Plant Molecular Virology

Plant viruses that are members of the Geminiviridae family have circular single-stranded DNA (ssDNA) genome and are responsible for major crop diseases worldwide. We have identified and characterized a novel monopartite geminivirus infecting tomato in Argentina. The full-length genome was cloned and sequenced. The genome-wide pairwise identity calculation that resulted in a maximum of 63% identity with all of other known geminiviruses indicated that it is a new geminivirus species. Biolistic infected plants presented interveinal yellowing, apical leaf curling and extreme root hypotrophy. Thus, the name proposed for this species is tomato apical leaf curl virus (ToALCV). The phylogenetic inferences suggested different evolutionary relationships for the replication-associated protein (Rep) and the coat protein (CP). Besides, the sequence similarity network (SSN) protein analyses showed that the complementary-sense gene products (RepA, Rep and C3) are similar to capulavirus while the viron-sense gene products (CP, MP and V3) are similar to topocuvirus, curtovirus and becurtovirus. Based on the data presented, ToALCV genome appears to have " modular organization " supported by its recombination origin. Analyses of the specificity-determining positions (SDPs) of the CP of geminiviruses defined nine subgroups that include geminiviruses that share the same type of insect vector. Our sequences were clustered with the sequences of topocuvirus, whose vector is the treehopper, Micrutalis malleifera. Also, a set of the highest scored amino acid residues was predicted for the CP, which could determine differences in virus transmission specificity. We predict that a treehopper could be the vector of ToALCV, but transmission assays need to be performed to confirm this. Given everything we demonstrate in this paper, ToALCV can be considered a type member of a new putative genus of the Geminiviridae family.

Introduction – A variety of sample preparation protocols for plant proteomic analysis using two-dimensional gel electrophoresis (2-DE) have been reported. However, they usually have to be adapted and further optimised for the analysis of plant species not previously studied.Objective – This work aimed to evaluate different sample preparation protocols for analysing Carica papaya L. leaf proteins through 2-DE.Methodology – Four sample preparation methods were tested: (1) phenol extraction and methanol–ammonium acetate precipitation; (2) no precipitation fractionation; and the traditional trichloroacetic acid–acetone precipitation either (3) with or (4) without protein fractionation. The samples were analysed for their compatibility with SDS–PAGE (1-DE) and 2-DE. Fifteen selected protein spots were trypsinised and analysed by matrix-assisted laser desorption/ionisation time-of-flight tandem mass spectrometry (MALDI-TOF-MS/MS), followed by a protein search using the NCBInr database to accurately identify all proteins.Results – Methods number 3 and 4 resulted in large quantities of protein with good 1-DE separation and were chosen for 2-DE analysis. However, only the TCA method without fractionation (no. 4) proved to be useful. Spot number and resolution advances were achieved, which included having an additional solubilisation step in the conventional TCA method. Moreover, most of the theoretical and experimental protein molecular weight and pI data had similar values, suggesting good focusing and, most importantly, limited protein degradation.Conclusion – The described sample preparation method allows the proteomic analysis of papaya leaves by 2-DE and mass spectrometry (MALDI-TOF-MS/MS). The methods presented can be a starting point for the optimisation of sample preparation protocols for other plant species. Copyright © 2009 John Wiley & Sons, Ltd.

Recent studies with Y satellite RNA (Y-sat) of
cucumber mosaic virus have demonstrated that Y-sat
modifies the disease symptoms in specific host plants
through the silencing of the magnesium protoporphyrin
chelatase I subunit (CHLI), which is directed by the Y-sat
derived siRNA. Along with the development of peculiar
yellow phenotypes, a drastic decrease in CHLI-transcripts
and a higher accumulation of Y-sat derived siRNA were
observed. To investigate the molecular mechanisms
underlying the Y-sat—induced chlorosis, especially whether or not the reduced expression of CHLI causes the chlorosis simply through the reduced production of
chlorophyll or it triggers some other mechanisms leading to the chlorosis, we have established a new experimental system with an inducible silencing mechanism. This system involves the expression of artificial microRNAs targeting of Nicotiana tabacum CHLI gene under the control of chemically inducible promoter. The CHLI mRNA levels and total chlorophyll content decreased significantly in 2 days, enabling us to analyze early events in induced chlorosis and temporary changes therein. This study revealed that the silencing of CHLI did not only result in the decreased chlorophyll content but also lead to the downregulation of chloroplast and photosynthesis-related genes expression and the up regulation of defense related genes. Based on these results, we propose that the
reduced expression of CHLI could activate unidentified
signaling pathways that lead plants to chlorosis.

