SAMPLE QUESTION PAPER

CLASS XII
BIOLOGY (044)
TERM II (2021-22)
Max. Marks 35 Time allowed: 2 hours
General Instructions:
i) All questions are compulsory.
ii) The question paper has three sections and 13 questions. All questions are
compulsory.
iii) Section–A has 6 questions of 2 marks each; Section–B has 6 questions of 3 marks
each; and Section–C has a case-based question of 5 marks.
iv) There is no overall choice. However, internal choices have been provided in
some questions. A student has to attempt only one of the alternatives in such
questions.
v) Wherever necessary, neat and properly labeled diagrams should be drawn.

Q. No. Marks

Section A

1 Humans have innate immunity for protection against pathogens that may 2
enter the gut along with food. What are the two barriers that protect the
body from such pathogens?

2 A patient admitted in ICU was diagnosed to have suffered from 2

myocardial infarction. The condition of coronary artery is depicted in the
image below.
Name two bioactive agents and their mode of action that can improve this
condition.

OR
Substantiate by giving two reasons as to why a holistic understanding of
the flora and fauna the cropland is required before introducing an
appropriate biocontrol method.
1
3 Identify the compound chemical structure is shown below. State any three 2
of its physical properties.

4 Water samples were collected at points A, B and C in a segment of a river 2

near a sugar factory and tested for BOD level. The BOD levels of samples
A, B and C were 400 mg/L, 480 mg/L and 8 mg/L respectively.
What is this indicative of? Explain why the BOD level gets reduced
considerably at the collection point C?

5 An ecologist study an area with population A, thriving on unlimited 2

resources and showing exponential growth, introduced population B and
C to the same area.
What will be the effect on the growth pattern of the population A, B and C
when living together in the same habitat?

6 With the decline in the population of fig species it was noticed that the 2
population of wasp species also started to decline. What is the
relationship between the two and what could be the possible reason for
decline of wasps?
OR
With the increase in the global temperature, the inhabitants of Antarctica
are facing fluctuations in the temperature. Out of the regulators and the
conformers, which of the two will have better chances of survival?
Give two adaptations that support them to survive in the ambient
environment? Give one suitable example.

2
 SECTION B

7 How do normal cells get transformed into cancerous neoplastic cells? 3

Elaborate giving three examples of inducing agent.
OR
A person is suffering from a high-grade fever. Which symptoms will help
to identify if he/she is suffering from Typhoid, Pneumonia or Malaria?

8 Recognition of an antigenic protein of a pathogen or exposure to a 3

pathogen occurs during many types of immune responses, including
active immunity and induced active immunity.
Specify the types of responses elicited when human beings get
encountered by a pathogen.

9 In a pathological lab, a series of steps were undertaken for finding the 3

gene of interest. Describe the steps, or make a flow chart showing the
process of amplification of this gene of interest.

10 a. ‘The Evil Quartet’ describes the rates of species extinction due to 3

human activities. Explain how the population of organisms is affected
by fragmentation the habitats.
b. Introduction of alien species has led to environmental damage and
decline of indigenous species. Give any one example of how it has
affected the indigenous species?
c. Could the extinction of Steller’s sea cow and passenger pigeon be
saved by man? Give reasons to support your answer.

11 a. The image shown below is of a sacred grove found in India. Explain 3

how has human involvement helped in the preservation of these
biodiversity rich regions.

b. Value of Z (regression coefficient) is considered for measuring the

species richness of an area. If the value of Z is 0.7 for area A ,and
0.15 for area B, which area has higher species richness and a steeper
slope?

3
12 The image below depicts the result of gel electrophoresis 3

If the ladder represents sequence length upto 3000 base pairs (bp),
a. Which of the bands (I - IV) correspond to 2500 bp and 100 bp
respectively?
b. Explain the basis of this kind of separation and also mention the
significance of this process.

