Learning Module: Force, Motion and Energy

2015
LEARNING MODULE
Science G10| Q2
Force, Motion
and Energy
NOTICE TO THE SCHOOLS
This learning module (LM) was developed by the Private Education Assistance
Committee under the GASTPE Program of the Department of Education. The learning
modules were written by the PEAC Junior High School (JHS) Trainers and were used as
exemplars either as a sample for presentation or for workshop purposes in the JHS In-
Service Training (INSET) program for teachers in private schools.
The LM is designed for online learning and can also be used for blended learning and
remote learning modalities. The year indicated on the cover of this LM refers to the year
when the LM was used as an exemplar in the JHS INSET and the year it was written or
revised. For instance, 2017 means the LM was written in SY 2016-2017 and was used in
the 2017 Summer JHS INSET. The quarter indicated on the cover refers to the quarter of
the current curriculum guide at the time the LM was written. The most recently revised
LMs were in 2018 and 2019.
The LM is also designed such that it encourages independent and self-regulated learning
among the students and develops their 21st century skills. It is written in such a way that
the teacher is communicating directly to the learner. Participants in the JHS INSET are
trained how to unpack the standards and competencies from the K-12 curriculum guides
to identify desired results and design standards-based assessment and instruction.
Hence, the teachers are trained how to write their own standards-based learning plan.
The parts or stages of this LM include Explore, Firm Up, Deepen and Transfer. It is
possible that some links or online resources in some parts of this LM may no longer be
available, thus, teachers are urged to provide alternative learning resources or reading
materials they deem fit for their students which are aligned with the standards and
competencies. Teachers are encouraged to write their own standards-based learning
plan or learning module with respect to attainment of their school’s vision and mission.
The learning modules developed by PEAC are aligned with the K to 12 Basic Education
Curriculum of the Department of Education. Public school teachers may also download
and use the learning modules.
Schools, teachers and students may reproduce the LM so long as such reproduction is
limited to (i) non-commercial, non-profit educational purposes; and to (ii) personal use or
a limited audience under the doctrine of fair use (Section 185, IP Code). They may also
share copies of the LM and customize the learning activities as they see fit so long as
these are done for non-commercial, non-profit educational purposes and limited to
personal use or to a limited audience and fall within the limits of fair use. This document
is password-protected to prevent unauthorized processing such as copying and pasting.
SCIENCE 10
Module 1: Living Things And

Their Environment
Lesson 2: Heredity: Inheritance and Variation: The Molecular
Basis of Inheritance and Variation
INTRODUCTION AND FOCUS QUESTION(S):
http://www.bbc.com/news/health-18041884
Nicknamed Photo 51, the image above is the first X-ray diffraction image of the
DNA, deoxyribonucleic acid, which is dubbed as the molecule of life. The
discovery of the DNA structure is one of the most celebrated discoveries of the
20th century, and this photo which provided key information to that discovery has
at least a claim to be the “most important image ever taken.”
In the previous modules, you have explored the concept of inheritance in the
cellular and subcellular level. It is now time for you to look at heredity at the
molecular level, right where it all starts. Among the molecules you will encounter
are DNA and proteins.
What is DNA and why is it so important to heredity? Why are proteins associated
with DNA and traits? How are these proteins synthesized in the cell? How do
Developed by the Private Education Assistance Committee 1

under the GASTPE Program of the Department of Education
these molecules contribute to genetic variation? These are the questions you will
find answers to as you go through this module.
LESSON COVERAGE:
In this lesson, you will examine those questions when you take the following
topics:
Lesson 2.1 – Gene Expression and Protein Synthesis

Lesson 2.2 – Mutation
Lesson 2.3 – Molecular Basis of Genetic Variation
In these topics, you will learn the following:
Lesson  Explain how protein is made using information from DNA.

2.1
Lesson  Explain how mutations may cause changes in the structure
2.2 and function of a protein.
 Discuss how mutations can be heritable.
Lesson  Explain in different ways how genetic variation is achieved at

2.3 the molecular level and discuss its implications to biodiversity
and the species’ adaptability and survivability.
MODULE MAP:
Here is a simple map of the above lessons you will cover:

EXPECTED SKILLS:
To do well in this module, you need to remember and do the following:
1. Read the instructions carefully before starting anything.
2. Complete all the activities and worksheets. Follow instructions on how to
submit them.
3. Look up the meaning of words that you do not know.
4. You will frequently come across process questions as you go through
different lessons. Keep a notebook (or use the Notepad) where you can write
(and revise) your answers to these questions. Use also the notebook to jot
down short notes, draw diagrams, and summarize what you have just read.
5. For worksheets and reports that need to be submitted, use the provided
checklist and rubric to evaluate your work before submission.
6. Allow time for relaxation and recreation when you are mentally tired. Make a
time table to schedule your study and recreation.

PRE-ASSESSMENT:
Let’s find out how much you already know about this module. Click on the letter
that you think best answers the question. Please answer all items. After taking
this short test, you will see your score. Take note of the items that you were not
able to correctly answer and look for the right answer as you go through this
module.
(A) 1. During cell division, each new daughter cell must have the same copy
of genetic information found in the DNA. Which of the following refers to
the process of copying a DNA molecule?
A. Replication
B. Transcription
C. Translation
D. Reverse Transcription
(A) 2. In order to produce a protein, segments of the DNA called genes must
be expressed. During transcription, specific segments of the DNA are
copied in order to produce what molecule?
A. Amino acid
B. cDNA
C. Polypeptide
D. RNA
(A) 3. Which of the following events happen during translation?

A. DNA nucleotide sequences are changed into amino acid
sequence.
B. RNA gets translated into DNA.
C. Sequence of codons in the mRNA directs the sequence of amino
acids.
D. The amino acid sequence forms into a protein and denatures.
(A) 4. If a mutation has occurred in a gene coding for a specific protein, which
of the following is not likely to occur?
A. Protein will not be formed.
B. Protein will be formed but in lower amounts.
C. Protein will have an additional function.
D. Protein will not have any amino acid.
(A) 5. Consider this DNA sequence: AGT CGA. If a substitution happens in

the fourth base such that the new sequence copied during replication is
AGT AGA, what kind of mutation has occurred?
A. Chromosomal aberration
B. Frameshift mutation
C. Point mutation
D. Polyploidy

(A) 6. A mutation always causes a mutant phenotype. What can be said of
this statement?
A. True, mutations are errors in DNA replication and will definitely
affect protein production.
B. True, a change in the DNA structure causes a change in both the
genotype and phenotype.
C. False, some changes in the DNA do not alter the amino acid
sequence.
D. False, mutations are not always harmful, and may sometimes
lead to better phenotypes.
(A) 7. Down syndrome is a chromosomal condition that is associated with

intellectual disability, a characteristic facial appearance, and weak
muscle tone (hypotonia) in infancy. Below is a diagram of the set of
chromosomes found in each cell of an individual with Down syndrome:
Based on the diagram, what type of genetic change causes Down

syndrome?
A. Base substitution
B. Inversion
C. Monosomy
D. Trisomy

(A) 8. Refer to the given genetic code chart to predict the type of mutation and
the protein produced if the mRNA codon GAG is changed to GAA.
A. Missense mutation. Protein is non-functional.

B. Neutral mutation. Protein may still be functional.
C. Nonsense mutation. Protein synthesis stops.
D. Silent mutation. Protein produced is the same.
(M) 9. Why is the DNA considered as the cell’s genetic material?

I. The DNA is variable between species and able to store
information that causes species to vary from one another.
II. The DNA is able to undergo rare changes, called mutations, that
provide genetic variability for evolution.
III. The DNA is constant within a species and able to be replicated
with high fidelity during cell division.
IV. The DNA is a macromolecule, found inside the cell, which contains
sugar, nitrogen, and phosphate groups.
A. I only
B. I and II
C. I, II, and III
D. I, II, III, and IV
(M) 10. A 38-year old male appears slightly overweight for his 6-foot, pear-
shaped stature. He has narrow shoulders, enlarged breasts, and barely
any facial hair. Recently, he got to see a documentary on genetic

conditions; interestingly, one of them seemed to describe his physical
features. He also learned that the Y-chromosome is responsible for
male traits, while the X-chromosome holds genes for female traits. He
started to get concerned and thought of seeing an expert to determine if
he has the said condition. The condition that he suspects that he might
have is Klinefelter’s syndrome; it is a genetic condition in males that is
characterized by having female characteristics. What might be found in
his karyotype?
A. 3 chromosomes in chromosome 21
B. XXY in chromosome 23
C. only the X chromosome in chromosome 23
D. only the Y chromosome in chromosome 21
(M) 11. Refer to the following early genetic experiments:

 Yanofsky showed that the order of observed mutations in the E.
coli tryptophan synthetase gene was the same as the
corresponding amino acid changes in the protein.
 Crick and Brenner demonstrated, from a large series of double
mutants of the bacteriophage T4, that the genetic code is read
in a sequential manner starting from a fixed point in the gene,
the code was most likely a triplet and that all 64 possible
combinations of the 4 nucleotides code for amino acids, i.e. the
code is degenerate since there are only 20 amino acids.
What can be concluded from these experiments?