Food security (a pressing issue for all nations) faces a threat due to population growth, land availability for growing crops, a changing climate (leading to increases in both abiotic and biotic stresses), heightened consumer awareness of the risks related to the use of agrichemicals, and also the reliance on depleting fossil fuel reserves for their production. Legislative changes in Europe mean that fewer agrichemicals will be available in the future for the control of crop pests and pathogens. The need for the implementation of a more sustainable
agricultural system globally, incorporating an integrated approach to disease management, has never been more urgent. To that end, the Valorizing Andean Microbial Diversity (VALORAM) project (http://valoram.ucc.ie), funded under FP7, examined the role of microbial
communities in crop production and protection to improve the sustainability, food security, environmental protection, and productivity for rural Andean farmers. During this work, microbial volatile organic compounds (mVOCs) of 27 rhizobacterial isolates were identified using gas chromatography/mass spectrometry (GC/MS), and their antifungal
activity against Rhizoctonia solani was determined in vitro and compared to the activity of a selection of pure volatile compounds. Five of these isolates, Pseudomonas palleroniana R43631, Bacillus sp. R47065, R47131, Paenibacillus sp. B3a R49541, and Bacillus simplex M3-4 R49538 trialled in the field in their respective countries of origin, i.e., Bolivia, Peru, and Ecuador, showed significant increase in the yield of potato. The strategy followed in the VALORAM project may offer a template for the future isolation and determination of putative biocontrol and plant growth-promoting agents, useful as part of a low-input integrated pest management system.

Chlorosis is one of the most common symptoms
of plant diseases, including those caused by viruses and
viroids. Recently, a study has shown that Peach latent
mosaic viroid (PLMVd) exploits host RNA silencing
machinery to modulate the virus disease symptoms through the silencing of chloroplast-targeted heat shock protein 90 (Hsp90C). To understand the molecular mechanisms of chlorosis in this viroid disease, we established an experimental system suitable for studying the mechanism underlying the chlorosis induced by the RNA silencing of Hsp90C in transgenic tobacco. Hairpin RNA of the Hsp90C-specific region was expressed under the control of a dexamethasone-inducible promoter, resulted in the silencing of Hsp90C gene in 2 days and the chlorosis along with growth suppression phenotypes. Time course study suggests that a sign of chlorosis can be monitored as early s 2 days, suggesting that this experimental model is
suitable for studying the molecular events taken place
before and after the onset of chlorosis. During the early
phase of chlorosis development, the chloroplast- and photosynthesis-related genes were downregulated. It should be noted that some pathogenesis related genes were upregulated during the early phase of chlorosis in spite of the absence of any pathogen-derived molecules in this system.

Abstract Tomatoes in Guatemala have been affected by a
new disease, locally known as ‘‘mancha de chocolate’’
(chocolate spot). The disease is characterized by distinct
necrotic spots on leaves, stems and petioles that eventually
expand and cause a dieback of apical tissues. Samples from
symptomatic plants tested negative for infection by tomato
spotted wilt virus, tobacco streak virus, tobacco etch virus
and other known tomato-infecting viruses. A virus-like
agent was sap-transmitted from diseased tissue to Nicotiana
benthamiana and, when graft-transmitted to tomato, this
agent induced chocolate spot symptoms. This virus-like
agent also was sap-transmitted to Datura stramonium and
Nicotiana glutinosa, but not to a range of non-solanaceous
indicator plants. Icosahedral virions *28–30 nm in diameter
were purified from symptomatic N. benthamiana plants.
When rub-inoculated onto leaves of N. benthamiana plants,
these virions induced symptoms indistinguishable from
those in N. benthamiana plants infected with the sap-transmissible
virus associated with chocolate spot disease.
Tomatoes inoculated with sap or grafted with shoots from
N. benthamiana plants infected with purified virions
developed typical chocolate spot symptoms, consistent with
this virus being the causal agent of the disease. Analysis of
nucleic acids associated with purified virions of the chocolate-
spot-associated virus, revealed a genome composed of
two single-stranded RNAs of*7.5 and*5.1 kb. Sequence
analysis of these RNAs revealed a genome organization
similar to recently described torradoviruses, a new group of
picorna-like viruses causing necrosis-associated diseases of
tomatoes in Europe [tomato torrado virus (ToTV)] and
Mexico [tomato apex necrosis virus (ToANV) and tomato
marchitez virus (ToMarV)]. Thus, the*7.5 kb and*5.1 kb
RNAs of the chocolate-spot-associated virus corresponded to
the torradovirus RNA1 and RNA2, respectively; however,
sequence comparisons revealed 64–83% identities with
RNA1 and RNA2 sequences of ToTV, ToANV and ToMarV.
Together, these results indicate that the chocolate-spotassociated
virus is a member of a distinct torradovirus species
and, thus, another member of the recently established genus
Torradovirus in the family Secoviridae. The name tomato
chocolate spot virus is proposed.

