bettina drisaldi

Alzheimer's & Dementia: The Journal of the Alzheimer's Association, Volume 2, Issue 3, Pages S559, July 2006, Authors:Joel C. Watts; Bettina Drisaldi; Bob Strome; Jing Yang; Paul E. Fraser; Howard TJ Mount; Gerold Schmitt-Ulms; David Westaway.

Consolidation of long-term memories depends on de novo protein synthesis. Several translational regulators have been identified, and their contribution to the formation of memory has been assessed in the mouse hippocampus. None of them, however, has been implicated in the persistence of memory. Although persistence is a key feature of long-term memory, how this occurs, despite the rapid turnover of its molecular substrates, is poorly understood. Here we find that both memory storage and its underlying synaptic plasticity are mediated by the increase in level and in the aggregation of the prion-like translational regulator CPEB3 (cytoplasmic polyadenylation element-binding protein). Genetic ablation of CPEB3 impairs the maintenance of both hippocampal long-term potentiation and hippocampus-dependent spatial memory. We propose a model whereby persistence of long-term memory results from the assembly of CPEB3 into aggregates. These aggregates serve as functional prions and regulate loc...

Cu ions have been suggested to enhance the assembly and pathogenic potential of the Alzheimer's disease amyloid-β (Aβ) peptide. To explore this relationship in vivo , toxic-milk ( tx J ) mice with a mutant ATPase7b transporter favoring elevated Cu levels were analyzed in combination with the transgenic (Tg) CRND8 amyloid precursor protein mice exhibiting robust Aβ deposition. Unexpectedly, TgCRND8 mice homozygous for the recessive tx J mutation examined at 6 months of age exhibited a reduced number of amyloid plaques and diminished plasma Aβ levels. In addition, homozygosity for tx J increased survival of young TgCRND8 mice and lowered endogenous CNS Aβ at times before detectable increases in Cu in the CNS. These data suggest that the beneficial effect of the tx J mutation on CNS Aβ burden may proceed by a previously undescribed mechanism, likely involving increased clearance of peripheral pools of Aβ peptide.

The dentate gyrus (DG) of the hippocampus is critical for spatial memory and is also thought to be involved in the formation of drug-related associative memory. Here, we attempt to test an aspect of the Gateway Hypothesis, by studying the effect of consecutive exposure to nicotine and cocaine on long-term synaptic potentiation (LTP) in the DG. We find that a single injection of cocaine does not alter LTP. However, pretreatment with nicotine followed by a single injection of cocaine causes a substantial enhancement of LTP. This priming effect of nicotine is unidirectional: There is no enhancement of LTP if cocaine is administrated prior to nicotine. The facilitation induced by nicotine and cocaine can be blocked by oral administration of the dopamine D1/D5 receptor antagonist (SKF 83566) and enhanced by the D1/D5 agonist (SKF 38393). Application of the histone deacetylation inhibitor suberoylanilide hydroxamic acid (SAHA) simulates the priming effect of nicotine on cocaine. By contra...

The heterodimeric HIF (hypoxia-inducible factor)-1 is a transcriptional master regulator of several genes involved in mammalian oxygen homoeostasis. Besides the well described regulation of the HIF-1α subunit via hydroxylation-mediated protein stability in hypoxia, there are several indications of an additional translational control of the HIF-1α mRNA, especially after growth factor stimulation. We identified an interaction of CPEB (cytoplasmic polyadenylation-element-binding protein) 1 and CPEB2 with the 3′-UTR (untranslated region) of HIF-1α mRNA. Overexpression of CPEB1 and CPEB2 affected HIF-1α protein levels mediated by the 3′-UTR of HIF-1α mRNA. Stimulation of neuroblastoma SK-N-MC cells with insulin and thus activation of endogenous CPEBs increased the expression of a luciferase reporter gene fused to the 3′-UTR of HIF-1α as well as endogenous HIF-1α protein levels. This could be abrogated by treating the cells with CPEB1 or CPEB2 siRNAs (short interfering RNAs). Injection of...

Alzheimer's & Dementia: The Journal of the Alzheimer's Association, Volume 2, Issue 3, Pages S559, July 2006, Authors:Joel C. Watts; Bettina Drisaldi; Bob Strome; Jing Yang; Paul E. Fraser; Howard TJ Mount; Gerold Schmitt-Ulms; David Westaway.

