Environmental Toxicology and Pharmacology 67 (2019) 108–116

Contents lists available at ScienceDirect

Environmental Toxicology and Pharmacology

journal homepage: www.elsevier.com/locate/etap

Identification and characterization of novel bacterial polyaromatic T

hydrocarbon-degrading enzymes as potential tools for cleaning up
hydrocarbon pollutants from different environmental sources
Heba A.R. Abdelhaleema, Haggag S. Zeinb, Abdel Azeiza, Ahmed N. Sharafb,
Abdelhadi A. Abdelhadib,
⁎

a
College of Biotechnology, Misr University for Science and Technology (MUST), 6th October City, Egypt
b
Department of Genetics Faculty of Agriculture, Cairo University, PO Box 12613 Giza, Egypt

ARTICLE INFO ABSTRACT

Keywords: Polycyclic aromatic hydrocarbons (PAHs) are recalcitrant hazardous environmental contaminants. Various
Bacillus subtilis strategies, including chemical and physical like oxidation, fixation, leaching, and electrokinetic or biological-
Dioxygenase based techniques are used for remediation of polluted sites. Bioremediation of PAHs, via PAH-degrading en-
Bioremediation dophytic and rhizospheric microbes, represent a time-/cost-effective way for ecorestoration. Four bacterial
PAHs
strains were isolated from contaminated soil on MSM supplemented with anthracene, alpha-naphthalene or
qPCR
catechol as sole carbon sources. These isolates were identified with 16S rRNA as Bacillus anthracis, B. cereus, B.
mojavensis and B. subtilis. The degradation efficiency on the selected aromatic compounds was tested by HPLC
analysis. B. subtilis showed the highest degradation efficiency of anthracene (99%) after five days of incubation.
B. subtilis showed the highest catechol 1, 2 dioxygenase activity in MSM supplemented with anthracene. The
enzyme was purified by gel filtration chromatography and characterized (70 kD, Km 2.7 μg and Vmax 178U/mg
protein). The catechol 1,2 dioxygenase gene from the identified four bacterial strains were isolated and sub-
mitted to GenBank (accession numbers MG255165-MG255168). The gene expression level of catechol 1,2 di-
oxygenase was upregulated 23.2-fold during the 72 h of incubation period. Furthermore, B. subtilis is a promising
strain to be used in bioremediation of aromatic compounds-contaminated environments.

1. Introduction groups of adenine and guanine forming DNA adducts that are known to
be aetiological agents in cancer development (Flesher and Lehner,
Polyaromatic hydrocarbons (PAHs) are a group of ubiquitous per- 2016). The mutational spectrum revealed a prevalence of G > T
sistent, semi-volatile, and organic pollutants that enter environmental transversions (Spink et al., 2008 and Tarantini et al., 2009).
systems via natural and anthropogenic-related sources. Their structures Certain microorganisms can neutralize PAHs by transforming them
are composed of two or more fused aromatics with a relatively low into molecules that can enter their metabolic machinery through
water solubility and high lipophilicity (Wick et al., 2011; Ghosal et al., aerobic biodegradation, using oxygen as an electron acceptor or
2016). Their hydrophobic states and persistence in the environment through anaerobic biodegradation (Gan et al., 2009; Ghosal et al.,
make them very toxic to living organisms by provoking mutagenic or 2016; Fulekar, 2017). Aerobic bacterial biodegradation of aromatic
carcinogenic risks (Shi et al., 2005; Kweon et al., 2011; Hajisamoh, compounds utilizes many enzymes including dioxygenases and dehy-
2013). The potential of reactive metabolites (e.g. epoxides and dihy- drogenases (Smith, 1990; Seo et al., 2009; Xu et al., 2018).
drodiols) of some PAHs, possibly could bind to cellular proteins and The Gram-positive Bacillus sp. can utilize many PAHs as sole sources
DNA and generates toxic effects, can result in biochemical disruptions of carbon and energy (Bayoumi, 2009; Bibi et al., 2018). The objective
and cell damages leading to developmental malformations, mutations, of the current study was to isolate and characterize some bacterial
and tumors (Kim et al., 2013). The mechanism of mutagenicity of PAHs species that were able to degrade PAHs at biochemical, enzymatic, and
has been extensively investigated. PHAs metabolites, e.g. dihydrodiol molecular levels.
epoxide, can predominantly bind to nucleic acids at the exocyclic amino

⁎
Corresponding author at: Genetics Department Faculty of Agriculture, Cairo University, PO Box 12613, Giza, Egypt.
E-mail address: abdelhadi.abdallah@agr.cu.edu.eg (A.A. Abdelhadi).

https://doi.org/10.1016/j.etap.2019.02.009
Received 6 November 2018; Received in revised form 6 February 2019; Accepted 18 February 2019
Available online 20 February 2019
1382-6689/ © 2019 Elsevier B.V. All rights reserved.
H.A.R. Abdelhaleem, et al. Environmental Toxicology and Pharmacology 67 (2019) 108–116

