DOI: https://doi.org/10.59983/s2023010308 AgroEnvironmental Sustainability, 2023, 1(3), 265-273 REVIEW Understanding the Transcription Factor Mediated Regulatory Mechanism Towards Abiotic Stress Response in Cereal Crops Tuward J. Dweh 1, Salma Kayastha 1 Jyoti Prakash Sahoo 1, * 1  , Manaswini Mahapatra 1 and Faculty of Agriculture and Allied Sciences, C. V. Raman Global University, Bhubaneswar 752054, India Author responsible for correspondence; Email(s): jyotiprakashsahoo2010@gmail.com or jyotiprakash.sahoo@cgu-odisha.ac.in. ARTICLE HISTORY Received: 23 September 2023 Revised: 23 October 2023 Accepted: 24 October 2023 Published: 24 October 2023 KEYWORDS abiotic stress tolerance cereal crops gene regulation transcription factors Abstract Cereal crops are critical to global food security and are valued for their adaptability and nutritional value. However, they are increasingly threatened by abiotic stresses such as water scarcity, high soil salinity, severe climatic conditions, and nutrient deficiencies. This review focuses on the central role of transcription factors (TFs) in the response of cereal crops to these environmental challenges. TFs, such as the DREB family, the bZIP family, and the WRKY family, emerge as central players in this intricate regulatory network. They initiate or inhibit the activation of stress-responsive genes by binding to specific cis-regulatory elements located in gene promoters and enhance the resilience of cereal crops to various abiotic stresses. For example, DREB1/CBF TFs alleviate cold stress, NAM, ATAF1/2, and CUC2 (NAC) factors combat salinity stress, and WRKY TFs modulate responses to drought, salinity, and cold stress by initiating vital physiological processes, including osmotic regulation, antioxidant defense, and ion homeostasis, ultimately promoting stress tolerance. Genetic engineering strategies that overexpress these stress-responsive genes and TFs hold great promise for enhancing crop resilience and productivity in the face of climate change. In addition, this review also emphasizes the potential of epigenetic modifications, such as DNA methylation and histone modifications, to fine-tune the control of genes that respond to abiotic stresses. These findings benefit agriculture by addressing global food security challenges. EDITOR Pankaj Kumar COPYRIGHT © 2023 Author(s) eISSN 2583-942X LICENCE This is an Open Access Article published under a Creative Commons Attribution-NonCommercial 4.0 International License Citation: Dweh, T. J., Kayastha, S., Mahapatra, M., & Sahoo, J. P. (2023). Understanding the Transcription Factor Mediated Regulatory Mechanism Towards Abiotic Stress Response in Cereal Crops. AgroEnvironmental Sustainability, 1(3), 265-273. https://doi.org/10.59983/s2023010308 Statement of Sustainability: The manuscript emphasizes the importance of transcription factors (TFs) in orchestrating the responses of cereal crops to environmental challenges and reviews the specific functions of different TF families in combating various abiotic stresses. The manuscript highlights the physiological processes regulated by TFs, including osmotic regulation, antioxidant defense, and ion homeostasis, and suggests the potential of genetic engineering strategies to overexpress stressresponsive genes and TFs, which contributes to several SDGs, such as Zero Hunger (SDG 2), in the face of frequent environmental changes that aim to end hunger, achieve food security, and promote sustainable agriculture. By increasing the resilience and productivity of cereal crops, this review can help ensure an adequate and stable food supply. 1. Introduction Cereal crops are a group of grasses grown for their edible grains or seeds. Some common examples of these types of crops are Oryza sativa (rice), Zea mays (corn), Triticum aestivum L. (wheat), Hordeum vulgare (barley), etc. (Sahoo et al., 2019). Cereals are the most widely cultivated crops in the world, and this is because they possess several important characteristics. These include multiple nutritional values, essential components of animal feed, boosting the economies of many nations through agricultural production, trade, and industrial applications, etc. (Sahoo et al., 2020). In the case of nutritional and caloric values, grains are cultivated worldwide because they serve as a staple food for many people around the world. They can survive in high, low, and moderate temperature areas and are therefore abundant in almost