A. A change in the amino acid sequence will cause a change in the
protein product.
B. Any change in the DNA structure is considered as mutation.
C. Information stored in the DNA is used in the synthesis of protein.
D. There are many possible combinations of the four nucleotides
that make up the DNA.
(M) 12. Below is a diagram comparing a normal red blood cell from a sickled
red blood cell. The latter is found in individuals suffering from sickle-cell
anemia.

Investigation of hemoglobin in the red blood cells of persons with sickle
cell disease showed its structural difference with hemoglobin in normal
individuals. In one location, normal hemoglobin contains the negatively-
charged amino acid glutamate, and in sickle cell hemoglobin, the
glutamate is replaced by the nonpolar amino acid valine.
What is the most likely explanation for this structural difference?
A. During replication, a single base change in the DNA occurred that
led to the synthesis of a faulty protein.
B. During transcription, a copying error occurred in the mRNA
transcript which led to the production of a defective protein.
C. During translation, an incorrect amino acid becomes attached to
the tRNA molecule thereby causing a change in the protein
structure.
D. During protein folding, a lack of enzyme causes incorrect folding
and modification of the protein structure.
(M) 13. Which of the following situations illustrate a mutation that may be
passed on by the parent to its offspring?
A. A man with normal chromosomes had a hip X-ray without a
protective shield. A year later, his wife gives birth to a child with a
chromosomal aberration.
B. An embryo missing one copy of chromosome 3 is miscarried very
early in pregnancy.
C. Exposure to excessive UV radiation causes changes in the DNA
of a skin cell, leading to basal cell carcinoma (skin cancer).
D. In a very early human embryo, a mistake in mitosis causes loss of
a chromosome in one daughter cell. The resulting child is a fertile
male.
(M) 14. In 1996, Susan Rosenberg, then a young professor at the University of
Alberta, undertook a risky and laborious experiment. Her
team painstakingly screened hundreds of thousands of bacterial
colonies grown under different conditions. Rosenberg’s findings
suggested that bacteria were capable of increasing their mutation rates,
which might in turn produce strains capable of surviving new conditions.
This raised questions from the scientific community because it
disagrees with which long accepted idea in Biology?
A. Adaptive mutation occurs when microorganisms are able to
choose which genes to mutate.
B. Mutations are much less random and more purposeful.
C. Mutations occur randomly, creating a mixture of harmful,
harmless or beneficial outcomes, which in turn fueled the process
of natural selection.*
D. Organisms can in some cases control how they mutate, enabling
them to more rapidly evolve to adapt to new environments.

(T) 15. If all members of a species have the same set of genes, how can there
be genetic variation?
Who among the following gave a correct explanation?
A. Francis pointed out that while there may be similar set of genes
for all members of a species, each of these genes give rise to
different phenotypes.
B. Frederick explained that even though there are similar types of
genes for species, each gene comes in different forms called
alleles.
C. James clarified that members of the same species have the same
set of genes, but being exposed to different environment cause
them to have varied genotypes.
D. Rosalind discussed that the same set of genes found among
members of the same species undergo different genetic
processing.
(T) 16. Gene duplication is defined as any duplication of a region of DNA that
contains a gene.
You are one of the biologists who believe in the gene-duplication
hypothesis of evolution. If you are asked to explain how gene
duplication can contribute to evolution, which of the following
statements will you most likely use?
A. Mutation can cause the duplication of a gene that allows one
copy of the gene to mutate and evolve to perform a new function.
B. Mutation can cause the duplication of a gene that doubles the
amount and functionality of the trait-causing protein.
C. Mutation can cause the duplication of a gene that may lead to the
production of a disease-causing protein.
D. Mutation can cause the duplication of the whole genome that give
rise to entirely new species.
(T) 17. One of your projects in the Institute of Molecular Biology and
Biotechnology is the creation and distribution of online educational
materials for use by high school students. If you want to explain how
genetic variation is achieved at the molecular level, which of the
following will you use?
A. Brochure
B. Interactive animation
C. Journal Article
D. Lecture
(T) 18. Cuticular proteins are crucial components of the insect cuticle. Qiao et
al (2014) studied a deletion mutation in a gene coding for a cuticular
protein in silkworm, BmorCPR2. The dysfunctional protein lost chitin-
binding ability, leading to reduced chitin content in larval cuticle and

limitation of cuticle extension. These variations in silkworm caused by
mutation may lead to:
A. better adaptability of the mutant silkworm.
B. increased reproductive capacity of the mutant silkworm.
C. lower mortality rate of the mutant silkworm.
D. serious defects in larval adaptability of the mutant silkworm.
(T) 19. Male house finches (Carpodus mexicanus) vary in the amount of red
pigmentation in their head and throat feathers. Colors range from pale
yellow to bright red. The colors come from carotenoid pigments that are
obtained from the birds’ diet, because no vertebrates are known to
synthesize carotenoid pigments. Thus, it can be said that the brighter
red the male’s feathers are, the more successful he has been at
acquiring the red carotenoid pigment by his food-gathering efforts.
During breeding season, female house finches prefer to mate with

males with the brightest red feathers. Which of the following is the most
favorable condition for male house finches to attract female mate?
A. Alleles that promote more efficient food-gathering skills of males
should increase over the course of generations.
B. Alleles that promote more effective deposition of carotenoid
pigments in the feathers of males should increase over the
course of generations.*
C. Both A and B
D. Neither A nor B
(T) 20. Swine may be infected by a bird flu virus or a human flu virus, or both
viruses in an individual pig at the same time. When both viruses are
present in an individual, it is possible for genes from bird flu virus and
human flu virus to be combined, thereby producing a genetically
distinctive virus, which can then cause widespread disease.
Given this situation, who among the following might be making an

inaccurate conclusion/decision?
A. An infectious disease specialist warned that the occurrence may
lead to an outbreak or epidemic because a new strain of virus
exists.
B. A molecular biologist confirmed that during such occurrence,
viruses undergo genetic mutation, combination, and reassortment
of the genetic material.
C. A population geneticist made a remark that this occurrence
enhances the genetic variability of the human species.
D. A team of health workers reviews the epidemiological situation
regularly and recommends new vaccine strains whenever
necessary.

Variation, in biology, refers to any difference between cells, individual
organisms, or groups of organism. Variation may be shown in physical
appearance, metabolism, fertility, mode of reproduction, behavior, learning and
mental ability, and other obvious or measurable characters.
Molecules, in chemistry, are groups of atoms bonded together representing the

smallest fundamental unit of a chemical compound that can take part in a
chemical reaction.
What role could the tiny molecules possibly play in variation? Your goal in this
section is to start exploring this relationship.
Let’s begin by examining a case of variation in humans.
ACTIVITY NO. 1: CASE ANALYSIS – Human Skin Color Variation
Read the given case carefully:
Modern Human Diversity - Skin Color

http://humanorigins.si.edu/evidence/genetics/skin-color/modern-human-diversity-
skin-color
Why do people from different parts of the world have different colored skin? Why
do people from the tropics generally have darker skin color than those who live in
colder climates? Variations in human skin color are adaptive traits that correlate
closely with geography and the sun’s ultraviolet (UV) radiation.
As early humans moved into hot, open environments in search of food and water,
one big challenge was keeping cool. The adaptation that was favored involved an
increase in the number of sweat glands on the skin while at the same time reducing
the amount of body hair. With less hair, perspiration could evaporate more easily
and cool the body more efficiently. But this less-hairy skin was a problem because
it was exposed to a very strong sun, especially in lands near the equator. Since
strong sun exposure damages the body, the solution was to evolve skin that was
permanently dark so as to protect against the sun’s more damaging rays.
Melanin, the skin's brown pigment, is a natural sunscreen that protects tropical
peoples from the many harmful effects of ultraviolet (UV) rays. UV rays can, for
example, strip away folic acid, a nutrient essential to the development of healthy
fetuses. Yet when a certain amount of UV rays penetrates the skin, it helps the
human body use vitamin D to absorb the calcium necessary for strong bones. This
delicate balancing act explains why the peoples that migrated to colder geographic

zones with less sunlight developed lighter skin color. As people moved to areas
farther from the equator with lower UV levels, natural selection favored lighter skin
which allowed UV rays to penetrate and produce essential vitamin D. The darker
skin of peoples who lived closer to the equator was important in preventing folate
deficiency.
There is also a third factor which affects skin color: coastal peoples who eat diets
rich in seafood enjoy this alternate source of vitamin D. That means that some
Arctic peoples, such as native peoples of Alaska and Canada, can afford to remain
dark-skinned even in low UV areas. In the summer they get high levels of UV rays
reflected from the surface of snow and ice, and their dark skin protects them from
this reflected light.
Process Questions:
1. Describe how skin color differs for the human species.
2. Why do our skin colors vary? Enumerate some of the factors mentioned in the
text.
3. How do you think does variation arise in human skin color? Write your
hypothesis and explain briefly why you came up with such hypothesis.
This is only the first step in your exploration of human skin color variation and the
factors affecting it. You will go back to this case in the succeeding sections of this
module.
ACTIVITY NO. 2: Eliciting Prior Knowledge through K-W-L Chart
In the previous activity, you examined the factors that affect skin color.
Environment plays a big role in the evolution of skin color in humans. A natural
substance, called melanin, gives our skin its color. It also gives color to our hair
and the iris of our eyes.
The traits or characteristics that organisms inherit and possess are provided by
substances found in their bodies. Usually, these trait-giving substances are in
the form of proteins.
Recall what you know about proteins and other biological macromolecules. How
are these proteins synthesized in the cell? Could the differences in the
proteins affect the way organisms grow and develop? To what extent do proteins
influence variety among species? How exactly does variation arise?
Write what you know about these questions in the K column of the K-W-L chart.
Then, write what you want to know about the topic in the W column. Leave the
third column blank.