2. Materials and method 90 s extension at 72 °C, and a final extension step of 10 min at 72 °C.
Five μL of the amplified mixture was then analyzed using 1.5% 1X TBE
2.1. Sample collection agarose gel electrophoresis. The gel was stained with ethidium bro-
mide, visualized under UV light, and photographed. The amplified
A set of oil-contaminated sludge, soil and sea water (10 samples products with the correct size were then purified and sequenced in both
each) were collected from an area bordering an industrial zone located directions using an ABI automated sequencer.
in Borg Al Arab City south-west of Alexandria Governorate, Egypt
(31°08′46.8″N 29°50′21.3″E). The study area harboring heavy in- 2.6. Sequencing, alignment and phylogenetic analysis
dustries (cement, chemicals, cosmetics, detergents, fish production,
industrial dyes, petroleum refining and tanneries) in addition to the 16S-rRNA PCR product was extracted from gel using gel extraction
uncontrolled disposal of these wastes. Hence, the selected study area kit QIAquick Qiagen (Promega, USA). DNA sequencing was conducted
receives significant amounts of untreated industrial wastes. Sampling using ABI Prism BigDyeTM Terminator Cycle Sequencing Ready
has been carried out during the period from March to June 2015. Reaction Kit (Applied Biosystems, USA) according to manufacturer's
Anthracene, catechol and alpha-Naphthalene with 98% purity were instructions. ABI PrismTM 3730/3730XL DNA Sequencer (AME
used as standards in this study and were purchased from oxford la- Biosciences, USA). The 16S rRNA gene sequences of the isolates ob-
boratory, USA. tained in this study were aligned and compared with the known 16S
rRNA gene sequences in Genbank database using the BLAST search at
2.2. Enrichment and isolation of PAHs-degrading bacteria the National Center for Biotechnology Information (http://www.ncbi.
nlm.nih.gov/BLAST/) to determine the closest available database se-
About 10 g of sludge and contaminated soil or 10 ml of sea water quences. Sequences were finally submitted to GenBank.
samples were suspended in 90 ml of distilled water, and then 10 ml was
transferred into a 250 ml conical flask containing 90 ml of mineral salt 2.7. Enzyme and growth assay
media (MSM). The mineral salt medium (MSM) was composed of (g/L):
3 g NH4NO3, 1.5 g K2HPO4, 0.5 g KH2PO4, 0.2 g MgSO4.7H2O, 0.5 g Each individual isolate was cultivated on LB medium for 24 h. The
NaCl, 0.02 g FeSO4, 0.05 g CaCl2, pH 7.0 (Chao et al., 2006). Trace cells were harvested by centrifugation at 5000 rpm for 10 min, washed
elements solution was sterilized by filtration through 0.2 μm filter. One three times with Phosphate buffer (pH 7.0), and measured on spectro-
ml from this solution was added to 100 ml of MSM after media ster- photometer at 600 nm to standardize the cell concentration of all
ilization the medium was supplemented with one of the following strains. Cells of each pure isolate was re-suspended in 50 ml MSM
aromatics compounds anthracene, catechol and alpha-Naphthalene at medium supplemented with either anthracene, catechol, or alpha-
concentration of 100 mg/l as a sole source of carbon. The flasks were Naphthalene at concentration of 100 mg/L for each. Abiotic controls
incubated on an orbital shaker at 150 rpm at 30 °C. were prepared in the same way without addition of bacteria. Samples
and controls were prepared in triplicates. Flasks were incubated at 30 °C
2.3. Inoculum preparation with shaking at 150 rpm for 5 days at normal daylight, according to
(Guo et al., 2010). The growth was spectrophotometrically measured at
After 7 days incubation, an aliquot of 10% enriched cultures were 600 nm daily using 1 ml from culture and the activity of catechol 1,2-
transferred into another 500 ml conical flasks containing 90 ml fresh dioxygenase was determined (260 nm) by quantitating the formation of
autoclaved MSM medium supplemented with previously mentioned cis,cis-muconic acid (CCMA) (εCCMA = 16 800 M–1 cm–1) at 40 °C. The
PAHs (Moussa et al., 2017). The formed colonies were picked up and reaction mixture used for measuring enzyme activity was contained
the purity and cell morphology were microscopically examined by 40 μL of catechol (50 mM), 134 μL of Na2 EDTA (20 mM), 1786 μL of
Gram staining. phosphate buffer pH 7.5 (50 mM) and 40 μL of culture supernatant in a
total volume of 2 ml (Hegeman, 1966).
2.4. Genomic DNA isolation
2.8. Anthracene utilization under different ions concentration and pH
Genomic DNA was extracted from pure bacterial culture; 24 h
grown in Luria-Bertani (LB) medium at 30 °C, centrifuged for 2 min at MSM media supplemented with anthracene at a concentration
5000 rpm. Bacterial lysis was performed according to the manufac- 100 mg/l was prepared at different pH 5.5, 6.5, 8.5 and was inoculated
turer's instructions using the GeneJET™genomic DNA purification kit with B. subtilis, the media was changed daily with new media with
(Thermo Fisher Scientific, USA). The obtained purified DNA was re- adjusted pH. Cells were harvested with centrifugation at 5000 rpm for
suspended in 100 μL of Tris-EDTA (TE) buffer (Sambrook and Russel, 5 min. MSM media was prepared with different ions concentrations of
2001). The A260/A280 absorbance ratio was used to determine purity. Mg2+, Fe2+, and NH4+ at a concentration of 1.0 mM for each ion and
The extracted DNA (5 μL) was loaded on 1% agarose gel (Invitrogen, 10 mM for NH4+ in 50 mM Tris−HCl buffer solution pH 8. The che-
California, USA), which contained ethidium bromide (1 μg/mL) for micals used were MgCl2, HgCl2, FeCl3, and (NH4)2SO4.
DNA staining.
2.9. HPLC analysis
2.5. Bacterial identification using 16S rRNA sequencing method
The bacterial biodegradation efficiency of the aromatic compounds
16S rRNA amplification was carried out according to Promega (anthracene, catechol and alpha-Naphthalene) was evaluated by de-
GoTaq kit with universal primers: F:5-'TGGAGAGTTTGATCCTGGCT termination of the remaining undegraded concentration from each
CAG-3′ and R:5′-TACCGCGGCTGCTGGCAC-3′ in a final volume of 25 μL aromatic compound by HPLC analysis. Each individual isolate was
containing 5 μL 5x buffer with 20 mM magnesium, 0.5 μL 2.5 mM nu- cultivated on nutrient broth medium for 24 h as mentioned above. The
cleotide mix, 0.125 μL Polymerase Promega M830B, 0.113 μL from each remaining of the aromatic compounds was extracted three times with
forward and reverse primer with concentration 100 pmol and 1 ng/ μL equal volumes of ethyl acetate, according to the method described by
genomic DNA (Linxiang et al., 2014). Amplification was performed in (Manohar et al., 1999). The samples were dried under vacuum and
an Applied Biosystems ABI 9901 veriti 96-well fast PCR thermal cycler stored at −20 °C. The extract was injected into HPLC using model
according to the following program: 2 min denaturation at 95 °C, fol- HP1100 with UV – Vis detector at wavelength of 254 nm. The separa-
lowed by 35 cycles of 40 s denaturation at 95 °C, 40 s annealing at 55 °C, tion conditions were: column: RP-C18 200mmX4.6mm X 5 μm and

109
H.A.R. Abdelhaleem, et al. Environmental Toxicology and Pharmacology 67 (2019) 108–116

injection volume: 2.0 μL. Mobile phase: acetonitrile (A): water (W) Table 1
isocratic program, Water %: 40% Acetonitrile %: 60% water. All the List of primers used in the isolation of catechol 1,2 dioxygenase.
HPLC solvents were HPLC grade, obtained from Merck. Primer name Sequence (5 > 3)