Although there is considerable evidence that PrPScis the infectious form of the prion protein, it has recently been proposed that a transmembrane variant calledCtmPrP is the direct cause of prion-associated neurodegeneration. We report here, using a mutant form of PrP that is synthesized exclusively with theCtmPrP topology, thatCtmPrP is retained in the endoplasmic reticulum and is degraded by the proteasome. We also demonstrate thatCtmPrP contains an uncleaved, N-terminal signal peptide as well as a C-terminal glycolipid anchor. These results provide insight into general mechanisms that control the topology of membrane proteins during their synthesis in the endoplasmic reticulum, and they also suggest possible cellular pathways by whichCtmPrP may cause disease.

We have produced a mouse model of a familial prion disorder by introduction of a transgene that encodes the moPrP homolog of a nine-octapeptide insertional mutant associated with an inherited form of CJD in humans. These mice develop progressive neurologic symptoms, display neuropathologic changes, and accumulate a form of mutant PrP in their brains and peripheral tissues that displays some of the biochemical properties of PrPSc. These mice have been extremely valuable for analyzing the cellular and biochemical mechanisms involved in inherited prion disorders and correlating the appearance of the PrPSc-like form with clinical and neuropathologic findings. Because the mutant protein in the mice is highly neurotoxic but appears to lack infectivity, further analysis of its properties promises to shed new light on the molecular distinction between pathogenic and infectious forms of PrP.

We have generated lines of transgenic mice that express a mutant prion protein (PrP) containing 14 octapeptide repeats whose human homologue is associated with an inherited prion dementia. These mice develop a neurological illness with prominent ataxia at 65 or 240 days of age, depending on whether the transgene array is, respectively, homozygous or hemizygous. Starting from birth, mutant PrP is converted into a protease-resistant and detergent-insoluble form that resembles the scrapie isoform of PrP, and this form accumulates dramatically in many brain regions throughout the lifetime of the mice. As PrP accumulates, there is massive apoptosis of granule cells in the cerebellum. Our analysis provides important insights into the molecular pathogenesis of inherited prion disorders in humans.

Exon trapping was employed to identify coding sequences from a collection of 46 bovine cosmids, previously characterized for the presence of microsatellite markers and physically mapped to chromosomes by FISH. The sequence analysis of 104 clones revealed 18 putative exons, 10 of which showed near identity to known sequences. Among these were the human (cytosine-5)-methyltransferase (DNMT), ATP-citrate lyase (ACLY), the mouse Lbcl1 oncogene, the bovine mitochondrial aconitase (ACO2) and beta-arrestin 1 (ARR1). The chromosomal localization of the cloned exons was inferred from the localization of the parent cosmids. DNMT and ACLY were not previously known in cattle, but the physical localization of the cloned bovine exons is in agreement with the published comparative human and bovine maps. The trapping of exons for bovine ACO2 and ARR1 confirms the available mapping information based on synteny and provides a physical assignment for the genes.