K-W-L Chart
How are proteins synthesized in the cell?
How does genetic variation arise?
WHAT I KNOW WHAT I WANT TO WHAT I LEARNED

KNOW
Each organism has a set of unique and different traits. Learn in this module how
this variation in traits is achieved. Learn further how this variation of traits affects
an organism’s adaptability and survivability. Your task at the end of this unit
will have you explain in the molecular level how traits develop and how
traits vary from generation to generation.
End of EXPLORE:
You looked at variation, which is a broad concept in biology. You looked at
molecules, substances, and proteins which are small entities that play important
roles in organisms.
The contrast of “big” and “small” may have overwhelmed you. But you need not
worry. This module will take you to a guided, step-by-step journey through the
tiny molecules and their huge impact to variation of species and populations.
Let’s start to find answers by doing the next activity.

Let’s start small. In this section, you will be introduced to the “tiny” molecules
found inside the cell that are the bases of inheritance. You will learn about the
structure of these molecules and the processes they undergo. You will also learn
what kind of action these processes do to our traits.
Do self-monitoring of your progress in the different topics through the checklist

below. The topics that will be covered in this section are indicated in the
checklist.
Is the topic clear to you?

Topics
YES A LITTLE NOT YET
DNA is the genetic material.
DNA makes copies of itself through

Replication.
Information from the DNA is copied

to RNA through Transcription.
Information from DNA (and RNA) is

‘translated’ to protein.
ACTIVITY NO. 3: Uncovering Mendel’s “hereditary factors”

(DNA is the genetic material.)
Gregor Mendel explained in the year 1865 that traits are passed from the parent
to the offspring through “hereditary factors.”
In the early 20th century, scientists establish that Mendel’s “hereditary factors” are
called genes. The gene is the unit of inheritance and different forms of the same
gene are called alleles.
But the individual genes make up a bigger whole. Humans, for instance, have
about 30,000 genes. All these genes are found in a very long genetic material,
the DNA or deoxyribonucleic acid.

Interactive A: DNA Structure
Click on the links below to learn what the DNA is.
http://www.pbs.org/wgbh/nova/genome/dna_flash.html - Journey into DNA
http://learn.genetics.utah.edu/content/molecules/dna/ - What is DNA?
http://www.nature.com/scitable/topicpage/dna-is-a-structure-that-encodes-
biological-6493050 - DNA is a structure that encodes biological information
http://www.johnkyrk.com/DNAanatomy.html - DNA Anatomy
Process Questions:
1. Instructions providing all of the information needed for an organism to grow
and live are found in the DNA. What do these instructions look like? Answer
this question by drawing the detailed structure of DNA in the box provided
below:
2. How can the DNA molecule hold information? Answer this question by
labelling the parts of the DNA structure that enables it to encode a detailed
set of plan for the cells of our body.
3. Why is the DNA considered as the genetic material?
Interactive B: Discovery of the DNA
Click on the link below to go to an interactive timeline about discoveries related to

the DNA.
http://www.learner.org/interactives/dna/history.html - How DNA was discovered
Take note of the important conclusions made by each of the scientists/ group of
scientists who studied DNA. Use the table below to summarize all information:

Scientists Experiment Conclusion
(Remember! Summarize. (Remember! Summarize.
Do not “copy and paste.” Do not “copy and paste.”
Include only the most Include only the most
important ideas. Put important ideas. Put
together the main ideas in together the main ideas in
meaningful sentences.) meaningful sentences.)
Process Questions:
1. What are the important conclusions that led the scientists to decide that the
DNA is the substance/molecule of inheritance? Explain.
2. What parts of the DNA structure enables it to perform its function as the
genetic material?
Before you end this activity, complete the exercise found in the link below:
http://learn.genetics.utah.edu/content/molecules/builddna/ - Build a DNA

molecule
http://www.nobelprize.org/educational/medicine/dna_double_helix/dnahelix.html -
DNA, the Double Helix
Process Questions:
1. What are the components of the DNA molecule?
2. How are these components arranged in order to build a DNA molecule?
3. How is DNA related to proteins? How are proteins synthesized in the cell?
ACTIVITY NO. 4: “Be a Careful Reader”

(DNA makes copies of itself through Replication.)
In the previous activity, you studied the DNA molecule. You have already
understood its double-helical structure. You have also seen how its structure
relates to its function as genetic material. Learn more about how “structure fits

function” for DNA as you study another crucial process that our genetic material
undergoes – its own replication.
Below are several learning materials on DNA replication:

http://science.howstuffworks.com/life/cellular-microscopic/dna3.htm - How DNA
works
https://www.youtube.com/watch?v=27TxKoFU2Nw – DNA replication process
http://www.johnkyrk.com/DNAreplication.html - DNA makes DNA
In this module, you will come across a lot of reading materials, some of which
may be too long and complicated. For you to better understand the content of the
given materials, always follow these four strategies: (taken from
www.interventioncentral.org)
1. Prediction. Before you begin to read, look at the main title, scan the material
to read the major headings, and look at the illustrations. Based on these
clues, try to predict what the material is about. Write your prediction in the
space provided.
2. List Main Ideas. Stop after each paragraph or major section of the learning
material. Construct one or two complete sentences that sum up only the most
important idea(s) that appear in the section. Good summary sentences
include key concepts or events but leave out less important details. Write
these summary (main idea) sentences down and continue reading.
3. Question Generation. Look at the ideas that you have summarized as you
work through the learning material. For each main idea listed, write down at
least one question that the main idea will answer.
4. Clarifying. Sometimes in your reading you will run into words, phrases, or
whole sentences that really don’t make sense. Here are some ways that you
can clarify the meaning of your reading before moving on:
 If you come across a word whose meaning you do not know, read the
sentences before and after it to see if they give you clues. If the word is
still unclear, look it up in a dictionary.
 Reread the phrase or sentence carefully and try to understand it. If it
contains words such as “them”, “it” or “they”, be sure that you know what
nouns to which these words refer.
Ready to summarize information about DNA replication? Complete the given

worksheet:
DNA Replication
Predicting Listing Main Questioning Clarifying
Ideas

I think that the The most For each main These are terms
learning materials important ideas idea, these are /concepts/ ideas
will talk are… the questions that that are not yet
about/show… might be asked… clear to me…
Summarizing:
Here’s a summary of what I learned about DNA Replication:
Process Questions:
1. Why does the DNA molecule need to make identical copies of itself?
2. Why does DNA replication need to be error-free? Why does the DNA need to
be a “careful reader?”
3. What is the importance of DNA replication to DNA’s function of storing genetic
information?
Quick Review:
Click on the letter that corresponds to the best answer:
1. During DNA replication, the parental strand is GAATCT. What will be the
complementary DNA strand?
A. GAATCT
B. CTTAGA
C. TCTAAG
2. After replication, two identical daughter molecules are produced. Each
daughter molecule contains one old strand of DNA. This is because DNA
replication
A. conservative.
B. continuous.
C. semiconservative.
For nos. 3-5, choose from the following enzymes used in replication.
A. DNA helicase
B. DNA ligase
C. DNA polymerase
3. Unwinds and unzips DNA

4. Adds new complementary DNA nucleotides to the daughter strand
5. Seals breaks in the DNA backbone
ACTIVITY NO. 5: “Pass the Message”

(Information from the DNA is copied to RNA through Transcription.)
You’ve seen from the previous activities how DNA is a very important molecule.
So important that every cell in an organism’s body has to have the same DNA;
and that if ever a cell is to divide itself, it has to first make sure it has identical
copies of its DNA. It is important, during replication, to preserve and pass on the
same information found in the DNA.
The DNA is found inside the nucleus; the molecule does not go out of there.
However, the instructions contained in the DNA go beyond the nucleus to reach
other parts of the cell. How is that made possible by the cell? To answer that
question, you have to get to know another molecule: RNA or ribonucleic acid.
Interactive A: What is RNA?
Click on the links below to learn what the RNA is.
http://learn.genetics.utah.edu/content/molecules/rnamolecule/ - RNA, the

Versatile Molecule
http://www.rnasociety.org/about/what-is-rna/ - What is RNA?
http://www.pbs.org/wgbh/nova/labs/video_popup/4/25/ - RNA VirtuaLab (video

intro)
https://www.youtube.com/watch?v=0Elo-zX1k8M – Why RNA is just as cool as

DNA

Process Questions:
1. What important role does RNA play in the expression of information found in
the DNA?
2. Compare and contrast the structure of DNA and RNA through a Venn
diagram.
DNA structure RNA structure

Interactive B: Transcription
How do genes (which are found in the DNA) give rise to actual traits or
characteristics? If I got that part of my mother’s DNA that tell me I should also
have a curly hair, how come I actually get a curly hair? How do our cells
accomplish that gene expression?
You have now come to the first step in gene expression which is transcription.
The RNA molecule takes part in this process.
Click on the links below to learn about transcription:
http://www.dnalc.org/resources/3d/12-transcription-basic.html - Transcription
https://www.youtube.com/watch?v=AGzsgTMgSog – video of transcription
http://www.stolaf.edu/people/giannini/flashanimat/molgenetics/transcription.swf -
transcription animation
Process questions:
1. What is transcription?
2. What molecule is produced after transcription? Why does it need to be
produced?
3. What does transcription have to do with protein synthesis?

