Supplemental Material and Method “Cardiomyocyte-specific loss of mitochondrial p32/C1qbp causes cardiomyopathy and activates stress responses” by Toshiro Saito et al. mtDNA contents For DNA isolation, tissue was digested and DNA isolated using DNeasy Blood and Tissue kit (QIAGEN) according to the manufacturer's protocol. DNA concentration was quantified using an ND-1000 spectrophotometer (Nanodrop Technologies). Mouse mitochondrial and nuclear copy number analysis was performed. Briefly, genomic DNA preparations (also containing mitochondrial DNA) were quantitatively PCR’d in a Step One Plus Sequence Detector using ATP6 (mitochondrial) and AT3 (nuclear) primers. Calculations assumed 300,000 mitochondrial copies and 150 nuclear copies per ng input DNA. The primers used were: ATP6 forward, 5’- AGCTGGAGCCGTAATTACAG-3’ , reverse, 5’-TGTAAGCCGGACTGCTAATG-3’ and AT3 forward, 5’-AGTGGCAAATCGCGAATTGG-3’, reverse, 5’-TGTGGACGACATCTGCATAG -3’ Antibody: Polyclonal antibodies against mouse p32 and VDAC were raised in our laboratory. The primary antibodies against p-AKT at Thr308 (#2965), p-AKT at Ser473 (#4060), AKT (#4691), p-S6 Ribosomal Protein at Ser235 and Ser236 (#2211), p-S6 Ribosomal Protein at Ser240 and Ser244 (#5364), S6 Ribosomal Protein (#2317), p-eIF2α at Ser51 (#3398), eIF2α (#5324), p-4EBP (Thr37/46) (#2855), p-4EBP (Ser65) (#9451), 4EBP (#9644), p-eIF4E(Ser209) (#9741), eIF4E (#2067), pAMPKα (Thr172)(#2535), AMPKα (#2603), p-PTEN(Ser380)(#9551), PTEN(#9552), IRE1α (#3294), GAPDH(#2118) were purchased by Cell signaling (Beverly, MA, U.S.A), respectively. Another primary antibodies were used OTC (ARP41766 avivasysbio.com), CPS1 (ab45956 abcam), coxI (#459600 invitrogen), α-Tubulin (T2200 SIGMA), respectively. Secondary antibodies were used Anti-mouse IgG HRP-linked (#7076 cell signaling), Anti-rabbit IgG HRP-linked (#7074 cell signaling), Alexa Fluor® 488 F(ab')2 Fragment of Goat Anti-Rabbit IgG (H+L) (#A11070 Life Technologies). Transmission Electron Microscopy For electron microscopy, fifty- to one hundred-nm-thick ultrathin sections were prepared, stained with uranyl acetate and lead citrate, and photographed with a JEOL (Akishima) 1200 electron microscope. The samples were fixed by perfusion fixation 1 with 2 % paraformaldehyde (GA) in 0.1 M cacodylate buffer pH 7.4. And then, the samples were fixed with 2 % PFA, 2 % GA, 0.5 % tannic acid in 0.1 M cacodylate buffer pH 7.4 at 40°C for 2h. After this fixation, the samples were rinsed 4 times with 0.1 M cacadylate buffer for 15 min each, followed by post fixation with 2 % osmium tetroxide (OsO4) in 0.1 M cacodylate buffer at 40°C for 2h. The samples were dehydrated through a series of graded ethanol (50%, 70%, 90%, 100%).The schedule was as follows: 50% and 70% for 30 min each at 40°C, 90% for 30 min at room temperature, and 4 changes of 100% for 30min each at room temperature. The samples were infiltrated with propylene oxide (PO) 2 times for 30 min each and put them into a 70:30 mixture of PO and