every region of the world. This level of diversity is due to several cellular pathways and genes that control their Society for AgroEnvironmental Sustainability, Dehradun, India [265] AgroEnvironmental Sustainability Dweh et al. metabolism (Samal et al., 2021). During climate change, abiotic factors induce stress in these crops, which tend to hinder their activities. During this phenomenon, crops undergo genetic changes that result in morphological differences and poor performance, making abiotic stress a major issue for cereal crops (Bodinga et al., 2023). Abiotic variables that can adversely affect plant growth, production, and yield include a variety of stresses and abiotic components such as temperature extremes, drought, salinity, and flooding, and cereal crops are susceptible to these phenomena (Radha et al., 2023). Drought stress, caused by inadequate water availability, can result in stunted growth, reduced grain filling, and even crop failure. Salinity stress, caused by high soil salinity, can impair water uptake and nutrient absorption, leading to reduced crop productivity (Hu and Xiong et al., 2014). Flooding can lead to oxygen deprivation in the root zone, resulting in root damage and reduced nutrient uptake. Nutrients such as potassium (K), phosphorus (P), and nitrogen (N) are key factors in plant growth, and a deficiency of these nutrients can inhibit their rate of growth and development. Periods of extreme heat, prolonged drought, heavy rainfall, and severe weather events have increased in frequency and severity and pose significant challenges. For example, heat stress during flowering can lead to reduced pollen viability and poor grain set, resulting in yield loss. Lack of water during the reproductive period of the plant can lead to wilting, reduced grain filling, and smaller grain size. At the zenith of abiotic stress effects, cereal crop production begins to decline, affecting global food security (Akhtar et al., 2012). Some recent findings on the effect of abiotic stress on cereal crop yield are indexed in Table 1. During stress, cereal crops use multiple signaling pathways to inhibit the induced stress. The way they do this is through specialized transcription factors (TFs). TFs are specialized proteins that interact with precise DNA sequences within promoter regions to control gene expression, in this case, to inhibit abiotic stress (Zhang et al., 2019). The mechanisms of these transcription factors vary from one cereal crop to another, depending on the genes and conditions involved. TFs are often considered as molecular switches (Solis et al., 2022). This review aims to explain in detail the mechanisms of how transcription factors control genes in cereal crops to inhibit abiotic stress. Table 1. Some recent findings on the effect of abiotic stress on the yield of cereal crops. Abiotic Stress(s) Cereal Crop Salinity Rice Year of Study 2021 Effects on Yield Region Reference - Solis et al. (2022) South and Southeast Asia, Latin America - Radha et al. (2023) - Soni et al. (2021) Ali et al. (2022) 2022 2021 Growth retardation and less germination Reduced pollen fertility and biomass production Reduce grain size and weight 6% yield loss Affect the physiological process Decrease in pollination and grain set Premature leaf senescence 25-30% yield loss Drought Rice 2023 Heat and osmotic stress Salinity Drought Wheat 2022 Wheat Maize 2021 2022 Chilling injury Drought and waterlogging Drought Maize Maize - Ali et al. (2022) Salika and Riffat (2021) Barley 2023 Less grain filling - Short-term heat stress Drought Barley Sorghum 2021 2022 Pollen abortion Seed setting and grain filling India Drought and heat stress combined Drought Dryland salinity Sorghum 2021 Sub Saharan Africa Pearl millet Pearl millet 2021 2023 Sub-Saharan, Africa Parts of Africa and Asia Drought Oats 2022 Reduced seed set and pollen viability 60-40% yield loss 30% reduction in ground plant biomass Shrinkage of grain and loss in yield Alamholo and Tarinejad (2023) Schindfessel et al. (2021) Banerjee and Roychoudhury (2022) Ndlovu and Maphosa (2021) Numan et al. (2021) Gunguniya et al. (2023) China Zhang et al. (2022) Annum et al. (2022) 2. Structure of Transcription Factor (TF) TFs consist of three main domains: DNA binding domain, activation domain, and protein interaction domain (Figure 1). DNA binding domain has two main parts and is composed of Helix-turn-helix (HTH): which is composed of alpha and beta helices