Read the following study about “junk” DNA, found in the given link. This will
help you discover important facts and events about transcription.
http://healthland.time.com/2012/09/06/junk-dna-not-so-useless-after-all/ -
Junk DNA – Not So Useless After All
4. What is “junk” DNA?

5. Do you think these portions of the DNA get transcribed? Why or why not?
6. According to studies, why are junk DNA “not so useless after all?”
7. How does “junk” DNA assist the process of transcription?
8. What can you conclude about the process of gene expression in living things?
Quick Review:
Click on the letter that corresponds to the best answer:
1. If the sequence of bases in DNA is GACT, then the sequence of bases in
RNA is:
A. GACT
B. GACU
C. CTGA
D. CUGA
2. The process of transcription produces
A. cDNA
B. mRNA
C. protein
3. Which of the following is not true about transcription?
A. In making RNA, uracil, instead of thymine, pairs with adenine.
B. RNA is made from a DNA template.
C. RNA is produced in the cytoplasm of eukaryotic cells.
D. The enzyme RNA polymerase synthesizes RNA.
ACTIVITY NO. 6: “In English, Please”

(Information from DNA (and RNA) is ‘translated’ to protein.)
The first step in gene expression was covered in the previous activity.
“Instructions” from the DNA is transcribed to RNA. RNA is an intermediate
product that serves as a messenger from the nucleus, where the DNA is, to the
ribosomes where proteins will be synthesized. Once the information from the
DNA has been transcribed and the messenger RNA (mRNA) produced, the
mRNA goes out of the nucleus to bring the information to the ribosomes.

Proteins are important molecules in our cells. They come in the form of enzymes,
some hormones, and structural proteins that together dictate what our traits will
be.
Learn more about proteins and their importance through this animation:
http://learn.genetics.utah.edu/content/molecules/proteins/ - What is a Protein?
Proteins are said to be the building blocks of our body. They constitute about
80% of the dry weight of muscle, 70% of the dry weight of skin and 90% of the
dry weight of blood. Proteins make up your hair, skin, eyes, muscle, and organs.
Collagen, for instance, is the protein found in our bones, tendons, and ligaments,
while keratin is the protein of nails, hair, and feathers.
Proteins are also responsible for almost all biochemical processes that keep you
alive.
Click on this link to learn more:

http://healthyeating.sfgate.com/6-primary-functions-proteins-5372.html - 6
Primary Functions of Proteins
To produce proteins, information from the DNA (brought by the mRNA) is used.
However, DNA and RNA are both made up of nucleotides, while proteins are
made up of amino acids. They don’t “speak” the same “language.” Hence,
another process must happen for genes to be expressed into protein. This
process is referred to as translation.
Before you go through the process of translation, discover first how the cell
“reads” genes. Read the following excerpt:
How do cells read genes?

http://learn.genetics.utah.edu/content/molecules/dnacodes/
Like words in a sentence, the DNA sequence of a gene determines the amino
acid sequence for the protein it encodes. In the protein-coding region of a gene,
the DNA sequence is interpreted in groups of three nucleotide bases, called
codons. Each codon specifies a single amino acid in a protein.
We can think about the protein-coding sequence of a gene as a sentence made

up entirely of 3-letter words. In the sequence, each 3-letter word is a codon,
specifying a single amino acid in a protein. Have a look at this sentence:
Thesunwashotbuttheoldmandidnotgethishat.

If you were to split this sentence into individual 3-letter words, you would
probably read it like this:
The sun was hot but the old man did not get his hat.
This sentence represents a gene. Each letter corresponds to a nucleotide base,

and each word represents a codon.
To know what amino acid is coded by a given codon, a genetic code chart is
used:
Notice that the genetic code is degenerate, this means more than one codon
codes for the same amino acid. The genetic code is unambiguous, each triplet
code has only one meaning. Notice also that the code has start and stop signals.
Click on the links below to learn about the process of translation:
http://www.nobelprize.org/educational/medicine/dna/b/translation/translation.html
- Translation
https://www.youtube.com/watch?v=h5mJbP23Buo – Protein Synthesis and the

Lean, Mean Ribosome Machines

http://highered.mheducation.com/olcweb/cgi/pluginpop.cgi?it=swf::535::535::/site
s/dl/free/0072437316/120077/micro06.swf::Protein+Synthesis – Protein
Synthesis
http://learn.genetics.utah.edu/content/molecules/transcribe/ - Transcribe and

Translate a Gene
Process Questions:
1. What information is “translated” in the process of protein synthesis?
2. How does the cell pick up this information? Discuss all the molecules involved
and the action of these molecules.
3. How are proteins synthesized in the cell? Answer this question through a
graphic organizer:
4. Do all cells of the body produce the same protein? Do all genes get
expressed at the same time? Explain.
5. What would happen if a change/irregularity happens in any of the steps? How
will this change affect the protein?
Quick review:
Determine the amino acid coded by the following mRNA codons:
1. CUU
2. ACA
3. GAC
4. UUU
Determine the amino acid sequence that can be produced from this DNA strand:

TACTGTCAGGAAAAATCTATT
Recall the first activity you did in this module. It was an analysis of the case of
skin color variation in humans. Retrieve the text as well as your initial analysis to
the case.
Now that you have learned a great deal about DNA and protein synthesis, we
can already discuss the case in more detail. Answer the following questions after
reviewing the text Modern Human Diversity – Skin Color.
1. What are the three factors that affect skin color in humans? Write each factor
in the columns of the given table:
Factor 1: Factor 2: Factor 3:

________________ ________________ ________________
2. How does each of these factors determine whether people will develop lighter
or darker skin color?
To answer this, go back to the text and summarize the main points for each
factor. List the most important ideas and write a summary using as many of the
main idea words as possible. Your list and summary should appear in the
appropriate columns of the table:
Factor 1: Factor 2: Factor 3:

________________ ________________ ________________

3. What substance, which was mentioned in the text, gives color to our skin?
How do you think does this substance give color to our skin? Why does it give
a lighter color to one, and a darker color to another? Make a detailed guess
and illustrate that in the box provided below:
EXPLAINING HUMAN SKIN COLOR VARIATION

(CONCRETE)
At present, the genetics of skin color is still largely unclear, even for the biologists
and experts. In the succeeding section, however, we will still look at some
studies that attempt to know and target the actual genes that control human skin
color and how it varies for peoples of different races.
It doesn’t yet fully answer our query about skin color variation. But, studying
those will deepen your understanding of the molecular basis of inheritance and
genetic variation.
Before ending this section, review and look back at how DNA has come to be
called the substance of inheritance, our genetic material. Show, through a cluster
map, the many substances and processes that rely on the DNA. Use
http://www.spicynodes.org/ to construct your map.

End of FIRM UP:
In this section, the discussion was about the DNA and how information from the
DNA is used to synthesize proteins.
How did you do?
Self-Assessment
Skills
YES A LITTLE NOT YET
I can infer, based on its structure,
that the DNA is the genetic material.
I can explain how DNA makes copies

of itself through Replication.
I can differentiate DNA and RNA

structure, as well as their
corresponding functions.
I can describe how information from

the DNA is copied to RNA through
Transcription.
I can interpret nucleotide codes and

their corresponding amino acids

using the genetic code and following
the steps in the process of
Translation.
Go back to the previous section and compare your initial ideas with the
discussion. How much of your initial ideas are found in the discussion? Which
ideas are different and need revision?
Now that you know the important ideas about this topic, let’s go deeper by
moving on to the next section.
In the previous section, you learned about the flow of genetic information from
the DNA to the RNA to proteins. That is the central dogma of molecular
biology.
Your goal in this section is to take a closer look at these processes by studying
actual proteins and their synthesis. You will also learn about the consequences
(or benefits) if an error or change occurred in the processing of DNA. Learn how
such changes may have implications to an organism’s adaptation and survival.
ACTIVITY NO. 8: “Transcribe and Translate”

(Changes in the DNA may affect protein production.)
Have you ever experienced sending a wrong message to somebody? Or you

delivered a message and it was misinterpreted by someone? On some
occasions, this may bring negative consequences. But there could also be some
instances when it could actually lead to something positive and good. Or, it may
not have any effect at all.
The process of replication is not entirely error-free. Changes may happen to the
DNA sequence. Such change is called mutation.
What happens if there is a mutation in the DNA sequence? Click on the link
below to do an activity about mutation. In this virtual lab, you will complete mRNA
and protein sequences based on the given information. Compare the original and
mutated sequences to see the impact of the mutation.
http://www.mhhe.com/biosci/genbio/virtual_labs/BL_26/BL_26.html - Virtual Lab:

DNA and Genes
Process Questions:
1. Describe the differences between the original and mutated sequences.