resin (Quetol-812; Nisshin EM Co.,Tokyo, Japan) for 1h, then they kept the cap of tube open and PO was volatilized overnight. The samples were transferred to a resin (Quetol-812; Nisshin EM Co.,Tokyo, Japan), and polymerized at 600°C for 48h. The resin blocks were semi thin sectioned at 1.5 μm with glass knives using an ultramicrotome (ULTRACUT UCT; Lica) and stained with 0.5% Toluidine blue. The blocks were ultra-thin sectioned at 70 nm with a diamond knife using a ultramicrotome (ULTRACUT UCT; Lica) and sections were placed on copper grids. They were stained with 2% uranyl acetate at room temperature for 15min, and then rinsed with distilled water followed by being secondary-stained with Lead stain solution (Sigma-Aldrich Co.) at room temperature for 3 min. The grids were observed by a transmission electron microscope (JEM-1400Plus; JEOL Ltd.) at an acceleration voltage of 80 kV. Digital images (2048×2048 pixels) were taken with a CCD camera (VELETA; Olympus soft Imaging Solutions GmbH). Carbamoyl Phosphate synthetase 1 (CPS1) activities The reaction was initiated by addition of the liver lysates to the rest of the reaction mixture. The reaction mixture contained 50 mM Tris-HCl pH 8.0, 2.5 mM phosphoenopyruvate, 0.2 mM NADH, 30 mM NH4Cl, 100 mM KHCO3, 5 mM ATP, 10 mM MgSO4, 10 mM N-acetylglutamate, 15 U/ml pyruvate kinase / lactate dehydrogenase (SIGMA P0294). The reactions were performed at 37°C and the decrease in absorbance at 340 nm was monitored. The initial velocity of the reaction was calculated to get the CPS1 activity. The activity assay was done with three pairs of p32WT and cKO mice. Immunoprecipitation (IP) using anti-p32 antibodies IP was carried out according to established techniques (Yagi,M NAR 2012). 2 Mouse heart were homogenized and centrifuged at 900 × g for 10 min. The supernatant (adjusted to 10% Percoll) was overlaid on a discontinuous Percoll density gradient (4 ml of 40% and 4 ml of 20% Percoll buffer; GE Healthcare) in a 12 ml centrifugation tube. After centrifugation at 24,000 rpm for 1 h using a SW41-Ti rotor (Beckman Coulter), the mitochondrial phase located in the middle of the tube was collected. Two to three milligrams of mitochondrial protein were solubilized in 1 ml IP buffer (10 mM Tris-HCl, pH 7.4, 150 mM NaCl, 1 mM EDTA, 1% NP-40 and 0.1% SDS) containing 40 ul of anti-p32 antibody with protein G agarose. After 12 h of rotation, the agarose were washed four times with IP buffer and eluted with 1 M glycine (pH 2.5). The mRNA were extracted and analyzing the mitochondrial mRNA content by qRT-PCR. Protein (Elute fraction) were loading to SDS-PAGE and analyzed with MRPS22 antibody. Pulse-labeling of mitochondrial translation products Mitochondrial from mouse heart were pulse-labeled in vitro with 35 [ S]-(methionine and cysteine) (GE Healthcare). In experiments, heart crude mitochondria were incubated in 100 ug/ml emetine prior to labeling for 60 min. Labeled mitochondria were then rinsed with an isotonic buffer (25 mM Tris-HCl, pH 7.4, 137 mM NaCl, 10 mM KCl and 0.7 mM Na2HPO4). After centrifugation at 1150 × g for 5 min, cell pellets were resuspended in loading buffer consisting of 93 mM Tris-HCl, pH 6.7, 7.5% glycerol, 1% SDS, 0.25 mg/ml bromophenol blue and 3% mercaptoethanol. The mitochondrial lysate was then subjected to 5-15% gradient SDS-PAGE for 3 h at 180 V. Gels were measured using a BAS2500 (Fuji). Mitochondrial isolation Isolation of mitochondria from mouse heart was performed with the MACS Mitochondrial Isolation Kit according to manufacturer’s protocol (Miltenyi Biotec GmbH, Bergisch Gladbach, Germany). Mouse heart are lysed and mitochondria are magnetically labeled with Anti-TOM22 MicroBeads. Next, the labeled tissue lysate is passed through a 30 μm filter and loaded onto a MACS Column, which is placed in the magnetic field of a MACS Separator. The unlabeled organelles and cell components run through. After removing the column from the magnetic field, the magnetically retained mitochondria can be eluted. LC-MS and data analysis. The heart-derive metabolites were analyzed by LC-MS based on both reverse phase 3 ion-pair chromatography and hydrophilic interaction chromatography (HILIC) modes coupled with a triple quadrupole mass spectrometer LCMS-8040 (Shimadzu). For monitoring 61 kinds of metabolites including intermediates in central metabolism (MRM transition list was described in supplemental Table 1), a reverse phase ion-pair chromatography was performed using an ACQUITY UPLC BEH C18 column (100 × 2.1 mm, 1.7 μm particle size, Waters). The mobile phase consisted of solvent A (15 mM acetic acid and 10 mM tributylamine) and solvent B (methanol), and the column oven temperature was 40°C. The gradient elution program was as follows: a flow rate of 0.3 mL/min: 0–3 min, 0%B; 3-5 min, 0–40%B; 5–7 min, 40-100% B; 7-10 min, 100%B; 10.1–14 min, 0%B. Paremeters for negative ESI mode under multiple reaction monitoring (MRM) were as follows; drying gas flow rate, 15 L/min; nebulizer gas flow rate, 3 L/min; DL temperature, 250ºC; and heat block temperature, 400°C; collision energy (CE), 230kPa. On the other hand, for monitoring 61 kinds of metabolites including amino acids (MRM transition list was described in supplemental Table 2), HILIC chromatography was performed using a Luna 3u HILIC 200A column (150 × 2 mm, 3 μm particle size, Phenomenex). The mobile phase consisted of solvent A (10mM ammonium formate in water) and solvent B(9:1 of acetonitrile:10 mM ammonium formate in water), and the column oven temperature was 40°C. The gradient elution program was as follows: a flow rate of 0.3 mL/min: 0–2.5 min, 100%B; 2.5-4 min, 100– 50%B; 4–7.5 min, 50-5% B; 7.5-10 min, 5%B; 10.1–12.5 min, 100%B. Parameters for positive and negative ESI mode under MRM were as described above. Data processing was performed using LabSolutions LC-MS software program (Shimadzu, Japan) and statistical graphics were generate using the R statistical software program (http://cran.at.r-project.org/). 4 Supplemental Table 1 Primer sequence: The sequences of the qRT-PCR primers are as follows Primer Forward (5’ - 3’) Reverse (5’ - 3’) Gdf15 cttgaagacttgggctggag taagaaccaccggggtgtag Fgf21 gggaggatggaacagtggta gtcctccagcagcagttctc Cdsn cctcctcgtcttttcctggt tggttctcaggcgatggatt Eif4ebp1 aactcacctgtggccaaaac tacggctggtcccttaaatg Hmox1 tgctcgaatgaacactctgg tctctgcaggggcagtatct Trib3 gctgtgggattcaagccaaa ctgtgggcctgggtactaaa Atf3 aactggcttcctgtgcactt ggccagctaggtcatctgag Slc7a5 cacctgccttctgtcctctc tgaatcggagccacatcata Oct ccaaagggttatgagccaga ccttggaaagcttgaagacg Acacb gatcatgaccctgaacgtgc acttggtgtagcttctcccc Sesn2 tagcctgcagcctcacctat ctacgggtcgtcttctcagg Igfbp3 caacctgctccaggaaacat ttctgggtgtctgtgctttg Nmnat3 tccagcagtttcagcacaac gaggccctctagccagtctt Ddit3 cagaggtcacacgcacatcc ccttgctcttcctcctcttcc Idh2 aagagccctaacggaacgat ggggtgaagaccaacttgaa Mgst1 gacaacttgcagcccttctc gtcttctgggttggcaaaaa Gpd1 tggcaagaaagtctgcattg tgccctggcaggtatttaac Nqo1 cagatcctggaaggatggaa tctggttgtcagctggaatg Nfe2l2 ctttcagcagcatcctctcc gtgacaggtcacagccttca Ppp1r15a gacccctccaactctccttc gcctctaccttggcttctcc Gabarapl1 catcgtggagaaggctccta atacagctggcccatggta Fbxo32 tgggtgtatcggatggagac tcagcctctgcatgatgttc Mthfd2L tgataatcacgagggcagct acacccgacagatgagcttt Egr2 caggagtgacgaaaggaagc atctcacggtgtcctggttc Bcl2 ggacttgaagtgccattggt caggctggaaggagaagatg Angptl6 gcccactacgacagcttctc gaggttagagtgggcacagg Atf4 tcgatgctctgtttcgaatg agaatgtaaagggggcaacc Ass1 ctggaaaaccccaagaatca cgcaacttcgttcaggtaca Asl aggagctgcagaccatcagt ctccactttattggggagca Egr1 gacgagttatcccagccaaa ggcagaggaagacgatgaag Abcb7 tgctgctatcgactcactgc ctgactggcaagcaccatta Hsp90b1 ggcatcgatgaagatgaggt acatgagcagagagccaggt 5 Hspa5 ccttgtgtttgacctgggtg ggagtttctgcacagctctg Cps1 aatcccagcctctcttccat tccacagtgcgagatttctg Hsp70 tgctgatccaggtgtacgag cgttggtgatggtgatcttg Hsp75 tccgcagcatcttctatgtg caggagctctctgctgaggt Hsp10 ggtcaggagggaaaggaaag cagcttcacgtgacaccatt 4ebp1 aactcacctgtggccaaaac tacggctggtcccttaaatg ClpP tgatcgagtcagcaatggag cccagcagaggaagtttcag InsR tgccagtgatgtgtttccat tcgatccgttctcgaagact Chop cagaggtcacacgcacatcc ccttgctcttcctcctcttcc Sestrin2 tagcctgcagcctcacctat ctacgggtcgtcttctcagg Gadd45a atggcatccgaatggaaata ttctcgcagcttccttcttc Arg1 gtgaagaacccacggtctgt ctggttgtcaggggagtgtt Asl1 aggagctgcagaccatcagt ctccactttattggggagca Ass1 ctggaaaaccccaagaatca cgcaacttcgttcaggtaca Cps1 aatcccagcctctcttccat tccacagtgcgagatttctg Oct ccaaagggttatgagccaga ccttggaaagcttgaagacg IL6 acaaccacggccttccctactt cacgatttcccagagaacatgtg Primer Forward (5’ - 3’) Reverse (5’ - 3’) Anf catcaccctgggcttcttcct tgggctccaatcctgtcaatc βMHC atgtgccggaccttggaa cctcgggttagctgagagatca αMHC ccaatgagtaccgcgtgaa acagtcatgccgggatgat MMP2 tgtgccaaggtggaaatcag caggaaatgcagtggagtgg MMP9 tcattcgcgtggataaggag ggaaactcacacgccagaag Periostin gaggaagcaagcagggaagg tcaaggaggctgaggaagatg Col1a ccggtgctaaaggagagaagg tcaccacgacttccaacagg Col3a agccactagactgccccaac gccatcaggaagcacaggag CTGF aggagtgggtgtgtgacgag cgcatcatagttgggtctgg Primer Forward (5’ - 3’) Reverse (5’ - 3’) 12S ccgctctacctcaccatctc cccatttcattggctacacc 16S gggataacagcgcaatccta gattgctccggtctgaactc ND1 ggatccgagcatcttatcca ggtggtactcccgctgtaaa ND2 agggatcccactgcacatag ctcctcatgcccctatgaaa 6 ND3 ttcgaccctacaagctctgc tgaattgctcatggtagtgga ND4 ccactgctaattgccctcat cttcaacatgggcttttggt ND5 tcctactggtccgattccac tttgatgtcgttttgggtga ND6 cgatccaccaaaccctaaaa ttggttgtcttgggttagca CoxI ggtcaaccaggtgcactttt tggggctccgattattagtg CoxII acgaaatcaacaaccccgta ggcagaacgactcggttatc CoxIII caaggccaccacactcctat attcctgttggaggtcagca Cytb tgagggggcttctcagtaga ctgtttcgtggaggaagagg ATP6 ccttccacaaggaactccaa ggtagctgttggtgggctaa 18S cgcggttctattttgttggt agtcggcatcgtttatggtc 7 Supplemental Table 2 MRM list for reverse ion-pair chromatography MS No Metabolite Retention time (min) MRM transition 1 2Phosphoglycerate/3Phosphoglycerate_ionpairRP 6.455 185.15>78.95 2 Acetyl-CoA_ionpairRP 6.708 808.15>407.90 3 ADP_ionpairRP 6.489 426.00>78.95 4 ADP ribose_ionpairRP 6.44 558.00>346.15 5 Alphaketoglutarate_ionpairRP 6.376 145.20>101.00 6 Alphaglycerophosphate_ionpairRP 5.335 171.10>79.10 7 AMP_ionpairRP 6.112 346.00>78.95 8 Arginine_ionpairRP 0.914 172.80>131.05 9 Asparagine_ionpairRP 0.765 131.10>112.80 10 Aspartate_ionpairRP 3.627 132.00>87.95 11 ATP_ionpairRP 6.63 506.00>158.85 12 cAMP_ionpairRP 6.264 327.90>134.20 13 Carbamoylphosphate_ionpairRP 5.476 139.90>78.95 14 Cisaconitate_ionpairRP 6.462 173.20>85.00 15 Citrate_ionpairRP 6.447 191.20>111.00 16 Citrulline_ionpairRP 0.805 174.20>131.00 17 CoA_ionpairRP 6.689 766.15>407.85 18 Creatine_ionpairRP 0.836 130.20>41.00 19 CTP_ionpairRP 6.594 481.95>158.75 20 dCTP_ionpair 6.639 466.05>158.80 21 Dihydroacetonephosphate_ionpairRP 5.473 169.15>96.95 22 Ethanolamine phosphate_ionpair 0.914 140.20>78.95 23 Fructose 1,6-bisphosphate_ionpairRP 6.491 339.10>97.00 24 Fructose 6-phosphate_ionpairRP 6.136 259.15>96.90 25 Formylmethionine_ionpairRP 6.454 175.90>98.10 26 Fumarate_ionpairRP 6.239 115.25>71.00 27 Glucose 1-phosphate_ionpairRP 5.092 259.15>78.95 28 Gslucose 6-phosphate_ionpairRP 6.85 259.15>96.90 29 Glyceraldehyde 3-phosphate_ionpairRP 5.48 169.15>96.95 30 GlutamineionpairRP 0.784 145.00>127.05 31 Glutamate_ionpairRP 2.889 146.00>102.00 8 32 Glucosamine_ionpairRP 6.975 178.00>142.00 33 Glycerol 3-phosphate_ionpaorRP 5.209 171.15>78.95 34 GSH_ionpairRP 5.518 306.00>143.10 35 GSSG_ionpairRP 6.354 611.20>306.15 36 IMP_ionpairRP 6.108 347.00>78.95 37 isocitorate_ionpairRP 6.448 191.20>111.00 38 Lactate_ionpairRP 5.261 89.20>43.00 39 Malate_ionpairRP 6.33 133.10>114.95 40 Methionine_ionpairRP 1.233 148.00>46.90 41 NAD_ionpairRP 5.637 662.00>540.10 42 NADH_ionpairRP 6.478 664.00>79.05 43 NADP_ionpairRP 6.45 742.00>620.05 44 NADPH_ionpairRP 6.634 744.00>408.05 45 Ornithine_ionpairRP 6.485 131.20>58.80 46 Oxaloacetate_ionpairRP 6.363 130.85>87.00 47 Pantothenate_ionpairRP 6.148 218.00>88.00 48 pCreatine_ionpairRP 6.314 210.00>79.00 49 Phpsphoenolpyruvate_ionpairRP 6.486 167.15>78.95 50 Phenylalanine_ionpairRP 3.299 164.00>147.10 51 