2.10. Enzyme precipitation and purification F.anthracis TCACATTACAGCAATCGTAGGACA

R.anthracis TCTCACTTCAAATGGTAAAAGCGT
F.cereus TCTCACTTCAAATGGTAAAAGCGT
MSM medium supplemented with 100 mg/l anthracene was used for R.cereus CACATTACAGCGATTGTAGGGC
enzyme isolation. Fifty ml MSM media in a 250 ml conical flask was F.subtilius ACAGCAATTGTCGGTCACCC
inoculated with 1 ml of seed inoculum and incubated at 30 °C shacked R.subtilius CAACTCTCTCACTTCAAACGGC
at 150 rpm for 5 days. At the end of incubation period, the biomass was F. mojavensis CTACAATTCAGGCAAAAGATCTGTAA
R.mojavensis ATGATAACAGAAGGATTGCACCA
separated by centrifugation; the supernatant was subjected to protein
precipitation. The precipitant obtained from 50 to 70% saturation of
ammonium sulfate was collected and re-suspended in 5 ml phosphate
buffer (0.05 M, pH 7.5) the enzyme solution was purified by gel fil- 0.5 min for B. antharacis, 54 °C 0.5 min for B. cereus, 56 °C 0.5 min for B.
tration chromatography (DEAE Sephadex A-50, 2 x 80 cm). The column mojavensis, and 55 °C 0.5 min for B. subtilis, and 72 °C 1 min. The reac-
was eluted with the same buffer with gradient NaCl ranged from 0 to tion was finished with an additional final extension for 10 min at 72 °C.
1 M at a flow rate of 0.1 ml/min. Total proteins and dioxygenase ac-
tivity were determined in each collected fraction. Fractions, eluted from
480 to 500 min, with catechol 1,2 dioxygenase activity were combined 2.14.2. RNA extraction
and subjected to precipitation again with 50% to 70% ammonium Selected isolate B. subtilis was cultivated on nutrient broth medium
sulphate and then dialyzed with dialysis tube against distilled water. for 24 h. The cells were harvested by centrifugation at 5000 rpm for
Enzyme purity was analyzed by SDS-PAGE and pooled for further study. 10 min, growth was measured at OD600, and re-suspended in phosphate
All purification steps were carried out at 4 °C. buffer (pH 7.0). MSM medium supplemented with anthracene at con-
centration of 100 mg/l were incubated at 30 °C with rotation at 150 rpm
2.11. Determination of protein concentration for 0, 24, 48, 72 and 96 h. Controls were prepared in the same way but
without addition of isolate. Samples and controls were prepared in
Protein concentration was determined using bovine serum albumin triplicate, after incubation periods flasks were subjected to centrifuga-
as a standard by the method of Bradford (Bradford, 1976). tion at 5000 rpm for 10 min at 4 °C. Cells were preserved in phosphate
saline pH at 4 °C till incubation period finished. RNA was extracted
2.12. SDS-PAGE using TRIsure™ RNA purification kit catalog # TRIsure BIO-38032 ac-
cording to manufacturing steps.
Isolated protein fractions were monitored for purity with SDS-PAGE
(Laemmli, 1970) using 12% separating gel. A Bio-Rad Mini-Protean II
apparatus was used throughout and proteins were stained with Coo- 2.14.3. cDNA synthesis and Real time PCR
massie Brilliant Blue R250. All procedures and reagents were as de- cDNA was synthetized using SensiFAST™ kit (Catalog # BIO-65053).
scribed previously by (Sambrook and Russel, 2001). The master mix was prepared using 1 μg RNA, 4 μl 5x Trans Amp Buffer,
1 μl Reverse Transcriptase and nucleases free water up to 20 μl. The
2.13. Determination of kinetic constants of catechol 1,2dioxygenase following program was used in a thermal cycler as 25 °C for 10 min for
primer annealing, 42 °C for 15 min for reverse transcription, 85 °C for
The catalytic parameters (Michaelis–Menten constant, Km, and 5 min for inactivation and hold in 4 °C (or chill on ice). Amplification
Maximum velocity, Vmax) for the enzyme were calculated by measuring was performed in an applied biosystem ABI 9901 veriti 96- well fast
the initial linear rates of the enzymatic reaction after the addition of PCR thermal cycler. cDNA samples were diluted 1.5-fold and a quan-
different concentrations of catechol ranging from 0 to 80 mM at 35 °C. titative real-time PCR run was employed on AB-7500 Real-time thermal
Three independent measurements were carried out for each substrate cycler (Applied Biosystems, California, USA) using SYBR Premix Ex-
concentration. Km and Vmax were calculated from the Michaelis–Menten TaqII (Takara Bio, Shiga, Japan) according to manufacturer’s direc-
equation. tions. PCR volume was 20 ml consisting of 0.4 mM of primer. Each PCR
run included a no-template control with water instead of cDNA as well
2.14. Catechol 1, 2 dioxygenase gene isolation as a RT negative control for each gene. Triplicate measurements were
performed for all reactions. pH and different ions samples were carried
2.14.1. Primer design and isolation of catechol 1, 2 dioxygenase gene on separate 96-well plates for the gene expression experiments while all
For designing a specific primer for each strain, sequences for each samples were analyzed on a single plate for the endogenous control
strain were subjected to multiple sequence alignment to identify a determination experiment. Results were analyzed using the critical
conserved region using MEGA3 software (Kumar et al., 2004). To de- threshold (ΔCT) and the comparative critical threshold (ΔΔCT) method
sign a new set of primers for dioxygenase gene (catA) sequences from B. in the AB-7500 software.
anthracis, B. cereus, B. mojavensis and bacillus subtilis were retrieved from
GenBank. Primer blast tool was used to find primers specific to each
sequence independently. The primer designed after tested with primer 2.15. Statistical analysis
blast to show the mismatched are presented in Table 1. To detect catA
gene with the newly designed primers, the PCR mixture was prepared, The experimental data was analyzed using analysis of variance
which contained 5 μL 10xPCR buffer, 2 mmol l−1 MgCl2, 0.3 μmol−1 (ANOVA). Either one- or two-way ANOVA were executed for real-time
(each) forward and reverse primers, 1 U of Taq DNA polymerase, PCR analysis and growth parameters and catechol 1,2 dioxygenase
0.2 mmol l−1 (each) deoxynucleoside triphosphate (Fermentas, Li- enzymatic activity, respectively. Duncan test was used to determine the
thuania), 3 μL of template DNA, and molecular grade water up to 50 μL. homogeneity among the means. Statistical analysis was performed
Amplification was performed in an applied biosystem ABI 9901 veriti using SPSS software (version 15; SPSS, Chicago, IL). Data are expressed
96- well fast PCR thermal cycler, according to the following tempera- as means ± SE.
ture profile: 98 °C 5 min, followed by 32 cycles of 94 °C 0.5 min, 55 °C

110
H.A.R. Abdelhaleem, et al. Environmental Toxicology and Pharmacology 67 (2019) 108–116

Table 2 Table 3
The growth values of the tested isolates in Mineral Salt Growth at OD600 of the selected four strains in MSM supplemented with pol-
Medium (MSM) supplemented with pollutant as a sole lutant (100 mg/l each) five days post incubation at 30 °C with shaking at
carbon source at OD600. 150 rpm.
Strain Anthracene Catechol Alpha-Naphthalene

a a
Control 0.0 ± 0.0 0.0 ± 0.0 0.0 ± 0.0 a
a,b
B. anthracis 0.219 ± 0.043 0.39 ± 0.074 a,b 0.33 ± 0.087 a,b
ab
B. cereus 0.237 ± 0.026 0.350 ± 0.040 a,b 0.28 ± 0.065 a,b
b
B. mojavensis 0.115 ± 0.029 0.445 ± 0.063 a,b 0.115 ± 0.029 b
ab
B. subtilis 0.228 ± 0.072 0.5425 ± 0.0329 c 0.44 ± 0.053 c

Values (mean ± SE, n = 3).