2. How many amino acids were changed or affected?
3. What do you think will be the impact of this mutation? Why?
4. Does changing the sequence of nucleotides always result in a different amino
acid sequence? Explain.
Learn more about mutation by exploring the learning materials found in the
following links:
http://biology.about.com/od/basicgenetics/ss/gene-mutation.htm - Gene mutation
http://www.uvm.edu/~cgep/Education/Mutations.html - Mutations
http://learn.genetics.utah.edu/content/variation/mutation/ - What is Mutation?
In order for you to get the most out of the materials provided, you will be
introduced to another writing strategy.
Just as the cell transcribes and translates information from the DNA, you will also
try to “transcribe” and “translate” the information given about mutation using the
POW+TREE Strategy.
Pick an idea or opinion.
Organize and generate Topic Sentence

notes and ideas for each
part of the TREE:
Reason
Explanation
Ending
Write and say more.

Process Questions:
1. What are the causes of mutation? Explain each.
2. Differentiate the types of mutation.
3. How can mutation affect protein synthesis in the cell? Discuss
thoroughly.
Many known diseases are caused by mutation. Click on the link below to learn
about some common genetic disorders:
http://www.steadyhealth.com/articles/The_16_Most_Common_Genetic_Diseases
_a1547.html - The 16 Most Common Genetic Diseases
http://www.cdc.gov/ncbddd/birthdefects/DownSyndrome.html - Facts about Down

Syndrome
4. As you have read, these diseases are usually resulting from lack of a
necessary protein or presence of wrong or malfunctioning proteins. How
does mutation contribute to the production of faulty proteins?
Quick Review:
Review the animation and answer the questions that follow to test your
understanding.
http://highered.mheducation.com/sites/0072552980/student_view0/chapter9/ani
mation_quiz_5.html - Addition and Deletion Mutations
ACTIVITY NO. 9: SITUATION ANALYSIS
You have looked at mutation and the effects it may have in protein synthesis.
You have also explored real situations related to the said topic.
This next activity will have you examine more real-life situations that illustrate
protein synthesis.
PROBLEM 1
What makes a firefly glow?

http://learn.genetics.utah.edu/content/molecules/firefly/
Process Questions:
1. Why is it possible for a firefly to produce its own light?
2. How is the protein (luciferase) synthesized in the cell? What results from
this?
3. If the synthesis is altered, what is the possible outcome?
PROBLEM 2
Viruses have no cells. How come they can “live?”
Tinkering with translation: protein synthesis in virus-infected cells

Walsh, Matthews, and Mohr, January 2013
http://www.ncbi.nlm.nih.gov/pubmed/23209131
Viruses are obligate intracellular parasites, and their replication requires host cell
functions. Although the size, composition, complexity, and functions encoded by
their genomes are remarkably diverse, all viruses rely absolutely on the protein
synthesis machinery of their host cells. Lacking their own translational apparatus,
they must recruit cellular ribosomes in order to translate viral mRNAs and produce
the protein products required for their replication. In addition, there are other
constraints on viral protein production. Crucially, host innate defenses and stress
responses capable of inactivating the translation machinery must be effectively
neutralized. Furthermore, the limited coding capacity of the viral genome needs to
be used optimally. These demands have resulted in complex interactions between
virus and host that exploit ostensibly virus-specific mechanisms and, at the same
time, illuminate the functioning of the cellular protein synthesis apparatus.
Process Questions:
1. What determines the size, composition, complexity, and functions of a virus?
2. How are viral proteins synthesized if viruses don’t have cells?
3. What may happen if the viral protein synthesis is altered? Why do many
scientists find ways to alter this process in viruses?
PROBLEM 3
Why are some people born with a disease?
http://www.dnalc.org/resources/3d/17-sickle-cell.html - Disease and Mutation:

Sickle Cell

Process Questions:
1. What happens to the red blood cells of individuals with sickle cell anemia?
Explain why this happens.
2. Why do cells produce abnormal or faulty proteins?
3. How are these proteins synthesized in the cell?
4. Can the production of these proteins be prevented? If yes, how? If no, why
not?
You have looked at different situations related to protein synthesis. Put together
in the table below your answers to the essential question that was asked for each
problem.
PROBLEM 1 PROBLEM 2 PROBLEM 3

ESSENTIAL What makes a Viruses have no Why are some
QUESTION: firefly glow? cells. How come people born with a
they can “live?” disease?
How are Tinkering with
proteins translation: Disease and
synthesized in protein synthesis Mutation: Sickle
the cell? in virus-infected Cell
What happens if cells
the process is
altered? Protein synthesis
Cells in the in viruses… Sickle-cell anemia
firefly’s tail is a disease that
produce… results due to
alteration in the
synthesis of…
Process Questions:
1. Look at your answers to the essential question in the above table. What do all
the answers have in common?
2. Are all the factors the same? How do the answers differ? What are the
different factors that affect protein synthesis in cells?
3. Complete the following statement and support your answer with examples
from the above situations.
The synthesis of proteins…

Supporting reasons and examples:
Be sure that everything is clear to you before you move on to the next activity.
Use the following self-monitoring guide:
RED YELLOW GREEN

Skills I still need More than I understand
more 50% of the all and will be
activities to concepts I able to apply.
understand fully
all the understand.
concepts.
I can describe the relationship
between DNA, RNA, and
proteins.
I can prove, by discussing the
processes and showing
examples, that the DNA holds
the genetic information that are
expressed as traits.
I can investigate the effects of
mutation on protein synthesis,
and the consequent effects to
the organism.
It is now time for you to go back to the case you have been investigating in the
previous sections.
Read the following additional information:

Rees in 2003 made a study entitled Genetics of Hair and Skin Color. According
to the study, “differences in skin and hair color are principally genetically
determined and are due to variation in the amount, type, and packaging of
melanin polymers produced by melanocytes secreted into keratinocytes.”
Let us get to know melanin in more detail then.
Melanin is the substance that gives skin, hair, and eyes their color. Melanin is
also found in the light-sensitive tissue at the back of the eye (the retina), where it
plays a role in normal vision. Melanin is produced in specialized cells called
melanocytes.
Tyrosinase is an enzyme located in melanocytes. This enzyme is responsible for

the first step in melanin production. It converts a protein building block (amino
acid) called tyrosine to another compound called dopaquinone. A series of
additional chemical reactions convert dopaquinone to melanin in the skin, hair
follicles, the colored part of the eye (the iris), and the retina.
The TYR gene provides instructions for making the enzyme tyrosinase.
(Taken from: http://ghr.nlm.nih.gov/gene/TYR)
Process Questions:
1. How is tyrosinase (a protein) synthesized in the cell? Based on what you
know about gene expression and protein synthesis, make a simple model of
the synthesis of tyrosinase from the TYR gene.

SYNTHESIS OF TYROSINASE
A Model
(REPRESENTATIONAL)

2. Do you think melanin and tyrosinase could play a role in human skin color
variation? How may they contribute to variation? Explain.
The next activity will help you analyze this case more deeply. The focus is on
genetic variation.
ACTIVITY NO. 11: VIDEO ANALYSIS

Biodiversity, the variety of life on earth, is crucial to both the abiotic and biotic
components of the ecosystem. One level of biodiversity is genetic diversity. It
refers to the total number of genetic characteristics in species.
Genetic diversity allows populations to adapt to changing environments. With

more variation, there is higher chance that some individuals will possess
variations of genes and alleles that are more suited for the environment. Those
individuals have higher chance of survival and will produce more offspring
bearing that allele. The population will continue to survive through generations
because of the success of these individuals.
To help you understand how genetic variation occurs at the molecular level,
watch carefully the following videos and answer the questions that follow:
VIDEO 1
https://www.youtube.com/watch?v=z9HIYjRRaDE – Where do Genes come

from?
Process Questions:
1. According to the video, what makes it possible for new genes to enter a
population?
2. How does genetic variation arise?
VIDEO 2
https://www.youtube.com/watch?v=xkVv52EyKzc – Are Mutations Heritable?
Process Questions:
1. What are heritable mutations?
2. How can mutations in genes be passed from the parent to offspring?

3. What is/are the possible contribution/s of heritable mutations to genetic
variation?
4. How does genetic variation arise?
Before you leave this topic on heritable mutations, spend some time thinking
about this additional question: Does mutation happen randomly or does it
happen as a response to the environment? Gather pertinent resources and
discuss this controversial issue with your classmates through an online
discussion forum.
VIDEO 3
https://www.youtube.com/watch?v=11iYk0Yrx3g - Genetic Variation, Gene Flow,

and New Species
Process Questions:
1. In terms of genetic variation, why is sexual reproduction more advantageous
than asexual reproduction?
2. How does genetic variation arise from sexual reproduction?
You have looked at three different videos related to genetic variation. Put
together in the table below your answers to the essential question that was asked
for each problem.
VIDEO 1 VIDEO 2 VIDEO 3

ESSENTIAL Where do Genes Are Mutations Genetic Variation,
QUESTION: come from? Heritable? Gene Flow, and
New Species
How does
genetic
variation arise? Genetic variation Genetic variation
may arise from… Genetic variation may arise from…
may arise from…

Process Questions:
1. Look at your answers to the essential question in the above table. What do all
the answers have in common?
2. Are all the factors the same? How do the answers differ? What are the
different ways by which genetic variation can be attained?
3. Complete the following statement:
Genetic variation arises as a result of …
Present your supporting reasons and examples through a funnel graphic

organizer. Modify as you see fit:
Read the article found in the given link:

http://evolution.berkeley.edu/evolibrary/news/120301_chipmunks - Climate
change causes loss of genetic diversity
Process questions:
1. Describe the situation of alpine chipmunks (Tamias alpinus) in the Yosemite
National Park. Why is it now difficult for park visitors to encounter the
chipmunks?
2. Discuss all the factors that led to the supposed loss of genetic variation in
alpine chipmunks.
3. Based on the analysis you’ve done, suggest measures that may be taken in
order to improve genetic variation in alpine chipmunks.