SECTION C

13 Some restriction enzymes break a phosphodiester bond on both the DNA 5

strands, such that only one end of each molecule is cut and these ends
have regions of single stranded DNA. BamH1is one such restriction
enzyme which binds at the recognition sequence, 5’-GGATCC- 3’and
cleaves these sequences just after the 5’- guanine on each strand.
a. What is the objective of this action?
b. Explain how the gene of interest is introduced into a vector.
c. You are given the DNA shown below.
5’ ATTTTGAGGATCCGTAATGTCCT 3’
3’ TAAAACTCCTAGGCATTACAGGA 5’
If this DNA was cut with BamHI, how many DNA fragments would
you expect? Write the sequence of these double-stranded DNA
fragments with their respective polarity.
d. A gene M was introduced into E.coli cloning vector PBR322 at
BamH1 site. What will be its impact on the recombinant plamids?
Give a possible way by which you could differentiate non
recombinant to recombinant plasmids.

4
OR
GM crops especially Bt crops are known to have higher resistance to pest
attacks. To substantiate this an experimental study was conducted in 4
different farmlands growing Bt and non Bt-Cotton crops. The farm lands
had the same dimensions, fertility and were under similar climatic
conditions. The histogram below shows the usage of pesticides on Bt
crops and non-Bt crops in these farm lands.

a. Which of the above 4 farm lands has successfully applied the concepts
of Biotechnology to show better management practices and use of
agrochemicals? If you had to cultivate, which crop would you prefer (Bt
or Non- Bt) and why?
b. Cotton Bollworms were introduced in another experimental study on
the above farm lands wherein no pesticide was used. Explain what
effect would a Bt and Non Bt crop have on the pest.

***

5
 MARKING SCHEME (SQP)
CLASS XII
BIOLOGY (044)
TERM II (2021-22)

Q. Section A Marks
No.

1 Microbial pathogens enter the gut of humans along with food: 2

 Physical barriers: Mucus coating of the epithelium lining the
gastrointestinal tract helps in trapping microbes entering our body.
(1 Mark)
 Physiological barriers: Acid in the stomach, saliva in the mouth
prevent microbial growth. (½+½ Mark)

2 Streptokinase (produced by the bacterium Streptococcus) is used as a 2

‘clot buster’ for removing clots from the blood vessels of patients who
have undergone myocardial infarction. (1 mark)
Statins (produced by the yeast Monascus purpureus) act as blood-
cholesterol lowering agents. (1 mark)
OR
Eradication of pests will disrupt predator-prey relationships, where
beneficial predatory and parasitic insects which depend upon flora and
fauna as food or hosts, may not be able to survive. (1 mark)
Holistic approach ensures that various life forms that inhabit the field,
their life cycles, patterns of feeding and the habitats that they prefer
are extensively studied and considered. (1 mark)

3 It is Morphine. (1/2 mark) 2

Physically it appears as a white, odourless, crystalline compound.
(1½ mark)

4 At collection points A and B, the BOD level is high due to high organic 2
pollution caused by sugar factory and sewage discharge. (1 mark)
At the collection point C, the water was released after secondary
treatment/ biological treatment (where vigorous growth of useful
aerobic microbes into flocs consume the major part of the organic
matter present in the river water or effluent due to sugar factory and
sewage discharge). (1 mark)

1
5 This interaction will lead to competition between the individuals of 2
population A,B and C for resources. Eventually the ‘fittest’ individuals
will survive and reproduce. (1 mark)
The resources for growth will become finite and limiting, and
population growth will become realistic. (1 mark)

6 The relationship between the plant and pollinator is called mutualism. 2

Fig depends on wasp for pollination, and wasp depends on fig for
food and shelter. (1 mark)
With the decline in population of figs, wasp loses its source of food
and shelter. (1 mark)
OR
Regulators;
Thermoregulation, Osmoregulation
Birds/mammals (any one) (½ x 4 Marks)

SECTION B

7 Transformation of normal cells into cancerous neoplastic cells may be 3

induced by following physical, chemical or biological agents causing
DNA damage:
● Ionising radiations like X-rays and gamma rays
● Non-ionizing radiations like UV.
● Chemical carcinogens present in tobacco smoke
● Cellular oncogenes (c-onc) or proto-oncogenes, when
activated under certain conditions cause cancer. Viruses with
oncogenes can transform normal cells to cancerous cells.
(any 3; 1 x 3 marks)
OR
If the person has sustained high fever (39° to 40°C), weakness,
stomach pain, constipation, headache and loss of appetite, it is
Typhoid. (1 mark)
If the person has fever, chills, cough and headache; and the lips and
fingernails turn gray to bluish, it is Pneumonia. (1 mark)
If the person has chills and high fever recurring every three to four
days then, it is Malaria. (1 mark)