Values marked with the same letters are similar (p > 0.05) whereas, those
with different letters aren’t (p < 0.05).

no available works report on the usage of B. anthracis to degrade any

aromatic hydrocarbons.
The data presented in Table 3 show that, in case of using anthra-
cene, there were significant differences among the experimental groups
[F (4, 47) = 7.692; p < 0.05]. In comparison to the control, B. moja-
vensis was significantly different to the mean growth values measured
for B. anthracis, B. subtilis and B. cereus. Also, with catechol, there were
differences among the tested groups [F (4, 47) = 16.599; p < 0.05].
Likewise, B. subtilis was significantly different to the mean growth va-
lues measured for B. anthracis and B. cereus. While, via alpha-Naph-
thalene, there were differences among the groups [F (4, 47) = 8.810;
p < 0.05]. Too, B. subtilis was significantly different to the mean
growth values of B. anthracis and B. cereus and B. mojavensis. Com-
parative growth parameters of the tested Bacillus strains on the different
tested PAHs are presented in Fig. 1.
The data presented in Table 4 show that, there were significant
difference (p < 0.05) observed in enzyme activity (U/ml/min) be-
tween control and the tested strains in case of using anthracene [F (4,
59) = 3.782; p < 0.05], catechol [F (4, 54) = 19.160; p < 0.05], and
alpha-Naphthalene [F (4, 54) = 16.436; p < 0.05]. The maximum
*Isolates 18–21 were designated as S1-S4 later and
used in further analyses. catechol 1,2 dioxygenase activities (40.6 Unit/ml/min) was observed
Each value is the mean ± SE of the results of three from B. subtilis grown on anthracene as sole carbon source, followed by
different experiments (n = 3). Means with the same B. mojavensis (33.5 Unit/ml/min) when grown in catechol. However,
superscript letter are similar (insignificantly different; there was no significance differences when using alpha-Naphthalene.
p > 0.05) whereas, those with different letters are Comparative catechol 1,2 dioxygenase activity among the tested Ba-
significantly different; p < 0.05). cillus strains are presented in Fig. 2.

3. Result 3.3. Biodegradation efficiency

3.1. Isolation of PAHs degrading-bacteria by enrichment method B. subtilis showed the highest biodegradation percentages on an-
thracene and alpha-Naphthalene (99% and 41%, respectively); while B.
Twenty-four bacterial strains were isolated from contaminated cereus showed the highest biodegradation percentage for catechol
Egyptian sites on solid MSM medium supplemented with PAHs as a sole (17%) after five days of incubation.
carbon source. These strains were examined with Gram-staining and Lily et al. (2009) reported that a novel strain of B. subtilis BMT4i
morphology. Based on growth rate at OD600 [F = 2.059; p < 0.05] of (MTCC 9447) can degrade Benzopyrene with efficiency of 84.66% after
the isolated PAHs-degrading bacteria, four different Gram-positive 28 days of incubation. Poornachander et al., 2016 reported that B.
isolates designated as S1-S4 were selected for further analyses as the cereus was able to degrade anthracene, phenanthrene, and pyrene with
most promising PAHs-degrading strains (Table 2). efficiencies of 85.76, 73.46, and 47.88%, respectively after 13 days of
incubation.
3.2. Bacterial identification
3.4. Enzyme purification
The four bacterial isolates were identified after BLAST analysis as B.
anthracis, B. cereus, B. mojavensis and B. subtilis. The 16S RNA sequences The chromatogram of size-exclusion enzyme purification is pre-
from these strains were submitted to GenBank and allocated the ac- sented in Fig. 3. Seven fractions from a total of thirty-three fractions
cession numbers MF521916and MF521917 for B. anthracis, MF521918 had displayed enzyme activity and subsequently subjected to SDS-
and MF521919 for B. cereus, MF521920 and MF521921 for B. moja- PAGE. A 57.2% of the 1,2 dioxygenase activity from the crude pre-
vensis, and MF521922 and MF521923 for B. subtilis. paration was recovered and yielded ˜ 45.2-fold increase in specific ac-
These identified bacterial strains were previously investigated for tivity (Table 5). One specific band at molecular weight ≃ 70 kDa was
biodegradation of acenaphthene, anthracene, dibenzoanthracene, ben- obtained using SDS-PAGE under reducing conditions (Fig. 4). Hence,
zopyrene, naphthalene, phenanthrene, and pyrene (Lily et al., 2009; the isolated B. subtilis catechol 1,2 dioxygenase is consisting of one
Poornachander et al., 2016 and Eskandari et al., 2017). Nevertheless, subunit. However, Nadaf and Ghosh (2011) have isolated a 1,2

111
H.A.R. Abdelhaleem, et al. Environmental Toxicology and Pharmacology 67 (2019) 108–116

Fig. 1. Growth parameters of the tested Bacillus strains. Different letters denote statistically significant differences between experimental groups (mean ± SE, n = 3,
One-Way ANOVA followed by Duncan's test, p < 0.05).

Table 4 anthracis, B. cereus, and B. mojavensis and B. subtilis were detected based
Production of catechol 1,2 dioxygenases (U/ml medium) by selected strains in on PCR amplification. The presence of catechol dioxygenase (C1, 2O)
MSM supplemented with 100 mg/l of each pollutant after five days incubation genes were confirmed, isolated the full length and the results are shown
at 30 °C with shaking at 150 rpm. in Fig. 6. The sizes of PCR products for C1,2O were approximately 900
Strain Anthracene Catechol Alpha-naphthalene bp. Táncsics et al., 2008 used this gene as a biomarker in the detection
of BTEX-degrading in Rhodococcus species while the used primers were
a a
Control 0.0 ± 0.0 0.0 ± 0.0 0.0 ± 0.0 a able to amplify this gene from several Rhodococcus strains and from
B. anthracis 38.8 ± 8.6 a,b 33.0 ± 2.3 a,b 34.2 ± 3.8 a,b
community DNA as well. In the genome of strain AK38, two different
B. cereus 37.0 ± 8.1 a,b 32.8 ± 3.3 a,b 33.4 ± 3.6 a,b
B. mojavensis 37.7 ± 8.1 a,b 33.3 ± 3.1 a,b 33.4 ± 3.8 a,b catA genes were found, therefore it can be presumed that this Rhodo-
B. subtilis 40.6 ± 9.02 a,b 32.6 ± 3.05 a,b 34.5 ± 4.3 a,b coccus strain possesses two catechol 1,2-dioxygenase isoenzymes. Si-
milar phenomenon was observed earlier in case of Delftia acidovorans
Values (mean ± SE, n = 3). CA28 strain, which possesses two catechol 1,2-dioxygenase isoenzymes
Values marked with the same letters are similar (p > 0.05) whereas, those as well. One was induced after growth in aniline, and showed activity
with different letters aren’t (p < 0.05).
with unsubstituted catechol, while the other was induced by 3-chlor-
oaniline, and showed preference for chlorinated catechol.
dioxygenase from Rhodococcus sp. NCIM 2891 with a molecular weight
of 30 kDa.
3.7. Gene expression analysis