ACTIVITY NO. 12: Summarizing New Knowledge through K-W-L Chart
Recall the two focus questions that you dealt with in the different activities:
 How are proteins synthesized in the cell?
 How does genetic variation arise?
Write your final answers to these questions in the L column of the K-W-L chart.
Compare your new answers with your answers in the previous columns.
K-W-L Chart
How are proteins synthesized in the cell?
WHAT I KNOW WHAT I WANT TO WHAT I LEARNED

KNOW
End of DEEPEN:
In this section, the discussion was about mutation and genetic variation.
What new realizations do you have about the topic? What new connections have
you made for yourself? What helped you make these connections?
Now that you have a deeper understanding of the topic, you are ready to do the
tasks in the next section.

Your goal in this section is apply your learning to real life situations. You will be
given a practical task which will demonstrate your understanding.
ACTIVITY NO.13: CASE ANALYSIS – Human Skin Color Variation
You now reached the concluding part of this case analysis of human skin color
variation. This time, you will write your own analysis of the case based on the
topics you learned about gene expression, mutation, and genetic variation.
Use as references the related activities you accomplished in the previous

sections. Below are additional references as well:
http://www.scientificamerican.com/article/researchers-identify-huma/ -
Researchers Identify Human Skin Color Gene
http://medicalxpress.com/news/2014-01-skin-gene-global-populations-reveal.html
- Studies of a skin color gene across global populations reveal shared origins
genetics - Modern Human Diversity – Genetics
Process Questions:
1. Why is there variation in human skin color?
2. Why is this variation important?
You will communicate the information you gathered and your analysis to your
classmates. Choose the mode which you think will best communicate your
thoughts. Use a project planning map to guide you through this task. See
sample map below.

My Own Analysis
(ABSTRACT)

Before submitting your work, do a self-assessment through this checkbric:
CRITERIA YES NO
I have a clear idea of what the case is about. I
asked questions and defined problems / variables.
I planned the project and carried out some

investigations.
I gathered enough data and information, and

evaluated them so as to include only those that
are accurate and relevant to the purpose of the
task.
I organized my ideas in a manner that is easy to

follow and suited to my purpose.
I cited all references and sources of information.
I communicated my ideas in a manner that is

appropriate to the purpose and audience.
My work is objective and evidence-based, but is

creative and engaging.
ACTIVITY NO.13: TRANSFER TASK
Read carefully your final task for this module:
Environmental change is now occurring on a global scale due to human activities

and many species will have to adapt to this change or experience an ever
increasing chance of extinction.
One of your projects in the Institute of Molecular Biology and Biotechnology is the
creation and distribution of online educational materials (videos, video podcasts,
interactive simulations, etc.) that explain the molecular basis of genetic variation
and species adaptability.
The responsibility of producing the materials is left to the media team composed
of a researcher, a scriptwriter, and an animator.
Materials are intended for students and are therefore expected to be informative,
engaging, and creative.

Rubric:
CRITERIA Exemplary Proficient Developing Beginning

4 3 2 1
Content is Content is Some parts Content is

insightful and relevant to are distracting irrelevant to
CONTENT highly the objectives or the
relevant to of the project. unnecessary objectives;
What is the the objectives All and some information
evidence that of the project, information information is presented is
the student can and wisely presented is inaccurate, very shallow,
obtain and chosen to correct, unclear, and many are
evaluate useful address the accurate, and rambling. false and
information? needs of the useful. confusing.
audience. Some
Advanced All sources of sources of No citations
level of information information were made.
scientific are clearly are not cited.
understandin identified and
g is apparent credited using
in the citations.
information
presented.
Thorough
research was
done and all
sources of
information
are clearly
identified and
credited using
citations.
Information is Information is Information is Information is

communicate communicate communicate communicate
COMMUNICATI d using d using d using d using
ON sophisticated appropriate language and language and
and varied language and style that is at style that is
What is the language that style that is times totally
evidence that is suited to suited to the inappropriate different from
the student can the purpose, purpose, to the the purpose,
communicate audience, and audience, and purpose, audience, and
the information task. task. audience, and task.
in an organized task.

and effective Organization Organization
manner? is appropriate is appropriate Inconsistenci A lack of
to the to the es in organization
purpose and purpose and organization makes it
audience and audience and and limited difficult to
supports with establishes use of follow the
great detail the line of transitions ideas and line
the line of reasoning; sometimes of reasoning.
reasoning; transitions confuse the
effectively guide audience.
hooks and audience
sustains understandin
audience g.
engagement.
The work is The work is The work is The work is

CREATIVITY put together put together put together entirely
by the student by the student by the student copied and
What is the in a novel and in a following shows no
evidence that resourceful resourceful another effort at all to
the student can way. The way. The model or reflect one’s
put together work has work has new work. The own ideas.
resources and insightful and ideas. work has The work
information in a striking ideas. borrowed does not
creative way? Some ideas from acknowledge
experimentati another the original
on is done source. source that it
which gives copied.
the work a
unique and
personal
style.
End of TRANSFER:
In this section, your task was to explain in different ways how genetic variation is
achieved at the molecular level and discuss its implications to biodiversity and
the species’ adaptability and survivability.
How did you find the performance task? How did the task help you see the real
world use of the topic?
You have completed this lesson. Before you go to the next lesson, you have to
answer the following post-assessment.

GLOSSARY OF TERMS USED IN THIS LESSON:
allele Alternative form of a gene
amino acid Organic molecule having an amino group and an acid group, which
covalently bonds to produce peptide molecules.
anticodon Three-base sequence in a transfer RNA that pairs with a

complementary codon in mRNA
bacteriophage Virus that infects bacteria
chromosome Chromatin condensed into a compact structure
DNA (deoxyribonucleic acid) Nucleic acid polymer produced from covalent

bonding of nucleotide monomers that contain the sugar deoxyribose; the
genetic material of nearly all organisms.
DNA replication Synthesis of a new double helix prior to mitosis and meiosis in
eukaryotic cells and during prokaryotic fission in prokaryotic cells
enzyme Organic catalyst, usually a protein, that speeds a reaction in cells due to
its particular shape.
gene Unit of heredity existing as alleles on the chromosomes
genetic code Universal code that specifies protein synthesis in the cells of all
living things. Each codon consists of three letters standing for the DNA
nucleotides that make up one of the 20 amino acids found in proteins.
genetic diversity Variety among members of a population
messenger RNA (mRNA) Type of RNA formed from a DNA template that bears
coded information for the amino acid sequence of a polypeptide.
mutation Alteration in chromosome structure or number and also an alteration in

a gene due to a change in DNA composition.
peptide Two or more amino acids joined together by covalent bonding
protein Molecule consisting of one or more polypeptides
ribosome RNA and protein in two subunits; site of protein synthesis in the
cytoplasm.

RNA (ribonucleic acid) Nucleic acid produced from covalent bonding of
nucleotide monomers that contain the sugar ribose; occurs in three forms:
messenger RNA, ribosomal RNA, and transfer RNA.
transcription Process whereby a DNA strand serves as a template for the

formation of mRNA.
transfer RNA Type of RNA that transfers a particular amino acid to a ribosome
during protein synthesis.
translation Process whereby ribosomes use the sequence of codons in mRNA

to produce a polypeptide with a particular sequence of amino acids.
REFERENCES AND WEBSITE LINKS USED IN THIS LESSON:
Mader, Sylvia S. Concepts of Biology. New York: The McGraw-Hill Companies,

Inc., 2009.
skin-color - Modern Human Diversity – Skin Color
http://www.pbs.org/wgbh/nova/genome/dna_flash.html - Journey into DNA
http://learn.genetics.utah.edu/content/molecules/dna/ - What is DNA?
http://www.nature.com/scitable/topicpage/dna-is-a-structure-that-encodes-
biological-6493050 - DNA is a structure that encodes biological information
http://www.johnkyrk.com/DNAanatomy.html - DNA Anatomy
http://www.learner.org/interactives/dna/history.html - How DNA was discovered
http://learn.genetics.utah.edu/content/molecules/builddna/ - Build a DNA

molecule
http://www.nobelprize.org/educational/medicine/dna_double_helix/dnahelix.html -
DNA, the Double Helix
http://science.howstuffworks.com/life/cellular-microscopic/dna3.htm - How DNA

works
https://www.youtube.com/watch?v=27TxKoFU2Nw – DNA replication process
http://www.johnkyrk.com/DNAreplication.html - DNA makes DNA

http://learn.genetics.utah.edu/content/molecules/rnamolecule/ - RNA, the
Versatile Molecule
http://www.rnasociety.org/about/what-is-rna/ - What is RNA?
http://www.pbs.org/wgbh/nova/labs/video_popup/4/25/ - RNA VirtuaLab (video

intro)
https://www.youtube.com/watch?v=0Elo-zX1k8M – Why RNA is just as cool as

DNA
http://www.dnalc.org/resources/3d/12-transcription-basic.html - Transcription
https://www.youtube.com/watch?v=AGzsgTMgSog – video of transcription
http://www.stolaf.edu/people/giannini/flashanimat/molgenetics/transcription.swf -
transcription animation
http://healthland.time.com/2012/09/06/junk-dna-not-so-useless-after-all/ - Junk
DNA – Not So Useless After All
http://learn.genetics.utah.edu/content/molecules/proteins/ - What is a Protein?
http://healthyeating.sfgate.com/6-primary-functions-proteins-5372.html - 6
Primary Functions of Proteins
http://learn.genetics.utah.edu/content/molecules/dnacodes/ - How do Cells Read