The beet necrotic yellow vein virus (BNYVV) RNA-5-encoded p26 protein is involved in the accentuation of symptoms expression of infected Chenopodium quinoa plants and is capable of transcription activation (TA) in yeast. TA was previously localized within the first 55 residues of the p26 protein. Interestingly, TA did not occur when C-terminally deleted forms of p26 were used. We used a genetic screen in the yeast one-hybrid system to select restored TA from randomly generated mutants. The TA domain was found to be located within the first 17 residues. Alanine replacement of aspartic acids 11, 16, and 17 within the full-length p26 prevented TA but did not impair subcellular localization and the symptom expression.

The complete genome sequences for two variant isolates of groundnut rosette assistor virus (GRAV) have been
determined from symptomatic groundnut plants in western Kenya. The sequences of the two GRAV isolates
(sc7.1 and sc7.2) are 84.2% identical at the nucleotide level and 98.5% identical at the coat protein level. The
variants sc7.1 and sc7.2 comprise 5850 and 5879 nucleotides respectively, and show similar genome organizations
with 7 predicted ORFs (P0, P1, P2, P3a, P3 (coat protein, CP), P4 (movement protein, MP) and P5 (coat
protein-readthrough protein, CP-RT). Currently, GRAV is an unassigned virus in the Luteoviridae family, due to
the fact that only the sequence of the coat protein was previously obtained. The presence of both ORF0 and ORF
4 within the genome sequence determined in the current work suggest that GRAV should be classified as a
member of the genus Polerovirus.

Pepo aphid-borne yellows virus (PABYV) has been proposed as a putative representative of a new species in the genus Polerovirus in the family Luteoviridae. The genomes of two South African (SA) isolates of cucurbit-infecting PABYV were described in this record. Total RNA, extracted from a pattypan (Cucurbita pepo L.) and a baby marrow (C. pepo L.) leaf samples, was subjected to next-generation sequencing (NGS) on the HiSeq Illumina platform. Sanger sequencing was subsequently used to authenticate the integrity of PABYV’s genome generated from de novo assembly of the NGS data. PABYV genome of SA isolates consists of 5813 nucleotides and displays an organisation typical of poleroviruses. Genome sequence comparisons of the SA PABYV isolates to other poleroviruses support the classification of PABYV as a new species in the genus Polerovirus. Recombination analyses showed that PABYV and Cucurbit aphid-borne yellows virus (CABYV) shared the same ancestor for the genome part situated between breaking points. Phylogenetic analyses of the RNA-dependent RNA polymerase and the coat protein genes showed that SA PABYV isolates shared distant relationship with CABYV and Suakwa aphid-borne yellows virus. Based on our results, we propose that PABYV is a distinct species in the genus Polerovirus.