that are connected by turn, Basic Leucine Zipper (bZIP): this sub-domain facilitates the binding of sagens.org/journal/agens [266] AgroEnvironmental Sustainability Dweh et al. leucine zipper and other sub-domains (Solis et al., 2022). The activation domain consists of the acidic domain (acidic zone and machinery of the transcription factor), the proline-rich active domain (proteins and coactivators), and the serine-threonine-rich activation (serine and threonine). Protein-protein interaction consists of the coiled-coil domain (alphas helices zone), tetratricopeptide repeat (TPR) (repeats of a 34-amino acid motif) that act as a scaffold for the assembly of protein complexes, and WD40 repeat domain is composed of many repeats of a 40-amino acid motif (Alamholo and Tarinejad, 2023). Figure 1. Structure and composition of a transcription factor. 3. Abiotic Stress in Cereal Crops Common stresses include drought, temperature extremes, salinity, flooding, and limited or absent nutrients (Figure 2). Drought causes water deficiency in the soil and plant tissues, resulting in low root water uptake, reduced transpiration rates, and disrupted photosynthesis (Alamholo and Tarinejad, 2023). Drought stress affects cereal crops by reducing cell expansion, leaf area, and biomass accumulation, resulting in stunted growth and reduced yield. Physiologically, drought stress triggers various responses in plants, including stomatal closure to avoid leaf dehydration, accumulation of osmoprotectants to maintain cell hydration, and activation of antioxidants to remove free radicals to avoid cell damage (Solis et al., 2022). Figure 2. An illustration of how stress is induced in cereal crops. sagens.org/journal/agens [267] Dweh et al. AgroEnvironmental Sustainability Salinity can lead to reduced water uptake, ion toxicity, and osmotic stress. This affects cereal crops by inhibiting seed germination, reducing root growth, and impairing nutrient uptake. In response, plants accumulate compatible solutes, such as proline and glycine betaine, to maintain their osmotic balance and activate ion transporters to regulate ion concentrations in various plant tissues (Hu and Xiong, 2014). Cold and high temperatures can cause cell damage, low photosynthetic activities, and decreased nutrient uptake. protein hydrolysis, membrane damage, and oxidative stress. It is beneficial to understand the molecular mechanisms to find the genes that respond and the regulatory systems that control them (Solis et al., 2022). This information facilitates the improvement of stress tolerance in crop varieties through genetic engineering and breeding or breeding initiatives. 4. TFs in Abiotic Stress Response Numerous genes have been identified as key players in the response of cereal crops to abiotic stress. For example, the DREB group of TFs can modulate the expression of genes associated with both high salinity and low water content (Hu and Xiong, 2014). Similarly, a class of gene regulators known as basic leucine zipper (bZIP) uses light signaling in response to several abiotic stresses (Akhtar et al., 2012), while another group of transcription factors, such as WRKY, are associated with controlling these responses in response to biotic or abiotic stresses and have been found in maize, barley, rice, and wheat (Zhang et al., 2022). Upon exposure to stress, the levels of specific stress-responsive transcription factors are often altered. Targeted genes are involved in response to stress when a transcription factor binds elements known as cis-regulatory sequences in their promoter regions to initiate a pathway that induces abiotic stress by repressing these targeted genes (Banerjee and Roychoudhury, 2022). Activation occurs when the transcription factor recruits other proteins, such as RNA polymerase, to the promoter region, leading to the initiation of transcription and subsequent expression of genes (Solis et al., 2022). The process by which transcription factors bind to cis-regulatory sequences is highly specific, as each transcription factor recognizes a specific DNA sequence motif. This specificity allows precise control of how a gene is expressed in response to abiotic stress (Samal et al., 2021). Different sets of target genes can be activated or repressed by different transcription factors depending on which cis-regulatory regions they recognize, due to their distinct properties such as DNA-binding domains (Alamholo and Tarinejad, 2023). Examples of such domains are the APETALA2/Ethylene-Responsive Element Binding Factor (AP2/ERF) domain in the DREB family, the bZIP domain in the bZIP family, and the WRKY domain in the WRKY family. The bZIP factor, for example, is associated with drought resistance in wheat and binds to a specific cis-regulatory element within the promoter of the gene and modulates various physiological and biochemical processes such as osmosis, scavenging of free radicals, and opening and closing of stomata to control how water enters and exits leaves (Soni et al, 2022). 