Genes?
http://www.nobelprize.org/educational/medicine/dna/b/translation/translation.html
- Translation
https://www.youtube.com/watch?v=h5mJbP23Buo – Protein Synthesis and the

Lean, Mean Ribosome Machines
http://highered.mheducation.com/olcweb/cgi/pluginpop.cgi?it=swf::535::535::/site
s/dl/free/0072437316/120077/micro06.swf::Protein+Synthesis – Protein
Synthesis
http://learn.genetics.utah.edu/content/molecules/transcribe/ - Transcribe and

Translate a Gene
http://ghr.nlm.nih.gov/gene/TYR - TYR gene

http://www.mhhe.com/biosci/genbio/virtual_labs/BL_26/BL_26.html - Virtual Lab:
DNA and Genes
http://biology.about.com/od/basicgenetics/ss/gene-mutation.htm - Gene mutation
http://www.uvm.edu/~cgep/Education/Mutations.html - Mutations
http://learn.genetics.utah.edu/content/variation/mutation/ - What is Mutation?
http://www.cdc.gov/ncbddd/birthdefects/DownSyndrome.html - Facts about Down

Syndrome
http://www.steadyhealth.com/articles/The_16_Most_Common_Genetic_Diseases
_a1547.html - The 16 Most Common Genetic Diseases
http://highered.mheducation.com/sites/0072552980/student_view0/chapter9/ani
mation_quiz_5.html - Addition and Deletion Mutations
http://learn.genetics.utah.edu/content/molecules/firefly/ - What makes a firefly

glow?
http://www.ncbi.nlm.nih.gov/pubmed/23209131 - Tinkering with translation:

protein synthesis in virus-infected cells
http://www.dnalc.org/resources/3d/17-sickle-cell.html - Disease and Mutation:

Sickle Cell
https://www.youtube.com/watch?v=z9HIYjRRaDE – Where do Genes come

from?
https://www.youtube.com/watch?v=xkVv52EyKzc – Are Mutations Heritable?
https://www.youtube.com/watch?v=11iYk0Yrx3g - Genetic Variation, Gene Flow,

and New Species
http://evolution.berkeley.edu/evolibrary/news/120301_chipmunks - Climate
change causes loss of genetic diversity
http://www.scientificamerican.com/article/researchers-identify-huma/ -
Researchers Identify Human Skin Color Gene
http://medicalxpress.com/news/2014-01-skin-gene-global-populations-reveal.html
- Studies of a skin color gene across global populations reveal shared origins
genetics - Modern Human Diversity – Genetics

Image Credits:
http://www.bbc.com/news/health-18041884 - X-ray diffraction image of the DNA
http://labtestsonline.org/assets/images/article_images/KARO+21.jpg – Down
syndrome karyotype
http://www.vce.bioninja.com.au/_Media/genetic_code_med.jpeg - Genetic code

chart
http://www.nature.com/scitable/content/sickle-shaped-and-normal-red-blood-
cells-21172 - Normal and sickle-shaped red blood cells
http://worms.zoology.wisc.edu/zooweb/Phelps/ZWK99034k.jpeg - Patau
syndrome karyotype
http://healertoday.com/wp-content/uploads/2013/08/ALS-Stephen-Hawking.jpg -
Stephen Hawking

POST-ASSESSMENT:
It’s now time to evaluate your learning. Click on the letter of the answer that you
think best answers the question. Your score will only appear after you answer all
items. If you do well, you may move on to the next module. If your score is not at
the expected level, you have to go back and take the module again.
(A) 1. During transcription, information from specific genes is transferred to

the intermediate molecule, RNA. After DNA has been transcribed into
RNA,
A. mRNA will then leave the nucleus.
B. mRNA will attach to the DNA template.
C. rRNA will begin to make new DNA strands.
D. rRNA will supply the required amino acid from the split DNA.
(A) 2. The sequence found in the mRNA molecule determines the following
except:
A. the protein that will be synthesized.
B. the amino acids to be brought by mRNA.
C. the complementary DNA sequence.
D. the amino acids that will form a protein.
(A) 3. A gene is expressed when its product, a protein, is produced and is

functioning in a cell. What is the scientific term for making a protein
according to the instructions found in the DNA?
A. Replication
B. Transcription
C. Translation
D. Reverse Transcription
(A) 4. A mutation in a DNA segment can possibly lead to the following except
A. change in amino acid sequence.
B. synthesis of a different protein.
C. no change in the protein that will be formed.
D. retention of the original position of the bases in the gene.
(A) 5. Consider this DNA sequence: AGT CGA GGC. If an adenine base (A)
is added to the sequence such that the new sequence copied during
replication is AGT ACG AGG C, what kind of mutation has occurred?
A. Chromosomal aberration
B. Frameshift mutation
C. Point mutation
D. Polyploidy
(A) 6. Does a mutation always give rise to a mutant phenotype?

A. No, because some mutations are harmful, but some are
beneficial.
B. No, some changes in the DNA do not alter the amino acid
sequence.
C. Yes, a change in the DNA structure causes a change in both the
genotype and phenotype.
D. Yes, mutations are errors in DNA replication and will definitely
affect protein synthesis.
(A) 7. Patau syndrome is a genetic disorder associated with severe

intellectual disability and physical abnormalities in many parts of the
body. Due to the presence of several life-threatening medical problems,
many infants with this condition die within their first days or weeks of
life. Below is a karyotype of a female with Patau syndrome:
Based on the diagram, what type of genetic change causes Patau

syndrome?
A. Base substitution
B. Inversion
C. Trisomy
D. Triploidy
(A) 8. Refer to the given genetic code chart to predict which mutation that
changed the mRNA codon would be most likely to affect protein
function.

A. AUU to ACU
B. CAC to CAG
C. GUU to GUC
D. UCC to UCG
(M) 9. In 1952, Hershey and Chase conducted a study to determine which

component, DNA or protein, was responsible for the ability of a
bacteriophage (a virus that infects bacteria) to take over and control the
metabolic activity of the bacteria in order to produce new phages.
Phages have a very simple structure – they are composed of a strand
of DNA surrounded by a protein coat.
In their experiment, they used two radioactive markers to label the

proteins and the DNA of the phages. To the proteins, they used a
radioactive sulfur and to the DNA, radioactive phosphorus.
They allowed the phages to infect the bacteria for a short time. Then,
the bacterial cells were pelleted in a centrifuge. They found that the
radioactive DNA was always found with the bacterial cells while the
radioactive protein was always in the supernatant (outside of the
bacterial cells).
During a phage infection, it was determined that some part of the phage
was injected into the bacterium and it was this injected material that
conveyed the genetic material necessary to produce new phages.
Having said this, which of the following is the conclusion made by
Hershey and Chase about the genetic material of bacteriophages?
A. DNA is the genetic material.

B. Protein is the genetic material.
C. DNA and protein together serve as the genetic material.
D. Bacteriophages do not have a genetic material.
(M) 10. Linda Hunt is an American actress known as one of the lead characters
in the TV series NCIS. She has taken a variety of roles both on TV and
in the movies in her more than 3 decades as an actress. Her efforts
have not gone unnoticed as she has received recognition from
numerous award-giving bodies. Linda has Turner syndrome, a condition
wherein a female would have a single X chromosome instead of the
usual pair. What could be a possible consequence of having just a
single X chromosome?
A. taller than usual because of genes that promote bone
development
B. there could be missing genes that lead to undeveloped
reproductive organs
C. inhibited breast development because of inactivated genes in the
Y chromosome
D. increased muscle mass from genes found in the Y chromosome
(M) 11. George W. Beadle and Edward L. Tatum, in 1941, conducted an

experiment using Neurospora crassa, a bread mold. First, they
irradiated (exposed to radiation) a large number of Neurospora, and
thereby produced some organisms with mutant genes. They then
crossed these potential mutants with non-irradiated Neurospora.
Normal products of this sexual recombination could multiply in a simple
growth medium. However, Beadle and Tatum showed that some of the
mutant spores would not replicate without addition of a specific amino
acid—arginine. They developed four strains of arginine-dependent
Neurospora—each of which, they showed, had lost use of a specific
gene that ordinarily facilitates one particular enzyme necessary to the
production of arginine.
What can be concluded from the experiment?
A. A change in the amino acid sequence will cause a change in the
protein product.
B. A gene specifies the production of an enzyme.
C. Any change in the DNA structure is considered as mutation.
D. Radiation causes mutations in genes.
(M) 12. Amyotrophic lateral sclerosis (ALS), often referred to as “Lou Gehrig’s
Disease,” is a progressive neurodegenerative disease that affects nerve
cells in the brain and the spinal cord. Early symptoms of ALS often
include increasing muscle weakness, especially involving the arms and
legs, speech, swallowing or breathing. When muscles no longer receive
the messages from the motor neurons that they require to function, the
muscles begin to “atrophy” or become smaller.