3.5. Determination of Km and Vmax

HPLC analysis showed that B. subtilis exhibited highest degradation
after incubation towards anthracene (Table 6). Hence, we used an-
The best activity of catechol 1,2 dioxygenase is 2.57 U/ml (178U/
thracene to induce the upregulation of C1, 2O. The highest expression
mg) was obtained at substrate concentration 2.70 μM. The measured
of C1,2O was displayed at 72 h of B. subtilis incubation with anthracene
Michaels-Menten constant (Km) was 2.70 (Fig. 5).
(Fig. 7-a). However, at lower pH 5.5 an increment in gene expression (≃
2-fold) was observed (Fig. 7-b). Moreover, we tracked the expression
3.6. Detection and isolation of catabolic genes by PCR level of C1, 20 in the presence of Fe3+ and NH4+ ions in the media. The
expression levels were increased by ≃ 2.5 and 1.5-fold respectively at
The catabolic genes could be used to trace the specific activities of 24 h of incubation for Fe3+ and NH4+, respectively (Fig. 7-c and 7-d).
bacterial strains. We targeted a key enzyme coding gene catechol di- At lower pH values, gene expression was found to increase as a
oxygenases gene (C1,2O) which is responsible for the mineralization of result of increasing cell permeability. A similar response was found by
PAHs compounds. The presence of catechol 1,2 dioxygenase in B. Badejo et al. (2013) who reported a four-fold increase in gene

Fig. 2. Catechol 1,2 dioxygenase activity of the tested Bacillus strains.

112
H.A.R. Abdelhaleem, et al. Environmental Toxicology and Pharmacology 67 (2019) 108–116

Fig. 3. Purification of catechol 1,2 dioxygenase from B. subtilis

with anion exchange/size exclusion chromatography on
Sephadex A-50 column. Proteins obtained with 50–70%
(NH4)2SO4 saturation of crude bacterial culture were applied
to column (80 × 2 cm) equilibrated with 0.05 M phosphate
buffer (pH 7.0). Elution was carried out with a gradient of
0–1 M of the NaCl a flow rate of 1 ml/min.

expression in pyrene and phenanthrene degradation by a myco-

bacterium culture at slightly acidic condition of pH 6.5. To the best of
our knowledge the current study is the first report of the effect of ions
on expression of C1,2O isolated from B. subtilis obtained from a polluted
environment. However, Camargo et al. (2012) study the addition of
different ions Fe3+ and NH4+ cations on enzyme activity his in-
vestigation revealed that the presence of these ions enhances enzyme
activity due to the presence of active-site iron that is essential for en-
zyme activity, at gene expression level the presence of Fe3+ and NH4+
ions in the media increase the gene expression by ≃ 2.5 and 1.5-fold
respectively at 24 h of incubation.

4. Discussion
Fig. 4. The 12% SDS-PAGE electrophoretic profile under denaturating condi-
Bioremediation has been implemented successfully in many recent
tions protein fractions obtained from anion exchange/size-exclusion chroma-
environmental management plans to solve many problems like con- tography of catechol 1,2 dioxygenase from B. subtilis. Each fraction exhibited
tamination of soil and groundwater with organic pollutants (Alegbeleye only a single band with the same molecular weight; indicating that, they are
et al., 2017). The biodegradation of contaminated material use the homogenous fractions. Lane 1, BlueStar prestained protein marker, lanes 2–8
aided-targeting with certain microorganisms to convert many toxic were the tested protein fractions.
macromolecules into simpler eco-friendly components. Various bac-
terial taxa play a feasible pivotal role in such biodegradation-aided The PAHs-degrading bacteria are wide spread in environment.
process in different environments and matrices (Seo et al., 2009; Liu These species use their own catabolic enzymatic activity to utilize or-
et al., 2017). ganic contaminants as sole carbon and energy source (Sukumar and
The PAHs are hazardous pollutants as they can form oxidative ra- Nirmala, 2016). Therefore, bioremediation uses the metabolic ma-
dicals and DNA adducts. They occur as complex mixtures of low and chinery of microorganisms to degrade pollutants to achieve two basic
high molecular weight chemical components. High molecular weight targets; i. transforming organic pollutants into harmless metabolites
PAHs are more resistant to biodegradation as they sorb strongly to se- and ii. mineralizing the pollutants into water and carbon dioxide (Seo
diments and soils. Also, they have high hydrophobicity and low de- et al., 2009). In this study, twenty-four bacterial isolates were obtained
gradability, solubility and volatility than are the low molecular weight by enriched technique. Out of them, four powerful Gram-positive bacilli
PAHs. Hence, they require specific microorganisms to perform their strains were the most efficient ones, based on their utilization of an-
degradation (Hesham et al., 2006; Bisht et al., 2015; Maletić et al., thracene, alpha-Naphthalene and catechol as a sole carbon source and
2019).

Table 5
Purification of dioxygenase from the PAHs-degrading Bacillus subtilis.
Steps Volume(ml) Total protein (mg) Total activity (U) Specific activity (U/mg protein) Yield (%) Purification factor

Crude preparation 50 1,440 850,700 590 100 –

(NH4)2SO4 10 340 486,000 1429 57 2.4
DEAE Sephadex A-50 5 7.6 203,000 26710 41.7 18.6

One unit of catechol 1,2-dioxygenase activity is defined as 1 μmol of substrate oxidized mg of protein−1 min−1.