5. Molecular Mechanisms of TF-mediated Abiotic Stress Drought stress activates the dehydration-responsive element-binding (DREB) and myeloblastosis (MYB) transcription factors in cereals (Samal et al., 2021). However, elevated soil salinity can cause osmotic stress and ion imbalances in plants. These bind to cis-elements (Table 2) on genes activated by the stress response and initiate their transcription. Cis-elements in this region include; dehydration-responsive element/C-repeat (DRE/CRT), which is activated by DREB, and MYB/MYC cis-elements, which are myeloblastosis oncogene-like transcription factor/myelocytomatosis oncogene (MYB/MYC) TFs, resulting in the control of genes that respond to drought stress as well as those involved in osmoprotectant synthesis and antioxidant defense (Zhang et al., 2022). Salinity stress also triggers the activation of specific TFs in cereal crops (Sahoo et al., 2019). Some abiotic stress-related TFs are described in (Table 3). This situation triggers a group of TFs, such as NAC TFs, which modulate the salinity stress response by binding to cis-elements, known as NAC recognition sequence (NACRS), of target genes to initiate ion homeostasis, adjust the osmotic balance, and enhance antioxidant defense. Through this action, NAC TFs contribute to the improvement of salinity tolerance in cereal crops (Zhang et al., 2022). NAC is an acronym representing the first three members of the group of TFs that control these processes. They are No Apical Meristem (NAM), Arabidopsis Transcription Activation Factor 1 and 2 (ATAF1&2), and Cup-Shaped Cotyledon 2 (CUC2). For example, extreme temperatures activate the C-repeat binding factor/dehydration-responsive element-binding protein-1 (CBF/DREB1) TF in cereals to inhibit cold stress through a mechanistic interaction with CRT/DRE cis-elements (Alamholo and Tarinejad, 2023). sagens.org/journal/agens [268] AgroEnvironmental Sustainability Dweh et al. Table 2. Genes and cis-elements in the promoter region, and their recognition sequences. Genes RD29A Name of Cis-element / Sequence Dehydration-responsive element (DRE) & ABRE Reference Samal et al. (2021) CTACGTGGCCA ABRE DRE ARABIDOPSIS THALIANA DROUGHT-INDUCED 8 Like ABRE; G box-related element Bodinga et al. (2023) Radha et al. (2023) Zhang et al. (2019) Zhang et al. (2019) GGACGCGTGGC GGACACGTGGC Response to ABA element and desiccation ABRE Wheat histone H3 GGACGCGTGGC Maize anthocyanin promoter Maize (Z.m.) rab28 Barley alpha-amylase gene (Amy 1/6-4) Barley (H.v.) HVA1 gene iso1 (encoding isoamylase1) promoter Barley HVA1 gene AGTTGAATGGGGGTGCA Synthetic element (hex-3) related to response to ABA and desiccation (Anthocyanin regulatory element) Solis et al. (2022) Alamholo and Tarinejad (2023) Radha et al. (2023) ACGCGCCTCCTC GGCCGATAACAAACTCCGGCC ABA GARE (gibberellic acid responsive element) Bodinga et al. (2023) Radha et al. (2023) CCTACGTGGCGG AAAACTAAGAAAGACCGATGGAAAA ABRE1and ABRE2 Sugar-responsive element Zhang et al. (2019) ACGCGTGTCCTC Alamholo and Tarinejad (2023) EPB-1 GTAACAGAATGCTGG HY5AT TGACACGTGGCA ABRC3 (ABA response complex 3) of HVA1 consists of CE3 and A2; ABA responsive element; stress response GAMyB Putative binding site of the transcription factor, development of root and hypocotyl RTBV promoter CAGAAGATA GATA motif binding factor RD22 RD29B RAB18 Amy3D (amylase) promoter of rice (O.s.) Wheat histone H3 Wheat (T.a.) Em gene Cis-element / Sequences of Gene DRE; TACCGACAT & ABRE; ACGTGG/TC RYACGTGGYR TACCGACAT Samal et al. (2021) Radha et al. (2023) Banerjee and Roychoudhury (2022) Zhang et al. (2022) Table 3. Transcription factor-mediated gene regulation in cereal crops. Transcription Factor Genes Regulated Abiotic Stress Outcome of Gene Regulation Cereal Crop Reference DREB1/CBF RD29A, COR47, KIN1, COR6.6, Drought, Cold Drought tolerance Wheat Samal et al. (2021) MYB RD22, RD29B, RAB18 Drought Enhanced drought tolerance Wheat, maize rice Bodinga et al. (2023) NAC SNAC1, SNAC2, OsOAT Salinity stress Salinity tolerance Rice, maize, wheat Radha et al. (2023) CBF/DREB1 COR genes, antifreeze proteins Extreme temperature Cold tolerance Rice, maize, Wheat Zhang et al. (2019) HSF HSP genes Heat stress Heat tolerance Rice, maize, Wheat Zhang et al. (2019) MYB MYB2, MYB44 Drought, UV-B Activation of stressrelated genes Sorghum Solis et al. (2022) WRKY WRKY22, WRKY46 Salinity, Pathogens Salinity, Pathogens tolerance Barley Alamholo and Tarinejad (2023) bZIP bZIP28, bZIP53 Extreme temperature, drought Heat, drought tolerance Maize Radha et al. (2023) 6. TF-mediated Abiotic Stress in Cereals: Case Studies Transcription factor-mediated responses to abiotic stress in cereals have been the subject of extensive research, with notable case studies providing valuable insights. The following case studies illustrate the importance of TFs in conferring abiotic stress resistance in cereals, offering promising avenues for crop improvement and agricultural sustainability in the face of changing environmental conditions. sagens.org/journal/agens [269] Dweh et al. AgroEnvironmental Sustainability 6.1. RD29A, COR47, KIN1 and COR6.6 Genes Mediated Drought Tolerance in Wheat RD29A (Responsive to Dehydration 29A) is a stress-responsive gene up-regulated by DREB1/CBF TFs under low temperature and low water content in wheat. It functions in the synthesis of osmoprotectants and the regulation of ion transporters. Osmo-protectants are small organic molecules that help plants maintain cellular osmotic balance (Annum et al., 2022). Their nature as compatible solutes allows them to accumulate in the cell without interfering with cellular processes. Osmo-protectants include proline, glycine betaine, and sugars such as trehalose and sucrose can be synthesized in response to stress (Soni et al., 2021). This complex process also involves the activation of several enzymes and metabolic pathways. The enzyme proline dehydrogenase is responsible for the synthesis of proline from glutamate, while enzymes such as betaine aldehyde dehydrogenase and choline monooxygenase synthesize glycine betaine from choline (Annum et al., 2022). The synthesis of sugars such as trehalose and sucrose involves the activation of specific sugar biosynthetic enzymes (Soni et al., 2021). COR47 (Cold-Regulated 47) is another gene that is activated to inhibit cold stress in wheat. It encodes a protein that prevents freezing damage in plant cells by stabilizing cell membranes to prevent ice crystal formation. It has been proposed that COR47 acts as a cryoprotectant by binding to and stabilizing the lipid bilayer of cell membranes (Annum et al., 2022). This helps to maintain membrane integrity and prevent leakage of cellular contents that can occur during freezing and thawing cycles, while the KIN1 (short infusion) gene functions in osmotic adjustment, which is essential to prevent dehydration in plants under drought conditions. RD29A may be involved in the regulation of ion channels and transporters that control the uptake and efflux of ions such as (K+), (Na+), (Ca2+), and (Cl-) in plant cells. The exact mechanisms are still under investigation (Soni et al., 2021). 6.2. WRKY22 and WRKY46 Genes Mediated Salinity Tolerance in Barley WRKY DNA-binding protein 46 (WRKY46) helps activate the plant's immune response and increases its resistance to various pathogens (Nazir et al., 2022). However, it minimizes damage to plants caused by high salt concentrations. In the presence of salt, there is an imbalance of ions inside and outside the cell, causing toxicity and subsequent cell damage (Alamholo and Tarinejad, 2023). channels, such as those responsible for the uptake and efflux of sodium (Na +) and potassium (K+). Meanwhile, WRKY22 can activate the expression of the potassium transporter HKT1, known for its strong attraction to potassium ions and its role in maintaining potassium homeostasis, and prevent sodium accumulation in the cytoplasm or by causing cellular dehydration through osmotic regulation (Schindfessel et al., 2021). 