Melon (Cucumis melo L.) is one of the most important crops in Pakistan and ranked as 4th largest produced with an annual production of 0.54 M tonnes over an area of 0.037 M hectares (GOP 2016). Production is mainly hampered due to many biotic factors including viruses. In 2016, a severe yellowing disorder (yellowing and thickening of leaves) was noticed on melons grown in Tehsil Hazro of District Attock (Punjab). Yellowing disorder in cucurbits is mainly attributed to viruses of genera Crinivirus (Tomassoli and Meneghini 2006) and Polerovirus (Lecoq et al. 1992). During fields surveys, abundant aphid populations were also observed on affected plants but no whiteflies, which suggested that the present infection might be due to poleroviruses rather than criniviruses. Total RNA was extracted from 26 symptomatic as well as four asymptomatic leaf samples and subsequently subjected to RT-PCR using degenerate polerovirus primers (PoconF-139 and PococpR-140) as described by Xiang et al. (2008). RT-PCR amplicons (ca. 1.4 kb) were obtained from symptomatic but not asymptomatic samples. Further confirmation was carried out using cucurbit aphid-borne yellows virus (CABYV) coat protein (CP) gene specific primer pairs (CABYF143 “5′-GAATACGGTCGCGGCTAGAAATC-3′” and CABYR-144 “5′-CTATTTCGGGTTCTGGACCTGGC3′”) (Juarez et al. 2004). All 26 RT-PCR amplicons (ca. 0.6 kb) were purified using GeneJET PCR purification kit (Thermo Scientific) and subsequently cloned into pTZ57R/T using InsTAclone™ PCR Cloning Kit (Thermo Scientific) and sequenced from both directions. Sequencing results confirmed the presence of CABYV in all symptomatic plants, and sequences of all isolates were identical, so the sequence of one CABYV-melon (AAHAM) isolate was submitted to GenBank (accession No. MH141556). This isolate shared 96% nucleotide identity with an isolate from France (X76931), 95.8% identity with an isolate from Spain (JF939814) and 95.1% identity with a Chinese isolate (EU636992). To the best of our knowledge, this is the first confirmed report of CABYV infecting melon in Pakistan. The presence of this potentially destructive virus on melon could be a serious threat to this important crop, and therefore further studies are needed to monitor CABYV disease impact on cucurbits across the country.

Potato virus Y (PVY, genus Potyvirus, family Potyviridae) causes high economic losses worldwide, especially in the production of seed potatoes (Solanum tuberosum). In a recent study, we reported, for the first time in Jordan, the incidence of recombinant strains of PVY in the southern part of the country (Anfoka et al., 2014). In this study, we further investigated the incidence of the recombinant strains of the virus in the north and east regions of Jordan. Therefore, in August 2015, a total of 172 potato leaf samples were collected from 3 farms in Ramtha (north Jordan) and 56 samples from 2 farms in Mafraq (east Jordan) regions. All samples were obtained from symptomatic potato plants
showing leaf mottling and mosaic symptoms. To test for PVY infection, all samples were subjected to DAS-ELISA using the ELISA kit (monoclonal cocktail) developed by BIOREBA (Reinach, Switzerland) that can detect all PVY strains. ELISA results showed that 24 and 51 samples obtained from Mafraq and Ramtha, respectively were infected with the virus. To confirm these results, total RNA was extracted from ELISA-positive samples and used as template in RTPCR
using the coat protein gene specific primer pair (CPVBamH1
TCAAGGATCCGCAAATGACACAATTGATGCA / CpcEcoR1
AGAGAATTCATCACATGTTCTTGACTCC). PCR results showed that 18
samples obtained from Mafraq and 41 samples from Ramtha were infected with PVY. PCR positive samples were further analyzed for PVY strain identification by uniplex PCR using strain-specific primers as previously described (2). PCR data showed that 48.8% and 61% of samples from Ramtha and Mafraq, respectively were infected with PVY-NTN(A), while 12.2% of samples from Ramtha were infected with PVY-O. PVYNTN SYR-I could be detected in 9.8% and 11% of samples from Ramtha and Mafraq, respectively. One sample from Ramtha was also found infected with PVYNTN SYR-II. PCR fragments (441 bp and 853 bp),
specific to the Wilga strain PVYNW(B) (2), could be amplified from 10 samples (3 from Ramtha and 7 from Mafraq) using the primer pairs n2258/n2700 and S5585/06400, respectively (2). Both fragments were cloned into pGEM-T easy vector and sequenced. Sequences were deposited in the GenBank under accession numbers KX000919 for the 441 bp fragment and KX027299 for the 853 bp fragment. Sequence comparison with other Wilga isolates available in the
NCBI database revealed that the Jordanian isolate of PVYNW(B) (PVYNW(B-Jo)) has 100% nucleotide sequence identity with isolate MV99 (HE608963) from Germany. Furthermore, phylogenetic analysis indicated that PVYNW(B-Jo) shares common ancestral origin with the Wilga isolate (EF558545) previously reported in Poland. To our knowledge, this is the first report of the Wilga strain of
PVY in Jordan