113
H.A.R. Abdelhaleem, et al. Environmental Toxicology and Pharmacology 67 (2019) 108–116

from B. subtilis. The SDS-PAGE analysis showed that the molecular

weight of the catechol 1,2 dioxygenase from B. subtilis EMCC 4454 is ca.
70 kD. However, it was observed in Ralstonia sp. Ba-0323 as 30 kD
(Wang et al., 2001). The Km of and Vmax values of this enzyme were
determined, and the results show a high affinity for the catechol sub-
strate, in contrast with enzyme isolated from of P. aeruginosa (Chuan
et al., 2006) and R. rhodochrous NCIMB 13259 strains (Strachan et al.,
1998) which degrade anthracene much efficiently.
Feasibility of remedial techniques depend on capability of micro-
organisms to quickly adapt to environmental conditions and efficiently
use pollutants of interest, as substrates or cometabolize them, in a
certain case in a rational time (Ghosal et al., 2016). Thus, under-
standing mechanisms, metabolic pathways and responsible enzymes is
Fig. 5. Determination of Michaelis-Menten constant (Km) of the catechol 1,2 an effective means to define important factors for efficient cleanup of
dioxygenase from B. subtilis. Km was determined by Lineweaver-Burk plot, (S is
pollutants. Environmental factors (e.g. temperature, pH, low molecular
expressed in U/mg), using catechol as a substrate and measured as OD/mg
weight organic acids and humic acids), microbial activity, pollutants
protein/h at 260 nm.
bioavailability can affect the bioremediation of PAHs. Anthracene de-
gradation can occur at various environmental conditions, like different
thermal profiles and pHs. The laboratory-developed conditions were
made to simulate these environmental conditions as much as possible.
Anthracene is feasible to be degraded at different states of pH and ions
concentration (Kleypas and Yates, 2009; Bibi et al., 2018). The slightly
acidic nature may increase the anthracene degrading activity as a result
of increased cell membrane permeability to anthracene substrates (Kim
and Freeman, 2005). The obtained data on anthracene degradation
activity may probably be applicable to soils which undergo different
rates of acidification as a result of PAHs pollution.
As an application in environmental catastrophes, hydrocarbon bio-
degradation is a major path for in situ removal of PAHs contained in oil
spills from contaminated marine environments as aerobic water col-
umns and sediment surficial layers to produce more readily degradable
intermediates (Haritash and Kaushik, 2009; Fulekar, 2017; Xu et al.,
2018). However, microbial PAH degradation rates are limited by PAH
concentrations, pH, temperature and the original microbial commu-
Fig. 6. Agarose gel electrophoresis for catechol 1,2 dioxygenase gene from
nities (Horel et al., 2012; Xu et al., 2018). A good example of appli-
selected isolate.
cation of PAHs-degrading bacteria in nature is the biodegradation of
source zone concentrations of anthracene (1 μM, at initial rates of
Table 6 0.82 μM h−1) in oil spill by the metal-reducing bacteria Shewanella
Biodegradation efficiency of the tested Bacillus strains via HPLC analysis post oneidensis-driven Fenton reaction via the generated high oxidation po-
incubation with each pollutant for five days at 30 °C with shaking at 150 rpm. tential hydroxyl radical (HO•) in the presence of Fe(III) (Sekar and
The injected volume is 2.0 μL. DiChristina, 2017). Moreover, this process alternately produce the
Strain Biodegradation percentage Fenton reagents H2O2 (via microbial O2 respiration) and Fe(II) (via
microbial Fe(III) reduction) in which the latter is primarily required for
Anthracene Catechol Alpha-naphthalene
dioxygenase activity. This microbially-driven degradation system re-
Control 0% 0% 0% quired neither UV-induced Fe(III) reduction to regenerate Fe(II) nor the
B. anthracis 87% 16% 30% continual supply of exogenous H2O2. Such technique provides an ex-
B. cereus 98% 17% 38% cellent model for development of alternative in situ and ex situ oil spill
B. mojavensis 98% 5.5% 30% remediation technologies.
B. subtilis 99% 1% 41%
The qRT-PCR technique is a highly accurate technique for quanti-
The biodegradation efficiency, measured in triplicates, was calculated as the fying gene expression to assess the specificity, sensitivity, and speed for
relative activities expressed in percentage in comparison with the 100% ac- the degradation of anthracene (Bustin et al., 2009). We employed the
tivity. qRT-PCR assay to study the transcript levels of catechol 1,2 dioxygenase
gene activities in the B subtilis EMCC 4454. A significant expression of
for their dioxygenase activities. We identified B. subtilis EMCC 4454 as the tested gene at the various conditions was shown. Tracking of an-
the strain with the highest degradation efficiency in the presence of the thracene degradation with RT-qPCR successfully quantified the dioxy-
mutagenic and carcinogenic PAHs anthracene in the MSM at con- genase gene that maybe differentially expressed at various pH states
centration 100 mg/L. Toxicity of anthracene can be intensely increased resembling these corresponding to acidic soils and PAHs-polluted water
after solar-light exposure (Guiraud et al., 2008). Certain aromatic-de- sources.
grading bacteria like P. aeruginosa, Ralstonia sp., Rhodococcus sp. AN-22, Diverse enzyme systems in aerobic bacteria contribute to catabolism
R. rhodochrous NCIMB 13259 strains are able to produce large con- of PAHs (Mahajan et al., 1994; Seo et al., 2009; Xu et al., 2018). These
centrations of the 1,2 dioxygenase that efficiently degrade different include methyl group oxidation to alcohol, aldehyde, or carboxylic
PAHs (Wang et al., 2001; and Chuan et al., 2006). Wang et al. (2001) acid, decarboxylation, demethylation and deoxygenation. In dioxy-
used Acinetobacter sp. for the first time to eliminate 500 mg/l phenol genases, metal ions interactions play significant catalytic roles. In the
concentration in MSM. To best of our knowledge, this is the first report present study, both NH4+ and Fe3+ ions have induced high levels of
on the purification and characterization of catechol 1,2 dioxygenase gene expression as well as enzyme activity. Both these two ions are
present in the dioxygenases enzymes structure, especially for enzymes

114
H.A.R. Abdelhaleem, et al. Environmental Toxicology and Pharmacology 67 (2019) 108–116

Fig. 7. Time course expression of C1,2O as quantified by qPCR after (A) incubation with anthracene, pH 5.5 (B), in the presence of Fe3+ (C) and NH4+ (D).

with intradiol cleavage, i.e. catechol 1,2 dioxygenase and protocatechol potential tool for cleaning up hydrocarbon pollutants, please see Seo
3,4-dioxygenase (Whiting et al., 1996). Ring-hydroxylating dioxy- et al. (2009).
genases, e.g. 1,2- dioxygenases, play a crucial role in biodegradation of
a range of PAHs, including anthracene. These dioxygenases catalyze the 5. Conclusion
first oxidation step of such compounds, to a dihydrodiol via a multi-
component enzyme system consisting of a ferredoxin, a NADH oxidor- In this study, four promising PAHs-degrading bacterial strains were
eductase and an oxygenase component that contains the active site. isolated from contaminated soil and characterized for their PAHs-de-
Iron is the key cofactor in these dioxygenation reactions (Gibson and grading efficiency as a tool for bioremediation. We have isolated and
Parales, 2000). The oxygenase component is a multimeric protein, with characterized a ring hydroxylating 1,2 dioxygenase with specificity to
either an αnβn (n = 2 or 3) or α3 structure, containing one non-heme catechol substrates, which may provide a good model for subsequent
iron atom per α subunit and one [2Fe-2S] Rieske cluster. Through the studies on this class of enzymes. In combination with studies on en-
reductase, the ferredoxin and the Rieske center, two electrons from the vironmental chemistry, characterizing enzyme systems responsible for
reduced pyridine nucleotide are transferred to the Fe(II) ion at the ac- feasible bioremediation are essential in elucidating mechanisms of
tive site during a catalytic cycle. As a prerequisite to dihydroxylation of biodegradation and biotransformation of environmental organic pol-
the substrate, the activation of molecular oxygen is permissible via lutants, mainly for conditions of multiple chemicals and microbial as-
reducing equivalents. Hydroxylated intermediate(s) may then be pro- sociations.
cessed to a principal intermediate like catechol which is cleaved via the
ortho or meta cleavage type of pathways (Seo et al., 2009). In poly- Transparency document
nuclear aromatic compounds like PAHs, sequential cleavage of the rings
take place via dihydroxylation leading to many intermediates subse- The Transparency document associated with this article can be
quently converted to intermediates of the tricarboxylic acid cycle. Di- found in the online version.
oxygenation catalyze carbon-carbon and carbon-sulfur bond cleavage
and thiol oxidation. Thus, hydrophobic, often toxic, PAHs converted References
into more hydrophilic products, allowing for their subsequent meta-
bolism by other bacterial enzymes (Bohdziewicz, 1998; Santos et al., Alegbeleye, O.O., Opeolu, B.O., Jackson, V.A., 2017. Polycyclic aromatic hydrocarbons: a
2008). For detailed chemical mechanisms on aerobic bacterial catabolic critical review of environmental occurrence and bioremediation. J. Environ. Manag.
60, 758–783.
pathways and how these enzymes catabolize many common PAHs as Badejo, A.C., Badejo, A.O., Shin, K.H., Chai, Y.G., 2013. A Gene expression study of the

115
H.A.R. Abdelhaleem, et al. Environmental Toxicology and Pharmacology 67 (2019) 108–116

activities of aromatic ring-cleavage dioxygenases in Mycobacterium gilvum PYR-GCK Kumar, S., Tamura, K., Nei, M., 2004. MEGA3 Integrated software for molecular evolu-
to changes in salinity and pH during pyrene degradation. PLoS One 8, e58066. tionary genetics analysis and sequence alignment. Brief. Bioinform. 5, 150–163.
Bayoumi, R.A., 2009. Bacterial bioremediation of polycyclic aromatic hydrocarbons in Kweon, O., Kim, S.J., Holland, R.D., Chen, H., Kim, D.W., Gao, Y., Yu, L.R., Baek, S., Baek,
heavy oil contaminated soil. J. Appl. Sci. Res. 5, 197–211. D.H., Ahn, H., 2011. Polycyclic aromatic hydrocarbon metabolic network in
Bibi, N., Hamayun, M., Khan, S.A., Iqbal, A., Islam, B., Shah, F., Khan, M.A., Lee, I.J., Mycobacterium vanbaalenii PYR-1. J. Bacteriol. 193, 4326–4337.
2018. Anthracene biodegradation capacity of newly isolated rhizospheric bacteria Laemmli, U.K., 1970. Cleavage of structural proteins during the assembly of the head of
Bacillus cereus S13. PLoS One 13, e0201620. bacteriophage T4. Nature 227, 680–685.
Bisht, S., Pandey, P., Bhargava, B., Sharma, S., Kumar, V., Sharma, K.D., 2015. Lily, M.K., Bahuguna, A., Dangwal, K., Garg, V., 2009. Degradation of Benzo [a] Pyrene
Bioremediation of polyaromatic hydrocarbons (PAHs) using rhizosphere technology. by a novel strain Bacillus subtilis BMT4i (MTCC 9447). J. Braz. Microbiol. 40,
Braz. J. Microbiol. 46, 7–21. 884–892.
Bohdziewicz, J., 1998. Biodegradation of phenols by enzymes from Pseudomonas sp. Linxiang, C., Cai, Y., Zhou, G., Shi, X., Su, J., Chen, G., Lin, K., 2014. Rapid Sanger
Immobilized onto ultrafilteration membrane. Process Biochem. 33, 811–818. sequencing of the 16S rRNA gene for identification of some common pathogens. PLoS
Bradford, M.M., 1976. A rapid and sensitive methods for the quantitation of microgram One 9, e88886.
quantities of protein utilizing the principle for protein–dye binding. Anal. Biochem. Liu, Q., Tang, J., Gao, K., Gurav, R., Giesy, J.P., 2017. Aerobic degradation of crude oil by
72, 248–254. microorganisms in soils from four geographic regions of China. Sci. Rep. 7, 14856.
Bustin, S.A., Benes, V., Garson, J.A., Hellemans, J., Huggett, J., 2009. Minimum in- Mahajan, M.C., Phale, P.S., Vaidyanathan, C.S., 1994. Evidence for the involvement of
formation for publication of quantitative real-time PCR experiments. Clin. Chem. 55, multiple pathways in the biodegradation of 1- and 2-methylnaphthalene by
611–622. Pseudomonas putida CSV86. Arch. Microbiol. 61, 425–433.
Camargo, A.S., Andreazza, R., Baldoni, R.J.S., Bento, F.M., 2012. Enzymatic activity of Maletić, S.P., Beljin, J.M., Rončević, S.D., Grgić, M.G., Dalmacija, B.D., 2019. State of the
catechol 1,2 dioxygenase and catechol 2,3 dioxygenase produced by Gordonia poly- art and future challenges for polycyclic aromatic hydrocarbons in sediments: sources,
isoprenivorans. Quãmica Nova Na Esc. 35, 1587–1592. fate, bioavailability and remediation techniques. J. Hazard. Mater. 365, 467–482.
Chao, Y., Na, L., Xinmin, G., Chuanling, Q., 2006. Cloning of mpd gene from a 382 Manohar, S., Kim, C.K., Karegoudar, T.B., 1999. Degradation of anthracene by a
chlorpyrifos degrading bacterium and use of this strain in bioremediation of con- Pseudomonas strain, NGK1. J. Microbiol. 37, 73–79.
taminated soil. Med. Microbiol. Lett. 265, 118–125. Moussa, L.A., Abdel Azeiz, A.Z., Hassanien, S.E., 2017. Microbial biodegradation of crude
Chuan, L.W., Su, L.Y., San, L.W., 2006. Purification and characterization of a novel ca- petroleum oils as affected by salinity. J. Biol. Chem. Environ. Sci. 12, 545–558.
techol 1, 2- dioxygenase from Pseudomonas aeruginosa with benzoic acid as a carbon Nadaf, N.H., Ghosh, J.S., 2011. Purification and characterization of catechol 1, 2-dioxy-
source. Process Biochem. 41, 1594–1601. genase from Rhodococcus sp. NCIM 2891. Res. J. Environ. Earth Sci. 3, 608–613.
Eskandari, S., Hoodaji, M., Tahmourespour, A., Abdollahi, A., Baghi, T.M., Eslamian, S., Poornachander, R.M., Yerra, A., Satyaprasad, K., 2016. Abilities of Bacillus cereus CPOU13
Askari, K.O.A., 2017. Bioremediation of polycyclic aromatic hydrocarbons by Bacillus in biodegradation of polycyclic aromatic hydrocarbons (PAHs). J. Pharmac. 4, 54–63.
licheniformis ATHE9 and Bacillus mojavensis ATHE13 as newly strains isolated from Sambrook, J., Russel, D.W., 2001. Molecular Cloning: A Laboratory Manual, 3rd ed. cold
oil-contaminated soil. J. Geogr. Environ. Earth Sci. Int. 11, 1–11. Spring Harbor Laboratory Press, Cold Spring Harbor. NY.
Flesher, J.W., Lehner, A.F., 2016. Structure, function and carcinogenicity of metabolites Santos, E.C., Jacques, R.J.S., Bento, F.M., Peralba, M.C.R., Selbach, P.A., Sá, E.L.S.,
of methylated and non-methylated polycyclic aromatic hydrocarbons: a compre- Camargo, F.A.O., 2008. Anthracene degradation and surfactant activity by an iron-
hensive review. Toxicol. Mech. Methods 26, 151–179. stimulated Pseudomonas sp. Bioresour. Technol. 99, 2644–2649.