6.3. COR Gene Mediated Cold Tolerance in Rice and Maize COR genes can respond to cold stress. The OsCOR413im gene in rice encodes a protein that is triggered by lowtemperature conditions and helps to stabilize cell membranes. Its full name is Oryza sativa Cold-Regulated Protein 413 and is located in the mitochondria (Ndlovu and Maphosa, 2021). One proposed mechanism is that the OsCOR413im protein interacts with lipids in the cell membrane, particularly phospholipids, and helps maintain their proper arrangement and organization (Ndlovu and Maphosa, 2021). This interplay could prevent the lipids from shifting from a state characterized by liquid crystalline properties to a more solid, gel-like state, which can occur at low temperatures and lead to membrane rigidity (Ali et al., 2022). In maize, the Zea mays Cold-Regulated Protein 413 or ZmCOR413 genes are induced during cold stress and are involved in membrane stabilization and protection against freezing-induced damage. Antifreeze genes such as the ZmAFP1 gene, which encodes a protein that inhibits ice crystal growth and increases cold tolerance, have also been identified in maize (Ndlovu and Maphosa, 2021). In wheat, the TaCOR14b gene is induced by cold stress and encodes a protein with cryoprotective properties that protects plant cells from freezing-induced damage, and the TaAFP2 gene has also been identified to confer cold tolerance by inhibiting ice crystal growth (Ali et al., 2022). 6.4. bZIP28 and bZIP53 Genes Mediated Heat and Drought Tolerance in Maize Basic leucine zipper 28 or bZIP28 is a transcription factor that is functional in the unfolded protein response (UPR) during stress in the endoplasmic reticulum (ER). bZIP28 undergoes multiple post-translational modifications that result in its subsequent translocation to the nucleus where it interacts with specific DNA sequences known as ER stress response elements (ERSEs) in the promoter region (Soni et al., 2021). As a result, protein folding enzymes including protein disulfide isomerases (PDIs) and chaperones such as heat shock proteins (HSPs) are induced (Ali et al., 2022). sagens.org/journal/agens [270] Dweh et al. AgroEnvironmental Sustainability These proteins ensure that proteins are properly folded and prevent the accumulation of misfolded or unfolded proteins, which can be toxic to cells under stress (Ndlovu and Maphosa, 2021). Superoxide dismutase (SOD) and catalase are two proteins that function to remove reactive oxygen species (ROS) and protect cells from oxidative damage caused by heat stress. Both the bZIP53 and bZIP28 genes modulate these proteins under drought stress to produce osmoprotectants that maintain cellular osmotic balance and protect against dehydration (Banerjee and Roychoudhury, 2022). 7. Future Trends in TFs Mediated Cereal Crops Improvement WRKY and DREB/CBF transcription factors DRE/CRT cis-acting element in the promoter regions of stress-responsive genes to enhance tolerance to drought stress. The conservation of this mechanism allows the transfer of knowledge and strategies for improving drought tolerance (Banerjee and Roychoudhury, 2022), as it is used by the majority of cereal crops. WRKY TF is used by cereal crops to modulate multiple abiotic stresses such as drought, salinity, and cold temperatures (Wang et al., 2023). In an event where environmental climate change creates situations characterized by intense multiple effects on the environment that cause prevailing abiotic stress in cereal crops, it becomes imperative to enhance TFs and genes associated with abiotic stress response using genetic engineering methods (Radha et al., 2023). This will increase the concentration of osmoprotectants to maintain cellular osmotic balance and protect against dehydration in case of drought. Regarding antioxidant protection, enzymes such as superoxide dismutase (SOD) and catalase (CAT) will scavenge free radicals to prevent oxidative damage, and TF such as DREB/CBF will be engineered to be overexpressed (Samal et al., 2021). In addition, epigenetic modifications such as DNA methylation and histone modifications can affect the ability of TFs to bind sites in response to stress (Zhang et al., 2019). These modifications may directly or indirectly affect the composition of chromatin and the activity of genes to influence abiotic stress in cereal crops. For example, in rice, DNA methylation has been shown to modulate genes that respond to stress (Zhang et al., 2019). During drought stress, the promoter regions of these stress-responsive genes can become hypermethylated, leading to transcriptional repression and reduced stress tolerance (Samal et al., 2021). However, DNA methylation regulates the accessibility of transcription factor binding sites by adding or removing methyl groups to cytosine residues of DNA (Soni