Stephen Hawking, an English physicist, cosmologist, and author,
suffers from ALS.
Most cases of ALS are sporadic, however some are genetic and are
attributed to a faulty gene. For instance, mutation in superoxide
dismutase 1 (SOD1) gene which affects the SOD1 protein is associated
with ALS symptoms.
What is the most likely explanation for this genetic cause of ALS?
A. During replication, a change in the SOD1 gene occurred that led
to the synthesis of SOD1 protein with a new and toxic function.
B. During transcription, a copying error occurred in the mRNA
transcript of SOD1 gene which led to the production of a defective
SOD1 protein.
C. During translation, an incorrect amino acid becomes attached to
the tRNA molecule thereby causing a change in the SOD1 protein
structure.
D. During protein folding, a lack of enzyme causes incorrect folding
and modification of the SOD1 protein structure.
(M) 13. Which of the following mutations is heritable?

A. A cell in the uterine wall of a human female undergoes a
chromosomal alteration.
B. A primary sex cell in human forms a gamete that contains 24
chromosomes.
C. The DNA of a human lung cell undergoes random breakage.

D. Ultraviolet radiation causes skin cells to undergo uncontrolled
mitotic divisions.
(M) 14. A paper entitled “To Mutate or Not to Mutate” was posted in the Institute
of Science in Society website. A quote from the paper goes:
Contrary to views widely held not so long ago, genes do not as a rule
mutate at random, and cells may choose what, or at least, when to
mutate.
Which of the following is a valid question to the above declaration?

A. Are all organisms capable of mutation?
B. Are mutations harmful or beneficial?
C. Does the cells’ environment play a role in mutation?
D. How can we prevent mutation from happening?
(T) 15. You are one of the invited guests in the annual biologists’ forum. This
year’s topic is “mutation-driven evolution.” You’ve made a number of
studies about the said topic and you’ve decided that your talk will focus
on which of the following?
A. Causes and mechanisms of mutation
B. Darwin’s theory of natural selection
C. Effects of mutation on population
D. Evidences of species’ evolution by mutation
(T) 16. You are a writer for the journal Trends in Evolution. If you are currently
writing an article entitled “Evolution by Gene Duplication,” which of the
following will you not include in your article?
A. In all three domains of life – bacteria, archaebacteria, and
eukaryotes – large proportions of genes were generated by gene
duplication.
B. Many genome sequences are determined and analyzed that
demonstrated the prevalence and importance of gene duplication.
C. Many studies concluded that the origin of a new function appears
to be a very rare fate for a gene that has been duplicated.
D. The doubling of a chromosomal band in a mutant of the fruit fly
Drosophila melanogaster exhibited extreme reduction in eye size.
(T) 17. Without genetic variation, some of the basic mechanisms of

evolutionary change cannot operate. Genetic variation allows new traits
to enter the population. Several students investigated the different
sources of variation and following are their conclusions. Who among
them has an inaccurate conclusion?
A. Al concluded that genetic variation may arise from random
changes that occur in DNA of sex cells.

B. Barbara concluded that genetic variation may arise from genetic
recombination which occurs during meiosis.
C. Martha concluded that genetic variation may arise from errors in
DNA replication that cause a change in the DNA sequence.
D. Oswald concluded that genetic variation may arise from cloning a
gene, a portion of the DNA sequence.
(T) 18. Cystic fibrosis is an autosomal recessive disorder that causes thick,
sticky mucus to build up in the lungs, digestive tract, and other areas of
the body. It is one of the most common chronic lung diseases in
children and young adults.
Mutations in the CFTR gene cause cystic fibrosis. The CFTR gene
encodes an ion transporter protein normally expressed in the
respiratory and digestive tracts. Individuals homozygous for mutated
CFTR gene died at very early ages then due to lack of advanced
medical intervention. Despite this, the mutation persists at relatively
high frequency in populations of European descent. A possible
explanation is that heterozygotes for such mutations are said to gain
immunity to the lethal effects of diseases such as typhoid fever. Which
of the statements below is most accurate?
A. The cystic fibrosis mutation is a beneficial mutation.
B. The cystic fibrosis mutation is a conditional mutation.
C. The cystic fibrosis mutation is a lethal mutation.
D. The cystic fibrosis mutation is a neutral mutation.
(T) 19. Bacteria use restriction enzymes to protect themselves against

successful attack by bacteriophages (viruses that infect bacteria)
because these enzymes can degrade the genome of the phages. The
bacterial genomes are not vulnerable to these restriction enzymes
because some bacterial DNA is methylated.
However there are also some bacteriophages whose genomes are

methylated, and some bacteria whose DNA is non-methylated.
Over the course of time, what should occur in order to maintain genetic
variation?
A. Methylated DNA should become fixed in the genes of all bacterial
species.
B. Non-methylated DNA should become fixed in the genome of all
bacteriophages.
C. Gene for DNA methylation should be eliminated in the
populations over time.
D. Methylated and non-methylated strains should be maintained
among both bacteria and bacteriophages.

(T) 20. Human Immunodeficiency Virus (HIV), the virus that causes Acquired
Immune Deficiency Syndrome (AIDS) reproduces much more rapidly
than most other viruses. It can produce billions of copies of itself each
day. As it makes rapid-fire copies of itself, it commonly makes errors,
which translate into mutations in its genetic code. If the mutations turn
out to be beneficial to the virus’s survival, it is likely that the mutated
virus will reproduce itself more.
Another cause of the variability in HIV is the virus’s ability to recombine

and form new variants within an individual. This happens when a host
cell is infected with two different variations of HIV. Elements of the two
viruses may combine to result in a new virus that is a unique
combination of the two parents.
Which of the following is an important implication of the high variability

in HIV?
A. Anti-HIV drugs can easily target the viruses.
B. Development of a vaccine against HIV is difficult.
C. Humans can quickly develop resistance to HIV.
D. There is a slow rate of HIV evolution.


Learning Module: Force, Motion and Energy

Uploaded by

Copyright:

Available Formats

Learning Module: Force, Motion and Energy

Uploaded by

Document Information

Original Title

Copyright

Available Formats

Share this document

Share or Embed Document

Sharing Options

Did you find this document useful?

Is this content inappropriate?

Copyright:

Available Formats

Learning Module: Force, Motion and Energy

Uploaded by

Copyright:

Available Formats

2015

Module 1: Living Things And

INTRODUCTION AND FOCUS QUESTION(S):

Developed by the Private Education Assistance Committee 1

Lesson 2.1 – Gene Expression and Protein Synthesis

In these topics, you will learn the following:

Lesson  Explain how protein is made using information from DNA.

Lesson  Explain in different ways how genetic variation is achieved at

Developed by the Private Education Assistance Committee 2

Developed by the Private Education Assistance Committee 3

(A) 3. Which of the following events happen during translation?

(A) 5. Consider this DNA sequence: AGT CGA. If a substitution happens in

Developed by the Private Education Assistance Committee 4

(A) 7. Down syndrome is a chromosomal condition that is associated with

Based on the diagram, what type of genetic change causes Down

Developed by the Private Education Assistance Committee 5

A. Missense mutation. Protein is non-functional.

(M) 9. Why is the DNA considered as the cell’s genetic material?

Developed by the Private Education Assistance Committee 6

(M) 11. Refer to the following early genetic experiments:

What can be concluded from these experiments?

Developed by the Private Education Assistance Committee 7

Developed by the Private Education Assistance Committee 8

Developed by the Private Education Assistance Committee 9

During breeding season, female house finches prefer to mate with

Given this situation, who among the following might be making an

Developed by the Private Education Assistance Committee 10

Molecules, in chemistry, are groups of atoms bonded together representing the

Let’s begin by examining a case of variation in humans.

ACTIVITY NO. 1: CASE ANALYSIS – Human Skin Color Variation

Read the given case carefully:

Modern Human Diversity - Skin Color

Developed by the Private Education Assistance Committee 11

ACTIVITY NO. 2: Eliciting Prior Knowledge through K-W-L Chart

Developed by the Private Education Assistance Committee 12

How are proteins synthesized in the cell?

How does genetic variation arise?

WHAT I KNOW WHAT I WANT TO WHAT I LEARNED

Let’s start to find answers by doing the next activity.

Developed by the Private Education Assistance Committee 13

Do self-monitoring of your progress in the different topics through the checklist

Is the topic clear to you?

DNA makes copies of itself through

Information from the DNA is copied

Information from DNA (and RNA) is

ACTIVITY NO. 3: Uncovering Mendel’s “hereditary factors”

Developed by the Private Education Assistance Committee 14

Click on the links below to learn what the DNA is.

http://www.pbs.org/wgbh/nova/genome/dna_flash.html - Journey into DNA

http://learn.genetics.utah.edu/content/molecules/dna/ - What is DNA?

http://www.johnkyrk.com/DNAanatomy.html - DNA Anatomy

Interactive B: Discovery of the DNA

Click on the link below to go to an interactive timeline about discoveries related to

http://www.learner.org/interactives/dna/history.html - How DNA was discovered

Developed by the Private Education Assistance Committee 15

http://learn.genetics.utah.edu/content/molecules/builddna/ - Build a DNA

ACTIVITY NO. 4: “Be a Careful Reader”

Developed by the Private Education Assistance Committee 16

Below are several learning materials on DNA replication: