Location via proxy:   [ UP ]  
[Report a bug]   [Manage cookies]                
0% found this document useful (0 votes)
53 views

Topic 2.7 Transcriptin and Translation

The document outlines key concepts related to transcription and translation, including: 1. Transcription is the synthesis of mRNA from DNA templates using RNA polymerase. 2. Translation is the synthesis of polypeptides from mRNA templates on ribosomes using tRNA and the genetic code. 3. The genetic code uses 3-nucleotide codons on mRNA to specify 20 amino acids in polypeptides.

Uploaded by

Sakina İmanova
Copyright
© © All Rights Reserved
Available Formats
Download as DOCX, PDF, TXT or read online on Scribd
0% found this document useful (0 votes)
53 views

Topic 2.7 Transcriptin and Translation

The document outlines key concepts related to transcription and translation, including: 1. Transcription is the synthesis of mRNA from DNA templates using RNA polymerase. 2. Translation is the synthesis of polypeptides from mRNA templates on ribosomes using tRNA and the genetic code. 3. The genetic code uses 3-nucleotide codons on mRNA to specify 20 amino acids in polypeptides.

Uploaded by

Sakina İmanova
Copyright
© © All Rights Reserved
Available Formats
Download as DOCX, PDF, TXT or read online on Scribd
You are on page 1/ 7

Topic 2.

7: Transcription & Translation

2.7.U4 Transcription is the synthesis of mRNA copied from the DNA


base sequences by RNA polymerase.

1. Define transcription.
(Define: Give the precise meaning of a word, phrase, or physical quantity.)

2. Outline the process of transcription, including the role of RNA polymerase


and complementary base pairing.
(Outline: Give a brief account or summary)

3. Identify the sense and antisense strands of DNA given a diagram of


translation.
(Identify: Find an answer from a given number of possibilities)

2.7.U5 Translation is the synthesis of polypeptides on ribosomes.


1. Define translation.
(Define: Give the precise meaning of a word, phrase, or physical quantity.)

2. State the location of translation in the cell.


(State: Give a specific name, value or other brief answer without explanation
or calculation)

2.7.U6 The amino acid sequence of polypeptides is determined by


mRNA according to the genetic code.

1. Outline the role of messenger RNA in translation.


(Outline: Give a brief account or summary)

2.7.U7 Codons of three bases on mRNA correspond to one amino acid


in a polypeptide.

1. Define codon, redundant and degenerate as related to the genetic code.


(Define: Give the precise meaning of a word, phrase, or physical quantity.)

2. Explain how using a 4 letters nucleic acid “language” can code for a
“language” of 20 amino acid letters in proteins.
(Explain: Give a detailed account including reasons or causes)

2.7.U8 Translation depends on complimentary base-pairing between


codons on mRNA and anti codons on tRNA.

1. Outline the role of complementary base pairing between mRNA and tRNA
in translation.
(Outline: Give a brief account or summary)

2.7.A1 Use of Taq DNA polymerase to produce multiple copies of DNA


rapidly by the polymerase chain reaction (PCR).

1. Outline the process of the PCR.


(Outline: Give a brief account or summary)

2. Explain the use of Taq DNA polymerase in the PCR.


(Explain: Give a detailed account including reasons or causes)

2.7.A2 Production of human insulin in bacteria as an example of the


universality of the genetic code allowing gene transfer between species.
1. Outline the source and use of pharmaceutical insulin prior to the use of
gene transfer technology.
(Outline: Give a brief account or summary)

2. Outline the benefits of using gene transfer technology in the production of


pharmaceutical insulin.
(Outline: Give a brief account or summary)

2.7.S1 Use a table of the genetic code to deduce which codons


corresponds to which amino acids.

1. Use a genetic code table to deduce the mRNA codon(s) given the name of
an amino acid.
(Deduce: Reach a conclusion from the information given)

AGGGCTACAATGGCTTTACTTTTAGGCTAATGATAACCATTACCCG

2.7.S2 Analysis of Meselson and Stahl’s results to obtain support for


the theory of semi-conservative replication of DNA.

1. Compare dispersive, conservative and semi-conservative replication.


(Compare: Give an account of similarities and differences between two (or
more) items, referring to both (all) of them throughout.)
2. Predict experimental results in the Meselson and Stahl experiment if DNA
replication was dispersive, conservative or semi-conservative.
(Predict: Give an expected result)

2.7.S3 Use a table of mRNA codons and their corresponding amino


acids to deduce the sequence of amino acids coded by a short mRNA
strand of known base sequence.

1. Use a genetic code table to determine the amino acid sequence coded for
by a given antisense DNA sequence or an mRNA sequence.
(Determine: Find the only possible answer)

AGGGCTACAATGGCTTTACTTTTAGGCTAATGATAACCATTACCCG

2.7.S4 Deducing the DNA base sequence for the mRNA strand.

1. Deduce the antisense DNA base sequence that was transcribed to produce
a given mRNA sequence.
(Deduce: Reach a conclusion from the information given)

GGGCAAUGUUGAUUGCCUCUAGAACGUGUACUAGGGCC

Key Terms
3'

5'

DNA polymerase I

DNA polymerase III

base pair ruling

ribosomes

rRNA

nucleic acid

gene transfer

parent strand

helicase

hydrogen bond

lagging strand

leading strand

transcription

nucleus

tRNA

amino acids

genetic code

anti condons

ligase

nucleotide

triphosphates

semi-conservative

translation
cytoplasm

condon

Taq DNA polymerase

Sense

Okazaki fragment

origin of replication

primase

primer

RNA polymerase

endoplasmic reticulum

redundant

PRC

Meselson and Stahl

replication bubble

replication fork

single stranded

binding proteins

polypeptides

mRNA

degenerate

insulin

antisense

You might also like