et al., 2021). Meanwhile, hypermethylation of promoter regions of stress-responsive genes under drought stress can lead to transcriptional repression and reduced stress tolerance (Samal et al., 2021). However, this occurs because DNA methylation can directly block the binding of TFs to their target sites on DNA, preventing the initiation of gene expression. Histone modifications, which include processes such as acetylation, methylation, phosphorylation, and ubiquitination, can regulate the accessibility of TF binding sites. Similarly, histone methylation can either activate or repress gene expression, depending on the specific lysine residue and the degree of methylation (Alamholo and Tarinejad, 2023). 8. Conclusion TFs in cereal crops are regulators of genes that respond to stress, and activating or repressing their expression levels can enhance the ability of plants to cope with environmental stresses. The identification and characterization of specific TFs involved in these processes have provided valuable insights into the molecular mechanisms of abiotic stress tolerance in cereals. A more detailed understanding of their regulatory networks and interactions with other genes is still needed. TFs serve as central nodes in these interaction networks, integrating signals from different stress-responsive genes and orchestrating their expression. Furthermore, the integration of omics technologies allows the identification of novel TFs and the genes they target. Author Contributions: Conceptualization, Jyoti Prakash Sahoo, Tuward J. Dweh; Data curation, Tuward J. Dweh, Salma Kayastha; Resources, Jyoti Prakash Sahoo, Tuward J. Dweh; Software, Jyoti Prakash Sahoo, Tuward J. Dweh; Supervision, Jyoti Prakash Sahoo, Manaswini Mahapatra; Validation, Jyoti Prakash Sahoo, Tuward J. Dweh; Visualization, Jyoti Prakash Sahoo, Tuward J. Dweh; Writing – original draft, Tuward J. Dweh; Writing – review & editing, Jyoti Prakash Sahoo, Tuward J. Dweh. All authors have read and agreed to the published version of the manuscript. Funding: Not applicable. Acknowledgment: Not applicable. Conflicts of Interest: The authors declare no conflict of interest. sagens.org/journal/agens [271] Dweh et al. AgroEnvironmental Sustainability Institutional/Ethical Approval: Not applicable. Data/Supplementary Information Availability: Not applicable. References Akhtar, M., Jaiswal, A., Taj, G., Jaiswal, J. P., Qureshi, M. I., & Singh, N. K. (2012). DREB1/CBF transcription factors: their structure, function and role in abiotic stress tolerance in plants. Journal of Genetics, 91(3), 385-395. Alamholo, M., & Tarinejad, A. (2023). Molecular mechanism of drought stress tolerance in barley (Hordeum vulgare L.) via a combined analysis of the transcriptome data. Czech Journal of Genetics and Plant Breeding, 59(2), 76-94. Ali, B., Wang, X., Saleem, M. H., Sumaira, Hafeez, A., Afridi, M. S., & Ali, S. (2022). PGPR-mediated salt tolerance in maize by modulating plant physiology, antioxidant defense, compatible solutes accumulation and bio-surfactant producing genes. Plants, 11(3), 345. https://doi.org/10.3390/plants11030345 Annum, N., Ahmed, M., Imtiaz, K., Mansoor, S., Tester, M., & Saeed, N. A. (2022). 32Pi labeled transgenic wheat shows the accumulation of phosphatidylinositol 4, 5-bisphosphate and phosphatidic acid under heat and osmotic stress. Frontiers in Plant Science, 13, 881188. https://doi.org/10.3389/fpls.2022.881188 Banerjee, A., & Roychoudhury, A. (2022). Molecular Genetic Studies and Breeding and Genomics-Based Approaches to Develop Abiotic Stress Tolerance in Sorghum. In Omics Approach to Manage Abiotic Stress in Cereals (pp. 465-477). Singapore: Springer Nature Singapore. https://doi.org/10.1007/978-981-19-0140-9_18 Bodinga, N. M., Suleiman, I., Malami, I., & Baraya, A. S. (2023). Role of NAC Gene Transcription Factors in the Regulation of Abiotic Stress Responses in Cereal Crops. ATBU Journal of Science, Technology and Education, 11(2), 387-393. Gunguniya, D. F., Kumar, S., Patel, M. P., Sakure, A. A., Patel, R., Kumar, D., & Khandelwal, V. (2023). Morpho-biochemical characterization and molecular marker based genetic diversity of pearl millet (Pennisetum glaucum (L.) R. Br.). PeerJ, 11, e15403. https://doi.org/10.7717/peerj.15403 Hu, H., & Xiong, L. (2014). Genetic Engineering and Breeding of Drought-Resistant Crops. Annual Review of Plant Biology, 65(1), 715741. Nazir, F., Kumari, S., Mahajan, M., & Khan, M. I. R. (2023). An