Fulekar, M.H., 2017. Microbial degradation of petrochemical waste-polycyclic aromatic Sekar, R., DiChristina, T.J., 2017. Degradation of the recalcitrant oil spill components
hydrocarbons. Bioresour. Bioprocess. 4, 28. anthracene and pyrene by a microbially driven Fenton reaction. FEMS Microbiol.
Gan, S., Lau, E.V., Ng, H.K., 2009. Remediation of soils contaminated with polycyclic Lett. 364 fnx203.
aromatic hydrocarbons (PAHs). J. Hazard. Mater. 172, 532–549. Seo, J.S., Keum, Y.S., Li, Q.X., 2009. Bacterial degradation of aromatic compounds. Int. J.
Ghosal, D., Ghosh, S., Dutta, T.K., Ahn, Y., 2016. Current state of knowledge in microbial Environ. Res. Public Health 6, 278–309.
degradation of polycyclic aromatic hydrocarbons (PAHs): a review. Front. Microbiol. Shi, W., Krella, A., Orth, A., Yu, Y., Fundele, R., 2005. Widespread disruption of genomic
7, 1369. imprinting in adult interspecies mouse (Mus) hybrids. Genesis 43, 100–108.
Gibson, D.T., Parales, R.E., 2000. Aromatic hydrocarbon dioxygenases in environmental Smith, R., 1990. The biodegradation of aromatic hydrocarbons by bacteria. J. Compos.
biotechnology. Curr. Opin. Biotechnol. 11, 236–243. Biodegrad. Polym. 1, 191–206.
Guiraud, P., Bonnet, J.L., Boumendjel, A., Kadri-Dakir, M., Dusser, M., Bohatier, J., Spink, D.C., Wu, S.J., Spink, B.C., Hussain, M.M., Vakharia, D.D., Pentecost, B.T.,
Steiman, R., 2008. Involvement of Tetrahymena pyriformis and selected fungi in the Kaminsky, L.S., 2008. Induction of CYP1A1 and CYP1B1 by benzo(k)fluoranthene
elimination of anthracene, and toxicity assessment of the biotransformation products. and benzo(a)pyrene in T-47D human breast cancer cells: roles of PAH interactions
Ecotoxicol. Environ. Saf. 69, 296–305. and PAH metabolites. Toxicol. Appl. Pharmacol. 226, 213–224.
Guo, C., Dango, Z., Wong, Y., Tam, N., 2010. Biodegradation ability and dioxgenase genes Strachan, P.D., Freer, A.A., Fewson, C.A., 1998. Purification and characterization of ca-
of PAH-degrading Sphingomonas and Mycobacterium strains isolated from mangrove techol 1,2-dioxygenase from Rhodococcus rhodochrous NCIMB 13259 and cloning and
sediments. Int. Biodeterior. Biodegrad. 64, 419–426. sequencing of its catA gene. J. Biochem. 333, 741–747.
Hajisamoh, A., 2013. Pollution levels of 16 priority PAHs in the major rivers of Southern Sukumar, S., Nirmala, P., 2016. Screening of diesel oil degrading bacteria from petroleum
Thailand. J. Chem. 2, 7–11. hydrocarbon contaminated soil. Int. J. Adv. Res. Biol. Sci. 3, 18–22.
Haritash, A.K., Kaushik, C.P., 2009. Biodegradation aspects of polycyclic aromatic hy- Táncsics, A., Szoboszlay, S., Kriszt, B., Kukolya, J., Baka, E., Márialigeti, K., Révész, S.,
drocarbons (PAHs): a review. J. Hazard. Mater. 169, 1–15. 2008. Applicability of the functional gene catechol 1,2-dioxygenase as a biomarker in
Hegeman, G.D., 1966. Synthesis of enzymes of mandelate pathways by Pseudomonas the detection of BTEX-degrading Rhodococcus species. J. Appl. Microbiol. 105,
putida. Synthesis of enzyme by wild type. J. Bacteriol. 91, 1140–1150. 1026–1033.
Hesham, A., Wang, Z., Zhang, Y., Zhang, J., Lv, W., Yang, M., 2006. Isolation and iden- Tarantini, L., Bonzini, M.V., Bollati, V., Marinelli, B., Cantone, L., Rizzo, G., Bertazzi, P.A.,
tification of a yeast strain capable of degrading four and five ring aromatic hydro- Baccarelli, A., 2009. Effects of particulate matter on genomic DNA methylation
carbons. Ann. Microbiol. 56, 109–112. content and iNOS promoter methylation. Environ. Health Perspect. 117, 340–341.
Horel, A., Mortazavi, B., Sobecky, P.A., 2012. Responses of microbial community from Wang, C.L., Takenaka, S., Murakami, S., Aoki, K., 2001. Production of catechol from
northern Gulf of Mexico sandy sediments following exposure to Deepwater Horizon benzoate by the wild strain Ralstonia species Ba-0323 and characterization of its
crude oil. Environ. Toxicol. Chem. 31, 1004–1011. catechol 1,2-dioxygenase. Biosci. Biotechnol. Biochem. 65 1957-1647.
Kim, Y.H., Freeman, J.P., 2005. Effects of pH on the degradation of phenanthrene and Whiting, A.K., Boldt, Y.R., Hendrich, M.P., Wackett, L.P., Que, L., 1996. Metal ions in
pyrene by Mycobacterium vanbaalenii PYR-1. Appl. Microbiol. Biotechnol. 67, biological system. J. Biochem. 35, 160–170.
275–285. Wick, A.F., Haus, N.W., Sukkariyah, Haering, B.F., K.C, Daniels, W.L., 2011. Remediation
Kim, K.H., Jahan, S.A., Kabir, E., Brown, R.J., 2013. A review of airborne polycyclic of PAH-contaminated Soils and Sediments: a Literature Review. CSES Department,
aromatic hydrocarbons (PAHs) and their human health effects. Environ. Int. 60, Internal Research Document, pp. 1–102.
71–80. Xu, X., Liu, W., Tian, S., Wang, W., Qi, Q., Jiang, P., Gao, X., Li, F., Li, H., Yu, H., 2018.
Kleypas, J.A., Yates, K.K., 2009. Coral reefs and ocean acidification. J. Oceanogr. 22, Petroleum hydrocarbon-degrading bacteria for the remediation of oil pollution under
108–117. aerobic conditions: a perspective analysis. Front. Microbiol. 9, 2885.

116