8 ● When our body encounters an antigenic protein or a pathogen for 3

the first time it produces a response which is of low intensity and
our body retains memory of the first encounter. (1 mark)
● The subsequent encounter with the same pathogen elicits a
highly intensified response carried out with the help of two
special types of lymphocytes present in our blood, B-

2
 lymphocytes, and T-lymphocytes. (1 mark)
● The B-lymphocytes produce an army of proteins in response to
these pathogens into our blood to fight with them. These proteins
are called antibodies. The T-cells themselves do not secrete
antibodies but help B-cells produce them. (1 mark)

9 The flow chart shows the three steps involved in the process of PCR
showing the following 3
- Denaturation The DNA strands are treated with a temperature of
940C (Heat) and the strands are separated.
- Annealing The primers anneal to the complementary strands
- Extension The DNA polymerase facilitates the extension of the
strands. (1x3=3 marks)
OR

Diagram : Polymerase Chain Reaction

10 a. When a large habitat is broken into small fragments due to various 3

activities, mammals and birds requiring large territories and certain
animals with migratory habitats are badly affected, leading to
population decline. (1 mark)
b.
● Nile perch introduced in Lake Victoria eventually led to the
extinction of an ecologically unique assemblage of more than
200 species of cichild fish.

3
 ● Parthenium/Lantana/water hyacinth caused environmental
damage and threat to our native species
● African catfish-Clarias gariepinus introduced for aquaculture
purposes is posing a threat to the indigenous catfishes in our
rivers. (Any one) (1 mark)
c. Yes; Humans have overexploited natural resources for their ‘greed’
rather than ‘need’ leading to extinction of these animals.
Sustainable harvesting could have prevented extinction of these
species. (1 mark)

11 a. India’s history of religious and cultural traditions emphasized the 3

protection of nature. In many cultures, tracts of forest are set
aside, all the trees and wildlife within are venerated and given total
protection. Sacred groves in many states are the last refuges for a
large number of rare and threatened plants. (2 marks)
b. Area A will have more species richness and a steeper slope.
(1 mark)

12 a. Band III corresponds to 2500 base pairs, and Band IV corresponds 3

to 100bp. (½ + ½ mark)
b. The fragments will resolve according to their size. The shorter
sequence fragments would move farthest from well as seen in
Band IV (100 bp) which is lighter as compared to Band III which is
heavier being 2500 base pairs. (1 mark)
The significance of electrophoresis is to purify the DNA fragments
for use in constructing recombinant DNA by joining them with
cloning vectors. (1 mark)

SECTION C

13 a. The two different DNA molecules will have compatible ends to 5

recombine. (½ mark)
b. Restriction enzyme cuts the DNA of the vector and then ligates the
gene of interest into the DNA of the vector. (1 mark)
c. 2 fragments (½ mark)
5’ ATTTTGAG 3’5’GATCCGTAATGTCCT 3’
3’ TAAAACTCCTAG 5’.3’GCATTACAGGA 5’ (1 mark)
d. BamH1 site will affect tetracycline antibiotic resistance gene,
hence the recombinant plasmids will lose tetracycline resistance
due to inactivation of the resistance gene. (1 mark)
Recombinants can be selected from non recombinants by plating
into a medium containing tetracycline, as the recombinants will not
grow in the medium because the tetracycline resistance gene is
cut. (1 mark)

4
OR
a. Farm Land II. (½ mark)
Bt crop. (½ mark)
Because the use of pesticides is highly reduced for Bt crop
// Decrease of pesticide used is also more significant for
Bt crop. (1 mark)
b. In Bt cotton a cry gene has been introduce from bacterium
Bacillus thuringiensis (Bt) which causes synthesis of a toxic
protein. This protein becomes active in the alkaline gut of
bollworm feeding on cotton, punching holes in the lining
causing death of the insect. (2 marks)
However; a Non Bt crop will have no effect on the cotton
bollworm/ the yield of cotton will decrease / non Bt will
succumb to pest attack. (1 mark)

***