PRPP_ionpairRP 5.129 388.90>291.00 52 Pyruvate_ionpairRP 5.797 87.15>43.00 53 Pyroglutamate_ionpairRP 5.315 128.00>84.10 54 Succinate_ionpairRP 6.28 117.10>73.05 55 Succinil CoA_ionpairRP 6.717 866.10>407.90 56 Taurine_ionpairRP 0.778 124.00>79.95 57 Trptophan_ionpairRP 5.368 203.00>116.05 58 Tyrosine_ionpairRP 1.604 180.00>163.15 59 UDP-Glucose_ionpairRP 6.423 565.00>323.05 60 UMP_ionpairRP 5.837 323.00>79.00 61 Xanthine_ionpairRP 1.586 150.90>108.05 No Metabolite Retention time (min) MRM transition 1 6.453 104.70>64.05 MRM list for HILIC chromatography MS 3-Hydroxybutyrate_HILIC 9 2 3-Hydroxykyunurenine_HILIC 4.808 224.80>208.05 3 3-Methylhistidine_HILIC 6.631 169.80>96.10 4 4-Hydroxyproline_HILIC 6.304 131.65>86.10 5 5-HTP_HILIC 7.305 220.85>204.10 6 5-Oxoproline_HILIC 3.575 128.00>84.10 7 Acetylcarnitine_HILIC 5.001 203.75>85.05 8 Acetylcholine_HILIC 2.603 146.80>88.00 9 Adenine_HILIC 3.004 135.75>119.05 10 Agmatine_HILIC 6.03 130.80>72.15 11 Alanine_HILIC 6.344 90.00>44.10 12 Arginine_HILIC 7.162 174.80>70.10 13 Argininosuccinate_HILIC 4.701 289.80>248.95 14 Asparagine_HILIC 6.497 132.80>74.05 15 Beta-alanine 7.531 89.85>30.20 16 Betaine_HILIC 3.568 118.15>58.10 17 Butyrobetaine_HILIC 6.514 146.80>88.05 18 Cadaverine_HILIC 7.835 102.80>86.10 19 Carnitine_HILIC 6.373 161.70>60.10 20 Choline_HILIC 3.09 104.80>61.10 21 Citrate_HILIC 8.443 190.90>111.00 22 Citrulline_HILIC 6.513 175.80>70.10 23 Creatine_HILIC 6.364 131.65>90.05 24 Creatinine_HILIC 2.205 113.70>44.10 25 Cytosine_HILIC 2.151 111.80>95.05 26 Dihydroorotate_HILIC 2.102 156.95>42.10 27 Dimethylglycine_HILIC 3.092 103.75>58.10 28 GABA_HILIC 6.291 103.75>45.15 29 Glutamate_HILIC 6.519 147.75>84.10 30 Glutamine_HILIC 6.44 146.75>84.05 31 Guanosine_HILIC 2.334 268.75>137.20 32 Histidine_HILIC 6.746 155.75>110.10 34 Hypoxanthine_HILIC 2.139 136.70>55.05 35 Indoleacetate_HILIC 1.582 175.80>130.15 36 Inosine_HILIC 2.342 269.05>137.05 38 Isoleucine_HILIC 2.789 131.80>86.05 10 39 Kynurenate_HILIC 2.138 189.75>144.05 40 Kynurenine_HILIC 3.803 208.80>192.05 41 Leucine_HILIC 3.805 131.80>86.15 42 Lysine_HILIC 7.161 146.80>84.10 45 Nicotinamide_HILIC 1.494 123.00>80.10 46 Nicotinamidemononucleotide_HILIC 5.937 334.80>123.05 47 Nicotinate_HILIC 1.955 122.00>78.00 48 Norvaline_HILIC 4.682 117.75>72.10 49 Ornithine_HILIC 7.254 132.75>70.15 50 Phenylalanine_HILIC 3.65 165.80>120.10 51 Picolinate_HILIC 8.427 123.75>78.10 52 Proline_HILIC 4.632 115.75>70.10 53 Putrescine_HILIC 6.52 89.05>72.10 54 Sarcosine_HILIC 6.332 90.00>44.15 55 Serine_HILIC 6.593 104.10>74.05 56 Taurine_HILIC 3.585 124.00>80.00 57 Threonine_HILIC 6.323 119.75>56.10 58 Trimethylamineoxide_HILIC 5.207 60.00>44.15 59 TMAO_HILIC 6.592 76.15>58.05 60 TML_HILIC 7.103 188.65>84.10 61 Tryptophan_HILIC 4.197 204.75>188.05 62 Tyramine_HILIC 4.096 137.80>121.10 63 Tyrosine_HILIC 5.446 181.80>91.05 64 Uridine_HILIC 1.915 244.80>113.05 65 Urocanate_HILIC 1.816 138.65>120.75 66 Valine_HILIC 4.712 117.75>72.10 67 Xanthurenate_HILIC 1.613 205.75>160.05 11