explicit story of plant abiotic stress resilience: Overtone of selenium, plant hormones and other signaling molecules. Plant and Soil, 486(1-2), 135-163. https://doi.org/10.1007/s11104-022-05826-2 Ndlovu, E., Van Staden, J., & Maphosa, M. (2021). Morpho-physiological effects of moisture, heat and combined stresses on Sorghum bicolor [Moench (L.)] and its acclimation mechanisms. Plant Stress, 2, 100018. https://doi.org/10.1016/j.stress.2021.100018 Numan, M., Serba, D. D., & Ligaba-Osena, A. (2021). Alternative strategies for multi-stress tolerance and yield improvement in millets. Genes, 12(5), 739. https://doi.org/10.3390/genes12050739 Radha, B., Sunitha, N. C., Sah, R. P., TP, M. A., Krishna, G. K., Umesh, D. K., & Siddique, K. H. (2023). Physiological and molecular implications of multiple abiotic stresses on yield and quality of rice. Frontiers in Plant Science, 13, 996514. https://doi.org/10.3389/fpls.2022.996514 Sahoo, J. P., Behera, L., Sharma, S. S., Praveena, J., Nayak, S. K., & Samal, K. C. (2020). Omics Studies and Systems Biology Perspective towards Abiotic Stress Response in Plants. American Journal of Plant Sciences, 11(12), 2172-2194. https://doi.org/10.4236/ajps.2020.1112152 Sahoo, J. P., Sharma, V., Verma, R. K., Chetia, S. K., Baruah, A. R., Modi, M. K., & Yadav, V. K. (2019). Linkage analysis for drought tolerance in kharif rice of Assam using microsatellite markers. Indian Journal of Traditional Knowledge, 18(2), 371-375. Salika, R., & Riffat, J. (2021). Abiotic stress responses in maize: a review. Acta Physiologiae Plantarum, 43(9), 130. https://doi.org/10.1007/s11738-021-03296-0 Samal, K. C., Sahoo, J. P., Behera, L., & Dash, T. (2021). Understanding the BLAST (Basic local alignment search tool) Program and a step-by-step guide for its use in life science research. Bhartiya Krishi Anusandhan Patrika, 36(1), 55-61. https://doi.org/10.18805/BKAP283 Schindfessel, C., Drozdowska, Z., De Mooij, L., & Geelen, D. (2021). Loss of obligate crossovers, defective cytokinesis and male sterility in barley caused by short-term heat stress. Plant Reproduction, 34(3), 243-253. Solis, C. A., Yong, M. T., Zhou, M., Venkataraman, G., Shabala, L., Holford, P., & Chen, Z. H. (2022). Evolutionary significance of NHX family and NHX1 in salinity stress adaptation in the genus oryza. International Journal of Molecular Sciences, 23(4), 2092. https://doi.org/10.3390/ijms23042092 Soni, S., Kumar, A., Sehrawat, N., Kumar, A., Kumar, N., Lata, C., & Mann, A. (2021). Effect of saline irrigation on plant water traits, photosynthesis and ionic balance in durum wheat genotypes. Saudi Journal of Biological Sciences, 28(4), 2510-2517. https://doi.org/10.1016/j.sjbs.2021.01.052 Wang, C., Ye, D., Li, Y., Hu, P., Xu, R., & Wang, X. (2023). Genome-wide identification and bioinformatics analysis of the WRKY transcription factors and screening of candidate genes for anthocyanin biosynthesis in azalea (Rhododendron simsii). Frontiers in Genetics, 14, 1172321. https://doi.org/10.3389/fgene.2023.1172321 Zhang, M. X., Bai, R., Nan, M., Ren, W., Wang, C. M., Shabala, S., & Zhang, J. L. (2022). Evaluation of salt tolerance of oat cultivars and the mechanism of adaptation to salinity. Journal of Plant Physiology, 273, 153708. https://doi.org/10.1016/j.jplph.2022.153708 sagens.org/journal/agens [272] Dweh et al. AgroEnvironmental Sustainability Zhang, X., Liu, W., Lv, Y., Li, T., Tang, J., Yang, X., & Zhou, H. (2022). Effects of drought stress during critical periods on the photosynthetic characteristics and production performance of Naked oat (Avena nuda L.). Scientific Reports, 12(1), 11199. https://doi.org/10.1038/s41598-022-15322-3 Zhang, Z., Dong, J., Ji, C., Wu, Y., & Messing, J. (2019). NAC-type transcription factors regulate accumulation of starch and protein in maize seeds. Proceedings of the National Academy of Sciences, 116(23), 11223-11228. https://doi.org/10.1073/pnas.1904995116 Publisher’s note/Disclaimer: Regarding jurisdictional assertions in published maps and institutional affiliations, SAGENS maintains its neutral position. All publications' statements, opinions, and information are the sole responsibility of their respective author(s) and contributor(s), not SAGENS or the editor(s). SAGENS and/or the editor(s) expressly disclaim liability for any harm to persons or property caused by the use of any ideas, methodologies, suggestions, or products described in the content. sagens.org/journal/agens [273]