mosaic cucumovirus (CMV) is a known devastating pathogen and menace threat to several important vegetables worldwide including Pakistan. This study was conducted to determine the incidence, distribution and genetic variability of CMV isolates infecting cucurbits and solanaceous vegetables in the Pothwar region of Pakistan, a rich region for vegetable production. Symptomatic leaf and fruit samples were subjected to double antibody sandwich enzyme linked immunosorbent assay (DAS-ELISA) using polyclonal antibodies for CMV. Moreover, it was further characterized by Triple Antibody Sandwich ELISA (TAS-ELISA), molecular assays and genetic recombination. The pathogen was prevalent in all districts and detected in all 10 tested vegetables i.e. cucumber, round gourd, watermelon, melon, pumpkin, bitter gourd, ridge gourd, smooth gourd, chilli and tomato, with an average incidence ranging from 11.85% to 25.89%, with the highest incidence in district Attock (25.17%) followed by Rawalpindi (23.04%), Jhelum (18.57%), Chakwal (18.30%) and Islamabad (14.45%). Cucumber, tomato, watermelon and chilli were found to be most affected by CMV with an average disease incidence (D.I.) of 45.38%, 21.15%, 19.39% and 19.05%, respectively. Capsid protein (CP) cistron nucleotides based In silico restriction and Phylogenetic analyses revealed that among 10 Pakistani CMV under studied isolates; the four viz., AAJAC, AARpCu, AAHAWM and AACCu isolates were grouped as member of CMV subgroup IB and they shared 94.96% identity with each other while rest of the six isolates viz., AARCF, AARwCu, AARTF, AAHAPu, AAICu and AAJABG grouped in to CMV subgroup II with 92.8% identity among themselves. In recombination detection analysis, the Pakistani CMV isolate AAICu (MH119070) was found likely to be a recombinant between the Indian (X89652) and Pakistani (MH119068) isolates with recombinant breakpoints between 370th and 630th nucleotides. Further research is needed to comprehend the economic impact of the virus and breeding programs for screening of resistant genotypes as per recombinant strains and there is also a need to focus on training of farmer communities to manage disease through adaption of resistant cultivars and controlling vector populations.
Keywords: RNA viruses, CMV, Coat protein, Serotyping, Subgroup I and II, Vegetables.

Bean common mosaic necrosis virus (BCMNV) is one of the most common and most destructive viruses of common bean and can cause a yield loss as high as 100%. The common bean (Phaseolus vulgaris L) is an important legume crop for food and cash in Kenya. In Kenya, there is inadequate documentation on the strains of the virus infecting common bean. This information is crucial in devising control measures. This study therefore, sought to characterize BCMNV isolates from western Kenya. Leafy samples showing virus-like symptoms were collected and analysed by Enzyme linked immunosorbent Assay (ELISA) and or next generation sequencing (NGS). Extraction of total RNA from ELISA positive samples was done using RNeasy Plant Mini Kit and NGS carried out following Illumina protocol to determine diversity of the virus. NGS data was trimmed and the sequence reads assembled into contigs, which were analyzed against virus sequence database. Phylogenetic analyses and comparisons were performed using MEGA7 program. The first complete genome sequence of Bean common mosaic virus (BCMNV) is reported from a Kenyan isolate. NGS technology revealed full-length sequence of BCMNV from an isolate BG 12 from Bungoma County with a genome of 9584 nt in length. Phylogenetic analysis of full-length sequences available through the Genbank clustered the isolate with the Tanzanian isolate strain TN-1 and two USA isolates, TN1a and NL-3K.

Present research was carried out to understand antagonistic potentiality of six native Trichoderma spp. against Rhizoctonia oryzae-sativae causing Aggregate sheath spot of rice. Dual culture technique revealed the inhibition percentages of R. oryzae-sativae by T.asperellum (KU933475), T.koningiopsis (KU904460), Hypocrea lixii (KX0113223), T.harzianum (KU904458), T.ovalisporum (KU904456) and T. atroviridae (KU933472) of 58.43%, 68.23%, 60.0%, 72.94%, 64.31%, and 70.19% respectively. Bell’s scale study showed class III category by Trichoderma spp and class II showed by T.harzianum (KU904458) against Rhizoctonia oryzae-sativae. Among the different biological agents Trichoderma harzianum is the most effective one for reducing rapid growth of the pathogen. Further, all Trichoderma isolates significantly inhibited the mycelial growth of the pathogen.

Key words: Rhizoctonia oryzae-sativae, Dual culture, Trichoderma spp.