Prions are the unconventional causative agent of sub-acute transmissible spongiform encephalopathies in human and various mammals; for example, Scrapie of sheep, Bovine Spongiform Encephalopathy (BSE) of cattle, Cruetzfeldt-Jakob disease (CJD) and Fatal Familial Insomnia (FFI) of human (Prusiner 1994). These diseases are characterized by the accumulation in the brain tissue of a prion protein, PrP Sc that is a partially proteinase-resistant isoform of the cellular protein, PrP . Prions are the product of a single gene that is highly conserved in mammals. Hamster prion gene is composed of two exons; the entire coding region of the gene is contained within the second exon (Goldfarb et al. 1991). On the contrary, the genes of human, cattle, sheep, rat, and mouse have three exons, with the entire protein-coding region contained within exon 3 (Inoue et al. 1997). Cytogenetic analysis of the prion genes has been reported in human, where the gene has been localized on HSA 20p12-pter by a combination of somatic cell and in situ hybridization (Sparkes et al. 1986). In cattle, the gene has been mapped to syntenic group U11 (BTA 13) with a panel of bovine–rodent hybrid somatic cells (Ryan and Womack 1993; Hawkins et al. 1995) and has been recently incorporated into a radiation hybrid framework map of BTA 13 (Shla ̈pfer et al. 1997). Here we report the direct localization of the PrP gene in cattle, sheep, and human by means of fluorescence in situ hybridization (FISH) with PCR-generated probes. Three pairs of oligonucleotides were designed, spanning the protein coding region to the 3 8 UTR region, on the basis of available sequences in cattle, sheep, and human (Yoshimoto et al. 1992, GenBank accession number D10612, nucleotides 153–1723; Goldmann et al. 1990, accession number M31313, nucleotides 61–1651; Puckett et al. 1991, accession number X83416, nucleotides 1–2131). The primer sequences were 5 8 GAAGTCATCATGGTGAAAAGC 38/58 TCACATCTCTAAACAATGTCAAA 3 8 (cattle), 58 GAAGTCATCATGGTGAAAAGC 38/58 AAGCATGAACTCTTCAGCACT 38 (sheep), 58 TTTTGCAGAGCAGTCATTAT 38/58 AATTTCAGTCAGATATTAAACATT 3 8 (human), and produced PCR products of 1570, 1590, and 2130 bp, respectively. Amplifications were done on 50 ng of genomic DNA, in the presence of 10 pmoles of each primer, 0.2 m M dNTPs, 1.5 mM of MgCl2. Thermal profiles were: 94° C × 5 min, 35cycles of 94°C × 30 s, 54°C × 60 s, 72°C × 90 s, and 72°C × 10 min. The amplified fragments were run on agarose gels, purified, and sequenced to confirm their identity. In addition, oligonucleotide primers were synthesized that amplify a 738-bp product corresponding to the ORF region of the human PrP gene (X83416, nucleotides 1–738), which was used in the comparative FISH mapping. The primer sequences were 5 8 TTTTGCAGAGCAGTCATTAT 38 and 58 TCATCCCACTATCAGGAAGA 38. PCR conditions were as above except for the thermal profile: 94° C × 2 min, 35cycles of 94°C × 30 s, 59°C × 45 s, 72°C × 1 min, and72°C × 10 min. All the probes were either nick-translated or directly labeled by PCR in the presence of biotin 16-dUTP and digoxigenin 11-dUTP (Boehringer; Richard et al. 1994) with the above described primers. Chromosome preparations were arranged from fibroblast cultures by standard procedures, except for the hypotonic treatment, 0.02M KCl, 37°C, 13 min (bovine and ovine). After a few days at −20°C, the slides were stained with 0.005% Quinacrine Mustard for 10 s (QFQ-banding), and well-spread metaphases, with distinctive banding, were imaged on a Leitz Aristoplan microscope connected to a CCD-camera (Photometrics) controlled by a Macintosh Quadra 950 computer. The probes generated by PCR were hybridized in situ to metaphase chromosomes at a final concentration of 0.5 ng/ ml (5 ng/slide) in the presence of 3 mg of Cot-1 DNA, whereas nick-translated probes were used as described in Mezzelani and coworkers (1995). For two-color FISH, the probes were detected via avidin-conjugated FITC (Vector) and antidigoxigenin-rhodamine (Boehringer). DAPI was used to counterstain the chromosomes. Digitized images were taken separately for each fluorochrome and merged with the software IPIab Spectrum MultiProbe (Signal Analytics) and Gene Join (Office of Cooperative Research, Yale University). The results of the hybridization of the PrP genes on bovine, ovine, and human chromosomes are shown in Fig. 1. The bovine and ovine PrP genes were mapped on the chromosomes of the two species either as single probes (Fig. 1a–d) or cohybridized in a dual-color FISH experiment (Fig. 1g–j). Fifty metaphase spreads were examined in both cases, with 70% showing a specific signal on at least one of the homologous chromosomes. The intensity of the hybridization signal was weak in the case of nick-translated probes; a much stronger signal was obtained when the same probes were directly labeled by PCR (Richard et al. 1994). The chromosomal assignment for the PrP gene was 13q17 in cattle and 13q17/ q18 in sheep (Fig. 1a–d). The ovine and bovine…

Tg(PG14) mice express a prion protein (PrP) with a nine-octapeptide insertion associated with a human familial prion disease. These animals spontaneously develop a fatal neurodegenerative disorder characterized by ataxia, neuronal apoptosis, and accumulation in the brain of an aggregated and weakly protease-resistant form of mutant PrP (designated PG14 spon ). Brain homogenates from Tg(PG14) mice fail to transmit disease after intracerebral inoculation into recipient mice, indicating that PG14 spon , although pathogenic, is distinct from PrP Sc , the infectious form of PrP. In contrast, inoculation of Tg(PG14) mice with exogenous prions of the RML strain induces accumulation of PG14 RML , a PrP Sc form of the mutant protein that is infectious and highly protease resistant. Like PrP Sc , both PG14 spon and PG14 RML display conformationally masked epitopes in the central and octapeptide repeat regions. However, these two forms differ profoundly in their oligomeric states, with PG14 RM...