on how to mark the different sequences and then indicate how many individuals have this
allele. Submit your answers as a pdf file.

>1
acagtggctcaatagggtacctgttcggaaacagcatcaatgcacagcgatctcgcaacggacccatgattatgttagagacatc

>2
atatggtcatcgtatcgcatctttgcttacctgttcggaaacagctcaacttaaggatgcgaggacagagggtaggccaagggtga

>3
cgctgagctgaagatctacctgttcggaaacagcatccggctcggataagacgcgctggcctataagcggattgcaggagaatc

>4
ataaatggcacaaacatttgatttgttggctgaccgatgtcatacctgttcggaaacagcatcgacctttagttggaagaatagaatc

>5
cgaggtgtgtatgtcaactacctgttcggaaacagctatcgtgatcccgtatagtcattggccgatgacgagttcctgttcctcggaa

 Start codons = red, bold font


 Stop codons = blue, bold font
 Identified allele = yellow highlight

Rubric for Short Essay


Criteria Performance Indicators Points
Markings and labels All codons and alleles were marked/highlighted appropriately. 2
Identified allele The allele identified was correct. 3
Number of Individuals The correct number of individuals was identified. 2
Total 7

ANSWERS:
1. D
2. F
3. C
4. B

eLMS Course Synthesis *Property of STI


                                                                                                                              Page 1 of 2
SH1918

>1
acagtggctcaatagggtacctgttcggaaacagcatcaatgcacagcgatctcgcaacggacccatgattatgttagagacatc

>2
atatggtcatcgtatcgcatctttgcttacctgttcggaaacagctcaacttaaggatgcgaggacagagggtaggccaagggtga

>3
cgctgagctgaagatctacctgttcggaaacagcatccggctcggataagacgcgctggcctataagcggattgcaggagaatc

>4
ataaatggcacaaacatttgatttgttggctgaccgatgtcatacctgttcggaaacagcatcgacctttagttggaagaatagaatc

>5
cgaggtgtgtatgtcaactacctgttcggaaacagctatcgtgatcccgtatagtcattggccgatgacgagttcctgttcctcggaa

eLMS Course Synthesis *Property of STI


                                                                                                                              Page 2 of 2

You might also like