This review focuses on virus-plant pathosystems, manipulation paradigms and alterations induced by viruses in their hosts and vectors. After forming a suitable cell environment viruses elude the defense mechanism of cell, having a transformative interaction with hosts and vectors urge the scientists to work on different molecular alterations and manipulations induced by viruses in their hosts and vectors. Different manipulation paradigms are regulated by viruses, that start after acquisition of viruses by corresponding vectors in adaptive manipulation and behavioral manipulation manners, which are generally known as " Host Manipulation Hypothesis " (HMH). Because of these mediated alterations, secondary chemistry of vector's behavior can be affected. In the same way, plants are also extensively influenced by viruses which cause dramatic fluctuations in; genotype, phenotype, metabolism, systemic and hormones of the plants. The combination of viral proteins and host proteins evidenced efficacious viral infection. After viral infection defense system of plants is activated in the way of Induced Systemic Resistance (ISR) that is (1) Rapid/ Extreme resistance (2) Slower host response or (hypersensitive response, HR) also known as programmed death of plant cells. Proteome-level alterations have been reported in phloem sap at the time of virus infection but this phenomenon needs to be investigated. Viruses have also been reported for making alterations in primary phytohormones of plants; Salicylic acid (SA), Abscisic acid (ABA), Jasmonic acid (JA), Ethylene (ET) actively involved in defense mechanism of the plant.

Citrus psorosis ophiovirus (CPsV)
was detected from naturally citrus cv. Navel
orange trees exhibited virus-like symptoms
(bark scaling and gum) at Qanater,
Qaluobia governorate, Egypt. CPsV isolate
was detected by serological assay
using monoclonal antibodies (Mabs) specific
to CPsV by double antibody sandwich-
enzyme linked immunosorbent assay
(DAS-ELISA), results showed that three
trees out of twenty eight trees gave positive
reactions with ELISA, values ranged
between 0.621 and 0.740 compared to the
negative (Healthy, 0.300) sample. The
results were biologically confirmed by
showing oak leaf pattern (OLP) on Dweet
tangor after 28 days of inoculation. These
plants were maintained as a suitable
propagative host for the CPsV. Molecular
detection was carried out by reverse transcription-
polymerase chain reaction (RTPCR)
with the extracted RNA from CPsV
infected trees and tissues virus-free as a
negative control and two sets of primers.
Four reactions of one-step RT-PCR were
done using the combination of the four
primers, i.e., CPsVR1 & CPsVR2,
CPsVN1 & CPsVR2, CPsVR1 &
CPsVN2 and CPsVN1 & CPsVN2. Results
showed that four DNA fragments of
1320, 1020, 540 and 240 bp were amplified
respectively

In recent years leaf curl disease of cotton has become a major limiting factor in the production of cotton, which is an important fiber cash crop. In the last two decades or more, leaf curl disease in cotton took on epidemic proportions in Pakistan. In the early 1990’s cotton leaf
curl disease (CLCuD) appeared in the bordering parts of India in the states of Rajasthan and Punjab and spread to entire cotton growing areas in Rajasthan, Punjab and Haryana. The very early appearance of the disease devastated entire crops of susceptible varieties. This led to a ban on the cultivation of Barbadense cotton and the collapse of several popular cotton varieties. The characteristic symptoms of CLCuD are general stunting, upward or downward curling of leaves and thickening of veins which turn dark green. Enations of various
shapes and sizes numbering up to twelve develop on the thickened veins on the abaxial side of leaves. Fewer, smaller balls are formed which sometimes fail to open. In the field CLCuD is a complex problem that needs an integrated management approach. Six species of the genus Begomovirus, family Geminiviridae viz. Cotton leaf curl Alabad virus (CLCuAV), Cotton leaf curl Gezira virus (CLCuGV),
Cotton leaf curl Kokhran virus (CLCuKV), Cotton leaf curl Multan virus (CLCuMV), Cotton leaf curl Rajasthan virus (CLCuRV) and Tomato leaf curl Bangalore virus-Cotton [Fat] associated with DNA-β and DNA-1 (genus Nanovirus) are reported to induce CLCuD. All these begomoviruses are monopartite DNA-A, transmissible by the whitefly Bemisia tabaci. Begomoviruses are recognized as the most
abundant and most severe viral pathogens of cotton, worldwide. Yield losses due to CLCuD amount to 60% or more if the disease appears at a very early stage of the crop. The aim of this review is to discuss and understand our current knowledge of CLCuD complex of cotton, and epidemiology, management and future prospects.